Journal Pre-proof

β-1,3-glucan–chitin unmasking in the Saccharomyces cerevisiae mutant, Δmnn9,

promotes immune response and resistance of the pacific oyster (Crassostrea gigas)
to Vibrio coralliilyticus infection

Alfredo Loor, Dongdong Wang, Peter Bossier, Nancy Nevejan

PII: S1050-4648(22)00577-0
DOI: https://doi.org/10.1016/j.fsi.2022.09.019
Reference: YFSIM 8285

To appear in: Fish and Shellfish Immunology

Received Date: 30 June 2022

Revised Date: 8 September 2022
Accepted Date: 11 September 2022

Please cite this article as: Loor A, Wang D, Bossier P, Nevejan N, β-1,3-glucan–chitin unmasking in the
Saccharomyces cerevisiae mutant, Δmnn9, promotes immune response and resistance of the pacific
oyster (Crassostrea gigas) to Vibrio coralliilyticus infection, Fish and Shellfish Immunology (2022), doi:
https://doi.org/10.1016/j.fsi.2022.09.019.

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition
of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of
record. This version will undergo additional copyediting, typesetting and review before it is published
in its final form, but we are providing this version to give early visibility of the article. Please note that,
during the production process, errors may be discovered which could affect the content, and all legal
disclaimers that apply to the journal pertain.

© 2022 Published by Elsevier Ltd.

CRediT author statement

A. Loor: Methodology, Formal analysis, Investigation, Writing – Original Draft; D. Wang:

Formal analysis, data curation; P. Bossier: Conceptualization, Methodology, Writing – Review
& Editing, Supervision; N. Nevejan: Methodology, Writing – Review & Editing, Supervision.

f
r oo
-p
re
lP
na
ur
Jo
 1 β-1,3-glucan–chitin unmasking in the Saccharomyces cerevisiae mutant,

2 Δmnn9, promotes immune response and resistance of the Pacific oyster

3 (Crassostrea gigas) to Vibrio coralliilyticus infection

5 Alfredo Loor*, Dongdong Wang, Peter Bossier, Nancy Nevejan

o f
7 Laboratory of Aquaculture & Artemia Reference Center, Faculty of Bioscience Engineering, Ghent

ro
8 University, Coupure Links 653, 9000 Ghent, Belgium

9
-p
re
10 * Corresponding author.
lP

11 E-mail addresses: Alfredo.Loor@UGent.be (A. Loor); Nancy.Nevejan@UGent.be (N. Nevejan).

na

12
ur

13 Abstract
Jo

14 Yeast cells can play a crucial role in immune activation in fish and shellfish predominantly due to the

15 cell wall component β-1,3-glucan, providing protection against bacterial or viral infections. However,

16 the immunostimulatory capacity of dietary yeast cells remains poorly studied in bivalves. To

17 understand the role of yeast cell wall components (mannan, β-glucan and chitin) as immune

18 activators, this study characterizes the surface carbohydrate exposure of the wild-type baker’s yeast

19 Saccharomyces cerevisiae (WT) and its Δmnn9 mutant, which presents a defective mannan structure,

20 and compares these profiles with β-glucan particles by fluorescein isothiocyanate (FITC)-conjugated

21 lectin analysis. A first trial evaluated the immunological response in Crassostrea gigas juveniles after

22 being fed for 24h with an algae-based diet (100A) and its 50% substituted version (based on dry
23 weight, DW) with WT (50A50WT) and Δmnn9 (50A50Y) as well as the posterior resistance of the oyster

24 spat against Vibrio coralliilyticus infection (trial 1). The mRNA expression was measured for β-glucan-

25 binding protein (CgβGBP), Toll-like receptor 4 (CgTLR4), C-type lectin receptor 3 (CgCLec-3), myeloid

26 differentiation factor 88 (CgMyD88), nuclear factor-kappa B (CgNFκB), lysozyme (CgLys), interleukin

27 17-5 (CgIL17-5), and superoxide dismutase (CgSOD). A second trial tested the effect of incorporating

28 Δmnn9 into the 100A diet for 24h at different substitution levels: 0, 5, 10, 25, and 50% (100A, 95A5Y,

29 90A10Y, 75A25Y, and 50A50Y), followed by the bacterial challenge with V. coralliilyticus (trial 2). Our

30 findings show that the outer cell wall surface of WT is largely composed of mannan, while Δmnn9

o f
31 presents high exposure of β-glucan and chitin, exhibiting similar FITC-lectin binding profiles

ro
32 (fluorescence intensity) to β-glucan particles. A significantly higher survival after the bacterial

33
-p
challenge was observed in oysters fed on 50A50Y compared to those fed 50A50WT and 100A in trial
re
34 1. This better performance of 50A50Y was supported by significantly higher gene expressions of CgLys,
lP

35 CgSOD, CgMyD88, and CgβGBP compared to 100A, and CgSOD and CgNFκB in relation to those fed on

36 50A50WT, prior to the bacterial inoculation. Furthermore, improved survival was observed in oysters
na

37 fed 50A50Y compared to those offered lower Δmnn9 levels and 100A in trial 2. The superior
ur

38 performance of Δmnn9-fed oysters is mostly associated with the elevated presence of unmasked β-
Jo

39 glucans on Δmnn9 cell wall surfaces, facilitating their interactions with oyster hemocytes. Further

40 studies are needed to evaluate administration dose and frequency of Δmnn9 to develop strategies for

41 long-term feeding.

42

43 Keywords:

44 β-1,3-glucan; Crassostrea gigas; Saccharomyces cerevisiae; Δmnn9; immune response; superoxide

45 dismutase

46
47 1. Introduction

48

49 Bivalve shellfish aquaculture represents a key opportunity to fulfil the increasing protein demand of

50 the growing world population, providing additionally high levels of essential omega-3 fatty acids, and

51 micronutrients such as zinc, iron, vitamin A and vitamin B12 [1,2]. The total aquaculture production

52 of bivalves in 2020 was 17.74 million tonnes [3]. One of the most widely cultured oysters is the cupped

53 oyster (Crassostrea spp.), with a registered production of 5.45 million tonnes in 2020 [3]. However,

f
54 the worldwide mass mortality reported in cultured C. gigas resulted in considerable economic losses

o
ro
55 in the oyster farming industry from 2010 to 2018 [4,5]. Disease control measures are traditionally

56 -p
using chemotherapeutics and antibiotics; however, the massive utilization of these products does not
re
57 only lead to antibiotic resistance, also endangers human health, the environment, and even the

58 cultured organisms themselves by diminishing innate disease resistance [6,7]. Instead, the use of
lP

59 immunostimulants such as yeast cells or their main immunostimulatory cell wall component, β-1,3-
na

60 glucan, has been reported to successfully enhance the immune response in fish and shellfish therefore
ur

61 offering protection against bacterial and viral infections [8−16].

Jo

62 As invertebrates lack an adaptive immune system, they rely on innate immunity to defend against

63 pathogens [17]. Innate response involves mainly hemocytes and a broad range of diverse molecular

64 effectors [18]. Once microbial components called pathogen-associated molecular patterns (PAMPs)

65 (e.g., β-1,3-glucans) are recognized by receptors on hemocytes called pattern recognition receptors

66 (PRRs) (e.g., β-glucan-binding proteins (βGBP) or Toll-like receptors (TLRs)), several signal pathways

67 are triggered (e.g., TLR signaling pathways or the prophenoloxidase (proPO) activation pathway),

68 resulting in fast humoral and cellular immune responses to confer protection against microorganisms

69 [19,20]. In bivalves, β-1,3-glucans have been well-documented to increase the expression of several

70 immune-related genes participating in immune recognition such as βGBPs [21,22] and TLRs [23];
71 signaling pathways including MyD88 [23]; immune effectors namely Lys [24] or CgIL17-5 [25]; or to

72 increase enzymatic activity of antioxidants such as SOD [13,26].

73 The wild-type Saccharomyces cerevisiae (WT) comprises an inner cell wall layer containing the

74 polysaccharides β-1,3-glucan, β-1,6-glucan, and chitin, and an outer layer consisting of heavily

75 glycosylated mannoproteins emanating from the cell surface [27,28]. As the outer layer is the primary

76 point of contact with PRRs, mannans have been considered as a mask for the underlying immunogenic

77 cell wall components to escape or weaken immune recognition [29,30]. In contrast, yeast cells with

78 mutations that compromise the mannan outer layer or glucan crosslinking have been documented to

o f
79 cause an elevated exposure of β-1,3-glucans on the outer layer of the cell wall, therefore enhancing

ro
80 the recognition of PAMPs in cells of the immune system [29,31−33]. The S. cerevisiae cell-wall mutant

81
-p
Δmnn9 has shown promising results as an alternative feed and immunostimulant for aquaculture
re
82 purposes [8,9,22]. Although the characteristics of the cell wall outermost layer have not been
lP

83 documented in S. cerevisiae Δmnn9, it is known that the deletion of the MNN9 gene leads to a
na

84 defective N-mannan biosynthesis and/or assembly in the cell wall resulting in a reduction in mannan

85 levels to 22% and an increased β-glucan (68%) and chitin (10%) contents, differing from WT that
ur

86 contains 49%, 50% and 1% of mannan, β-glucan, and chitin, respectively [28,34]. Earlier studies have
Jo

87 shown that Δmnn9-containing diets improved survival of Artemia after infection with Vibrio campbelii,

88 associating this result to the higher β-glucan content in this mutant [8,9]. While recent progress has

89 been made in understanding the nutritional role of Δmnn9 cells in bivalves [22], the contribution as

90 an immunostimulant to provide health benefits remains poorly described.

