| |

Received: 22 April 2019    Revised: 31 May 2019    Accepted: 18 June 2019

DOI: 10.1111/tbed.13280

R A P I D C O M M U N I C AT I O N

Novel goose parvovirus in domestic Linwu sheldrakes with

short beak and dwarfism syndrome, China

Chunhe Wan1,2,3 | Rongchang Liu1,2,3 | Cuiteng Chen1,2,3 | Longfei Cheng1,2,3 |

Shaohua Shi1,2,3 | Guanghua Fu1,2,3 | Hongmei Chen1,2,3 | Qiuling Fu1,2,3 |
Yu Huang1,2,3

1
Institute of Animal Husbandry and
Veterinary Medicine, Fujian Academy of Abstract
Agricultural Sciences, Fuzhou, China Recently, short beak and dwarfism syndrome (SBDS) had a sudden outbreak in
2
Fujian Provincial Key Laboratory for Avian
Cherry Valley duck flocks, followed by Pekin ducks and mule ducks in various re‐
Diseases Control and Prevention, Fuzhou,
China gions of mainland China. This widely spreading infectious disease was characterized
3
Fujian Animal Diseases Control Technology by growth retardation, smaller beak and tarsus with high morbidity and low mortal‐
Development Center, Fuzhou, China
ity rate. In this study, we identified and characterized virus from domestic Linwu
Correspondence sheldrakes (namely as HuN18) with SBDS. HuN18 isolates shared high nucleotide
Yu Huang, Institute of Animal Husbandry
and Veterinary Medicine, Fujian Academy of
identity with novel goose parvovirus (N‐GPV). A 5110‐nucleotide full‐length genome
Agricultural Sciences, Xi‐feng Road No.100, sequence of HuN18 was found with no deletion in ITR region. Alignment studies of
Jiantian village, Jin'an district, Fuzhou city
350013, China.
HuN18 showed 96.8%–99.0% identity with other N‐GPVs and 92.9%–96.3% iden‐
Email: huangyu_815@163.com tity with classic GPV. According to the recombination analysis, HuN18 showed the

Funding information
potential major parent was the N‐GPV sdlc01 strain, the potential minor parent was
Natural Science Foundation of China, the classical GPV Y strain, and the secondary potential minor parent was the SYG61v
Grant/Award Number: 31602068; China
Agriculture Research System, Grant/Award
strain. To the best of our knowledge, this is the first report of N‐GPV in domestic
Number: CARS-42; Fujian Academy of Linwu sheldrakes with SBDS; these data provide evidence that attenuated live vi‐
Agriculture Science Innovative Research
Team Project, Grant/Award Number:
ruses are involved in genetic recombination with prevailing wild parvoviruses, which
STIT2017-3-10; Young Talent Program contributes to the novel emerging variants of waterfowl parvoviruses.
Project, Grant/Award Number: YC2015-12;
Fujian Public Welfare Project, Grant/Award
KEYWORDS
Number: 2018R1023-5
Linwu sheldrakes, novel goose parvovirus, recombination, short beak and dwarfism syndrome

1 |  I NTRO D U C TI O N
Waterfowl parvovirus, including goose parvovirus (GPV) and
Muscovy duck parvovirus (MDPV), share a linear, single‐stranded
DNA genome that is approximately 5,000–5,100 nucleotides in
length (Shien et al., 2008; Zádori, Stefancsik, Rauch, & Kisary, 1995).
The GPV and MDPV genomes have two inverted terminal repeats
(ITRs) at both ends. The ITRs can form a hairpin structure containing
two stem regions and a bubble with a Sph I restriction site. There
are two major open reading frames (ORFs) in both GPV and MDPV.
The left ORF encodes a non‐structural (NS) protein, and the right
ORF encodes structural proteins known as VP1, VP2 and VP3. The
entirety of the sequences of VP2 and VP3 shares the same C‐termi‐
nus as VP1, and two proteins (VP2 and VP3) are derived from VP1
due to different alternative mRNA splices.
Goose parvoviruses are aetiological agents for Derzsy's disease,
characterized by lethargy, stunting, anorexia, locomotor dysfunction
and watery diarrhoea, which can cause a high mortality rate for both
goslings and Muscovy ducklings that are less than one month old.
Unlike GPV, MDPV only causes a fatal disease to Muscovy ducklings.
Both GPV and MDPV were first described and identified in China
(Fang, 1962; Lin, Yu, Chen, & Chen, 1991). Reportedly, genomic
comparisons of these two parvoviruses shared 79.6%–85.0% nu‐
cleotide similarity at the genome level. Additionally, immunological

