Professional Documents
Culture Documents
MCQ Chapter 6 Molecular Basis of Inheriharitance
MCQ Chapter 6 Molecular Basis of Inheriharitance
MCQ Chapter 6 Molecular Basis of Inheriharitance
a) Transduction
b) transformation
c) transcription
d) translation
9. Teminism is
10. Cistron is
b) The functional unit of DNA molecule that codes for a particular gene product
11. Read the statements given below and identify the incorrect statement.
b) introns
c) exons
d) cistrons
13. The removal of which enzyme affects the synthesis of hnRNA in eukaryotes
a) RNA polymerase II
b) RNA primase
d) RNA polymerase I
a) Base paring
a) Is a 23s rRNA
c) component of ribosome
17. Which mRNA will be translated to a polypeptide chain containing 8 amino acids?
a) AUGUUAAUAGACGAGUAGCGACGAUGU
b) AUGAGACGGACUGCAUUCCCAACCUGA
c) AUGCCCAACCGUUAUUCAUGCUAG
d) AUGUCGACAGUCUAAAACAGCGGG
iv) The large subunit attaches to the small subunit and the initiator tRNA fits in the
P-site
vi) The activated amino acid tRNA complex attaches the initiation codon on mRNA
a) iv, v, iii, ii, i, vi b) iv, vi, v, ii, I, iii c) v, iv, iii, ii, vi, id) v, vi, iv, ii, i, iii
19. Select the incorrect statement out of the five given below about lac operon
when Lactose is present in the medium.
21. Match the entries in column I with those of column II and choose the correct
answer.
Column I Column II
(1) A - N, B- Q, C- P, D- R, E- M, F - O
(2) A - P, B - R, C - M, D -O, E - N, F - Q
(3) A - Q, B - O, C - M, D - R, E - P, F – N
(4) A - N, B - O, C - M, D - R, E - P, F –
Q 22. Enzyme which can break and seal the DNA strand
a) Topoisomease II
(b) Helicase
(c) Primase
23. Match the names of scientists in column I with their achievements in column II
and choose the correct answer given below
Column I Column II
a) R S P T Q
b) R S Q T P
c) R Q P T S
d) R T S P Q
24. Which of the statements give below is correct with respect to frameshift
mutation
25. The transcription initiation factor associated with the RNA polymerase
holoenzyme in prokaryotes is
26. The stretch of codons between AUG and a stop codon is called
b) TATA box
c) colinearity
d) degenerate
a) polycistronic
b) replicative
c) monokaryotic
d) monocistronic
28. If the sequence of bases in DNA is TACCGACCA, then the sequence of codons on
the transcript will be
a) ATGGCTGGT
b) ATCCGAACU
c) AUGGCUGGU
d) AUGGACUAA
Column I Column II
30. Genes which are active all the time synthesizing substances needed by the cell
are called
b) metabolic genes
d) control genes
ANSWERS 1)b, 2)a, 3)a, 4)d, 5)d, 6)c, 7)a, 8)b, 9)a, 10)b, 11)b, 12)c, 13)a, 14)b, 15)b,
16)d, 17)b, 18)d, 19)a, 20)a, 21)d, 22)a, 23)b, 24)d, 25)c, 26)a, 27)a, 28)c, 29)a, 30)c