The FASEB Journal article fj.201600392RR. Published online September 14, 2016.

THE

JOURNAL • RESEARCH • www.fasebj.org

Galectin-3 regulates inflammasome activation in

cholestatic liver injury
Jijing Tian,*,† Guoxiang Yang,‡ Huan-Yuan Chen,§,{ Daniel K. Hsu,§ Alexey Tomilov,k Kristin A. Olson,#
Ali Dehnad,* Sarah R. Fish,* Gino Cortopassi,k Bin Zhao,† Fu-Tong Liu,§,{ M. Eric Gershwin,‡ Natalie J. Török,*,**
and Joy X. Jiang*,1
*Department of Internal Medicine, Division of Gastroenterology and Hepatology, ‡Department of Internal Medicine, Division of
Rheumatology, Allergy and Clinical Immunology, §Department of Dermatology, and #Department of Pathology, University of California Davis
Medical Center, and kDepartment of Molecular Biosciences, University of California Davis, Sacramento, California, USA; †State Key Laboratory
of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing,
China; {Institute of Biomedical Sciences, Academia Sinica, Taipei City, Taiwan; and **Veterans Administration Northern California Medical
Center, Mather, California, USA

ABSTRACT: Macrophage activation is an important feature of primary biliary cholangitis (PBC) pathogenesis and
other cholestatic liver diseases. Galectin-3 (Gal3), a pleiotropic lectin, is produced by monocytic cells and macro-
phages. However, its role in PBC has not been addressed. We hypothesized that Gal3 is a key to induce NOD-like
receptor family, pyrin domain containing 3 (NLRP3) inflammasome in macrophages and in turn to propagate
proinflammatory IL-17 signaling. In liver tissues from patients with PBC and dnTGF-bRII mice, a model of auto-
immune cholangitis, the expression of Gal3, NLRP3, and the adaptor protein adaptor apoptosis-associated speck-
like protein was induced, with the downstream activation of caspase-1 and IL-1b. In wild-type hepatic macrophages,
deoxycholic acid induced the association of Gal3 and NLRP3 with direct activation of the inflammasome, resulting
in an increase in IL-1b. Downstream retinoid-related orphan receptor C mRNA, IL-17A, and IL-17F were induced. In
Gal32/2 macrophages, no inflammasome activation was detected. To confirm the key role of Gal3 in the patho-
genesis of cholestatic liver injury, we generated dnTGF-bRII/galectin-32/2 (dn/Gal32/2) mice, which showed im-
paired inflammasome activation along with significantly improved inflammation and fibrosis. Taken together, our
data point to a novel role of Gal3 as an initiator of inflammatory signaling in autoimmune cholangitis, mediating the
activation of NLRP3 inflammasome and inducing IL-17 proinflammatory cascades. These studies provide a ratio-
nale to target Gal3 in autoimmune cholangitis and potentially other cholestatic diseases.—Tian, J., Yang, G., Chen,
H.-Y., Hsu, D. K., Tomilov, A., Olson, K. A., Dehnad, A., Fish, S. R., Cortopassi, G., Zhao, B., Liu, F.-T., Gershwin, M. E.,
Török, N. J., Jiang, J. X. Galectin-3 regulates inflammasome activation in cholestatic liver injury. FASEB J.
30, 000–000 (2016). www.fasebj.org
KEY WORDS: primary biliary cholangitis • NLRP3 • galectin-3 • IL-17

Primary biliary cholangitis (PBC), formerly known as
“primary biliary cirrhosis,” is an autoimmune disorder
characterized by the destruction of the small intrahepatic
bile ducts that leads to cholestasis, progressive inflam-
mation, and fibrosis. Dysregulation of innate immunity
ABBREVIATIONS: AMA, antimitochondria antibody; ASC, adaptor
apoptosis-associated speck-like protein; BLI, biolayer interferometry; DCA,
deoxycholic acid; Gal3, galectin-3; NLRP3, NOD-like receptor family, pyrin
domain containing 3; PBC, primary biliary cholangitis; qPCR, quantitative
PCR; rGal3, recombinant galectin-3; RORc, retinoid-related orphan
receptor C; Th, T helper; WT, wild-type
1
Correspondence. Department of Internal Medicine, Division of Gastroen-
terology and Hepatology, UC Davis Medical Center, PSSB, 4150, V St.,
Suite 3500, Sacramento, CA 95817, USA. E-mail: joyjiang@ucdavis.edu
doi: 10.1096/fj.201600392RR
This article includes supplemental data. Please visit http://www.fasebj.org to
obtain this information.
plays a major role in its pathogenesis. The induction of
Th1/Th17 signaling is linked to disease progression (1),
and activation of natural killer T cells has been shown to
accelerate PBC in murine models (2). Despite major ad-
vances delineating the changes in innate and adaptive
immunity in PBC, the early inflammatory events are not
well understood. Incubation of biliary epithelial cell apo-
ptotic bodies that carry the E2 component of the pyruvate
dehydrogenase complex (PDC-E2) with macrophages
from patients with PBC led to an intense production of
inflammatory cytokines (3). However, the mechanistic
aspects of macrophage activation in PBC have not been
well described. Therefore, in this study we focused on
elucidating how inflammasome activation leads to exac-
erbation of proinflammatory cascades. We have pre-
viously demonstrated that galectin-3 (Gal3), a pleiotropic
lectin, is required for phagocytosis of apoptotic debris

