Chapter 5

Print ISBN: 978-93-5547-521-3, eBook ISBN: 978-93-5547-522-0

Analysis of the Optimum Productivity and Genetic

Diversity of Garlic Selections with White and
Colored Skin in Egyptian, Eggaseed-1 and Sids- 40
Varieties
Haitham E. M. Zaki a,b*
DOI: 10.9734/bpi/ctas/v7/15737D

ABSTRACT

The primary goal of this research is to look into the performance and productivity, as well as the
genetic diversity, of 18 garlic selections in 3 garlic genotypes (i.e., Eggaseed-1 cv., Sids- 40 cv. and
Egyptian cv.) commonly found in the Egyptian market. In both seasons of the study, varieties with
fewer cloves produced greater yields. Eggaseed-1 cv. and Sids-40 cv. produced between 9.7-11.9
ton/fed, while Egyptian cv. produced between 8.8-9.1 ton/fed (fresh yield). The genetic diversity of
garlic varieties was demonstrated using simple sequence repeat markers (SSR), which were
integrated with a post-labeling technique. For genetic characterization, 18 garlic selections and SSR
markers with high polymorphism richness were studied. Ten markers amplified a total of 61 DNA
fragments, with each marker amplifying an average of 6.1 fragments. With SSR data, genetic
distances were calculated using the garlic selections, and the associations between selections were
clearly illustrated using a dendrogram cluster analysis. The garlic varieties ' genetic similarity ratings
ranged from 65.77 to 91.54 %. Eggaseed-1 and Sids-40 selections had the most genetic similarity
(91.54 %), whereas Egyptian and Eggaseed-1 selections had the largest genetic dissimilarity. These
findings enable the identification of two garlic-colored garlic selections in Eggaseed-1 cv. and Sids-40
cv., as well as their distinction from Egyptian cv. selections, which is classified as white garlic variety.
Because garlic reproduces asexually, identifying the right genotype(s) is essential for obtaining high
quality; in the meantime, the results can aid in selection in the breeding program and for commercial
production.

Keywords: Alliaceae; garlic (Allium sativum L.); genetic diversity; simple sequence repeats (SSR);
post-labeling.

1. INTRODUCTION

Garlic (Allium sativum L.) belongs to the family of Alliaceae, which includes over 600 species in the
genus Allium [1]. Garlic was grown and eaten in Egypt during the construction of the pyramids
between 2780 and 2100BC [2]. Apomictic diploid (2n=2x=16), sterile, and clonally generated garlic
varieties are available for purchase. Despite the discovery of male fertility in wild garlic and the
availability of genetic linkage maps from the S1 (family of plants formed by self-pollination) [3,4], the
selection of spontaneous or induced mutations continues to be a significant challenge in garlic
breeding. Generally, breeding programs rely on genetic diversity and trait determination, which are
vital for the comprehensive classification of accessions within germplasm collections.

Garlic has a wide range of morphotypes, including flowering aptitude, leaf characteristics, bulb
qualities, bulbing response to environment, and plant maturity [5]. The majority of Egypt's commonly

_____________________________________________________________________________________________________
a
Horticulture Department, Faculty of Agriculture, Minia University, El-Minia 61517, Egypt.
b
Applied Biotechnology Department, University of Technology and Applied Sciences-Sur, 411, Sur, Sultanate of Oman.
*Corresponding author: E-mail: haitham.zaki@mu.edu.eg;
 Current Topics in Agricultural Sciences Vol. 7
Analysis of the Optimum Productivity and Genetic Diversity of Garlic Selections with White and Colored Skin in Egyptian,
Eggaseed-1 and Sids- 40 Varieties