Transbound Emerg Dis. 2019;00:1–6. © 2019 Blackwell Verlag GmbH |  1

wileyonlinelibrary.com/journal/tbed  
 |
2       WAN et al.

cross‐reactivity was observed between these two parvoviruses

(Zádori et al., 1995).
Short beak and dwarfism syndrome (SBDS), which was first de‐
scribed in mule ducks in France during the early 1970s, is caused by
a novel distinct lineage of goose parvovirus (N‐GPV) (Palya et al.,
2009). Then, SBDS was found in 1989–1990 in Taiwan, China (Lu,
Lin, Lee, Liao, & Tsai, 1993). SBDS was also found in Poland (1995)
and Hungary (2009). Since early 2015, SBDS had a sudden outbreak
in Cherry Valley duck flocks (Chen et al., 2015), followed by Pekin
ducks (Ning et al., 2017; Yu et al., 2016) and mule ducks (Chen et al.,
2016) in various regions of mainland China. After serial experiments,
the aetiological agent of SBDS was identified as a variant of GPV (N‐
GPV). The phylogenetic and alignment analysis showed that N‐GPV
is a branch of GPV, sharing more than 92.2% nucleotide similarity at
the genome level. Although the mortality rate was less than 3.0% in
affected flocks, with a morbidity rate of less than 30%, ducks with
SBDS showed growth retardation with beak atrophy, which caused
large losses in the duck industries (Bian et al., 2019; Chen et al., F I G U R E 1   Clinical signs of infected domestic Linwu sheldrakes
2015, 2016; Li et al., 2018; Ning et al., 2017).