91 In the present study, we characterized the carbohydrates present on the outer cell-wall surface of the

92 WT S. cerevisiae yeast, the Δmnn9 mutant, and compared them with β-glucan particles, all by FITC-

93 conjugated binding analysis. We evaluated the immunostimulatory effect of both yeast strains on C.

94 gigas spat and their protective action against Vibrio coralliilyticus infection. Finally, we tested the

95 effect of dietary inclusion of Δmnn9 at five levels (0, 5, 10, 25, and 50% of the algae-based diet) on

96 immune response and resistance of C. gigas to V. coralliilyticus infection.

 97

98 2. Material and methods

99

100 2.1. Oyster collection and acclimatization

101 Oyster juveniles (4-6 mm shell length) were provided by the hatchery of Roem Van Yerseke (Yerseke,

102 The Netherlands), transported chilled to the Laboratory of Aquaculture & Artemia Reference Center

103 (Ghent University, Ghent, Belgium), and acclimatized under a 12:12 h light:dark regimen in 100-L tanks

o f
104 with aerated seawater over 10 days by increasing the temperature with 1 ˚C day−1 until reaching 23

ro
105 ˚C. Other seawater parameters such as salinity (handheld refractometer VWR; 32 g L–1), pH (pH meter,

106
-p
pHenomenal, pH 1100 H, VWR; 8.0-8.3), dissolved oxygen (WTW Oxi 3205 Set 1; 5.0-5.5 mg L–1),
re
107 ammonia, NH3/NH4+ (API Ammonia NH3/NH4+ test kit; < 0.25 mg L–1) were constantly measured.
lP

108 Oysters were provided a bi-algal diet consisting of Tisochrysis lutea and Chaetoceros muelleri at a

109 feeding ration of 0.5% algal dry weight per wet weight of oyster per day (DW WW −1). Seawater was
na

110 renewed every three days.

ur

111
Jo

112 2.2. Microalgae and yeast culture

113 Two microalgae species, T. lutea (CCAP 927/14) and C. muelleri (CCAP 1010/3), were cultured in 500-

114 mL Erlenmeyer flasks and then transferred to 5-L glass bottles and 10-L polyethylene terephthalate

115 (PET) bottles (batch culture). Cultures in Erlenmeyer flasks were grown in 0.2-μm-filtered and

116 autoclaved seawater (FASW) enriched with Walne medium at 1 mL L−1. The upscaled cultures in glass

117 and PET bottles were grown in 0.2-μm filtered seawater (FSW) enriched with NutriBloom Plus®

118 medium (Necton, S.A.) (1.5 mL L−1). Potassium nitrate (KNO3) and sodium metasilicate (Na2SiO3) were

119 added to C. muelleri cultures at concentrations of 100 mg L−1 and 40 mg L−1, respectively. Seawater

120 temperature was maintained at 19 °C under continuous fluorescent (cool-white) light. Microalgae
121 species were harvested in the exponential growth phase (between 4 and 6 days after inoculation) and

122 counted prior to feeding with an XperCount portable device (XpertSea).

123 The wild-type S. cerevisiae strain (WT) (BY4741, (genotype Mata his3Δ1 leu2Δ0 met15Δ0 ura3Δ0)) and

124 the Δmnn9 isogenic mutant (BY4741, (genotype Mata his3Δ1 leu2Δ0 met15Δ0 ura3Δ0

125 YPL050c::kanMX4)) were provided by the European S. cerevisiae Archive for Functional Analysis

126 (University of Frankfurt, Frankfurt, Germany). Yeast cultures were performed according to Loor et al.,

127 (2021). Briefly, yeast cells were cultured in sterile Erlenmeyer flasks (2.5% (v/v) inoculum) on a shaker

128 (125 rpm) at 28 °C with a complete yeast extract peptone dextrose medium (YEPD) containing yeast

o f
129 extract (Roth, 1% w/v), bacteriological-grade peptone (Roth, 1% w/v) and D-glucose (VWR, 2% w/v).

ro
130 The medium was prepared in FASW. The strains were harvested in exponential phase (24h culture).

131
-p
For harvesting, the cultures were washed twice by centrifugation (3000 rpm for 10 min) and
re
132 resuspension with FASW, and then stored at 4 °C. Procedures were carried out under a laminar flow
lP

133 hood to maintain sterility. Feeding rations were calculated based on cellular DW (i.e., 22.6 ± 6.9, 38.7
na

134 ± 5.1, 11.2 ± 0.9 and 41.0 ± 7.7 pg cell−1 (mean ± SD; N = 7), for T. lutea, C. muelleri, WT and ∆mnn9,

135 respectively). The DW determination method as well as the fatty acid profiling and protein levels of
ur

136 each cell are shown in Loor et al. [22].

Jo

137

138 2.3. FITC-labelled lectin binding and Flow cytometry analysis

139 FITC-conjugated lectins were used to visualize changes in the carbohydrate composition of WT and

140 Δmnn9 outermost cell wall layer, and β-glucan extracted from S. cerevisiae (Sigma-Aldrich;

141 specifications: only glucose detected, purity ≥ 98%). The lectins included concanavalin A (ConA; sugar

142 specificity, mannose), peanut agglutinin (PNA; galactose), soybean agglutinin (SBA; N-

143 Acetylgalactosamine), Ulex europaeus agglutinin I (UEA I; fucose), wheat germ agglutinin (WGA; N-

144 Acetylglucosamine), Griffonia simplicifolia lectin II (GSL II; N-Acetylglucosamine), Lycopersicon

145 esculentum lectin (LEL; N-Acetylglucosamine), Solanum tuberosum lectin (STL; N-Acetylglucosamine),
146 Vicia villos a lectin (VVA; N-Acetylgalactosamine) (catalog no. FLK-2100 for ConA, PNA, SBA, UEA I and

147 WGA; and FLK-4100 for GSL II, LEL, STL, VVA; Vector Laboratories). A blank (without any lectin) was

148 also included as a reference.

149 Briefly, harvested yeast cells and β-glucan particles were suspended in FASW and adjusted in Falcon

150 tubes to an optical density of 0.1 at 600 nm (OD600) (measured with a spectrophotometer, Thermo

151 Spectronic Genesys 20, Thermo Fisher Scientific, Belgium). Then, 250 μL of the suspension was

152 transferred to sterile Eppendorf tubes and 1 μL of the FITC-lectin was added to each Eppendorf. The

153 suspensions (251 μL each) were mixed with a micropipette, transferred to a 96-well plate, and then

o f
154 incubated for 1h in the dark at room temperature. Finally, the samples were analyzed with a CytoFLEX

ro
155 flow cytometer system (Beckman Coulter’s Life sciences, France). The flow cytometer was set as

156
-p
follows: gain FSC-1, gain FITC-1. Events were recorded for 1 min at medium speed (30 μL min−1). Data
re
157 are shown as histogram plots (FITC-A/event counts) for the FITC-conjugated lectin analysis and as FSC-
lP

158 A/SSC-A to visualize the cell size distribution of WT and Δmnn9 cells from blank samples.
na

159
ur

160 2.4. Pre-challenge feeding

Jo

161 2.4.1. General conditions

162 C. gigas spat were randomly distributed from acclimatization to the pre-challenge feeding system.

163 Oysters were distributed in PVC trays (L10 × W10 × H19 cm) (4-5 g of spat per tray) that were provided

164 with a mesh (1-mm hole) at the bottom. The trays were suspended in 20-L rectangular tanks (L39 ×

165 W21 × H25 cm) filled with 15 L of seawater (2 trays per tank). Each tank was aerated with an air stone

166 to keep the diets in suspension and equipped with an air-lift downwelling system as described by Loor

167 et al. [22]. Animals from each pre-challenge treatment were placed in one tank. All diets were supplied

168 at a feeding ration of 2% DW WW−1, with an initial supply of 30% and the remaining ration provided

169 over a period of 24h with a peristaltic pump.