grown varieties were introduced from China, while other genotypes were selected via agricultural
output. This explains why cloves and bulbs exhibit such a wide range of phenotypic manifestations in
terms of number, weight, color, and size [6]. Meanwhile, several studies have been conducted at
Egypt's Faculty of Agriculture, Minia University, to examine the relationship between these varieties.
Osman et al. [7] investigated the cytological characteristics of 14 garlic genotypes, which included
Eggaseed-1, Sids-40, Eggaseed-2, Egyptian, and other ten clonal selections. Cytogenetic results
reported that all current number and alteration of homologous chromosome pairs were incredibly hard
for a variety of reasons, including: 1) a significant proportion of sizable fragments; 2) difficulties
defining the centromere position; and 3) wide differences in satellite number and size among
genotypes. Gad El-Hak et al. [8] on the other hand, aimed to identify the optimum selection strategy.
Therefore, two selection procedures were applied; in the first population, a full bulb was used, while in
the second, a single clove was used. Plants in both groups were markedly different from one another.
The means, range, variances, standard deviation, and coefficients of variability in bulb and neck
diameter and fresh weight indicated a wide range in both the original and chosen populations. Abdel-
Ghany [9] screened numerous garlic cultivars for physical features using random amplified
polymorphic DNA (RAPD). In the cluster analysis, morphological and RAPD markers were employed
to generate contrast outcomes. As a result, it was necessary to examine the relationship between
garlic varieties and improved selection procedures.

Earlier, DNA-based molecular markers were employed in crop genetic diversity studies and
phylogenetic analysis [10,11]. Simple sequence repeat (SSR) markers or microsatellites are the
marker of choice for a wide spectrum of genetic studies due to their significant polymorphism, genome
frequency, and simplicity of usage in the experiment [12,13]. Several DNA markers, including (SSR),
were developed and used in a variety of genotyping investigations utilizing a fluorescent capillary DNA
sequencer [14]. Post-PCR labeling using fluorescently labeled short oligonucleotides and nested PCR
of the amplified product obtained from unlabeled primer pairs is a simple and cost-effective method.
Post-PCR labeling was found to be successful for SSR marker genotyping, having modest
adjustments to the PCR procedure used for prelabeled primers [15]. Therefore, 18 selections of the 3
most common garlic varieties in Egypt were chosen and evaluated for optimum productivity and
genetic diversity using SSR markers and post-labeling techniques in order to find an appropriate and
reliable way to differentiate among garlic genotypes, which is critical for selection in the breeding
program.

2. MATERIALS AND METHODS

2.1 Genetic Materials

Local Egyptian, Eggaseed-1, and Sids-40 garlic varieties were employed in this investigation (Fig.1).
The three varieties were identified as the most widely used commercial garlic varieties in Egypt.
Egyptian cv. is a landrace which was obtained from the Department of Horticulture, Faculty of
Agriculture, Minia University, El-Minia, Egypt. Egyptian cv. seems to be a local variety grown in Egypt
for its intense aroma, ripe cloves with white covering scale, and relatively long storability (Fig.1A).
Eggaseed-1 cv., which produced by Metwally and El-Denary in 2003, was obtained from the Egyptian
Agriculture Company (EGAS). This variety provides large cloves with colorful skin and ripe cloves
(Fig.1B). Sids-40 cv. was obtained from Sids Research Station of the Agriculture Research Center
(ARC) in Giza, Egypt. The variety's primary source is China, and it boasts huge cloves that are easy
to peel, as well as mature cloves have white skin and purple vertical stripes (Fig.1C).

2.2 Field Experiment

Garlic varieties were planted in the field during two consecutive winter seasons, at the farm of the
Department of Horticulture, Faculty of Agriculture, Minia University, El-Minia, Egypt, to examine the
vegetative development, plant production, and components of each variety. The experimental field's
soil type was clay loam. The approach described by Page et al. was used for soil chemical analysis
[16]. The pH, organic matter %, and available inorganic N, P, and K values were 8.12, 1.09 %, 45.13,
11.25, and 81.15 ppm, respectively.

83
 Current Topics in Agricultural Sciences Vol. 7
Analysis of the Optimum Productivity and Genetic Diversity of Garlic Selections with White and Colored Skin in Egyptian,
Eggaseed-1 and Sids- 40 Varieties

(A)

(B)

(C)

Fig. 1. Bulb characteristic of three common garlic varieties in the Egyptian market, Egyptian
cv., a white-skin variety (A), Eggaseed-1 cv., color-skin variety (B) and Sids-40 cv., a white-skin
variety (C)

For the two seasons of field experiment, consistent and healthy cloves of various types were sown in
the season time. In a basic experiment, three replicates of each variety were used. Each experimental
unit (sub-plot) measured 3 x 3.5 m. Prior to sowing, garlic bulbs were divided into individual cloves.
Cloves of all varieties were planted upright at 10 cm intervals, with the apical tip exposed. After direct
planting and before watering, weeds were controlled using a pre-emergence herbicide. All other
agricultural methods were carried out in line with Egyptian Ministry of Agriculture instructions for
commercial garlic production in 2010. The plants in each plot were harvested when the elder leaves
became yellowish green and began to wither. For curing, the bulbs were dispersed in thin layers at
typical temperature settings (during a 21-day period).