0892-6638/16/0030-0001 © FASEB 1
Downloaded from www.fasebj.org to IP 207.162.240.147. The FASEB Journal Vol., No. , pp:, September, 2016
by mediating integrin crosslinking, thereby facili-
tating the tethering and uptake of apoptotic bodies
(4). Gal3 is a 30-kDa protein with a unique chime-
ric structure containing a C-terminal that binds to
N-glycan residues of other molecules and an N-terminal
domain containing proline/tyrosine/glycine-rich motifs
(5). It is mainly produced by activated macrophages and
stellate cells in the liver and is thought to play an impor-
tant profibrogenic role. Therefore, we hypothesized that
Gal3 is a key element that is required for the activation of
the NLR family, pyrin domain containing 3 (NLRP3)
inflammasome, and proinflammatory activation of
macrophages.
Accumulating evidence shows that inflammasome
signaling in hepatic macrophages contributes to liver
injury, inflammation, and fibrosis (6, 7). NLRP3, also
known as cryopyrin and NALP3, bound with the adaptor
apoptosis-associated speck-like protein (ASC), triggers the
cleavage of procaspase-1 to form the mature caspase-1,
which catalyzes the activation of IL-1b, contributing to the
activation of innate immune responses (8). Transgenic
mice expressing constitutively active NLRP3 showed se-
vere hepatocyte pyroptosis, inflammation, and fibrosis (6),
and NLRP3 depletion was protective (7, 9). In addition,
the NLRP3 inflammasome-derived IL-1b synergized
with IL-23/IL-17 signaling in T cells in murine autoim-
mune encephalomyelitis (10).
In this study, we showed for the first time increased
activity of the NLPR3 inflammasome in patients with
PBC and in our animal model. Activation of NLRP3 in
macrophages was Gal3 dependent, resulting in IL-17
responses via an autocrine mechanism. Furthermore,
we found that inflammatory injury and fibrosis were
significantly improved in dnTGF-bRII/gal32/2 mice.
These findings suggest that the induction of Gal3/
inflammasome/IL-17 signaling in macrophages could
be an important pathogenic pathway in PBC that con-
tributes to fibrosis.
MATERIALS AND METHODS
PBC liver samples
Liver tissues from patients with PBC were kindly provided by
M.E.G. These samples were deidentified and therefore institu-
tional review board exempted. The tissues were processed for
Western blot assay and real-time quantitative PCR (qPCR).
Animals and cell cultures
The dnTGF-bRII mice with a C57/B6 background were provided
by M.E.G. (11). These mice express dominant negative TGF-b re-
ceptor II driven by a CD4 promoter resulting in a knockdown
of TGF-b signaling exclusively in T cells. They spontaneously de-
velop autoimmune cholangitis with the presence of serum anti-
mitochondrial antibody (AMA), similarly to human PBC (11–13).
Gal32/2 mice (kindly provided by F.-T.L.) in a C57/B6 back-
ground were generated by gene targeting technology as previously
described (14). To generate dn/Gal32/2 mice, the dnTGF-bRII
mice were crossed with the Gal32/2 mice. The offspring with the
desired genotype were euthanized at 12 wk of age for tissue
2 Vol. 30 December 2016 The FASEB Journal x www.fasebj.org
Downloaded from www.fasebj.org to IP 207.162.240.147. The FASEB Journal Vol., No. , pp:, September, 2016
collection. The age- and sex-matched littermates were used as
controls. NLRP32/2 mice were from The Jackson Laboratory (Bar
Harbor, ME, USA).
To isolate hepatic macrophages, a standard in situ perfusion
procedure was conducted as described previously (15). In brief,
the liver was sequentially perfused with collagenase and pro-
tease. The digested liver was suspended into Gey’s balanced salt
solution (Sigma-Aldrich, St. Louis, MO, USA). A 25.6%/13%
two-step nycodenz (Invitrogen, Carlsbad, CA, USA) gradient
was made, and the cell suspension was added on the top. After
centrifugation (1500 g, 15 min), macrophages were collected on
the top of the 25.6% nycodenz layer and kept in RPMI 1640 me-
dium with 10% fetal bovine serum and antibiotics. The cells were
allowed to settle and treated with deoxycholic acid (DCA)
(100 mM) with or without recombinant Gal3 (1 mM for 24 h). The
cells were then collected for RNA extraction, real-time qPCR,
coimmunoprecipitation, and other biochemistry assays.
Immunohistochemistry and confocal microscopy
Cryostat sections from PBC liver (4 mm) were fixed in 4% form-
aldehyde and permeabilized in 0.2% Triton X-100/PBS. After
washing and blocking with 2% bovine serum albumin, the
sections were incubated with antibodies for NLRP3 (1:200;
Adipogen Corporation, San Diego, CA, USA) and Gal3 (1:2000;
provided by F.-T.L.) or ASC (1:200, Adipogen Corp.) for 16 h at
4°C. After washing, the appropriate secondary antibodies were
applied (1:2000; Invitrogen). The images were analyzed by con-
focal microscopy.
H&E staining and Sirius red staining were conducted by the
Department of Pathology of UC Davis following standard pro-
tocols. The images were analyzed with ImageJ (NIH, Bethesda,
MD, USA) to quantify the fibrotic area.
RNA extraction and real-time qRT-PCR
RNA was extracted from the liver tissues or hepatic macro-
phages using an RNeasy Mini kit (Qiagen, Valencia, CA,
USA) following the manufacturer’s instruction. cDNA was
synthesized using an iScript cDNA Synthesis kit (Bio-Rad,
Hercules, CA, USA). Absolute real-time PCR was conducted
with the SYBR Green DNA Master mix (Applied Biosystems,
Foster City, CA, USA) using the Applied Biosystems 7900HT
real-time PCR system (Invitrogen). The cycler was pro-
grammed at 50°C for 2 min and 95°C for 10 min for system
activation, followed by 40 cycles at 95°C for 15 s and 60°C for
1 min for melt/annealing/extension. The absolute amount of
target genes was calculated based on the standard curves
generated from different amount of templates and adjusted
to the housekeeping gene. The wild-type (WT) control was
set as 1-fold. The primers used are listed in Table 1 and have
been described previously (4).
Coimmunoprecipitation and Western blot analysis
The macrophages were treated as indicated and were collected in
the lysis buffer (150 mM NaCl, 5 mM EDTA, 5 mM EGTA, 10 mM
HEPES, pH 7.4, and 0.5% Triton X-100) containing protease in-
hibitors and lysed with repeated freeze-thaw cycles. The protein
concentration was determined with the BCA protein assay kit
(Thermo Fisher Scientific, Waltham, MA, USA), and 100 mg of
protein was incubated with protein A-agarose beads mixed with
either anti-NLRP3 or anti-Gal3 rabbit antibodies. After extensive
washing with the lysis buffer, the beads were boiled in 40 ml of
sample buffer. The supernatant was then separated by SDS-
PAGE. The blots were incubated with the appropriate antibodies
TIAN ET AL.
 TABLE 1. Primer sequences used

Primers, 59–39
Gene Forward Reverse

Human Gal3 GCCTTATAACCTGCCTTTGC ACCGTGCCCAGAATTGTTAT

Human NLRP3 GGAGAGACCTTTATGAGAAAGCAA GCTGTCTTCCTGGCATATCACA
Human IL-1b AGCTGAGGAAGATGCTGGTT GGAAAGAAGGTGCTCAGGTC
Human ASC GTCCTGACGGATGAGCAGTA CACCAGGTAGGACTGGGACT
Human GAPDH TCAAGAAGGTGGTGAAGCAG CGCTGTTGAAGTCAGAGGAG
Mouse Gal3 GCCCTTGCCTGGAGGAGTCATG CATTGAAGCGGGGGTTAAAGTGG
Mouse NLRP3 CCCTTGGAGACACAGGACTC GAGGCTGCAGTTGTCTAATTCC
Mouse ASC GAGCAGCTGCAAACGACTAA GTCCACAAAGTGTCCTGTTCTG
Mouse IFN-g GGAGGAACTGGCAAAAGGATGG TGTTGCTGATGGCCTGATTGTC
Mouse IL-1b CAACCAACAAGTGATATTCTCCATG GATCCACACTCTCCAGCTGCA
Mouse IL-10 GGTTGCCAAGCCTTATCGGA ACCTGCTCCACTGCCTTGCT
Mouse IL-18 CAAACCTTCCAAATCACTTCCT TCCTTGAAGTTGACGCAAGA
Mouse IL-17A TCCAGAAGGCCCTCAGACTA TGAGCTTCCCAGATCACAGA
Mouse IL-17F GAGGATAACACTGTGAGAGTTGAC GAGTTCATGGTGCTGTCTTCC
Mouse RORc TGCAAGACTCATCGACAAGGC AGCTTTTCCACATGTTGGCTG
Mouse IL-23p19 GCCCAGCCTGAGTTCTAGTC AGGGCTCAGTCAGAGTTGCT
Mouse 18S rRNA GGAGGAACTGGCAAAAGGATGG TGTTGCTGATGGCCTGATTGTC

for 16 h at 4°C. The membranes were washed and incubated with
horseradish peroxidase-conjugated secondary antibodies (Santa
Cruz Biotechnology, Santa Cruz, USA), and the blots were de-
veloped by enhanced chemiluminescence (Thermo Fisher Sci-
entific). As an internal control, GAPDH was blotted using a
polyclonal antibody (1:2000; Trevigen, Gaithersburg, MD, USA).
The image quantification was performed with ImageJ (NIH). The
Western blot data showed are representative, and similar data
were obtained at least 3 times.
containing protease inhibitor cocktail) and quantified using
the BCA method. One microgram of protein was used. Classic
sandwich ELISA was performed following the standard
protocol. All the antibodies and reagents for IL-1b and IL-17
were from Affymetrix eBioscience (San Diego, CA, USA).
Mouse serum Gal3 was measured by an ELISA kit from
Abcam following the provided instructions.
Hydroxyproline assay