170
171 2.4.2. Trial 1: comparison Δmnn9 vs WT

172 To evaluate the potential immunostimulatory effect of the incorporation of Δmnn9 and WT in the

173 algae-based diet, oyster spat (5.87 ± 0.81 mm shell length, 31.4 ± 5.4 mg ind −1 (mean ± SD; N = 50))

174 were treated with three diets for a period of 24h before the challenge: the bi-algal diet (T. lutea and

175 C. muelleri, 1:1 ratio based on DW) (100A) and its 50% substituted version with Δmnn9 (50A50Y) and

176 WT (50A50WT).

177

f
178 2.4.3. Trial 2: Δmnn9 administration

o
ro
179 To examine whether Δmnn9 has immunostimulatory benefits on C. gigas, individuals (5.94 ± 0.67 mm

180 -p
shell length, 33.1 ± 5.9 mg ind−1 (mean ± SD; N = 50)) five pre-challenge diets were tested for 24h: the
re
181 bi-algal diet (100A) and its substituted version with Δmnn9 at four levels, 5%, 10%, 25% and 50%
lP

182 (95A5Y, 90A10Y, 75A25Y, 50A50Y, respectively). In order to observe whether oysters can digest

183 Δmnn9 cells, faeces from treatments 50A50Y and 75A25Y were collected during the pre-challenge
na

184 feeding test and stained with methylene blue (MB) according to Sami et al. [35]. The staining
ur

185 technique is based on the assumption that MB is able to enter cells of which the selective permeability
Jo

186 of the plasma membrane has been destroyed or severely compromised, allowing the discrimination

187 between living/viable (unstained) and dead/unviable (blue-stained) Δmnn9 cells [35,36].

188

189 2.5. Bacterial culture and challenge test

190 The bacterial strain V. coralliilyticus DO1 (V. coralliilyticus/neptunius-like isolate, Genbank: EU358784),

191 isolated from Perna canaliculus larvae [37], was maintained and stored in 30% glycerol at −80 °C until

192 use. Before bacterial challenge, 100 μL of the freezer stock were transferred in 10 mL Luria-Bertani

193 broth supplemented with 35 g L−1 (LB35) and incubated overnight on a rotator at 23 °C. Then, 1 mL

194 was re-inoculated in 19 mL LB35 and incubated for 6h at 23 °C until reaching an OD550 ≈ 1.25.
195 After the 24-h feeding period (section 2.4), all animals from each pre-challenge treatment tank were

196 randomly split into 4 groups, and 6 animals were sampled per group, frozen in liquid nitrogen, and

197 stored at −80 °C for posterior gene expression analysis. The remaining oysters from these groups were

198 then split and placed into 8 plastic containers (4 replicates for the bacterial challenge, and 4 for the

199 non-infected negative controls). Each replicate contained 36 animals. The containers were filled with

200 500 mL of FSW. For the challenged groups, V. coralliilyticus was inoculated in the water column to

201 reach a concentration of 6 × 106 CFU mL−1. The bacterial concentration was determined based on the

202 McFarland standard (BioMerieux, Marcy L’Etoile, France), where OD550 = 1 corresponds to 1.2 × 109

o f
203 cells mL-1. LB35 was added in the non-infected controls (same volume as the infected groups, ~2 mL).

ro
204 At 24h post bacterial inoculation, 6 animals were sampled per replica, frozen in liquid nitrogen, and

205
-p
kept at −80 °C until RNA extraction. Dead animals were daily removed and survival (%) was calculated
re
206 over a period of 7 days as follows: (final number of juveniles / initial number of juveniles) × 100.
lP

207 Seawater temperature was maintained at 23.4 ± 0.5 ˚C, and 22.8 ± 0.6 ˚C (mean ± SD; N = 10) for trials

208 1 and 2, respectively.

na

209
ur

210 2.6. Immune-related gene expression

Jo

211 2.6.1. Gene selection and mRNA expression analysis

212 The immune response of C. gigas spat was evaluated through genes participating in several defense

213 mechanisms, including: immune recognition of PAMPs such as CgβGBP, CgTLR4, CgCLec-3; hemocyte

214 signaling and activation, CgMyD88 and CgNFκB; immune effectors, CgLys, CgIL17-5; antioxidant

215 enzymes, CgSOD. The primer sequences are presented in Table 1. Specific primers for CgLys gene were

216 designed by using Primer BLAST (NCBI primer designing tool:

217 https://www.ncbi.nlm.nih.gov/tools/primer-blast/). As for other genes, primers were selected from

218 previously published research. The amplification product was confirmed by electrophoresis (1.5h at

219 80 V) on 2% agarose gel and posterior sequencing of purified PCR products.

220

221 2.6.2. RNA extraction, cDNA synthesis, and real-time RT-qPCR

222 Total RNA was extracted from frozen animals following the RNeasy® Plus Mini Kit (Qiagen) protocol.

223 RNA purity and quantity were determined by NanoDrop™ 2000 (Thermo Scientific). For each sample,

224 2 μg of total RNA were synthesized to cDNA with the RevertAid™ H Minus First Strand cDNA Synthesis

225 Kit (Thermo Scientific), using oligo (dT) primers. The cDNAs were used as templates after diluting to

226 1:20 in UltraPureTM distilled water (Invitrogen).

f
227 Quantitative real-time PCR (RT-qPCR) assay was performed on Step One Plus Real-Time System

o
ro
228 (Applied Biosystems) using a Maxima SYBR Green/ROX qPCR Master Mix (2X) (Thermo Scientific). The

229 -p
qRT-PCR reaction mixture (15 μL) consisted of 2X SYBR green master mix (7.5 μL), 1.5 μL of forward
re
230 and reverse primers (0.3 μM each) and 4 μL of cDNA dilution. The reaction volume was completed

231 with 0.5 μL UP water. Each biological replicate was run in duplicate. qPCR conditions were as follows:
lP

232 95 °C for 5 min, 40 cycles of 95 °C for 10 s, 60 °C for 30 s. Dissociation curve analysis was performed
na

233 to verify the specificity of the amplified product. Two internal reference genes, the ribosomal proteins
ur

234 S18 (CgRS18) and L7 (CgRL7) were introduced to normalize the qPCR data. The relative expression
Jo

235 ratio of different genes in the animals was calculated using the comparative Ct method (2–ΔΔCt method)

236 [41]. All data were given in terms of relative mRNA expression.

237

238 2.7. Statistical analysis

239 Normality and homoscedasticity of gene expression data were tested using the Kolmogorov-Smirnov

240 test and Levene’s test, respectively. Survival curves of bacterial challenged groups from trials 1 and 2

241 were subjected to two-way repeated measures ANOVA, followed by Bonferroni’s multiple

242 comparisons (with dietary treatments and time as factors) and also analyzed using Kaplan-Meier

243 curves with log rank (Mantel-Cox) comparison over strata (Fig. S1) and one-way ANOVA with Tukey’s

244 multiple comparisons on day 7 (Fig. S1). Statistical significance in log-transformed gene expression
245 data was analyzed using one-way ANOVA with Tukey’s multiple comparisons. The results are

246 expressed as mean ± SE (n = 4). Differences were considered statistically significant at p < 0.05 and

247 were indicated by different letters. All data were analyzed using the statistical software SPSS Statistics

248 26.

249

250 3. Results

251

o f
252 3.1. Binding of FITC-conjugated lectins to yeast cells and β-glucan

ro
253 Cell size distributions and images of WT and Δmnn9 are shown in Fig. 1. The Δmnn9 mutant notably

254
-p
showed large and aggregated cells contrary to WT. Representative flow cytometry profiles of FITC-
re
255 labelled lectins binding to the WT yeast, the Δmnn9 mutant, and β-glucan particles are shown in Fig.
lP

256 2. In general, the lectin-binding profiles (FITC-A/event-counts histogram plots) showed marked
na

257 differences with respect to cell surface components between WT and Δmnn9, while high similarities

258 were observed between Δmnn9 and β-glucan particles. The lectins ConA and GSL II presented a strong
ur

259 binding affinity to both yeast cells, but low affinity towards β-glucan particles. WGA and LEL showed
Jo

260 a clear stronger binding to Δmnn9 in comparison to WT. At a lower intensity, binding affinities to

261 Δmnn9 were also observed with the lectins STL, UEA I, PNA, SBA, and VVA compared to WT yeast,

262 which showed no detectable binding.

263

264 3.2. Bacterial challenge and gene expression

265 3.2.1. Trial 1: Δmnn9 vs WT

266 Oysters fed on 50A50Y for 24h and then challenged with V. coralliilyticus for 7 days showed

267 significantly higher survival (p < 0.05) (66%) than those treated with 50A50WT (48%) and the 100A

268 control (53%) (Fig. 3; Fig. S1). After 24h of feeding, just before the challenge, the relative mRNA
269 expressions of CgLys, CgSOD, CgMyD88, and CgβGBP were significantly higher (p < 0.05) in oysters fed

270 with 50A50Y compared with 100A-fed replicates, while CgSOD and CgNFκB were significantly higher

271 (p < 0.05) expressed in 50A50Y-fed oysters in relation to oysters that received the diet 50A50WT (Fig.