2.3 Growth Characteristics, Yield and Yield Components

Plant height, number of leaves, fresh weight of whole plant, bulb fresh weight, bulb dry weight (dried
at 70ºc), number of cloves/bulb, single clove weight, and fresh total yield were all determined at the
harvesting period. The bulbing ratio (neck diameter/bulb diameter) was calculated as described by
Mann [17]. On the other hand, the cured bulb diameter, cured bulb weight, and total cured yield of
bulbs were evaluated 21-day after harvesting.

84
 Current Topics in Agricultural Sciences Vol. 7
Analysis of the Optimum Productivity and Genetic Diversity of Garlic Selections with White and Colored Skin in Egyptian,
Eggaseed-1 and Sids- 40 Varieties

2.4 Statistical Analysis

The MSTATC software version 4 was used to evaluate data gathered over the two study seasons
(1996). The Duncan mean separation test was used at the 0.05 level to compare the means of the
collected data [18].

2.5 Lab Experiment

DNA extraction and selections analysis using SSR with post-labeling technique: The plant
materials used in the genetic diversity study consisted of 18 garlic individual plants selected from 3
varieties: Egyptian, Egaseed-1, and Sids-40. The GenElute TM Plant Genomic DNA Miniprep kit
(Sigma, Saint Louis, USA) was used to extract total DNA from young leaves of greenhouse-grown
selections, according to the manufacturer's recommendations. To evaluate the relative purity and
concentration of extracted DNA, the NanoDrop ND-1000 was utilized. The final DNA concentration
was adjusted at 20 ng/L.

For polymorphism analysis, SSR markers were used, and a total of 20 SSR marker pairs were
successfully amplified [19]. As previously indicated, a post-labeling technique for multicolored SSR
genotyping analysis was used [15]. Each primer's name, sequence, annealing temperature, and
labeling tags are listed in Table 1. To amplify the microsatellite loci, a 20 µl reaction mixture including
20 ng of genomic DNA, 1 µl of each primer (10 mM), 2 µl of dNTPs (10 mM), 1 µl of 10 x reaction
buffer (Takara, Japan), and 1 unit of Taq polymerase was used (Takara, Japan). The polymorphism of
the markers was examined using the thermal cycling program described by Ma et al. [12] which
included an initial denaturing step at 94°C for 3 min, followed by 30 cycles at 94°C for 30 s, at the
specific annealing temperature of each pair of primers (Table 1) for 45 s, and at 72°C for 1 min; 10
cycles at 94° C for 30 s, at 2°C below the specific annealing temperature of each pair of primer.

SSR markers polymorphism and cluster analysis: To confirm the amplification data, a fluorescent
capillary DNA sequencer with fragment analysis was employed. For each fragment-selection
combination, fragment data was entered into a spreadsheet to generate a binary matrix, with (1)
representing fragment presence and (0) representing fragment absence. The cluster analysis was
performed by converting the data matrix into a similarity matrix using a simple matching coefficient. As
reported by Nei and Li, [20] this coefficient was calculated by dividing the total number of comparisons
by the number of matches (0-0 and 1-1). After that, the S-Professional Plus 2000 application was
utilized to do a cluster analysis using the unweighted pair group approach with arithmetic average
(UPGMA).

3. RESULTS AND DISCUSSION

3.1 Field Experiment
Morphological investigations indicated that the 3 garlic varieties differed considerably in terms of plant
height, plant fresh weight, bulb fresh weight, and bulb dry weight % over both seasons (Fig. 2).
Egyptian cv. had the longest plants, followed by Eggaseed-1 cv. and Sids-40 cv. (Fig. 2A), despite
having the biggest fresh weight of whole plant, bulb fresh weight, and bulb dry weight %.
Simultaneously, Eggaseed-1 cv. plants produced the highest values for these qualities, as shown in
Figs. 2B, C, and D. This study supported the conclusions of Al-Otayk et al. [21] who reported that the
Egyptian cv. had the lowest bulb fresh weight among the Elephant and Chinese varieties and clones
studied. These consequences can be expected based on the genetic background of each variety and
the diversity among genotypes. These findings agree with those published by Omer and Abou-Hadid
[22] and Zaki and Abdelrasheed [6]. Eggaseed-1 cv. and Sids-40 cv., on the other hand, produced far
more leaves than the Egyptian cv. However, no significant differences in this trait were observed
between Eggaseed-1 cv. and Sids-40 cv. The statistical study revealed no statistically significant
differences between the two seasons analyzed (Fig. 2E).
Temperature rise, day length, and solar reaction all vary seasonally. As a consequence, certain
attributes remain constant while others may change [23]. There were significant differences in bulbing