NLRP3/Gal3 binding assay
The interaction of NLRP3 and Gal3 was analyzed with cell-
free biolayer interferometry (BLI) assay using the Octet Red
system (Pall ForteBio, Menlo Park, CA, USA). In brief, Octet
Red biosensors (antiglutathione S-transferase) were coated with
recombinant human NLRP3-GST (Novus Biologicals, Littleton,
CO, USA) and incubated with either WT or a truncated Gal3
mutant lacking N-terminal proline-rich domain (Gal3-C) (pro-
vided by F.-T.L.) (16), and the binding was measured for 600 s.
Biosensors were then moved into the blank buffer without Gal3
or Gal3-C to measure the dissociation for 600 s. The resulting
sensogram of NLRP3-Gal3 interaction was presented as response
(nanomoles of Gal3) plotted against time.
Caspase-1 activity assay
Macrophages were processed for caspase-1 activity assay using a
kit purchased from Abcam (Cambridge, MA, USA) following the
manufacturer’s instruction. In brief, the cells were lysed and in-
cubated with fluorescence-conjugated YVAD, the caspase-1
substrate. When cleaved by caspase-1, fluorescence would be
emitted at 400 nm. The data were normalized with protein con-
centration decided by the BCA method.
Liver tissue was boiled in 6 N HCl for 16 h. After washing with
H2O, the denatured tissue was resuspended in H2O and mixed
with 50 mM chloramines-T and incubated at room temperature
for 20 min, and then perchloric acid (3.15 M; Sigma-Aldrich)
and p-dimethylaminobenzaldehyde (20%; Sigma-Aldrich) were
added. After incubation at 60°C for 20 min, 557-nm absorbance
was recorded. The result was obtained based on a standard
curve generated from a serial dilution of the hydroxyproline
standard and expressed as milligrams of hydroxyproline per
gram of wet liver.
Statistical analysis
The data shown represent at least 3 experiments and are
expressed as the means 6 SEM. Differences between 2 groups
were compared using 1-way ANOVA associated with the
Dunnett’s test. The 2-tailed, unpaired Student’s t test was used
to analyze the differences between 2 groups. Comparisons be-
tween more than 2 groups were done with the Kruskal-Wallis
test followed by Dunn’s multiple comparison test. Statistical
significance was considered at P , 0.05.
RESULTS

ELISA Gal3 and NLRP3 inflammasome signaling are

Mouse serum, liver tissues, and macrophage culture medium
were collected for ELISA to detect IL-1b, IL-17, and Gal3. The
liver tissues were homogenized in the lysis buffer (50 mM
Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100
induced in patients with PBC and in a mouse
model of autoimmune cholangitis
In the normal liver, Gal3 is expressed at a low level, mainly
in macrophages. Here, we examined Gal3 expression in

ROLE OF GAL3 IN REGULATING INFLAMMASOME ACTIVATION 3

Downloaded from www.fasebj.org to IP 207.162.240.147. The FASEB Journal Vol., No. , pp:, September, 2016
the liver of patients with PBC and in dnTGF-bRII mice. In
patients with PBC, Gal3 was significantly induced at the
mRNA (3.15 6 0.57-fold; P , 0.05) (Fig. 1A) and protein
levels (6.49 6 1.81-fold; P , 0.05) (Fig. 1B). NLRP3 ex-
pression was also significantly increased in PBC livers
(4.21 6 1.02-fold in transcript, P , 0.05; 3.90 6 1.30-fold in
protein) (Fig. 1A and B, respectively). ASC transcript was
induced by 1.80 6 0.31-fold and IL-1b by 2.26 6 0.36-fold
(P , 0.05) (Fig. 1A). Immunohistochemical studies showed
enhanced signals of Gal3 and NLRP3 in livers of patients
with PBC (Fig. 1C). These results were corroborated in the
dnTGF-bRII mice, which showed increased Gal3 and
NLRP3 at the transcript (3.49 6 0.42-fold, P , 0.001; 2.78 6
0.19-fold, P , 0.01) and protein levels (13.83 6 0.43-fold;
34.00 6 7.00-fold, P , 0.001) compared with the WT lit-
termates (Fig. 2A, B). The transcripts of ASC and IL-1b
were induced as well (2.20 6 0.28-fold, P , 0.01; 2.07 6
0.07-fold, P , 0.05). The cleavage of caspase-1 was more
pronounced in the livers of the transgenic mice (15.50 6
5.30-fold; P , 0.001), indicating inflammasome activation
(Fig. 2B). Serum ELISA showed that the transgenic mice
had significantly higher Gal3 levels (56.35 6 4.86 ng/ml;
P , 0.05) (Fig. 2C). The activation of inflammasome in
the livers of dnTGF-bRII mice was confirmed by IL-1b
ELISA. IL-1b was significantly higher in the serum (36.44 6
8.99 pg/ml) and in the liver homogenates of these mice
(5.81 6 0.43 pg/mg protein) compared with WT mice
(nondetectable in serum, P , 0.001; 2.10 6 0.23 pg/mg
protein, P , 0.001) (Fig. 2D, E).
Deoxycholic acid induces the expression of
Gal3 and NLRP3 and their association in
hepatic macrophages
To study whether Gal3 modulates the inflammasome ac-
tivation, we treated hepatic macrophages with DCA, a
hydrophobic dihydroxy bile acid known to mediate hep-
atotoxicity (17, 18), and macrophage activation (19). DCA
increased the transcripts of Gal3 by 1.75 6 0.20-fold (P ,
0.05) and NLRP3 by 1.48 6 0.02-fold (P , 0.05) (Fig. 3A, B).
The induction of Gal3 and NLRP3 by DCA was confirmed

Figure 1. The expression of Gal3 and NLRP3 inflammasome components are induced in patients with PBC. Liver tissues from
healthy subjects (Ctrl) and patients with PBC were processed for RT-qPCR to evaluate the expression of Gal3, NLRP3, ASC, and
IL-1b (A–D). A) The mRNA levels of Gal3, NLRP3, the adaptor ASC and the downstream effector IL-1b were all significantly
elevated in livers from patients with PBC (*P , 0.05; means 6 SEM; n = 4). B) Western blot and densitometry analyses showed that the
protein levels of Gal3 and NLRP3 were increased in PBC livers (*P , 0.05; means 6 SEM; n = 4). C) Immunohistochemistry revealed
enhanced signals for Gal3 and NLRP3 in the livers from patients with PBC compared with livers from healthy control subjects.

4 Vol. 30 December 2016 The FASEB Journal x www.fasebj.org TIAN ET AL.

Downloaded from www.fasebj.org to IP 207.162.240.147. The FASEB Journal Vol., No. , pp:, September, 2016
Figure 2. The expression of Gal3 and NLRP3 inflammasome components are induced in dnTGF-bRII mice. A) In transgenic
dnTGF-bRII mice that spontaneously develop PBC-like cholangitis, the transcripts of Gal3, NLRP3, ASC, and IL-1b were
significantly induced in the livers compared with WT (Ctrl) livers (*P , 0.05, **P , 0.01, and ***P , 0.001; means 6 SEM; n = 4).
B) Western blots on liver homogenates depicted increased Gal3 and NLRP3 in the dnTGF-bRII mice and enhanced caspase-1
cleavage (***P , 0.001; data are representative.). C ) Serum levels of Gal3 were examined by ELISA. The dnTGF-bRII mice had
significantly higher levels of Gal3 (*P , 0.05; means 6 SEM; n = 5, 13). Sera (D) and the liver homogenates (E ) from WT and
dnTGF-bRII mice were processed for IL-1b ELISA. Significantly higher levels of IL-1b were seen in both serum and livers from
the transgenic mice (***P , 0.001; means 6 SEM; n = 6)