272 4). The mRNA expression of all genes did not differ significantly (p > 0.05) among the different dietary

273 treatments at 24h post bacterial challenge (Fig. 5).

274

275 3.2.1. Trial 2: Effect of Δmnn9 administration on survival of oyster spat when challenged

f
276 MB-stained faeces sampled in the groups 50A50Y and 75A25Y are presented in Fig. 6A and 6B,

o
ro
277 respectively. Oyster faeces showed round and perceivably unbroken Δmnn9 yeast cells in both

278 treatments. -p
re
279 After 7 days of challenge with V. coralliilyticus, significantly higher survival (p < 0.05) was observed in
lP

280 infected oysters fed 50A50Y (23%) compared to the algae-fed control (100A, 3%) and the substitution

281 levels 95A5Y (3%), 90A10Y (7%), and 75A25Y (14%) (Fig. 6C; Fig. S1).
na

282 Prior to V. coralliilyticus challenge, CgβGBP was significantly overexpressed (p < 0.05) in 50A50Y and
ur

283 75A25Y compared to 100A, similar to CgMyD88, which was significantly upregulated (p < 0.05) in
Jo

284 50A50Y (Fig. 7). Following the V. coralliilyticus inoculation, mRNA expressions did not show significant

285 differences (p > 0.05) in any genes after 24h (Fig. 8).

286

287 4. Discussion

288

289 Examining the specificity of FITC-lectins on cell surface polysaccharides is essential to better

290 understand the yeast outer cell wall components and the implications on either immune recognition

291 or immune shielding in bivalves. The wild-type (WT) S. cerevisiae cell wall comprises an inner layer

292 containing the polysaccharides β-1,3-glucan, β-1,6-glucan (both representing around 50%) and chitin
293 (1%), and an outer layer consisting of heavily glycosylated mannoproteins emanating from the cell

294 surface (49%) [27,28]. Mannans provide cell rigidity and limit the accessibility of the inner part of the

295 wall and the plasma membrane to foreign enzymes [27]. In our study, ConA bound predominantly to

296 WT, suggesting the outermost layer of WT cell wall is predominantly mannan. This is in line with

297 previous studies reporting the marked binding affinity of ConA to β-mannans and α-mannans in WT

298 yeast cells [42,30,33]. Although previous studies have indicated that mannans can stimulate PRRs and

299 promote phagocytic action of hemocytes [43,44], the most important PAMP playing a dominant role

300 in immune activation, β-1,3-glucans, remain fully masked in WT [30].

o f
301 During the cell wall elaboration, the Mnn9 protein, a subunit of the mannosyltransferase complex

ro
302 located in Golgi membranes, participates in the synthesis of the α-1,6-mannose backbone N-linked to

303
-p
the cell wall proteins [34,45]. The deletion of the gene MNN9 in S. cerevisiae results in a defective N-
re
304 mannan biosynthesis and/or assembly leading to a reduction in mannan levels in cell walls, whereas
lP

305 β-glucans and chitin contents are increased [28,34]. Our data revealed marked binding affinity of WGA
na

306 and LEL lectins to Δmnn9. It is known that these plant lectins bind preferentially to N-

307 Acetylglucosamine (GlcNAc) [34,46], which serves as a building block for chitin [47]. Interestingly, this
ur

308 study also showed high lectin binding affinities of WGA and LEL to β-glucan particles, suggesting these
Jo

309 lectins exhibit a degree of specificity with glucose. To date, however, no studies have validated these

310 findings.

311 Altogether, the high similarities in binding-affinity profiles observed between ∆mnn9 cells and β-

312 glucan, and their marked dissimilarities compared to that of the WT, suggest that the defective and

313 reduced mannan content distinctive in ∆mnn9 cells also result in chitin and β-glucan unmasking on its

314 cell-wall surface. Mutants showing similar characteristics have been described in the S. cerevisiae

315 Δmcd4 [31] and the Candida albicans Δmnn2 [29,32,33] and Δoch1 [30].

316 In this study, oysters fed on Δmnn9 (50A50Y) for 24h showed protective effects against V.

317 coralliilyticus exposure compared to those fed on WT (50A50WT) or only microalgae (100A). This
318 result is comparable with earlier studies on Artemia showing higher protection against Vibrio

319 campbellii when offered Δmnn9 at 10% of the diet for 8h and 16h prior to challenge [8], or when

320 supplied this mutant as a mono diet during the bacterial challenge [9]. Although proper ingestion and

321 nutrient assimilation of Δmnn9 have been recently documented in C. gigas [22] and confirmed by MB

322 staining in this study, the presence of round-shaped yeast cells in the faeces observed, suggests that

323 Δmnn9 cell wall cannot be fully broken-down to permit its components (as β-glucan) to cross the gut

324 epithelium during digestion and facilitate efficient interactions with hemocytes in the hemolymph.

325 Nevertheless, the better survival in 50A50Y could be mainly explained by a higher contact between

o f
326 unmasked β-glucan and/or chitin on Δmnn9 cell-wall surface and the hemocytes located in the gut

ro
327 epithelium. Connective tissues of the gills and sub-epithelial tissues along the digestive tract are

328
-p
among the most hemocyte-rich tissues in bivalves [48]. These hemocytes can migrate and infiltrate
re
329 epithelial tissues to interact via PRRs with foreign particles (PAMPs) such as yeast β-glucans and
lP

330 activate immune responses [11,12,49].

na

331 This work showed that the 50A50Y diet promoted the expression of several genes involved in cellular

332 and humoral immune responses in C. gigas. We reported an upregulation of the PRR CgβGBP in
ur

333 oysters fed 50A50Y compared to 100A. Furthermore, although this study did not observe differences
Jo

334 in CgβGBP expression between 50A50Y and 50A50WT, an overexpression of CgβGBP in oyster feeding

335 on 50A50Y compared to those fed 50A50WT has been reported after a 3-week period of daily feeding

336 [22]. Comparably, increased βGBP expression has been described in the mussel Perna viridis against

337 laminarin [50], and in Artemia franciscana treated with Gas1 β-glucan [16]. CgβGBP was previously

338 identified and characterized by Itoh et al. [21] in C. gigas (designated as CgβGBP-2). That study

339 demonstrated not only the ability of CgβGBP protein to bind β-glucan but also to enhance

340 phenoloxidase (PO) activity in C. gigas hemocytes. It suggests Δmnn9 might trigger the proPO

341 activation pathway in oysters, as also documented in Artemia [9]. In addition, CgβGBP was also

342 reported to be highly expressed in the digestive gland while almost absent in circulatory hemocytes

343 and other tissues [21], suggesting that C. gigas may possess biased pattern recognition toward the
344 digestive system as the first line of defense, as stated by Allam and Raftos [12].

345 Other PRRs playing an essential role in innate immune responses and host defense are Toll-like

346 receptors (TLR) and C-type lectins (CLec). In bivalves, TLR stimulation provokes MyD88 recruitment to

347 trigger the activation of MAP kinases (MAPKs) and transcription factors such as NF-κB, resulting in the

348 expression of inflammatory cytokine genes, chemokines, and/or type I interferon [51]. Differently,

349 CLec is involved in pathogen elimination in the innate response through the activation of the

350 complement system and enhancement of phagocytosis [43]. Although previous works in C. gigas have

351 shown upregulation of CgTLR4 and CgCLec-3 in response to β-glucan [23,17], no differences were

o f
352 observed in the present study. On the one hand, it can be hypothesized that the gene upregulation

ro
353 arose earlier than the time point analyzed in this work (24h). After β-glucan stimulation, previous

354
-p
studies in C. gigas have reported the highest expression of CgTLR4 at 6h and 12h [23], while CgCLec-
re
355 3 also expressed highly at 6h and 9h [17]. CfCLec-4 was reported to express mainly at 3, 6 and 12 h
lP

356 after stimulation in Chlamys farreri [52]. On the other hand, Song et al. [17] also described that
na

357 CgCLec-3 proteins are mostly distributed in the gonad, mantle, and gill tissues, but there was no

358 evident indication in the adductor muscle and hepatopancreas tissues (e.g., digestive glands). This low
ur

359 presence of CgCLec-3 protein in oyster digestive glands, where Δmnn9 cells are mostly present, might
Jo

360 explain the undetected upregulation of CgCLec-3.