2 |  M ATE R I A L S A N D M E TH O DS 2.3 | PCR and RT‐PCR

2.1 | Ethics statement
The animal protocol used in this study was approved by the Research
Ethics Committee of the College of Institute of Animal Husbandry and
Veterinary Medicine, Fujian Academy of Agriculture Sciences (Permit
Number FAAS‐AHVM2018‐09). All ducks were handled in accord‐
ance with the Regulations for the Administration of Affairs Concerning
Experimental Animals approved by the State Council of China.
2.2 | Clinical symptoms
In August 2018, three domestic Linwu sheldrakes flocks (flock
A, flock B and flock C) located in Hunan province were found to
be suffering from SBDS (Figure 1). The morbidity among flock A,
flock B and flock C was about 25% (nearly 200 diseased in 800
sheldrakes), 20% (nearly 160 diseased in 800 sheldrakes) and 25%
(nearly 200 diseased in 800 sheldrakes). Initial symptoms, including
easily feather fraction, poor protruding tongue and growth reduc‐
tion, began at the age of 15 days. Infection rate was peaked nearly
at 25 days, which can be found with atrophic beak with protruding
tongue and stunted growth disease syndrome. Although the mortal‐
ity rates were less than 1% in three affected Linwu sheldrakes flocks,
this disease causes striking loss of weight increased with age, which
leads huge economic loss to sheldrakes breeding history, because
of the survived Linwu sheldrakes with significant loss of body size
and weight, with no visible neurological signs. Nine individual dis‐
eased Linwu sheldrakes (three for each flock, at the age of 45 days)
were obtained from three flocks with typical SBDS. Gross inspection
showed no characteristic lesions in brain, heart, liver, spleen, kidney
and pancreas for the nine diseased Linwu sheldrakes.
To evaluate the pathogens, the liver and spleen mixture from these
nine diseased Linwu sheldrakes was homogenized in sterile phos‐
phate‐buffered saline (PBS, pH 7.2) to form a 20% (wt/vol) suspen‐
sion containing penicillin and streptomycin. After centrifugation at
3,000 g for 20 min, the supernatants were used for nucleic acid ex‐
traction using EasyPure Viral DNA/RNA Kit (Transgen Bio Tech). All
classical endemic and emerging viruses’ outbreaks in ducks, such as
avian influenza virus, duck Tembusu virus, duck hepatitis virus type
1 and type 3, Muscovy duck reovirus, novel duck reovirus, avian
paramyxovirus type 1, duck circovirus, duck adenovirus, duck en‐
teritis virus and goose haemorrhagic polyomavirus, were excluded
as the causative agents by PCR (RT‐PCR) methods. N‐GPV infection
was identified by duplex semi‐nested PCR assays for the detection
of classical goose parvovirus and novel goose parvovirus‐related vi‐
ruses (Li et al., 2017).
2.4 | Virus isolation
To isolate the pathogens, the supernatants of these nine sam‐
ples were filtered through a 220‐nm filter using a syringe; 0.2 ml
of the suspension per embryo was inoculated into the allantoic
cavities of 10‐day‐old non‐immune Muscovy duck embryos, 9‐
day‐old non‐immune sheldrakes embryos and 9‐day‐old non‐im‐
mune Cherry Valley duck embryos. The inoculated embryonated
eggs were checked daily for survival. If the embryos survived,
allantoic fluid was collected and pooled at day 6 post‐inocula‐
tion and used to inoculate duck embryos for further passages.
If the embryo died, the allantoic fluid and internal organs were
tested for PCR assay described previously (Li et al., 2017).
Five samples (isolation rate was 55.56%) can be observed with
WAN et al.
embryos died within 5 days after three blind passages using
Muscovy duck embryos. However, no deaths or pathologi‐
cal changes were observed in sheldrakes embryos and Cherry
Valley duck embryos after three blind passages. These data
show that attempts to isolate the virus using sheldrakes em‐
bryos and Cherry Valley duck embryos were unsuccessful. These
five viruses were prepared for PCR using Viral DNA Kit (Omega
Bio‐Tek). All samples were subjected to PCR using specific prim‐
ers (P4‐F: 5′‐ CTTGATGATGCTGAAAATGAAC‐3′ and P4‐R:
5′‐ GCCCATGGTGCCATAAGC‐3′) to amplify a partial sequence
(1,446 bp) of the N‐GPV, described previously (Li et al., 2018).
The target amplified PCR products were purified (Gel Extraction
Kit; Omega Bio‐Tek), T‐A cloned (pBackZero8‐T vector clon‐
ing kit; Takara) and then sequenced in both directions (Sangon
Biotech) using an ABI 3730 DNA sequencer (ABI). Sequence anal‐
ysis showed that these five amplicons shared 100% nucleotide
identity with each other, indicating that a single virus strain was
prevalent in the diseased Linwu sheldrakes in this area. The virus
has been provisionally designated strain HuN18.
2.5 | Animal experiments
Newly hatched Linwu sheldrakes were derived from a commercial
hatchery, where SBDS had never been observed. At age of 3 days,
the sheldrakes were randomly divided into two groups (15 birds/
group) and reared in different isolators. The challenged groups were