by Western blot (Fig. 3C). The cell culture medium from
the DCA-treated cells also had higher level of Gal3 (687.00 6
64.50 ng/ml) compared with the control (375.75 6
39.00 ng/ml, P , 0.05) (Fig. 3D). Immunofluorescence
studies showed intense Gal3 and NLRP3 signals in
DCA-treated macrophages compared with that in the
nontreated cells (Fig. 3E). Immunoprecipitation revealed
the association of Gal3 and NLRP3 in macrophages, and
this was enhanced by DCA (Fig. 3F), suggesting that Gal3
modulates inflammasome activation. To further confirm
the direct association of Gal3 to the NLRP3 inflamma-
some, we next performed a cell-free BLI study (Fig. 3G, H),
which showed direct binding of Gal3 to NLRP3 in a
dose-dependent pattern. Interestingly, Gal3-C, the mutant
without N-terminal domain, did not associate to NLRP3,
suggesting that the binding site is at the N-terminal motif.
DCA induces the activation of NLRP3 signaling
in WT but not in Gal32/2 macrophages
To study whether Gal3 is required for the activation of
NLRP3 inflammasome, hepatic macrophages were isolated
from WT and Gal32/2 mice and treated with DCA. Because
recombinant Gal3 (rGal3) could be taken up by macrophages
(Supplemental Fig. 1), a separate group of Gal32/2 cells was
incubated with DCA in combination with rGal3 (Fig. 4).
Real-time qPCR showed that DCA significantly increased
the mRNA levels of NLRP3 (1.49 6 0.06-fold, P , 0.05), IL-1b
(1.54 6 0.15-fold, P , 0.01), IFN-g (2.23 6 0.10-fold, P , 0.01),
and IL-10 (1.93 6 0.36-fold, P , 0.05). The expression of these
genes was significantly reduced in the Gal32/2 cells (NLRP3,
0.65 6 0.10-fold, P , 0.01; IL-1b, 0.45 6 0.08-fold, P , 0.001;
IFN-g, 0.55 6 0.07-fold, P , 0.01; IL-10, 0.24 6 0.05-fold,
P , 0.05). Administration of rGal3 reversed the expression
of NLRP3 to 1.59 6 0.44-fold, IL-1b to 2.19 6 0.78-fold
(P , 0.05), and partially for IFN-g (1.06 6 0.08-fold, P , 0.05)
and IL-10 (0.69 60.16-fold, P , 0.05) (Fig. 4A–D). To visualize
the activation of inflammasome in macrophages, WT and
Gal32/2 cells treated with DCA were stained for ASC
(Fig. 4E). DCA increased the formation of ASC foci in WT cells.
Fewer foci were detected in the knockout cells, and this was
increased after the exposure to rGal3. To confirm that the
DCA-induced inflammasome activation is Gal3 dependent,
caspase-1 activity and IL-1b were measured in culture
medium (Fig. 4F, G). As a control, macrophages from
NLRP32/2 mice were included. Caspase-1 activity signif-
icantly increased in DCA-treated WT cells (1.47 6 0.66-fold,

ROLE OF GAL3 IN REGULATING INFLAMMASOME ACTIVATION 5

Downloaded from www.fasebj.org to IP 207.162.240.147. The FASEB Journal Vol., No. , pp:, September, 2016
Figure 3. DCA induces Gal3 and NLRP3 expression and their association in hepatic macrophages. Primary macrophages were isolated
from mouse livers and treated with DCA (100 mM for 24 h). A, B) RT-qPCR showed significantly induced Gal3 and NLRP3 expression
after DCA treatment (means 6 SEM; n = 4; *P , 0.05). C) The induction at protein levels was also detected by Western blot analysis. D)
Culture media was collected for ELISA to examine Gal3. The DCA-challenged cells release significantly higher level of Gal3 (means 6 SEM;
n = 6; *P , 0.05). E) To visualize Gal3 and NLRP3 in macrophages, immunofluorescence studies were done in the DCA-treated
macrophages. The signals for Gal3 (green) and NLRP3 (red) were dispersed and weak in nontreated cells. In the DCA-challenged cells,
enhanced Gal3 and NLRP3 were seen, and more NLRP3 clusters were observed. F) Immunoprecipitation of Gal3 and NLRP3 Western
blot showed their association in DCA-treated macrophages. BLI was conducted to confirm the association. Recombinant NLRP3 loaded
sensors were incubated with either recombinant WT Gal3 or N-terminal truncated Gal3 (Gal3-C) (18 mM). The association was recorded
for 600 s. G) The sensors were moved to the blank buffer to measure the dissociation. Gal3 showed an obvious association/dissociation
pattern. This was not present in Gal3-C. Thus, Gal3 directly interacts with NLRP3, and its N-terminal motif is crucial for this interaction. H)
When the NLRP3-loaded sensors were incubated with Gal3 at a series of concentrations, a dose-dependent association was observed.

P , 0.05). No induction was seen in Gal32/2 cells.
Caspase-1 activity was not detected in NLRP32/2 cells.
IL-1b ELISA showed a similar trend: it was induced by
DCA in WT cells (96.30 6 10.70 pg/ml) compared with
the untreated cells (51.80 6 8.50 pg/ml, P , 0.05); this
effect was abolished in Gal32/2 cells. A minimal level of
IL-1b was detected in NLRP32/2 cells.
Gal3 mediates IL-23/IL-17 signaling in
hepatic macrophages
IL-17 is considered a proinflammatory and profibrogenic
cytokine (20). Because IL-1b is known to induce IL-23/IL-17
signaling and Th17 polarization (21, 22) and because mac-
rophages produce significant IL-17 (23), we hypothesized
that IL-1b resulting from NLRP3 inflammasome activation
mediates IL-17 production by macrophages. Next, we ex-
amined whether DCA-induced IL-17 signaling is Gal3 me-
diated (Fig. 5). First, WT hepatic macrophages treated with
IL-1b showed significantly higher levels of IL-17A (2.41 6
0.17-fold; P , 0.01) and IL-17F (1.93 6 0.25-fold; P , 0.05)
mRNA, suggesting that IL-1b could induce IL-17 pro-
duction in hepatic macrophages (Fig. 5A, B). When treated
with DCA, WT macrophages displayed increased expres-
sion of IL-23p19, the IL-17 inducer (2.84 6 0.53-fold;
P , 0.05), retinoid-related orphan receptor C (RORc),

6 Vol. 30 December 2016 The FASEB Journal x www.fasebj.org TIAN ET AL.

Downloaded from www.fasebj.org to IP 207.162.240.147. The FASEB Journal Vol., No. , pp:, September, 2016
Figure 4. Gal3 is required for the induction of NLRP3 inflammasome signaling by DCA in macrophages. Macrophages from WT
and Gal32/2 mice were incubated with DCA (100 mM) and with recombinant Gal3 (rGal3; 1 mM for 24 h) in the knockout cells.
A–D) Real-time qPCR revealed that the expression of NLRP3 (*P , 0.05), IL-1b (**P , 0.01), IFN-g (**P , 0.01), and IL-10
(*P , 0.05) was significantly induced in WT cells (means 6 SEM; n = 4) but not in the Gal32/2 cells. When the knockout cells
were exposed to rGal3, the expression of these transcripts was partially reversed (means 6 SEM; n = 4; *P , 0.05). E ) The
immunofluorescent staining probing ASC (red) revealed that there were no ASC foci in nontreated cells, whereas DCA induced
more ASC foci formation in WT cells than in the knockout cells. Application of rGal3 in the knockout cells enhanced the ASC
signal and foci formation. To confirm that the activation of inflammasome by DCA is Gal3 dependent, caspase-1 activity and
IL-1b in media were assessed in WT, Gal32/2, and NLRP32/2 macrophages (F, G). DCA significantly induced caspase-1 activity
in WT cells but not in Gal32/2 cells (F ). In NLRP32/2 cells, caspase-1 activity could not be detected in either DCA-treated or
nontreated groups (means 6 SEM; n = 4). IL-1b ELISA was conducted with cell culture media from the above cells. WT cells
released more IL-1b upon the challenge of DCA; this was not seen in the Gal32/2 cells (G). A minimal amount of IL-1b was
detected in NLRP32/2 cells (means 6 SEM; n = 4).