85
 Current Topics in Agricultural Sciences Vol. 7
Analysis of the Optimum Productivity and Genetic Diversity of Garlic Selections with White and Colored Skin in Egyptian,
Eggaseed-1 and Sids- 40 Varieties

ratio between Eggaseed-1 cv., Sids-40 cv., and Egyptian cv. in the first season, but not in the second
season (Fig. 2F). Egyptian cv. had a lower bulbing ratio than Sids-40 cv. and Eggaseed-1 cv. in
general. According to the data, the Egyptian variety required more time for bulb development than the
other varieties. The bulbing ratio in garlic is influenced by photoperiod, temperature, and light [24].
One of the challenges of garlic growing for export, particularly in the Upper Egypt region, is attaining
maturity in such a short season. Garlic farmers and producers seek a speedy changeover from the
vegetative growth stage towards the bulbing stage at the right time to provide their plants enough time
to generate larger bulbs. In order to form bulbs, the genetic basis of the growing genotypes governs
nutrient redistribution.

The analysis of clove number per bulb, clove weight, fresh total yield, cured bulb diameter, cured bulb
weight, and cured yield indicated significant differences among the 3 garlic varieties in both seasons
(Fig.3). Plants with fewer bulb cloves had higher clove weight (Fig. 1 and Fig. 3A). Egyptian cv.
produced more cloves per bulb (40.937 cloves per bulb) than Eggaseed-1 and Sids-40 varieties. In
contrast to Egyptian cv., Eggaseed-1 cv. and Sids-40 cv. produced the highest mean value of clove
weight (Fig. 3B). Al-Otayk et al. [21] and Zaki et al. [25] observed similar results which showed that
Egyptian cv. yielded the most cloves, followed by Sids-40 cv. Total fresh yield differed significantly
between the 3 varieties (Fig. 3C). Egyptian cv. produced less fresh than both Eggaseed-1 cv. and
Sids-40 cv., ranging from 8.827 to 9.103 ton/fed. Eggaseed-1 cv. had the highest fresh yield, ranging
from 11.601 to 11.867 ton/fed. These observations are also congruent with those of Noorbakhshian et
al. [26] who examined several agricultural aspects associated with yield and its components for a
selection of garlic varieties and discovered that clove weight had the greatest effect on yield attributes.

Fig. 2. Plant height (A), fresh weight of whole plant (B), bulb fresh weight (C), bulb dry
weight % (D), number of leaves/plant (E) and bulbing ratio (F) of Egyptian cv., Eggaseed-1 cv.
and Sids-40 cv. during two seasons. Means within each season followed by the same letter are
not statistically significant at 0.05 level (Duncan`s range test)

86
 Current Topics in Agricultural Sciences Vol. 7
Analysis of the Optimum Productivity and Genetic Diversity of Garlic Selections with White and Colored Skin in Egyptian, Eggaseed-1 and Sids- 40 Varieties