inoculated intramuscularly with the HuN18 strain at the dose of
0.2 ml (the ELD50 was 10–2.68/0.2 ml) per bird, respectively, and the
control group with 0.2 ml of phosphate‐buffered saline (PBS). The
birds were monitored daily for 42 days post‐infection. Body weights
were measured after 7d, 14d, 21d, 28d, 35d and 42d post‐infection
(DPI), respectively.
Data were represented as the mean ± SD. Statistical signifi‐
cance was determined using the GraphPad Prism software version
6.01 (GraphPad Software Inc.). p < .05 was considered statistically
significant.
2.6 | Full‐genome sequencing and analysis
The complete genome of HuN18 strain was amplified using PCR with
the primers described previously (Li et al., 2018). The target ampli‐
fied PCR products were purified, T‐A cloned and then sequenced
in both directions. The obtained sequences were compared with
those in the GenBank database using BLAST analysis. Nucleotide
sequences were aligned using the MegAlign software included in
the DNASTAR package, using the ClustalW matrix as the compari‐
son scoring table. Phylogenetic trees of the aligned nucleotide and
amino acid sequences were constructed using the neighbour‐joining
method included in the MEGA 6.06 version, based on 1,000 boot‐
strap replications. Reference sequences obtained from GenBank are
indicated by accession number and strain name.
Previous works revealed several recombination cases for GPV
and MDPV (Li et al., 2018; Wang et al., 2017; Zhu et al., 2014). Here,
|
      3
we used RDPv.4 software to analyse the recombination of HuN18
strain, with the first sequenced N‐GPV sdlc01 strain (isolated from
Cherry Valley ducks), the GPV Y strain (virulent strain, isolated from
a Muscovy duckling in China) and the GPV attenuated vaccine strain
SYG61v. The recombination events were confirmed using SimPlot
3.5.1.
3 | R E S U LT S A N D D I S CU S S I O N
No birds died in infected group and control group. At 14 DPI, 3 birds
can be found with feather fraction and poor protruding tongue. At
21 DPI, 5 birds can be found with atrophic beak with protruding
tongue and stunted growth. By the end of the experiment (42 DPI),
a total of five birds (33.33%) can be found with typical SBDS in the
infected group. At 21DPI, 28 DPI, 35 DPI and 42 DPI, only the five
diseased birds’ body weights were measured and compared with
control group. The body weight of infected group was much lower
than the control group at 21DPI p < .05), 28 DPI (p < .05), 35 DPI
(p < .05) and 42 DPI (p < .05), respectively (Figure 2).
At 42 DPI, the diseased ducks with typical SBDS were euthanized,
and tissues (e.g., brain, heart, liver, spleen, kidney and pancreas) were
also submitted to histopathological examination. Gross inspection
showed no characteristic lesions in brain, heart, liver, spleen, kidney
and pancreas for the diseased Linwu sheldrakes. After deparaffiniza‐
tion, the sections were stained with haematoxylin and eosin (H&E).
Pathological changes were observed by Professor Baomin Qi (Fujian
Agriculture and Forestry University). The histopathological examina‐
tion revealed no remarkable difference in brain, heart, liver, spleen,
kidney and pancreas tissues between the diseased and healthy Linwu
sheldrakes. These findings suggested that the pathogen causes non‐
significant pathological changes in these organs and tissues.
A 5110‐nucleotide full‐length genome sequence of HuN18
strain was assembled using Lasergene (DNAStar, v7.1). The obtained
sequences were submitted to the GenBank under the accession
F I G U R E 2   Body weight comparison between infected group
and control group. *Means significant difference between infected
group and control group (p < .05)
 |
4       WAN et al.
number MK736656. The complete genome contained two identical
ITRs located at both terminals and two major ORFs that shared a
similar genomic characterization with classic GPV. The ITR region of
HuN18 strain contained 446 nt. Compared to the majority of classic
GPVs and N‐GPVs, no deletions were found in the stems of the ITRs
F I G U R E 3   Phylogenetic relationships
of waterfowl parvoviruses based on
complete genome sequences. The tree
was generated by MEGA software using
the neighbour‐joining method with
bootstrapping over 1,000 replicates.
The scale bar represents the number of
nucleotide substitutions per site. The
N‐GPV (HuN18 strain) in this study is
indicated with a black diamond (◆). Other
N‐GPVs are indicated with black circles
(●). Reference sequences obtained from
GenBank are indicated by their accession
numbers and strain names
of HuN18 strain, which is significantly different from previously re‐
ported results (Bian et al., 2019; Li et al., 2018; Shien et al., 2008).
The left ORF is an 1,884 nt (position 539–2422) NS encoding protein
(627 amino acids), and the right ORF is a 2,199 nt (position 2441–
4639) VP1 encoding protein (732 amino acids).
WAN et al. |
      5