the transcription factor mediating IL-17 (1.34 6 0.11-fold),
IL-17A (9.82 6 2.27-fold; P , 0.05), and IL-17F (2.17 6
0.29-fold; P , 0.05). This was not found in Gal32/2
cells. When Gal32/2 cells were treated with rGal3 in
addition to DCA, the mRNA levels of IL-23p (3.26 6
1.36-fold), IL-17A (2.73 6 0.95-fold), and IL-17F (1.92 6
0.19-fold; P , 0.05) increased (Fig. 5C–F). The IL-17A in
the media from WT cells was also increased by DCA
(11.50 6 0.30 pg/ml; P , 0.05), but no induction was
found in Gal32/2 culture media. A minimal level of
IL-17A was detected in the media from NLRP32/2 cells,
and it was not altered by DCA or DCA plus rGal3 (Fig.
5G). These data suggest that extra- or intracellular Gal3
mediates the assembly and activation of NLRP3 inflam-
masome, resulting in IL-1b activation, which in turn ac-
tivates IL-17 production by macrophages.
Gal3-deficient dnTGF-bRII mice display
reduced inflammasome activation and
collagen deposition
To assess the role of Gal3 in vivo, we crossed dnTGF-bRII
with Gal32/2 mice to generate Gal3-deficient transgenic
mice (dn/Gal32/2). These mice had similar levels of the
characteristic serologic hallmark AMA, anti-PDC-E2 as
the Gal3-sufficient dnTGF-bRII mice (Supplemental Fig.
2A). The dnTGF-bRII mice are known to develop in-
flammatory bowel disease (24), and the severity of colitis
was scored based on histology (Supplemental Fig. 2B, C).
The dn and dn/Gal32/2 mice showed similar severity of
colon inflammation.
However, in the liver, we found that knocking
down Gal3 significantly reduced the transcripts of
NLRP3 (0.42 6 0.04-fold; P , 0.05), ASC (0.36 6 0.04-fold;
P , 0.05), IFN-g (0.48 6 0.05-fold; P , 0.05), IL-1b (0.28 6
0.04-fold; P , 0.05), IL-10 (0.40 6 0.15-fold; P , 0.05), and
IL-18 (0.43 6 0.01-fold; P , 0.05) (Fig. 6A). Less NLRP3
protein and caspase-1 cleavage was observed in the livers
of these animals as well (Fig. 6B). The serum level of IL-1b
was reduced in these mice (Fig. 6C). We next examined IL-
17 signaling and found reduced RORc and IL-17F in the
dn/Gal32/2 mice (0.64 6 0.10-fold and 0.53 6 0.10-fold,
P , 0.05) (Fig. 6D). Liver histology showed improved in-
flammation with less inflammatory focus formation and
less collagen deposition (Fig. 6E). In parallel, Gal3 defi-
ciency significantly reduced hydroxyproline from 85.80 6
4.58 to 70.55 6 4.36 mg/g liver (P , 0.05) (Fig. 6F). We
and others have previously reported that Gal3 is

ROLE OF GAL3 IN REGULATING INFLAMMASOME ACTIVATION 7

Downloaded from www.fasebj.org to IP 207.162.240.147. The FASEB Journal Vol., No. , pp:, September, 2016
Figure 5. DCA-induced IL-23/IL-17 signaling is mediated by Gal3. RT-qPCR was performed on macrophages treated with
IL-1b (5 ng/ml). A, B) The transcripts of IL-17A and IL-17F were significantly increased (means 6 SEM; n = 4; *P , 0.05 and
**P , 0.01). DCA induced IL-23p19, RORc, IL-17A, and IL-17F in WT cells but not in the knockout cells. C–F ) This effect was
partially reversed by rGal3 (means 6 SEM; n = 4; *P , 0.05, **P , 0.01, and ***P , 0.001). G) IL-17A in media from DCA-treated
WT, Gal32/2, and NLRP32/2 cells was evaluated by ELISA. The DCA-treated WT cells, but not the Gal32/2 cells, released
significantly more IL-17A. Only a trace amount of IL-17A was detected in NLRP32/2 cells, and rGal3 did not change this
(means 6 SEM; n = 4; *P , 0.05).

profibrogenic in BDL and CCl4 models (4, 25). The
dn/Gal32/2 mice also had suppressed profibrogenic
genes, including procollagen Ia1, a-SMA, and TGF-b
(0.13 6 0.03-fold, P , 0.05; 0.54 6 0.02-fold, P , 0.05; and
0.41 6 0.02-fold, P , 0.05, respectively) (Fig. 6G). These
data support our hypothesis that Gal3 modulates the
activation of NLRP3 inflammasome/IL-1b production
and IL-17 signaling, contributing to the inflammatory
injury and fibrogenesis in cholestatic liver injury.
DISCUSSION
Ursodeoxycholic acid, a hydrophilic bile acid, is the only
known treatment for PBC. However, 20 to 30% of patients
with PBC do not respond to ursodeoxycholic acid; thus, a
large patient population still does not have adequate
therapy (26). Understanding the mechanisms of key
proinflammatory pathways may offer a potential new
treatment approach. Herein we focused on describing a
novel pathway with Gal3 as an important modulator of
inflammasome signaling in hepatic macrophages, trig-
gering IL-17 production.
In physiological conditions, Gal3 is predominantly
expressed by macrophages (27, 28) in the liver. Gal3 ex-
pression is enhanced in macrophages and active stellate
cells in different liver diseases (4, 25, 27, 29, 30), and its
profibrogenic role has been emphasized in several studies.
Gal3 deficiency or inhibition was shown to exert anti-
fibrogenic effects in BDL, CCl4, thioacetamide, concanav-
alin A, and NASH diet-induced liver injuries in rodent
models (4, 25, 29–32). Gal3 also plays a pivotal role in
regulating innate and adaptive immune functions, mod-
ulating T-cell functions by inhibiting T-cell apoptosis, and
regulating T-cell receptor signaling (33, 34). We found that
Gal3 expression was increased in livers of patients with

8 Vol. 30 December 2016 The FASEB Journal x www.fasebj.org TIAN ET AL.

Downloaded from www.fasebj.org to IP 207.162.240.147. The FASEB Journal Vol., No. , pp:, September, 2016
Figure 6. Gal3 deficiency prevents inflammasome activation and reduces collagen deposition in dnTGF-bRII mice. dn/Gal32/2
mice were generated by crossing Gal32/2 and dnTGF-bRII mice. A) RT-qPCR showed that dn/Gal32/2 mice expressed
significantly lower levels of NLRP3, ASC, INF-g, IL-1b, IL-10, and IL-18 compared with dnTGF-bRII (dn) mice (means 6 SEM;
n = 6; *P , 0.05 and **P , 0.01). B) Western blots showed less hepatic NLRP3 and caspase-1 cleavage (representative data). C )
The dn/Gal32/2 mice also had undetectable serum IL-1b (representative data), suggesting suppressed NLRP3 inflammasome
activation. D) The transcripts of RORc and IL-17F were lower in these mice as well (n = 6; *P , 0.05). E ) H&E showed
inflammatory granulomas in the dnTGF-bRII mice (arrows), whereas this was not seen in the dn/Gal32/2 group (Ea, b).
Picrosirius red staining and image morphometric analysis revealed less fibrosis in the dn/Gal32/2 mice (Ec, d). F ) Liver tissue
was subjected to hydroxyproline assay. The dnTGF-bRII mice showed significantly higher amount of hydroxyproline compared
with their WT littermates, and this was significantly reduced in dn/Gal32/2 mice (means 6 SEM; n = 9; *P , 0.05 and **P , 0.01).
G) Fibrogenic transcripts procollagen Ia1, a-SMA, and TGF-b also significantly decreased in the dn/Gal32/2 mice (means 6 SEM,
n = 6; *P , 0.05).

PBC and in a murine model of autoimmune cholangitis. follows the immunologic injury in autoimmune liver dis-
For in vitro studies, we chose DCA to challenge the cells eases (35, 36). Exposure of hepatic macrophages to DCA
because it is one of the major hydrophobic cytotoxic bile increased their Gal3 expression. DCA is known to activate
acids and is highly related to the hepatotoxicity that NF-kB and Ap-1 (37, 38), which are known transcriptional