361 In the TLR pathway, MyD88 and NF-κB are fundamental upstream and downstream components,

362 respectively [53]. Despite CgTLR4 not exhibiting overexpression in this study, CgMyD88 showed

363 significant upregulation in oysters fed 50A50Y compared to 100A, suggesting MyD88 might be

364 activated via other TLR members that could also respond to β-glucan, such as TLR2 and TLR3 [23].

365 MyD88 overexpression was previously reported in Mytilus galloprovincialis challenged with the

366 fungus, Fusarium oxysporum, which contains a similar cell-wall structure to S. cerevisiae [54], and in

367 C. gigas at 3h, 6h, and 12h post-β-glucan stimulation [23]. Our data also showed a significant increase

368 in NF-κB mRNA in 50A50Y compared to those fed 50A50WT, implying that the CgNFκB activation is

369 likely mediated by the Toll-pathway (MyD88, IRAK, IkB, and NF-κB). However, further research is still
370 needed to clarify the effect of Δmnn9 and WT on the activation of NF-κB, since no significant

371 differences were observed between 50A50Y and 100A.

372 Further, among the hydrolytic enzymes, the lysozymes (Lys) play key roles in microbial destruction

373 due to their lytic properties on the peptidoglycan of the bacteria cell wall [11]. In this study, an

374 increased CgLys expression was detected in oysters fed the Δmnn9-containing diet 50A50Y compared

375 to those fed the 100A control. Similarly, following β-glucan stimulation, higher Lys activity was

376 reported in Ostrea edulis at 24h and 48h [13], in Fenneropenaeus chinensis (during 48h) [55], as well

377 as higher Lys expression in Ruditapes philippinarum gills after 3h and 6h [24].

o f
378 To avoid self-damage against reactive oxygen species, the host relies on effective antioxidant defense

ro
379 systems that involve antioxidant enzymes such as SOD and catalase [11]. SOD converts superoxide

380
-p
radicals (O2•–) to hydrogen peroxide (H2O2), which is further converted to H2O and O2 [56]. Our data
re
381 showed a higher expression of CgSOD in oysters fed on 50A50Y in relation to 100A and 50A50WT at
lP

382 24h post-feeding. In bivalves, β-glucans have been reported to increase the activity of SOD in Chlamys
na

383 farreri (from 2.5 to 4.5 days) [26] and in O. edulis (peaked at 24h) [13]. SOD upregulations were also

384 detected in the shrimp Litopenaeus vannamei after yeast (Rhodosporidium paludigenum) stimulation
ur

385 [57], and in A. franciscana treated with Gas1 β-glucan [16].

Jo

386 IL17-5 is a proinflammatory cytokine that participates in clearing extracellular bacteria and contributes

387 to the pathology of many autoimmune and allergic conditions [58]. Although CgIL17-5 has exhibited

388 β-glucan-binding activity in C. gigas [25], the present study did not detect higher CgIL17-5 expressions

389 in yeast-fed oysters. As discussed above with CgCLec-3, it is possible that the CgIL17-5 protein

390 functions mainly in tissues not associated with the digestive system. Li et al. [58] reported that CgIL17-

391 5 mRNAs were mainly detected in gills, while the levels in digestive glands were around 6 times lower.

392 In trial 2, the reduced survival in oysters fed on Δmnn9 at the substitution levels 95A5Y, 90A10Y, and

393 75A25Y may be explained by a low β-glucan-hemocyte interaction compared to the diet 50A50Y,

394 resulting in a weaker immune response. This hypothesis is supported by the poor ability of oysters to
395 completely break down yeast cell walls, relying mostly on β-glucan exposure on the cell wall surface.

396 Furthermore, although limited studies have shown how dietary S. cerevisiae can effectively induce

397 health beneficial effects in bivalves and induce protection against bacterial infections, earlier studies

398 in fish and other invertebrates reported that low inclusion levels of yeast cells (e.g., 10% Candida sake

399 for feeding shrimp Fenneropenaeus indicus; [59]) or β-glucans (e.g., 0.1% for Nile tilapia; [60]) in the

400 diets are certainly required to maintain active and continued immunostimulation at long-term

401 administration, whereas the supply at high levels might result in immunosuppression due to

402 exhaustion of the immune system [10,15]. Based on this, the lack of protective effects offered to

o f
403 oysters fed on diets containing lower Δmnn9 levels might also be explained by the short period of

ro
404 administration evaluated in this study (24h). Future investigations into doses, administration

405
-p
frequencies, and long-term feeding with Δmnn9 are required to further clarify the immunostimulatory
re
406 effect of this mutant over time.
lP

407
na

408 5. Conclusion
ur

409
Jo

410 Our study provided insight into how FITC-lectin analysis could be used to characterize yeast cells based

411 on the surface sugar components. The similarities of FITC-lectin binding profiles observed between S.

412 cerevisiae Δmnn9 and β-glucan particles indicate low mannan content and increased exposure of β-

413 glucan and chitin on Δmnn9 outermost cell surface. In contrast, the WT was shown to be

414 predominantly masked by mannan. The Δmnn9-containing diet, 50A50Y, supplied for 24h triggered

415 immune responses in C. gigas spat (upregulation of CgLys, CgSOD, CgMyD88 and CgβGBP compared

416 to the 100A control, and CgSOD and CgNFκB compared to 50A50WT), as well as provided higher

417 protection against V. coralliilyticus infection. These results were possibly tied to the enhanced β-

418 glucan–chitin exposure on Δmnn9 cell surface, which facilitated the recognition by hemocytes and

419 promoted immune response. The weaker performance of oysters fed Δmnn9 at lower substitutions
420 levels (5, 10, and 25%) is perhaps due to the lower interaction between the mutant and hemocytes in

421 the digestive tract. The immunomodulatory effect of Δmnn9 on prolonged feeding needs to be

422 determined to develop strategies that more effectively support the dual role of Δmnn9 as a

423 nutritionally valuable feed source and immunostimulatory component for bivalves.

424

425 Acknowledgments

426 This research was financed by Ghent University through the Special Research Fund (BOF) (grant code

o f
427 01D34318). We thank Roem van Yerseke (Yerseke, The Netherlands) for kindly providing oyster spat

ro
428 for the trials. The research leading to results presented in this publication was carried out with

429
-p
infrastructure funded by EMBRC Belgium - FWO international research infrastructure I001621N. This
re
430 research has benefitted from a statistical consult with Ghent University FIRE (Fostering Innovative
lP

431 Research based on Evidence).

432
na

433 References
ur
Jo

434 [1] J.W.M. Wijsman, K. Troost, J. Fang, A. Roncarati, 2019. Global production of marine bivalves.

435 Trends and challenges. In: Smaal, A.C., Ferreira, J.G., Grant, J., Petersen, J.K., Strand, Ø.,

436 editors. Goods and services of marine bivalves. Cham: Springer International Publishing. pp.

437 7-26.

438 [2] D.F. Willer, D.C. Aldridge, 2020. Sustainable bivalve farming can deliver food security in the

439 tropics. Nature food 1, 384-388.

440 [3] FAO 2022. The state of world fisheries and aquaculture 2022. Towards blue transformation.

441 Rome, FAO.

442 [4] V. Barbosa Solomieu, T. Renault, M-A. Travers, 2015. Mass mortality in bivalves and the

443 intricate case of the Pacific oyster Crassostrea gigas. Journal of Invertebrate Pathology 131,
444 2-10.

445 [5] A.C. Alfaro, T.V. Nguyen, F. Merien, 2019. The complex interactions of Ostreid herpesvirus 1,

446 Vibrio bacteria, environment and host factors in mass mortality outbreaks of Crassostrea

447 gigas. Reviews in Aquaculture 11, 1148-1168.

448 [6] T. Defoirdt, N. Boon, P. Sorgeloos, W. Verstraete, P. Bossier, 2007. Alternatives to antibiotics

449 to control bacterial infections: luminescent vibriosis in aquaculture as an example. Trends in

450 Biotechnology 25, 472-479.

451 [7] X. Ma, F. Zhu, Q. Jin, 2019. Antibiotics and chemical disease-control agents reduce innate

o f
452 disease resistance in crayfish. Fish & Shellfish Immunology 86, 169-178.

ro
453 [8] S. Soltanian, T.Q. Thai, J. Dhont, P. Sorgeloos, P. Bossier, 2007. The protective effect against

454
-p
Vibrio campbellii in Artemia nauplii by pure β-glucan and isogenic yeast cells differing in β-
re
455 glucan and chitin content operated with a source-dependent time lag. Fish & Shellfish
lP

456 Immunology 23, 1003-1014.

457 [9] C.R. Rojas-García, A.F.M. Hasanuzzaman, P. Sorgeloos, P. Bossier, 2008. Cell wall deficient
na

458 Saccharomyces cerevisiae strains as microbial diet for Artemia larvae: Protective effects
ur

459 against vibriosis and participation of phenoloxidase. Journal of Experimental Marine Biology
Jo

460 and Ecology 360, 1-8.