TA B L E 1   Nucleotide comparisons of HuN18 with other waterfowl parvoviruses at the genome level

N‐GPV MDPV

Viruses M15 Other N‐GPV Classic GPV Classic MDPV Recombinant MDPV

Identities (%) 94.4% 96.8%–99.0% 92.9%−96.3% 83.4%–83.9% 83.5%−83.5%

Sequence alignment and homology comparisons of HuN18
strain with other already reported sequences retrieved from
GenBank were performed with MegAlign (By Clustal Method)
and MEGA 6.06 packages. Phylogenetic analysis of N‐GPV, GPV
and MDPV demonstrated that sheldrake‐origin N‐GPV (HuN18
strain) together with other N‐GPVs formed a distinct independent
sub‐cluster (N‐GPV cluster) under the GPV cluster, except for the
M15 strain (GenBank number KU844283, isolated from a mule
duck) (Chen et al., 2016) (Figure 3). At the genome‐level homol‐
ogy comparison, the HuN18 strain shared 96.8%–99.0% identity
with other N‐GPVs (except the M15 strain). In addition, HuN18
strain only shared 94.4% with N‐GPV (M15 strain) in the genome
similarity analysis. When compared with other classic GPVs, the
HuN18 strain shares 92.9%–96.3% identity at the genome level. In
genomic comparisons with classic MDPV and recombinant MDPV,
HuN18 strain shared 83.4%–83.9% and 83.5%–83.5% identity, re‐
spectively (Table 1).
In this study, we used RDPv.4 software to analyse the recom‐
bination of HuN18 strain, with N‐GPV (sdlc01 strain), the classic
GPV (Y strain) and the attenuated vaccine (SYG61v strain). A puta‐
tive recombination event was found at nucleotides 2,638–3,185 by
the RDP methods. The recombination events were confirmed using
SimPlot 3.5.1 (Figure 4). According to the analysis results, the poten‐
tial major parent was the N‐GPV sdlc01 strain, the potential minor