ROLE OF GAL3 IN REGULATING INFLAMMASOME ACTIVATION 9

Downloaded from www.fasebj.org to IP 207.162.240.147. The FASEB Journal Vol., No. , pp:, September, 2016
activators of Gal3 (39–41), hence, this could represent the
potential mechanism.
The key role of macrophages in PBC has been noted (42,
43). A common compound used in cosmetics and food, 2-
octynoic acid could induce a PBC-like histology in mice
lacking CD4+ or CD8+ T cells, with a significant increase of
hepatic macrophages (44). Monocyte-derived macro-
phages from patients with PBC were shown to display a
more inflammatory profile (43), and the exposure to apo-
topes led to proinflammatory cytokine production in
macrophages from patients with PBC (3). To gain more
mechanistic insights into the role of Gal3 in cholestatic liver
injury, in this study we focused on a novel role for Gal3 as
an important regulator of inflammasome activation.
NLRP3 is at the crossroads of many different inflamma-
tory pathways, however, activation of inflammasomes in
autoimmune-driven cholestatic liver injury has not been
evaluated. NLRP3 was shown to be activated by danger-
associated molecular pattern (DAMP) molecules (8), and
Gal3 is considered to be a DAMP (45). In this study we
showed that activation of NLRP3 was Gal3 dependent. We
also discovered a direct binding of Gal3 N-terminal do-
main to NLRP3, as shown in immunoprecipitation and
BLI assay, and, as a result, the activation of the inflam-
masome. In Gal32/2 cells, inflammasome signaling was
significantly reduced, and this could be reversed by
recombinant Gal3, suggesting that extracellular Gal3 also
plays a role. A putative mechanism for this could be Gal3-
mediated integrin crosslinking and formation of a “lat-
tice,” as we have previously demonstrated (4), which
culminates in more potent inflammasome activation.
It was previously reported that Gal3 induced the
alternative activation of macrophages in the presence
of T helper (Th)2 cytokines and contributed to fibro-
genesis (46). Our findings are more consistent with an
early inflammatory classic activation pathway and
point to the fact that Gal3 could mediate distinct effects
depending on the etiology, the phase of liver injury, and
cellular cross talks. A recent study in the thioacetamide
model also showed that the regulatory role of Gal3 on
macrophage activation could indeed be either M1 or M2
oriented (47).
Because IL-17 is a significant proinflammatory and
profibrogenic factor in the liver (20) and plays a key role in
PBC (48), we postulated that inflammasome-mediated
IL-1b signaling can trigger Th17 responses. Indeed, a re-
cent study showed increased hepatic Th17 in patients with
advanced PBC (49), and the induction of Th17 in PBC was
preferential to the liver (48). Here we showed that
Gal3-induced inflammasome activation resulted in the
production of IL-1b, and this in turn enhanced IL-17
production by macrophages in an autocrine manner.
Whether Gal3 mediates Th17 differentiation is un-
known and requires further study.
Nitrosative stress is another pathogenic factor in cho-
lestatic liver injury, and the accumulation of nitrotyrosine
correlates with bile duct damage in PBC, reflecting disease
severity (50). Because IL-1b can induce nitrosative stress
(51), this could be an alternative pathway by which the
Gal3/inflammasome/IL-1b axis contributes to the disease
pathogenesis.
10 Vol. 30 December 2016 The FASEB Journal x www.fasebj.org
Downloaded from www.fasebj.org to IP 207.162.240.147. The FASEB Journal Vol., No. , pp:, September, 2016
The dnTGF-bRII mice spontaneously develop intra-
hepatic bile duct destruction and are positive for AMA.
This model has been used to study the pathogenesis of
PBC, although it is not a perfect model because it does not
mimic all aspects of the human disease (11–13). How-
ever, to study PBC there is a paucity of available models
that would satisfy all criteria. These mice are also
known to develop colitis, but global knockdown of Gal3
did not protect against bowel inflammation (Supple-
mental Fig. 2B, C). It was reported recently that Gal3
may exert a protective role in colon inflammatory diseases
(52). M.E.G.’s group also showed that autoimmune
cholangitis and colitis may have distinct pathogenic
pathways in dnTGF-bRII mice (53).
In summary, NLRP3 inflammasome activation is a key
to early proinflammatory injury in autoimmune-driven
biliary injury, and Gal3 plays an important role in
inflammasome activation. Interrupting the signaling cas-
cade with Gal3 or NLRP3 inhibitors could be potential
therapeutic strategies for PBC and other chronic chole-
static liver diseases.
ACKNOWLEDGMENTS
This study was supported by the U.S. National Institutes of
Health (NIH) National Institute of Diabetes and Digestive and
Kidney Diseases Grants DK090121 and DK106467 (to J.X.J.),
DK083283 (to N.J.T.), DK39588 and DK090019 (to M.E.G.); U.S.
Veterans Administration Grant BX002418 (to N.J.T.); National
Natural Science Foundation of China Grant NNSFC21525730 (to
B.Z.); and NIH National Institute on Aging Grant AG025532 (to
G.C.); and Taiwan Ministry of Science and Technology Grant
MOST104-2321-B-001-036 (to H.-Y.C.). The authors declare no
conflicts of interest.
AUTHOR CONTRIBUTIONS
J. Tian and G. Yang performed the experiments; J. Tian
and J. X. Jiang wrote the manuscript; G. Yang, H.-Y. Chen,
D. K. Hsu, G. Cortopassi, B. Zhao, N, J. Török, and J. X.
Jiang analyzed the data; H.-Y. Chen, D. K. Hsu, and
G. Cortopassi participated in the discussion; A. Tomilov
performed the BLI assay; K. A. Olson analyzed the
histology data; A. Dehnad conducted colon sample
processing and analysis; S. R. Fish conducted genotyping
and participated in colony management and language
correction; B. Zhao interpreted the data; M. E. Gershwin
and F.-T. Liu collaborated on this study; M. E. Gershwin
provided dnTGF-bRII mice and samples from PBC
patients; F.-T. Liu provided Gal32/2 mice, Gal3 antibody,
and recombinant proteins; N. J. Török and J. X. Jiang
designed the experiment; N. J. Török edited the manuscript;
and J. X. Jiang acquired funding for this experiment.
REFERENCES
1. He, X. S., Ansari, A. A., Ridgway, W. M., Coppel, R. L., and Gershwin,
M. E. (2006) New insights to the immunopathology and autoimmune
responses in primary biliary cirrhosis. Cell. Immunol. 239, 1–13
2. Chuang, Y. H., Lian, Z. X., Yang, G. X., Shu, S. A., Moritoki, Y.,
Ridgway, W. M., Ansari, A. A., Kronenberg, M., Flavell, R. A., Gao, B.,
and Gershwin, M. E. (2008) Natural killer T cells exacerbate liver
TIAN ET AL.
 injury in a transforming growth factor beta receptor II dominant-
negative mouse model of primary biliary cirrhosis. Hepatology 47,
571–580
3. Lleo, A., Bowlus, C. L., Yang, G. X., Invernizzi, P., Podda, M.,
Van de Water, J., Ansari, A. A., Coppel, R. L., Worman, H. J., Gores,
G. J., and Gershwin, M. E. (2010) Biliary apotopes and anti-
mitochondrial antibodies activate innate immune responses in pri-
mary biliary cirrhosis. Hepatology 52, 987–998