o
Table 1. Forward and reverse sequences, labeling tags, annealing temperature (Ta C), and number of alleles of 10 SSR markers (size-bp) used. All
data are based on the screening of 18 individual garlic plants from 3 varieties: Egyptian cv. (a white-skin variety), Eggaseed-1 cv. (a
colored-skin variety) and Sids-40 cv. (a white-skin variety)
o
Loci Primer sequence Tag Ta ( C) No. of alleles (size-bp)
Egyptian cv. Eggaseed-1 cv. Sids-40 cv.
Asa07 F: CTCGGAACCAACCAGCATA 6-FAM 58 2(244, 253) 3(244, 246, 253) 2(246,253)
R: CCCAAACAAGGTAGGTCAGC
Asa08 F: TGATTGAAACGAATCCCACA NED 56 2(228, 230) 2(224,226) 2(222, 232)
R: GGGGGTTACCTGAACCTGTTA
Asa17 F: TCCACGACACACACACACAC PET 56 5(149,151,153,155,157) 1(145) 5(149,151,153,155,157)
R: ATGCAGAGAATTTGGCATCC
Asa18 F: TCAAGCTCCTCCAAGTGTCC VIC 45 3(210,216,221) 1(210) 3(210,216,221)
R: TCGGGATATGACAGCATTTG
Asa25 F: GCACTTCACTTTCCCCATTC 6-FAM 51 2(174,175) 2(174,175) 2(174,175)
R: GGCGACGGTGAAGAGAGAG
Asa31 F: CAGAGACTAGGGCGAATGG NED 50 2(157-160) 2(154,163) 12(146,148,150,152,154,155,
R: ATGATGATGACGACGACGAG 157, 159,160,162,163,164)
Asa10 F: TTGTTGTTCTGCCATTTT 6-FAM 48 1(244) 1(240) 2(238,248)
R: GATCTAAGCCGAGAGAAA
Asa14 F: TCTATCTCGCTTCTCAGGGG NED 48 2(235,236, 239) 2(222,240,244,247) 1(237)
R: GCTGACAGAAGTAGTCTTTCC
Asa16 F: CACGACTTTTCCTCCCATTT PET 48 2(175,178) 4(171,178,179,189) 2(178,189)
R: GCTAATGTTCATGTCCCCAGT
Asa24 F: TTGTTGTGCCGAGTTCCATA VIC 48 7(163, 164,168-172) 8(163,164, 169- 8(163,164,166,168,170-173)
R: CAGCAATTTACCAAAGCCAAG 172,176,177)

87
 Current Topics in Agricultural Sciences Vol. 7
Analysis of the Optimum Productivity and Genetic Diversity of Garlic Selections with White and Colored Skin in Egyptian,
Eggaseed-1 and Sids- 40 Varieties

Fig. 3. Clove number/plant (A), clove weight (B), total fresh yield (C), cured bulb weight (D),
cured bulb diameter (E) and cured yield (F) of Egyptian cv., Eggaseed-1 cv. and Sids-40 cv.
during two seasons. Means within each season followed by the same letter are not statistically
significant at 0.05 level (Duncan`s range test)

In terms of cured bulb weight, cured bulb diameter, and cured weight, Eggaseed-1 cv. surpassed
varieties Sids-40 cv. and Egyptian cv. in both seasons. The findings indicated that it is hard to identify
whether genetic and/or environmental variables have a role in the development behavior of garlic
varieties. These differences in subsequent traits across varieties might be attributed to genetic
dispersal, which resulted in modifications in garlic bulb tissues.

3.2 Lab Experiment

Genetic markers are useful tools for researching the genetics of populations and selections. The
molecular characterization of 18 individuals selected from 3 typical garlic varieties in the Egyptian
market: Egyptian cv., Eggaseed-1 cv., and Sids-40 cv., was undertaken using simple sequence
repeats (SSR) markers and the post-labeling approach. Twenty SSR primer pairs with distinct
polymorphic fingerprints were used to demonstrate genetic diversity across garlic selections (Table 1),
whereas polymorphism was identified in the 18 selections of the 3 garlic varieties, each having 6
selections. The polymorphism of the SSRs was evaluated through fragment analysis; the majority of
primers were polymorphic, with the exception of one monomorphic primer (Fig. 4). All of the primers
produced comparable bands. The 10 markers generated 61 DNA fragments in total, with an average
of 6.1 bands per primer. In all selections, it was possible to discern between 1 and 12 bands. The
primers used in this study ranged in size from 145-247 bp (Table 1). Reactions were duplicated to
check that the amplified products were consistent.

88
 Current Topics in Agricultural Sciences Vol. 7
Analysis of the Optimum Productivity and Genetic Diversity of Garlic Selections with White and Colored Skin in Egyptian,
Eggaseed-1 and Sids- 40 Varieties

The polymorphism was estimated to be 77.049 %, with 47 out of 61 fragments being polymorphic,
with 10 markers used among the 18 garlic selections, and the other 14 bands being monomorphic.
The SSR markers used in the present study purporting to show diversity in the 18 garlic selections.
Several of the primers were significant enough to distinguish all of the selections on their own; the
marker Asa31 had a high polymorphism content (PIC value) as presented in Table 1. In the examined
selections, Asa17 was determined to be monomorphic. The degree of polymorphism showed that any
two varieties might be identified using an appropriate SSR primer combination. As a result, it was
feasible to conclude that the current findings might be used to discover genetic diversity and the
relationship between members of complex varieties such as garlic. Cunha et al. [19] studied diversity
in 75 Allium sativum accessions using these 10 markers and identified a considerable amount of
heterozygosity.