461 [10]T.P. Sajeevan, R. Philip, I.S. Bright Singh, 2009. Dose/frequency: A critical factor in the

462 administration of glucan as immunostimulant to Indian white shrimp Fenneropenaeus indicus.

463 Aquaculture 287, 248-252.

464 [11]P. Schmitt, R.D. Rosa, M. Duperthuy, J. de Lorgeril, E. Bachère, D. Destoumieus-Garzón, 2012.

465 The antimicrobial defense of the Pacific oyster, Crassostrea gigas. How diversity may

466 compensate for scarcity in the regulation of resident/pathogenic microfora. Frontiers in

467 Microbiology 160, 1-17.

468 [12]B. Allam, D. Raftos, 2015. Immune responses to infectious diseases in bivalves. Journal of

469 Invertebrate Pathology 131, 121-136.

470 [13]M. Prado-Alvarez, S.A. Lynch, A. Kane, G. Darmody, B.G. Pardo, P. Martínez, J. Cotterill, T.

471 Wontner-Smith, S.C. Culloty, 2015. Oral immunostimulation of the oyster Ostrea edulis:

472 Impacts on the parasite Bonamia ostreae. Fish & Shellfish Immunology 45, 43-51.

473 [14]K.G. Takahashi, N. Izumi-Nakajima, K. Mori, 2017. Unique phagocytic properties of hemocytes

474 of Pacific oyster Crassostrea gigas against yeast and yeast cell-wall derivative. Fish & Shellfish

475 Immunology 70, 575-582.

476 [15]M. Álvarez-Rodríguez, P. Pereiro, F.E. Reyer-López, L. Tort, A. Figuera, B. Novoa, 2018. Analysis

477 of the long-lived responses induced by immunostimulants and their effects on a viral infection

o f
478 in zebrafish (Danio rerio). Frontiers in Immunology 9, 1575.

ro
479 [16]B. Han, K. Baruah, D.V. Nguyen, D.L. Williams, B. Devriendt, E. Cox, P. Bossier, 2020. Beta-

480
-p
glucan’s varying structure characteristics modulate survival and immune-related genes
re
481 expression from Vibrio harveyi-infected Artemia franciscana in gnotobiotic conditions. Fish &
lP

482 Shellfish Immunology 102, 307-315.

483 [17]X. Song, X. Xin, H. Wang, H. Li, H. Zhang, Z. Jia, C. Liu, S. Jiang, L. Wang, L. Song, 2019. A single-
na

484 CRD C-type lectin (CgCLec-3) with novel DIN motif exhibits versatile immune functions in
ur

485 Crassostrea gigas. Fish & Shellfish Immunology 92, 772-781.

Jo

486 [18]M. Gerdol, M. Gómez-Chiarri, M.G. Castillo, A. Figueras, G. Fiorito, R. Moreira, B. Novoa, A.

487 Pallavicini, G. Ponte, K. Roumbedakis, P. Venier, G.R. Vasta, 2018. Immunity in molluscs:

488 recognition and effector mechanisms, with a focus on Bivalvia. In: E.L.E. Cooper (Ed.),

489 Advances in Comparative Immunology. Springer International Publishing, Cham. Pp. 225-341.

490 [19]D.K. Meena, P. Das, S. Kumar, S.C. Mandal, A.K. Prusty, S.K. Singh, M.S. Akhar, B.K. Behera, K.

491 Kumar, A.K. Pal, S.C. Mukherjee, 2013. Beta-glucan: an ideal immunostimulant in

492 aquaculture (a review). Fish Physiology and Biochemistry 39, 431-457.

493 [20]L. Wang, H. Zhang, M. Wang, Z. Zhou, W. Wang, R. Liu, M. Huang, C. Yang, L. Qiu, L. Song,

494 2019. The transcriptomic expression of pattern recognition receptors: Insight into molecular

495 recognition of various invading pathogens in oyster Crassostrea gigas. Developmental and
496 Comparative Immunology 91, 1-7.

497 [21]N. Itoh, R. Kamitaka, K.G. Takahashi, M. Osada, 2010. Identification and characterization of

498 multiple β-glucan binding proteins in the Pacific oyster, Crassostrea gigas. Developmental and

499 Comparative Immunology 34, 445-454.

500 [22]A. Loor, P. Bossier, N. Nevejan, 2021. Dietary substitution of microalgae with the

501 Saccharomyces cerevisiae mutant, Δmnn9, for feeding Pacific oyster (Crassostrea gigas)

502 juveniles. Aquaculture 534, 736253.

503 [23]Y. Zhang, X. He, F. Yu, Z. Xiang, J. Li, K.L. Thorpe, Z. Yu, 2013. Characteristic and functional

o f
504 analysis of Toll-like Receptors (TLRs) in the lophotrocozoan, Crassostrea gigas, reveals ancient

ro
505 origin of TLR-mediated innate immunity. Plos One 8, e76464.

506
-p
[24]J. Ding, R. Wang, F. Yang, L. Zhao, Y. Qin, G. Zhang, X. Yan, 2014. Identification and
re
507 characterization of a novel phage-type like lysozyme from Manila clam, Ruditapes
lP

508 philippinarum. Developmental and Comparative Immunology 47, 81-89.

509 [25]L. Xin, H. Zhang, R. Zhang, H. Li, W. Wang, L. Wang, H. Wang, L. Qiu, L. Song, 2015. CgIL17-5,
na

510 an ancient inflammatory cytokine in Crassostrea gigas exhibiting the heterogeneity functions
ur

511 compared with vertebrate interkeukin 17 molecules. Developmental and Comparative

Jo

512 Immunology 53, 339-348.

513 [26]T. Lin, J. Xing, J. Jiang, X. Tang, W. Zhan, 2011. β-glucan-stimulated activation of six enzymes

514 in the haemocytes of the scallop Chlamys farreri at different water temperatures. Aquaculture

515 315, 213-221.

516 [27]F.M. Klis, P. Mol, K. Hellingwerf, S. Brul, 2002. Dynamics of cell wall structure in Saccharomyces

517 cerevisiae. FEMS Microbiology Reviews 26, 239-256.

518 [28]E. Dague, R. Bitar, H. Ranchon, F. Durand, H.M. Iken, J.M. Francois, 2010. An atomic force

519 microscopy analysis of yeast mutants defective in cell wall architecture. Yeast 27, 673-684.

520 [29]M.S. Graus, M.J. Wester, D.W. Lowman, D.L. Williams, M.D. Kruppa, C.M. Martinez, J.M.

521 Young, H.C. Pappas, K.A. Lidke, A.K. Neumann, 2018. Mannan molecular substructures control
522 nanoscale glucan exposure in Candida. Cell Reports 24, 2432-2442.

523 [30]B. Yadav, H.M. Mora-Montes, J. Wagener, I. Cunningham, L. West, K. Haynes, A.J.P. Brown,

524 N.A.R. Gow, 2020. Differences in fungal immune recognition by monocytes and macrophages:

525 N-mannan can be a shield or activator of immune recognition. The Cell Surface 6, 100042.

526 [31]Y. Sakai, M. Azuma, M., Takada, Y., Umeyama, T., Kaneko, A., Fujita, T., Igarashi, K., Ooshima,

527 H., 2007. Saccharomyces cerevisiae mutant displaying β-glucans on cell surface. Journal of

528 Bioscience and Bioengineering 103, 161-166.

529 [32]R.A. Hall, S. Bates, M.D. Lenardon, D.M. MacCallum, J. Wagener, D.W. Lowman, M.D. Kruppa,

o f
530 D.L. Williams, F.C. Odds, A.J.P. Brown, N.A.R. Gow, 2013. The Mnn2 mannosyltransferase

ro
531 family modulates mannoprotein fibril length, immune recognition and virulence of Candida

532 albicans. PLOS pathogens 9 (4), e1003276.

-p
re
533 [33]J.M. Bain, J. Louw, L.E. Lewis, B. Okai, C.A. Walls, E.R. Ballou, L.A. Walker, D. Reid, C.A. Munro,
lP

534 A.J.P. Brown, G.D. Brown, N.A.R. Gow, L.P. Erwig, 2014. Candida albicans hypha formation and

535 mannan masking of β-glucan inhibit macrophage phagosome maturation. mBio 5(6):e01874-
na

536 14.
ur

537 [34]M. Molon, O. Woznicka, J. Zebrowski, 2018. Cell wall biosynthesis impairment affects the
Jo

538 budding lifespan of the Saccharomyces cerevisiae yeast. Biogerontology 19, 67-79.

539 [35]M. Sami, M. Ikeda, S. Yabuuchi, 1994. Evaluation of the alkaline methylene blue staining

540 method for yeast activity determination. Journal of Fermentation and Bioengineering 78, 212-

541 216.