F I G U R E 4   Recombination analysis using Simplot 3.5.1. Similarity plot analysis of full‐genome sequences of HuN18 strain, sdlc01 strain
(red), SYG61v strain (green) and Y strain (black). Bootscan analysis was executed with the following parameters: 1,000 bootstrap replicates,
sliding window of 200 bp and step size of 20 bp. Strain HuN18 was used as query
 |
6       WAN et al.
parent was the classical GPV Y strain, and the secondary potential
minor parent was the SYG61v strain.
Previous works provided evidence of natural genetic recom‐
bination in parvoviruses, which plays an important role in viral
evolution. Recently, novel Muscovy duck parvoviruses were iden‐
tified with a recombinant event between GPV and MDPV (Fu et al.,
2017; Wang et al., 2017; Zhu et al., 2014). SYG61v is an attenuated
live vaccine strain that has been widely used against GPV infec‐
tion and may provide the opportunity for genetic recombination
with wild GPV and N‐GPV strains. In the present work, we found
that SYG61v and wild Muscovy duck‐origin GPV were involved
in the recombination events of HuN18 strain. To the best of our
knowledge, this is the first report of N‐GPV in domestic Linwu
sheldrakes with SBDS; these data provide evidence that attenu‐
ated live viruses are involved in genetic recombination with pre‐
vailing wild parvoviruses, which contributes to the novel emerging
variants of waterfowl parvoviruses. Whether attenuated vaccines
against waterfowl parvoviruses should still be widely used remains
to be clarified and evaluated. Considering the lack of history for
attenuated vaccines used in domestic Linwu sheldrakes, how the
N‐GPV HuN18 strain transmits to unsuspecting duck species is
unclear and will require further investigation.
AC K N OW L E D G E M E N T S
This work was funded by the Natural Science Foundation of China
(31602068), China Agriculture Research System (CARS‐42), Fujian
Academy of Agriculture Science Innovative Research Team Project
(STIT2017‐3‐10) and Young Talent Program Project (YC2015‐12),
and the Fujian Public Welfare Project (2018R1023‐5). The funders
had no role in study design, data collection and analysis, decision to
publish or preparation of the manuscript.
C O N FL I C T O F I N T E R E S T
No potential conflict of interest was reported by the authors.
ORCID
Yu Huang  https://orcid.org/0000-0003-3654-8898
REFERENCES
Bian, G., Ma, H., Luo, M., Gong, F., Li, B., Wang, G., … Yuan, J. (2019).
Identification and genomic analysis of two novel duck‐origin GPV‐re‐
lated parvovirus in China. BMC Veterinary Research, 15, 88.
Chen, H., Dou, Y., Tang, Y., Zhang, Z., Zheng, X., Niu, X., … Diao, Y. (2015).
Isolation and genomic characterization of a duck‐origin GPV‐related
parvovirus from Cherry Valley ducklings in China. PLoS ONE, 10,
e0140284.
Chen, S., Wang, S., Cheng, X., Xiao, S., Zhu, X., Lin, F., … Yu, F. (2016).
Isolation and characterization of a distinct duck‐origin goose par‐
vovirus causing an outbreak of duckling short beak and dwarfism
syndrome in China. Archives of Virology, 161, 2407–2416. https​://doi.
org/10.1007/s00705-016-2926-4
Fang, D. (1962). Introduction of Goose Plague. Chinese Journal of
Veterinary Medicine, 8, 19–20.
Fu, Q., Huang, Y., Wan, C., Fu, G., Qi, B., Cheng, L., … Chen, Z. (2017).
Genomic and pathogenic analysis of a Muscovy duck parvovirus
strain causing short beak and dwarfism syndrome without tongue
protrusion. Research in Veterinary Science, 115, 393–400.
Li, P., Lin, S., Zhang, R., Chen, J., Sun, D., Lan, J., … Jiang, S. (2018). Isolation
and characterization of novel goose parvovirus‐related virus reveal
the evolution of waterfowl parvovirus. Transboundary and Emerging
Diseases, 65, e284–e295.
Li, P., Zhang, R., Chen, J., Sun, D., Lan, J., Lin, S., … Jiang, S. (2017).
Development of a duplex semi‐nested PCR assay for detection of
classical goose parvovirus and novel goose parvovirus‐related virus
in sick or dead ducks with short beak and dwarfism syndrome. Journal
of Virological Methods, 249, 165–169. https​://doi.org/10.1016/j.jviro​
met.2017.09.011
Lin, S., Yu, X., Chen, B., & Chen, B. (1991). Diagnosis of a novel viral in‐
fectious disease in Muscovy ducklings. Chinese Journal of Animal and
Poultry Infectious Diseases, 2, 27–28.
Lu, Y. S., Lin, D. F., Lee, Y. L., Liao, Y. K., & Tsai, H. J. (1993). Infectious bill
atrophy syndrome caused by parvovirus in a co‐outbreak with duck
viral hepatitis in ducklings in Taiwan. Avian Diseases, 37, 591–596.
Ning, K., Wang, M., Qu, S., Lv, J., Yang, L., & Zhang, D. (2017).
Pathogenicity of Pekin duck‐ and goose‐origin parvoviruses in Pekin
ducklings. Veterinary Microbiology, 210, 17–23.
Palya, V., Zolnai, A., Benyeda, Z., Kovács, E., Kardi, V., & Mató, T. (2009).
Short beak and dwarfism syndrome of mule duck is caused by a dis‐
tinct lineage of goose parvovirus. Avian Pathology, 238, 175–180.
Shien, J. H., Wang, Y. S., Chen, C. H., Shieh, H. K., Hu, C. C., & Chang,
P. C. (2008). Identification of sequence changes in live attenuated
goose parvovirus vaccine strains developed in Asia and Europe.
Avian Pathology, 37, 499–505.
Wang, J., Ling, J., Wang, Z., Huang, Y., Zhu, J., & Zhu, G. (2017). Molecular
characterization of a novel Muscovy duck parvovirus isolate:
Evidence of recombination between classical MDPV and goose par‐
vovirus strains. BMC Veterinary Research, 13, 327.
Yu, K., Ma, X., Sheng, Z., Qi, L., Liu, C., Wang, D., … Song, M. (2016).
Identification of goose‐origin parvovirus as a cause of newly emerg‐
ing beak atrophy and dwarfism syndrome in ducklings. Journal of
Clinical Microbiology, 54, 1999–2007.
Zádori, Z., Stefancsik, R., Rauch, T., & Kisary, J. (1995). Analysis of the
complete nucleotide sequences of goose and muscovy duck parvovi‐
ruses indicates common ancestral origin with adeno‐associated virus
2. Virology, 1212, 562–573.
Zhu, Y., Zhou, Z., Huang, Y., Yu, R., Dong, S., Li, Z., & Zhang, Y. (2014).
Identification of a recombinant Muscovy Duck parvovirus (MDPV) in
Shanghai, China. Veterinary Microbiology, 174, 560–564.
How to cite this article: Wan C, Liu R, Chen C, et al. Novel
goose parvovirus in domestic Linwu sheldrakes with short
beak and dwarfism syndrome, China. Transbound Emerg Dis.
2019;00:1–6. https​://doi.org/10.1111/tbed.13280​