4. Jiang, J. X., Chen, X., Hsu, D. K., Baghy, K., Serizawa, N., Scott, F.,
Takada, Y., Takada, Y., Fukada, H., Chen, J., Devaraj, S., Adamson, R.,
Liu, F.-T., and Török, N. J. (2012) Galectin-3 modulates phagocytosis-
induced stellate cell activation and liver fibrosis in vivo. Am. J. Physiol.
Gastrointest. Liver Physiol. 302, G439–G446
5. Liu, F.-T. (1990) Molecular biology of IgE-binding protein, IgE-
binding factors, and IgE receptors. Crit. Rev. Immunol. 10, 289–306
6. Wree, A., Eguchi, A., McGeough, M. D., Pena, C. A., Johnson, C. D.,
Canbay, A., Hoffman, H. M., and Feldstein, A. E. (2014) NLRP3
inflammasome activation results in hepatocyte pyroptosis, liver
inflammation, and fibrosis in mice. Hepatology 59, 898–910
7. Wree, A., McGeough, M. D., Peña, C. A., Schlattjan, M., Li, H.,
Inzaugarat, M. E., Messer, K., Canbay, A., Hoffman, H. M., and
Feldstein, A. E. (2014) NLRP3 inflammasome activation is required
for fibrosis development in NAFLD. J. Mol. Med. 92, 1069–1082
8. Davis, B. K., Wen, H., and Ting, J. P. (2011) The inflammasome NLRs
in immunity, inflammation, and associated diseases. Annu. Rev.
Immunol. 29, 707–735
9. Zhu, P., Duan, L., Chen, J., Xiong, A., Xu, Q., Zhang, H., Zheng, F.,
Tan, Z., Gong, F., and Fang, M. (2011) Gene silencing of NALP3
protects against liver ischemia-reperfusion injury in mice. Hum. Gene
Ther. 22, 853–864
10. Lalor, S. J., Dungan, L. S., Sutton, C. E., Basdeo, S. A., Fletcher, J. M.,
and Mills, K. H. (2011) Caspase-1-processed cytokines IL-1beta and
IL-18 promote IL-17 production by gammadelta and CD4 T cells that
mediate autoimmunity. J. Immunol. 186, 5738–5748
11. Oertelt, S., Lian, Z. X., Cheng, C. M., Chuang, Y. H., Padgett, K. A., He,
X. S., Ridgway, W. M., Ansari, A. A., Coppel, R. L., Li, M. O., Flavell,
R. A., Kronenberg, M., Mackay, I. R., and Gershwin, M. E. (2006) Anti-
mitochondrial antibodies and primary biliary cirrhosis in TGF-beta
receptor II dominant-negative mice. J. Immunol. 177, 1655–1660
12. Kawata, K., Yang, G. X., Ando, Y., Tanaka, H., Zhang, W., Kobayashi,
Y., Tsuneyama, K., Leung, P. S., Lian, Z. X., Ridgway, W. M., Ansari,
A. A., He, X. S., and Gershwin, M. E. (2013) Clonality, activated
antigen-specific CD8(+) T cells, and development of autoimmune
cholangitis in dnTGFbRII mice. Hepatology 58, 1094–1104
13. Wang, J., Yang, G. X., Tsuneyama, K., Gershwin, M. E., Ridgway, W. M.,
and Leung, P. S. (2014) Animal models of primary biliary cirrhosis.
Semin. Liver Dis. 34, 285–296
14. Hsu, D. K., Yang, R. Y., Pan, Z., Yu, L., Salomon, D. R., Fung-Leung,
W. P., and Liu, F.-T. (2000) Targeted disruption of the galectin-3 gene
results in attenuated peritoneal inflammatory responses. Am. J. Pathol.
156, 1073–1083
15. Geerts, A., Niki, T., Hellemans, K., De Craemer, D., Van Den Berg, K.,
Lazou, J. M., Stange, G., Van De Winkel, M., and De Bleser, P. (1998)
Purification of rat hepatic stellate cells by side scatter-activated cell
sorting. Hepatology 27, 590–598
16. Hsu, D. K., Zuberi, R. I., and Liu, F.-T. (1992) Biochemical and
biophysical characterization of human recombinant IgE-binding
protein, an S-type animal lectin. J. Biol. Chem. 267, 14167–14174
17. Qiao, L., Studer, E., Leach, K., McKinstry, R., Gupta, S., Decker, R.,
Kukreja, R., Valerie, K., Nagarkatti, P., El Deiry, W., Molkentin, J.,
Schmidt-Ullrich, R., Fisher, P. B., Grant, S., Hylemon, P. B., and Dent,
P. (2001) Deoxycholic acid (DCA) causes ligand-independent acti-
vation of epidermal growth factor receptor (EGFR) and FAS receptor
in primary hepatocytes: inhibition of EGFR/mitogen-activated pro-
tein kinase-signaling module enhances DCA-induced apoptosis. Mol.
Biol. Cell 12, 2629–2645
18. Ferreira, D. M., Afonso, M. B., Rodrigues, P. M., Simão, A. L., Pereira,
D. M., Borralho, P. M., Rodrigues, C. M., and Castro, R. E. (2014) c-Jun
N-terminal kinase 1/c-Jun activation of the p53/microRNA 34a/
sirtuin 1 pathway contributes to apoptosis induced by deoxycholic
acid in rat liver. Mol. Cell. Biol. 34, 1100–1120
19. Ljubuncic, P., Fuhrman, B., Oiknine, J., Aviram, M., and Bomzon, A.
(1996) Effect of deoxycholic acid and ursodeoxycholic acid on lipid
peroxidation in cultured macrophages. Gut 39, 475–478
20. Meng, F., Wang, K., Aoyama, T., Grivennikov, S. I., Paik, Y., Scholten,
D., Cong, M., Iwaisako, K., Liu, X., Zhang, M., Osterreicher, C. H.,
Stickel, F., Ley, K., Brenner, D. A., and Kisseleva, T. (2012)
ROLE OF GAL3 IN REGULATING INFLAMMASOME ACTIVATION
Downloaded from www.fasebj.org to IP 207.162.240.147. The FASEB Journal Vol., No. , pp:, September, 2016
Interleukin-17 signaling in inflammatory, Kupffer cells, and hepatic
stellate cells exacerbates liver fibrosis in mice. Gastroenterology 143,
765–776 e1-3
21. Besnard, A. G., Togbe, D., Couillin, I., Tan, Z., Zheng, S. G., Erard, F.,
Le Bert, M., Quesniaux, V., and Ryffel, B. (2012) Inflammasome-IL-1-
Th17 response in allergic lung inflammation. J. Mol. Cell Biol. 4, 3–10
22. Acosta-Rodriguez, E. V., Napolitani, G., Lanzavecchia, A., and
Sallusto, F. (2007) Interleukins 1beta and 6 but not transforming
growth factor-beta are essential for the differentiation of interleukin
17-producing human T helper cells. Nat. Immunol. 8, 942–949
23. Bosmann, M., Sarma, J. V., Atefi, G., Zetoune, F. S., and Ward, P. A.
(2012) Evidence for anti-inflammatory effects of C5a on the innate
IL-17A/IL-23 axis. FASEB J. 26, 1640–1651
24. Gorelik, L., and Flavell, R. A. (2000) Abrogation of TGFbeta signaling
in T cells leads to spontaneous T cell differentiation and autoimmune
disease. Immunity 12, 171–181
25. Henderson, N. C., Mackinnon, A. C., Farnworth, S. L., Poirier, F.,
Russo, F. P., Iredale, J. P., Haslett, C., Simpson, K. J., and Sethi, T.
(2006) Galectin-3 regulates myofibroblast activation and hepatic
fibrosis. Proc. Natl. Acad. Sci. USA 103, 5060–5065
26. Eisa, N. H., Ebrahim, M. A., Ragab, M., Eissa, L. A., and El-Gayar, A. M.
(2014) Galectin-3 and matrix metalloproteinase-9: Perspective in man-
agement of hepatocellular carcinoma. J. Oncol. Pharm. Pract.°21, 323–330
27. Sano, H., Hsu, D. K., Apgar, J. R., Yu, L., Sharma, B. B., Kuwabara, I.,
Izui, S., and Liu, F.-T. (2003) Critical role of galectin-3 in phagocytosis
by macrophages. J. Clin. Invest. 112, 389–397
28. Hsu, D. K., Dowling, C. A., Jeng, K. C., Chen, J. T., Yang, R. Y., and Liu,
F.-T. (1999) Galectin-3 expression is induced in cirrhotic liver and
hepatocellular carcinoma. Int. J. Cancer 81, 519–526
29. Nomoto, K., Nishida, T., Nakanishi, Y., Fujimoto, M., Takasaki, I.,
Tabuchi, Y., and Tsuneyama, K. (2012) Deficiency in galectin-3 pro-
motes hepatic injury in CDAA diet-induced nonalcoholic fatty liver
disease. ScientificWorldJournal 2012, 959824
30. Iacobini, C., Menini, S., Ricci, C., Blasetti Fantauzzi, C., Scipioni, A.,
Salvi, L., Cordone, S., Delucchi, F., Serino, M., Federici, M., Pricci, F.,
and Pugliese, G. (2011) Galectin-3 ablation protects mice from diet-
induced NASH: a major scavenging role for galectin-3 in liver.
J. Hepatol. 54, 975–983