Egyptian-24 Asa25

Eggaseed-1-9

Sids-40-19

(A)

Egyptian-24 Asa16

Eggaseed-1-9

Sids-40-19

(B)
Fig. 4. Electropherogram for SSR marker analysis with the post-labeling method for 18
selections of 3 garlic varieties; Egyptian cv., Eggaseed-1 cv. and Sids-40 cv.
Electropherograms of SSR marker Asa25 (A) and SSR marker Asa16 (B) as examples of
monomorphic and polymorphic markers obtained using a post-PCR labeling with 6-FAM and
PET, respectively

89
 Current Topics in Agricultural Sciences Vol. 7
Analysis of the Optimum Productivity and Genetic Diversity of Garlic Selections with White and Colored Skin in Egyptian,
Eggaseed-1 and Sids- 40 Varieties

The genetic distance for SSR data using 18 garlic selections was computed as reported by Nei [27]
and the diversity or relationship was graphically depicted as a dendrogram, as shown in Fig. 5. The
genetic similarity values of the garlic varieties ranged from 65.77 to 91.54 %. The selections within the
varieties differed with the least degree of dissimilarity. The Egyptian cv. and Eggaseed-1 cv.
selections had the largest dissimilarity, according to the data. The similarity scores were utilized to
create a dendrogram (Fig. 5), which revealed two groupings. The first group was created by Egyptian
cv. selections (Egyptian-16, 10, 24, 19, 5, and 8) that had a lower output (smaller clove weight and/or
greater quantity of cloves: Fig.3) and required more time for bulbing. The second set consisted of
colored garlic Eggaseed-1 selections (Eggaseed-1-3, 9, 22, 7, 14, and 13) and Sids-40 selections
(Sids-40-19, 22, 23, 8, 9 and 6) which was distinguished by greater bulb and clove weight, fewer
cloves per bulb, and a shorter period for bulb development. The data are compatible with those of
Garcia et al. [28]. The disadvantage of the most prolific cultivar is that it contains more cloves per bulb.
The SSRs utilized in this investigation using the post-labeling approach effectively grouped
Eggaseed-1 cv. and Sids-40 cv. selections, which produced greater yields than Egyptian cv.
Meanwhile, Eggaseed-1 cv. and Sids-40 cv. selections contained a 189 bp band with an Asa16
marker, indicating that it might be used as a selection marker in the breeding program [29].

Fig. 5. Dendrogram obtained by SSR markers with the post-labeling technique and general
description according to morphological and genetic diversity in garlic varieties grown in Egypt.
Eighteen garlic individual plants selected from 3 varieties; Egyptian cv. (Egyptian-16, 10, 24, 19,
5 and 8), Eggaseed-1 cv. (Eggaseed-1-3, 9, 22, 7, 14 and 13) and Sids-40 cv. (Sids-40-19, 22, 23,
8, 9 and 6) were used for analysis

90
 Current Topics in Agricultural Sciences Vol. 7
Analysis of the Optimum Productivity and Genetic Diversity of Garlic Selections with White and Colored Skin in Egyptian,
Eggaseed-1 and Sids- 40 Varieties

4. CONCLUSION

The examination of SSR fragment differences using the post-labeling methodology provides an
efficient tool for investigating variety, which will benefit in the development of plant breeding
approaches. Finding excellent SSRs is vital, but due to the number and complexity of the garlic
genome, this can be a time-consuming and challenging task. There is little information available on
the genetic diversity within and across garlic varieties, which has primarily been relied on morphology.
Meanwhile, analyzing genetic diversity with molecular markers and a post-labeling technique might
provide plant breeders with more precise information. This knowledge will be useful in the selection
process of garlic varieties. SSRs obtained with the post-labeling method described in this study might
be used for garlic genome mapping and gene tagging. These findings enable us to differentiate garlic
varieties with colored garlic, greater bulb and clove weight, and lower clove numbers/bulb (Eggaseed-
1 cv. and Sids-40 cv. selections) from Egyptian cv. selections, which has white garlic, lower production,
smaller clove weight, and/or a larger number of cloves.