542 [36]A. Bonara, D. Mares, 1982. A simple colorimetric method for detecting cell viability in cultures

543 of eukaryotic microorganisms. Current Microbiology 7, 217-222.

544 [37]A. Kesarcodi-Watson, H. Kaspar, M.J. Lategan, L. Gibson, 2009. Two pathogens of GreenshellTM

545 mussel larvae, Perna canaliculus: Vibrio splendidus and a V. coralliilyticus/neptunius-like

546 isolate. Journal of Fish Diseases 32, 499-507.

547 [38]X. Song, H. Wang, L. Xin, J. Xu, Z. Jia, L. Wang, L. Song, 2016. The immunological capacity in
548 the larvae of Pacific oyster Crassostrea gigas. Fish and Shellfish Immunology 49, 461-469.

549 [39]D. Wang, A. Loor, L. De Bels, G. Van Stappen, W. Van den Broeck, N. Nevejan, 2021. Dynamic

550 immune response to vibriosis in Pacific oyster Crassostrea gigas larvae during the infection

551 process as supported by accurate positioning of GFP-tagged Vibrio strains. Microorganisms 9,

552 1523.

553 [40]Y. Du, L. Zhang, F. Xu, B. Huang, G. Zhang, L. Li, 2013. Validation of housekeeping genes as

554 internal controls for studying gene expression during Pacific oyster (Crassostrea gigas)

555 development by quantitative real-time PCR. Fish & Shellfish Immunology 34, 939-945.

o f
556 [41]K.J. Livak, T.D. Schmittgen, 2001. Analysis of relative gene expressing data using realtime

ro
557 quantitative PCR and the 2−∆∆Ct method. Methods 25, 402−408.

558
-p
[42]S.N. Smith, R.A. Armstrong, R.A. Bird, R. Chohan, N.A. Hartell, D.A. Poyner, 2001.
re
559 Characterization of FITC-conjugated lectin binding to Candida albicans. Mycologia 93, 422-
lP

560 431.

561 [43]H. Li, H. Zhang, S. Jiang, W. Wang, L. Xin, H. Wang, L. Wang, L. Song, 2015. A single-CRD C-type
na

562 lectin from oyster Crassostrea gigas mediates immune recognition and pathogen elimination
ur

563 with a potential role in the activation of complement system. Fish and Shellfish Immunology
Jo

564 44, 566-575.

565 [44]Y. Zong, Z. Liu, Z. Wu, Z. Han, L. Wang, L. Song, 2019. A novel globular C1q domain containing

566 protein (C1qDC-7) from Crassostrea gigas acts as pattern recognition receptor with broad

567 recognition spectrum. Fish & Shellfish Immunology 84, 920-926.

568 [45]A. Striebeck, D.A. Robinson, A.W. Schütterlkopf, D.M.F. van Aalten, 2013. Yeast Mnn9 is both

569 a priming glycosyltransferase and an allosteric activator of mannan biosynthesis. Open Biology

570 3, 130022.

571 [46]A. Silsirivanit, 2019. Glycosylation markers in cancer. Advances in Clinical Chemistry 89, 189-

572 213.

573 [47]J. Wendland, Y. Schaub, A. Walther, 2009. N-Acetylglucosamine utilization by Saccharomyces

574 cerevisiae based on expression of Candida albicans NAG genes. Applied and Environmental

575 Microbiology 75, 5840-5845.

576 [48]B. Allam, E. Pales Espinosa, 2016. Bivalve immunity and response to infections: Are we looking

577 at the right place? Fish & Shellfish Immunology 53, 4-12.

578 [49]Y-T. Lau, L. Sussman, E. Pales Espinosa, S. Katalay, B. Allam, 2017. Characterization of

579 hemocytes from different body fluids of the eastern oyster Crassostrea virginica. Fish &

580 Shellfish Immunology 71, 372-279.

581 [50]S.S. Jayaraj, R. Thiagarajan, M. Arumugam, P. Mullainadhan, 2008. Isolation, purification and

o f
582 characterization of β-1,3-glucan binding protein from the plasma of marine mussel Perna

ro
583 viridis. Fish & Shellfish Immunology 24, 715-725.

584
-p
[51]X. Tang, B. Huang, L. Zhang, L. Li, G. Zhang, 2017. Molecular characterization of Pacific oyster
re
585 (Crassostrea gigas) IRAK4 gene and its role in MyD88-dependent pathway. Developmental
lP

586 and Comparative Immunology 72, 21-29.

587 [52]M. Huang, L. Wang, J. Yang, H. Zhang, L. Wang, L. Song, 2013. A four-CRD C-type lectin from
na

588 Chlamys farreri mediating nonself-recognition with broader spectrum and opsonization.
ur

589 Developmental and Comparative Immunology 39, 363-369.

Jo

590 [53]L. Zhang, L. Li, G. Zhang, 2011. A Crassostrea gigas Toll-like receptor and comparative analysis

591 of TLR pathway in invertebrates. Fish & Shellfish Immunology 30, 653-660.

592 [54]M. Toubiana, M. Gerdol, U. Rosani, A. Pallavicini, P. Venier, P. Roch, 2013. Toll-like receptors

593 and MyD88 adaptors in Mytilus: Complete cds and gene expression levels. Developmental and

594 Comparative Immunology 40, 158-166.

595 [55]C-L. Yao, C-G. Wu, J-H. Xiang, F. Li, Z-Y. Wang, X. Han, 2008. The lysosome and lysozyme

596 response in Chinese shrimp Fenneropenaeus chinensis to Vibrio anguillarum and laminarin

597 stimulation. Journal of Experimental Marine Biology and Ecology 363, 124-129.

598 [56]C. Bowler, M.V. Montagu, D. Inze, 1992. Superoxide dismutase and stress tolerance. Annual

599 Review of Plant Physiology and Plant Molecular Biology 43, 83-116.
600 [57]S-P. Yang, Z-H. Wu, J-C. Jian, X-Z. Zhang, 2010. Effect of marine red yeast Rhodosporidium

601 paludigenum on growth and antioxidant competence of Litopenaeus vannamei. Aquaculture

602 309, 62-65.

603 [58]J. Li, Y. Zhang, Y. Zhang, Z. Xiang, Y. Tong, F. Qu, Z. Yu, 2014. Genomic characterization and

604 expression analysis of five novel IL-17 genes in the Pacific oyster, Crassostrea gigas. Fish &

605 Shellfish Immunology 40, 455-465.

606 [59]T.P. Sajeevan, R. Philip, I.S. Bright Singh, 2006. Immunostimulatory effect of a marine yeast

607 Candida sake S165 in Fenneropenaeus indicus. Aquaculture 257, 150-155.

o f
608 [60]J.F.A. Kock, C.A.F. de Oliveira, F.S. Zanuzzo, 2021. Dietary β-glucan (MacroGard®) improves

ro
609 innate immune responses and disease resistance in Nile tilapia regardless of the

610
-p
administration period. Fish & Shellfish Immunology 112, 56-63.
re
611
lP

612
na

613
ur

614
Jo

615

616

617

618

619

620

621

622
623

624

625

626 Table 1

627 Specific primers used in the trials for qRT-PCR of Crassostrea gigas.

Gene Gene code Category 3’-5’ Size Reference

(bp)

f
β-GBP CgβGBP immune recognition GACCACCATTCCTTCAACGAA 62 [21]

o
ro
CATATTCCGCGGACATCC

TLR-4 CgTLR4 immune recognition -p CGGTGAGTTATGCCTTGTCG

CGAAGCCATCGTAGAGGAAGT
146 [23]
re
C-type lectin CgCLec-3 immune recognition GGTTGCTGGTGGGAAAGCATTGTAT 113 [17]
lP

TGTCGGGAGAGGTCGTTGGTGAAG
na

MyD88 CgMyD88 immune signaling pathways TGGGGAACGAGACCAGAAC 143 [23]

TCTTTGTGGCATTGCTTAT
ur

Rel/NF-κB CgNFκB immune signaling pathways GAAGGCAAAGGGAGGTGATGAG 171 [38]

Jo

GGTGTGCGGAAGACAATGGC

Lysozyme CgLys immune effector TCGTTATTCTGACGACCGTGT 103 XM011434423.3

CAACCAATGGGTCTGCATCC

IL17-5 CgIL17-5 immune effector CGTCCTTGCCTTACTGACTAGA 176 [25]

TGTCGTTGTCCTCTACCATGAT

Superoxide dismutase CgSOD antioxidant enzyme TGAAGGCCGTCTGTGTATTG 128 [39]

TCCATGCTGTCCTGGTGTTA

Ribosomal protein S18 CgRS18 Internal control GCCATCAAGGGTATCGGTAGAC 168 [40]

CTGCCTGTTAAGGAACCAGTCAG

Ribosomal protein L7 CgRL7 Internal control TCCCAAGCCAAGGAAGGTTATGC 242 [40]

 CAAAGCGTCCAAGGTGTTTCTCAA

628

629

630

631 Figure captions

632 Fig. 1. Left: representative flow cytometry contour plots showing the cell size distribution by

633 examining forward and side-scatter areas (FSC-A/SSC-A) of wild-type Saccharomyces cerevisiae strain

f
634 (WT) and the Δmnn9 isogenic mutant. Right: light microscopy images of WT (up) and Δmnn9 (down)

o
ro
635 cells. Scale bar, 20 µm.