31. Wijesundera, K. K., Izawa, T., Tennakoon, A. H., Murakami, H.,
Golbar, H. M., Kato-Ichikawa, C., Tanaka, M., Kuwamura, M., and
Yamate, J. (2014) M1- and M2-macrophage polarization in rat liver
cirrhosis induced by thioacetamide (TAA), focusing on Iba1 and
galectin-3. Exp. Mol. Pathol. 96, 382–392
32. T raber, P. G., and Zomer, E. (2013) Therapy of experimental NASH
and fibrosis with galectin inhibitors. PloS One 8, e83481
33. Hsu, D. K., Chen, H. Y., and Liu, F.-T. (2009) Galectin-3 regulates
T-cell functions. Immunol. Rev. 230, 114–127
34. Chen, H. Y., Fermin, A., Vardhana, S., Weng, I. C., Lo, K. F., Chang,
E. Y., Maverakis, E., Yang, R. Y., Hsu, D. K., Dustin, M. L., and Liu, F.-T.
(2009) Galectin-3 negatively regulates TCR-mediated CD4+ T-cell
activation at the immunological synapse. Proc. Natl. Acad. Sci. USA 106,
14496–14501
35. Beuers, U., Boyer, J. L., and Paumgartner, G. (1998) Ursodeoxycholic
acid in cholestasis: potential mechanisms of action and therapeutic
applications. Hepatology 28, 1449–1453
36. Rodrigues, C. M., Fan, G., Wong, P. Y., Kren, B. T., and Steer, C. J.
(1998) Ursodeoxycholic acid may inhibit deoxycholic acid-induced
apoptosis by modulating mitochondrial transmembrane potential
and reactive oxygen species production. Mol. Med. 4, 165–178
37. Jenkins, G. J., Harries, K., Doak, S. H., Wilmes, A., Griffiths, A. P.,
Baxter, J. N., and Parry, J. M. (2004) The bile acid deoxycholic acid
(DCA) at neutral pH activates NF-kappaB and induces IL-8 expres-
sion in oesophageal cells in vitro. Carcinogenesis 25, 317–323
38. Looby, E., Abdel-Latif, M. M., Athié-Morales, V., Duggan, S., Long, A.,
and Kelleher, D. (2009) Deoxycholate induces COX-2 expression via
Erk1/2-, p38-MAPK and AP-1-dependent mechanisms in esophageal
cancer cells. BMC Cancer 9, 190
39. Hsu, D. K., Hammes, S. R., Kuwabara, I., Greene, W. C., and Liu, F.-T.
(1996) Human T lymphotropic virus-I infection of human
T lymphocytes induces expression of the beta-galactoside-binding
lectin, galectin-3. Am. J. Pathol. 148, 1661–1670
40. Liu, L., Sakai, T., Sano, N., and Fukui, K. (2004) Nucling mediates
apoptosis by inhibiting expression of galectin-3 through interference
with nuclear factor kappaB signalling. Biochem. J. 380, 31–41
41. Kim, K., Mayer, E. P., and Nachtigal, M. (2003) Galectin-3 expression
in macrophages is signaled by Ras/MAP kinase pathway and up-
regulated by modified lipoproteins. Biochim. Biophys. Acta 1641, 13–23
11
42. Leicester, K. L., Olynyk, J. K., Brunt, E. M., Britton, R. S., and
Bacon, B. R. (2006) Differential findings for CD14-positive
hepatic monocytes/macrophages in primary biliary cirrhosis,
chronic hepatitis C and nonalcoholic steatohepatitis. Liver Int.
26, 559–565
43. Mao, T. K., Lian, Z. X., Selmi, C., Ichiki, Y., Ashwood, P., Ansari, A. A.,
Coppel, R. L., Shimoda, S., Ishibashi, H., and Gershwin, M. E. (2005)
Altered monocyte responses to defined TLR ligands in patients with
primary biliary cirrhosis. Hepatology 42, 802–808
44. Chang, C. H., Chen, Y. C., Yu, Y. H., Tao, M. H., Leung, P. S., Ansari,
A. A., Gershwin, M. E., and Chuang, Y. H. (2014) Innate immunity
drives xenobiotic-induced murine autoimmune cholangitis. Clin. Exp.
Immunol. 177, 373–380
45. Sato, S., St-Pierre, C., Bhaumik, P., and Nieminen, J. (2009) Galectins
in innate immunity: dual functions of host soluble beta-galactoside-
binding lectins as damage-associated molecular patterns (DAMPs)
and as receptors for pathogen-associated molecular patterns
(PAMPs). Immunol. Rev. 230, 172–187
46. MacKinnon, A. C., Farnworth, S. L., Hodkinson, P. S., Henderson,
N. C., Atkinson, K. M., Leffler, H., Nilsson, U. J., Haslett, C., Forbes,
S. J., and Sethi, T. (2008) Regulation of alternative macrophage
activation by galectin-3. J. Immunol. 180, 2650–2658
47. Wijesundera, K. K., Izawa, T., Tennakoon, A. H., Murakami, H.,
Golbar, H. M., Katou-Ichikawa, C., Tanaka, M., Kuwamura, M., and
Yamate, J. (2014) M1- and M2-macrophage polarization in rat liver
cirrhosis induced by thioacetamide (TAA), focusing on Iba1 and
galectin-3. Exp. Mol. Pathol. 96, 382–392
48. Lan, R. Y., Salunga, T. L., Tsuneyama, K., Lian, Z. X., Yang, G. X., Hsu,
W., Moritoki, Y., Ansari, A. A., Kemper, C., Price, J., Atkinson, J. P.,
12 Vol. 30 December 2016 The FASEB Journal x www.fasebj.org
Downloaded from www.fasebj.org to IP 207.162.240.147. The FASEB Journal Vol., No. , pp:, September, 2016
Coppel, R. L., and Gershwin, M. E. (2009) Hepatic IL-17 responses in
human and murine primary biliary cirrhosis. J. Autoimmun. 32, 43–51
49. Yang, C. Y., Ma, X., Tsuneyama, K., Huang, S., Takahashi, T.,
Chalasani, N. P., Bowlus, C. L., Yang, G. X., Leung, P. S., Ansari, A. A.,
Wu, L., Coppel, R. L., and Gershwin, M. E. (2014) IL-12/Th1 and
IL-23/Th17 biliary microenvironment in primary biliary cirrhosis:
implications for therapy. Hepatology 59, 1944–1953
50. Sanz-Cameno, P., Medina, J., Garcı́a-Buey, L., Garcı́a-Sánchez, A.,
Borque, M. J., Martı́n-Vı́lchez, S., Gamallo, C., Jones, E. A., and
Moreno-Otero, R. (2002) Enhanced intrahepatic inducible nitric
oxide synthase expression and nitrotyrosine accumulation in primary
biliary cirrhosis and autoimmune hepatitis. J. Hepatol. 37, 723–729
51. Geller, D. A., de Vera, M. E., Russell, D. A., Shapiro, R. A., Nussler,
A. K., Simmons, R. L., and Billiar, T. R. (1995) A central role for IL-1
beta in the in vitro and in vivo regulation of hepatic inducible nitric
oxide synthase. IL-1 beta induces hepatic nitric oxide synthesis.
J. Immunol. 155, 4890–4898
52. Tsai, H. F., Wu, C. S., Chen, Y. L., Liao, H. J., Chyuan, I. T., and Hsu,
P. N. (2016) Galectin-3 suppresses mucosal inflammation and re-
duces disease severity in experimental colitis. J. Mol. Med. 94, 545–556
53. Zhang, W., Tsuda, M., Yang, G. X., Tsuneyama, K., Rong, G., Ridgway,
W. M., Ansari, A. A., Flavell, R. A., Coppel, R. L., Lian, Z. X., and
Gershwin, M. E. (2010) Deletion of interleukin-6 in mice with the
dominant negative form of transforming growth factor beta receptor
II improves colitis but exacerbates autoimmune cholangitis. Hepatol-
ogy 52, 215–222
Received for publication February 25, 2016.
Accepted for publication September 1, 2016.
TIAN ET AL.
Galectin-3 regulates inflammasome activation in cholestatic liver
injury
Jijing Tian, Guoxiang Yang, Huan-Yuan Chen, et al.

FASEB J published online September 14, 2016

Access the most recent version at doi:10.1096/fj.201600392RR

Supplemental http://www.fasebj.org/content/suppl/2016/09/14/fj.201600392RR.DC1.html
Material

Subscriptions Information about subscribing to The FASEB Journal is online at

http://www.faseb.org/The-FASEB-Journal/Librarian-s-Resources.aspx

Permissions Submit copyright permission requests at:

http://www.fasebj.org/site/misc/copyright.xhtml

Email Alerts Receive free email alerts when new an article cites this article - sign up at
http://www.fasebj.org/cgi/alerts

© FASEB

Downloaded from www.fasebj.org to IP 207.162.116.194. The FASEB Journal Vol., No. , pp:, September, 2016