COMPETING INTERESTS

Author has declared that no competing interests exist.

REFERENCES

1. Osman SAM, Ata AM, Gad El-Hak SH. Morphological, germination, bolting and cytogenetical
characteristics of fourteen promising garlic genotypes. Afri Crop Sci Confer Proceed.
2007;8:2005-2012.
2. Yamaguchi M. World vegetables (principles, production, and Nutritive value). AVI Publishing
Company Inc; Westport CT; 1983.
3. Ipek M, Ipek EA, Alquist ESG, Simon EPW. Demonstration of linkage and development of the
first low-density genetic map of garlic, based on AFLP markers. Theoretical and Applied
Genetics. 2005;110: 228 – 236.
4. Zewdie Y, Havey MJ, Prince JP, Jenderek MM. The first genetic linkages among expressed
regions of the garlic genome. Journal of the American Society for Horticultural Science.
2005;130:569 – 574.
5. Senula A, Keller RJ. Morphological characterization of garlic core collection and establishment
of a virus-free in vitro gene bank. Allium Improv. Newsletters. 2000;10:3-5.
6. Zaki HEM, Abdelrasheed KG. Correlation and tolerance of garlic genotypes under nutrient
stress conditions induced by organic farming. Agronomy Journal. 2021;113(5):4231-4251.
7. Osman SAM, Ata AM, Gadel-Hak SH. Morphological, germination, bolting and cytogenetical
characteristics of fourteen promising garlic genotypes. African Crop Science Conference
Proceedings. 2012;8:2005-2012.
8. Gadel-Hak SH, Moustafa YMM, Abdel-Wahab IA. Selection of new promising white garlic
(Allium sativum L.) clones under the drip irrigation system. The Sixth Inter. Conf. of Sustain.
Agric. And Develop. Fac. of Agric., Fayoum Univ; 2010.
9. Abdel-Ghany GMA. Genetical and molecular studies on some garlic clones. Ph.D. thesis,
Genetics, Fac. of Agric., Minia Univ. El-Minia, Egypt; 2011.
10. Savolainen V, Chase MW. A decade of progress in plant molecular phylogenetics. Trends in
Genetics. 2003;19: 717–724.
11. Nybom H. Comparison of different nuclear DNA markers for estimating intraspecific genetic
diversity in plants. Molecular Ecology. 2004;13:1143–1155.
12. Ma KH, Kwag JG, Zhao W, Dixit A, Lee GA, Kim HH, Chung IM, Et al. Isolation and
characteristics of eight novel polymorphic microsatellite loci from the genome of garlic (Allium
sativum L.). Scientia Horticulturae. 2009;122:355-361.
13. Zaki HEM, Yokoi S, Takahata Y. Molecular genetic analysis of root traits in brassicaceae root
crops. Ph.D. thesis, Science of bioresources, functional genomics and biotechnology, Lab of
Plant Breeding, Fac. of Agric., Iwate Univ., Iwate, Japan; 2010.
14. Nguyen HT, Xiaolei WU. Molecular marker systems for genetic mapping. In the handbook of
plant genome mapping. Edited by: Khalid Meksem GK. Weinheim: WILLEY-VCH GmbH.
2005;23-52.

91
 Current Topics in Agricultural Sciences Vol. 7
Analysis of the Optimum Productivity and Genetic Diversity of Garlic Selections with White and Colored Skin in Egyptian,
Eggaseed-1 and Sids- 40 Varieties