636 -p
re
637 Fig. 2. Representative histogram of FITC-conjugated lectins binding the wild-type Saccharomyces
lP

638 cerevisiae strain (WT), the Δmnn9 isogenic mutant, and β-glucan particles analyzed by flow cytometry.

639 Based on carbohydrate specificity, nine different lectins (ConA, GSL II, WGA, LEL, STL, UEA I, PNA, SBA,
na

640 VVA) were used to bind to exposed carbohydrates on yeast cell wall surfaces and β-glucan particles.
ur

641 A blank sample (without lectin) was included as reference. Numbers in the histograms indicate the
Jo

642 percentage of events contained in between both dashed lines (blanks were set as 1% for reference).

643

644 Fig. 3. Trial 1: survival of Crassostrea gigas juveniles over a 7-day challenge with Vibrio coralliilyticus.

645 Oysters were fed on microalgal diet (100A), and its 50% replacement with either Δmnn9 (50A50Y), or

646 the wild-type yeast (50A50WT) for 24h prior to the bacterial inoculation. Data are expressed as mean

647 ± SE (n = 4). Different letters next to the treatment names indicate significant differences in overall

648 survival between bacterial infected groups; while differences between 50A50Y and 50A50WT, or

649 between 50A50Y and 100A, per time point, are represented by asterisks (*) and hash sign (#),

650 respectively (p < 0.05, two-way repeated measures ANOVA).

651
652 Fig. 4. Trial 1 - Pre-challenge. Effect of diets on the relative expression of immune-related genes in

653 Crassostrea gigas spat after 24h feeding (prior to bacterial challenge). The diets consist of a microalgal

654 diet (100A), and its 50% replacement with either Δmnn9 (50A50Y) or the wild-type yeast (50A50WT).

655 Data represents means ± SE (n = 4). Bars with different superscript letters are significantly different at

656 p < 0.05.

657

658 Fig. 5. Trial 1, 24-h post-bacterial inoculation. Effect of diets on the relative expression of immune-

659 related genes in Crassostrea gigas spat at 24h post Vibrio coralliilyticus challenge. The diets consist of

o f
660 a microalgal diet (100A), and its 50% replacement with either Δmnn9 (50A50Y) or the wild-type yeast

ro
661 (50A50WT). Data represents means ± SE (n = 4). Bars with different superscript letters are significantly

662 different at p < 0.05.

-p
re
663
lP

664 Fig. 6. Trial 2. Faeces released by oysters fed on 50A50Y (A) and 75A25Y (B) stained with methylene
na

665 blue to discriminate living/viable (unstained) and dead/unviable (blue) Δmnn9 Saccharomyces
ur

666 cerevisiae cells. Scale bar, 20 µm. (C) Survival curves of Crassostrea gigas juveniles infected with Vibrio
Jo

667 coralliilyticus or left unchallenged (negative controls). Before the challenge, the juveniles were fed

668 different diets for 24h: the algae-based diet (100A) and its substitution with Δmnn9 at four levels, 5%

669 (95A5Y), 10% (90A10Y), 25% (75A25Y) and 50% (50A50Y). Data are expressed as mean ± SE (n = 4).

670 Different letters next to the treatment names indicate significant differences in overall survival

671 between bacterial infected groups. Significant differences between 50A50Y and 90A10Y, 95A5Y and

672 100A per time point are indicated by asterisks (*), while differences between 50A50A and 75A25Y are

673 indicated by hash sign (#) (p < 0.05, two-way repeated measures ANOVA).

674

675 Fig. 7. Trial 2, pre-bacterial challenge. Effect of Δmnn9-containing diets on the relative expression of

676 immune-related genes in Crassostrea gigas spat after 24h feeding but prior to bacterial challenge. The
677 diets consist of the microalgal diet (100A), and the its substitution with Δmnn9 (Y) at different levels,

678 5% (95A5Y), 10% (90A10Y), 25% (75A25Y) and 50% (50A50Y). Data represents means ± SE (n = 4). Bars

679 with different superscript letters are significantly different at p < 0.05.

680

681 Fig. 8. Trial 2, 24-h post-bacterial challenge. Effect of Δmnn9-containing diets on the relative

682 expression of immune-related genes in Crassostrea gigas spat at 24h post Vibrio coralliilyticus

683 challenge. The diets consist of the microalgal diet (100A), and the its substitution with Δmnn9 (Y) at

684 different levels, 5% (95A5Y), 10% (90A10Y), 25% (75A25Y) and 50% (50A50Y). Data represent means

o f
685 ± SE (n = 4). Bars with different superscript letters are significantly different at p < 0.05.

ro
686

687
-p
re
lP

688

689
na

690
ur

691
Jo

692
 WT

10 6
Δmnn9

10 5

10 4
SSC-A

of
10 3 10 4 10 5
FSC-A

ro
-p
re
lP
na
ur
Jo
  Δ    β
   

  
   

   


  

   

  


  
            ­ 

  


   


of
ro
      

-p
  

re
€‚ 
lP

    

          

na

ƒ ƒ     
ur

0 103 104 105 106 107

Jo

  

 
*
* #
 * #
* *
        




 
 

  
  
       
     
  
         
     
 
           
     

       
         
    

of
ro
-p
re
lP
na
ur
Jo
   β           
    
      

 
    
  

      
    
      
    

      
    

      
    
  
   
    
   
      
         
     
   
   
   
     
       
               

  ­ € κ     
  ‚  ƒ     „…  
 

 
       
      
    

      
    

      
    
      
    

    

   
    

     
    
    
   
   
   
   
   
   
 

of
     
               

ro
-p
re
lP
na
ur
Jo
   β      
       
       
     
     
   
        

   
        

   
        

   
        
 
    
     
   
     
    
     
 
     
   
     
 
       
       
               

    ­ κ      €  ‚   ƒ„ 
        
      
 

   
        
   
   
        

   
        

   
        
  
     
   
   
     
    
     
 
     
 
 
       

of
       
               

ro
-p
re
lP
na
ur
Jo
A B C

 

  
 

     
 
 
 #
 
        

*
 * #
* * *



       
 
       
   

of
ro
-p
re
lP
na
ur
Jo
     
           
      

 
 
 

 
 
 
 
 
 
 
 
 
 

 
 

 
 



 
 
 


 

  β 

  € ‚ κ
 
 


 


 
 




 
 
 




 

    
           
      
 
 
 
 
 
 
 

 
 
 
 

 
 
 
 
 

 
 



Jo
 
 
   


 
 

 
 


 

ur
 
 


 


 
 
na


 


lP
    
           
      
 
 
 
 
 
 

 
 
 
 

 
 
 
 
 
 

re  


 
 
 


 
-p
 
  ƒ   

 
      

 
 
ro
 



 
 
 



 
of
    
           
      
 
 
 
 
 
 

 
 
 
 
 
 

 



 
 
 


 


 „… ­

 
 
   ­ 

 


 
 


 


 
 



 
        

         

 

 
 
 
 
 
 
 
 
 
 

 
 
 
 
 
 
 
 
 
  


 







  β  



  ­ € κ
 







   
 






 
 







       

         

 
 
 
 
 
 
 
 
 
 
 
 

 
 
 
 
 
 
 
 





Jo
 
 





  

 

 
 





ur
   
 





 
na
 




lP 

       

         

 
 
 
 
 
 
 
 

 
 
 
 
 
 
 
 
 
 
 

re
 


 
 







-p

 
      

  ‚    

 


 
 
ro   





 
 






 
of
       

         

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 






 





 
 ƒ„ 

 
 

 
 

 
   
 



 
 
 



 
Highlights:

• Outermost layer of Saccharomyces cerevisiae Δmnn9 has elevated β-glucan and chitin exposure
• Δmnn9 cells support Lysozyme, SOD, MyD88, and β-GBP expressions in Crassostrea gigas
• Immune response is associated with higher β-glucan-hemocyte interaction in the digestive tract
• Δmnn9-fed C. gigas exhibited higher resistance against Vibrio coralliilyticus infection
• Δmnn9 supplied at 50% of diet promotes higher survival in oysters than those fed lower levels

f
r oo
-p
re
lP
na
ur
Jo