15. Shimizu T, Yano K. A post-labeling method for multiplexed and multicolored genotyping
analysis of SSR, indel and SNP markers in single tube with bar-coded split tag (BStag). BMC
Research Notes. 2011;4:161.
16. Page AL, Miller RH, Keeney DR. Methods of soil analysis part 2: chemical and microbiological
nd
properties. 2 Edn. ASA and SSSA, Madison, WI., USA. 1982;1159.
17. Mann LK. Garlic bulb studies. Calif. Agric. 1952;6: 13.
18. Duncan DB. Multiple range and multiple F test. Biometrics. 1995;11:1-42.
19. Cunha CP, Hoogerheide ESS, Zucchi MI, Monteiro M, Pinheiro JB. New microsatellite markers
1
for garlic, Allium sativum (Alliaceae) . American Journal of Botany. 2012;e17–e19.
20. Nei M, Li W. Mathematical model for studying genetic variation in terms of restriction
endonucleases. Proc. Natl. Acad. Sci. USA. 1979;79:5256-5273.
21. Al-Otayk S, El-Shinawy MZ, Motawei MI. Variation in productive characteristics and diversity
assessment of garlic cultivars and lines using DNA markers. Met. Env. Arid Land Agric. Sci.
2008;20:63-79.
22. Omer EA, Abou-Hadid AF. Evaluation of some lines of Sids-40 garlic comparing with Balady
cultivar. Egypt J. Hort. 1992;19:17-20.
23. Warterer D, Schmitz. Influence of variety and cultural practices on garlic yields in Saktchewan.
Canadian J.P. Scineca. 1994;74:611-614.
24. Brewester JL. Crop production science in horticulture onions and other vegetable Alliums. CABI
is a trading name of CAB international CABI North American office 875 massachustts avenue
th
7 floor; 2008.
25. Zaki HEM, Toney HSH, Abd Elraouf RM. Response of two garlic cultivars (Allium sativum L.) to
inorganic and organic fertilization. Nature and Science. 2014;12(10):52-60.
26. Noorbakhshian SGJ, Mousavi SA, Bagheri HR. Evaluation of agronomic traits and path
coefficient analysis of yield for garlic cultivars. Paiouhes Sazadegi. 2008;77:10-18.
27. Nei M. Estimation of average heterozygosity and genetic distance from a small number of
individual. Genetics. 1978;89:583-590.
28. Garcia LS, Martinez L, Burba JL. Genetic diversity among Argentinean garlic clones (Allium
satvium L.) using AFLP (Amplified Fragment Length Polymorphism). Euphytica. 2003;132:115-
119.
29. Metwally EI, El-Denary ME. Elevation of (AVRDC) international garlic collection under Egyptian
conditions. Acta Hort. 604, ISHS; 2003.

92
 Current Topics in Agricultural Sciences Vol. 7
Analysis of the Optimum Productivity and Genetic Diversity of Garlic Selections with White and Colored Skin in Egyptian,
Eggaseed-1 and Sids- 40 Varieties

Biography of author(s)

Dr. Haitham E. M. Zaki

Associate Professor, Horticulture Department, Faculty of Agriculture, Minia University, El-Minia 61517, Egypt and Applied
Biotechnology Department, University of Technology and Applied Sciences-Sur, 411, Sur, Sultanate of Oman.

Research and Academic Experience: He has 20 years of experience. He got PhD degree in Science of Bioresource,
Functional Genomics and Biotechnology from Iwate University, Japan. He has worked as a visiting scientist at USDA-ARS,
USA, and at The Faculty of Agriculture, Iwate University, Japan.

Research Area: Salinity or drought as well as other biotic and abiotic stresses-negatively affects yield production of different
economic and important crops. Tolerance mechanism is very important to understand cell death which is the common effect of
different stress factors. His research projects try to enhance the plant tolerance mechanism under different stress factors which
will be a good start point in decreasing the massive yield loss due to stress in different regions.

Number of Published papers: He has 50 Published papers

Special Award:
-Award Borlaug Fellowship Program and Scientific Exchanges, 2016 Norman E. Borlaug International Agricultural Science and
Technology Fellowship Program (Borlaug Fellowship).
-Award a fellowship for post-doctor research in the Laboratory of Plant Breeding, Iwate University, Iwate, Morioka, Japan from
the period of 2013 to 2014.
-Award a fellowship for post-doctor research in the Laboratory of Genetic Improvement of Fruits and Vegetables, USDA/ARS-
Beltsville, Maryland, USA from the period of 2012 to 2013.
-Award Egyptian scholarship to study the Ph.D. in the Laboratory of Plant Breeding, Iwate University, Iwate, Morioka, Japan
from the period of 2006 to 2010.

Any other remarkable point(s): He has supervised 3 PhD students and 10 MSc students. He is currently the PI on three
research projects, one of which is part of the PRIMA European program.
_________________________________________________________________________________
© Copyright (2022): Author(s). The licensee is the publisher (B P International).

DISCLAIMER
This chapter is an extended version of the article published by the same author(s) in the following journal.
Life Science Journal, 11(10), 2014.

93