O RI G I NAL ART I C L E LIVER

Coffee-Derived Exosome-Like Nanoparticles: Are They the

Secret Heroes?
Murat Kantarcıoğlu1 , Gülşen Yıldırım1 , Pınar Akpınar Oktar1 , Serpil Yanbakan1 , Zeynep Büşra Özer2 , Deniz Yurtsever Sarıca1 ,
Serpil Taşdelen1 , Emel Bayrak1 , Dilara Fatma Akın Balı3 , Seçkin Öztürk4 , Kamil Can Akçalı2 , Üstün Ezer1 ,
Ahmet Emin Kürekçi1
1
LÖSEV LÖSANTE Hospital, Ankara, Turkey
2
Ankara University Stem Cell Institute, Ankara, Turkey
3
Department of Medical Biology, Niğde Ömer Halis University Faculty of Medicine, Niğde, Turkey
4
Middle East Technical University, Ankara, Turkey

Cite this article as: Kantarcıoğlu M, Yıldırım G, Akpınar Oktar P, et al. Coffee-derived exosome-like nanoparticles: Are they the
secret heroes? Turk J Gastroenterol. 2022. [epub ahead of print]

Abstract
Background: Regular coffee consumption has beneficial and preventative effects on liver and chronic neurodegenerative diseases.
However, the studies performed with the ingredients found in coffee beverages have not clarified the responsible mechanisms. Exosomes
are small, membrane-coated cargo packages secreted by prokaryote and eukaryote cells. Exosomes regulate intercellular communica-
tion and affect cellular metabolic activities even among different species. In this study, we aimed to isolate and characterize the edible
plant-derived exosome-like nanoparticles from roasted hot coffee beverages, hypothesizing that the edible plant-derived exosome-like
nanoparticles were responsible for the beneficial effects of coffee.
Methods: Size exclusion chromatography and commercial kits were used for the isolation process. Efficient coffee edible plant-derived
exosome-like nanoparticle fractions were determined by an ultraviolet-visible spectrophotometer. Harvested coffee edible plant-derived
exosome-like nanoparticles were characterized by transmission electron microscopy. The quantification procedure was performed
using a commercial kit. Coffee edible plant-derived exosome-like nanoparticles’ proliferative effects on human hepatic stellate cells
and human hepatocellular carcinoma cells were studied using an MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide)
assay. Whole-exosome RNA sequencing was performed.
Results: Transmission electron microscopy scanning analysis indicated round-shaped nanoparticles with sizes ranging from 40 to
100 nm. Both size exclusion chromatography and kit-isolated edible plant-derived exosome-like nanoparticle samples showed maxi-
mum absorbance at 227.5 nm in ultraviolet-visible spectrophotometer analysis. Regarding the quantitation results, kit isolation was
more efficient than the size exclusion chromatography method when the harvested particle numbers were compared. An important
MTT assay finding confirmed the observed beneficial effects of coffee beverages: coffee edible plant-derived exosome-like nanopar-
ticles significantly suppressed hepatocellular carcinoma cell proliferation. As a result of sequencing, we identified 15 mature miRNAs.
A MapReduce-based MicroRNA Target Prediction Method (The DIANA tools’ MR-microT algorithm) highlighted 2 genes specifically
associated with the miRNAs that we obtained: KMT2C and ZNF773.
Conclusion: For the first time in the literature, coffee edible plant-derived exosome-like nanoparticles were identified. These nanopar-
ticles may have therapeutic effects on chronic liver diseases. Experimental studies, therefore, should be performed on disease models to
demonstrate their efficacy.
Keywords: Coffee edible plant derived exosome-like nanopar­ticles, coffee drink, exosomes, hepatocellular carcinoma, size exclusion
chromatography

INTRODUCTION survival following liver transplantation.3 Another organ in

Coffee, the most consumed hot beverage globally, has
recently gained increased prominence due to its proven
health benefits. Coffee consumption is inversely asso-
ciated with total and cause-specific mortality,1 and the
effects of coffee consumption on the liver are notewor-
thy. Meta-analyses have revealed the beneficial and pro-
tective effects of coffee on hepatic fibrosis and cirrhosis in
patients with chronic liver disease2 and even on long-term
which the positive effects of coffee have been observed
is the brain. Alzheimer’s disease is among the most com-
mon neurodegenerative disorders, and its prevalence in
the world’s aging population has increased.4 The results
of meta-analyses have provided motivation for the regu-
lar consumption of coffee to help reduce the likelihood of
Alzheimer’s disease, as well as to help prevent other neu-
rodegenerative disorders like dementia and Parkinson’s

Corresponding author: Murat Kantarcıoğlu, e-mail: kantarci@hotmail.com

Received: October 21, 2021 Accepted: April 2, 2022
DOI: 10.5152/tjg.2022.21895

Copyright @ Author(s) – Available online at https://www.turkjgastroenterol.org.

Content of this journal is licensed under a Creative Commons Attribution (CC BY) 4.0 International License
T urk J G ast roe nt e ro l 20 22
disease.5 Nevertheless, studies performed using ingredi-
ents such as caffeine, caffeoyl, kahweol, and trigonelline
have not been able to elucidate the mechanisms respon-
sible for these beneficial effects.6
Exosomes are small vesicles with a diameter ranging
from 40 to 100 nm. They are formed within endosomal
compartments and secreted through the fusion of mul-
tivesicular bodies with the plasma membrane.7,8 These
tiny membrane-coated cargo packages are secreted
by prokaryotic and eukaryotic cells and transport pro-
teins, lipids, and nucleic acids to other cells.9 Exosomes
regulate intercellular communication and affect cel-
lular metabolic activities, even between different
species. In an experimental model, mouse mast cell-
derived exosomes transported to human mast cells
induced the expression of mouse proteins in the donor
cells.10 Exosome release in plant cells was demonstrated
more than a decade before it was isolated from mam-
malian cells;11 however, researchers only started isolating
and characterizing edible plant-derived exosome-like
nanoparticles (EPDENs) from ginger, carrots, grapefruit,
and grapes in 2014.12 Their data revealed the important
role that EPDENs play in terms of maintaining intestinal
homeostasis.
Most chronic liver diseases stemming from different eti-
ologies result in progressive liver fibrosis. Myofibroblasts
produce an extracellular matrix, which includes type I col-
lagen and is responsible for the development of fibrous
scarring in liver fibrosis.13 A normal liver has a small
amount of type I collagen and no detectable myofibro-
blasts; however, myofibroblasts can appear early when
the liver is injured. The specific marker for myofibroblasts
is alpha-smooth muscle actin (α-SMA) protein, which
is the actin isoform that predominates within vascu-
lar smooth muscle cells and plays an important part in
fibrogenesis.14 The authors of a comprehensive review
reported associations between coffee consumption and
changes in liver enzymes, liver fibrosis, and hepatocellular
Main Points
• For the first time in literature, coffee edible plant-derived
exosome-like nanoparticles (EPDENs) were discovered.
• Whole-exosome sequencing determined 15 novel miRNAs.
• Coffee EPDENs suppress hepatocellular carcinoma
proliferation.
• Coffee EPDENs seem to be responsible for the beneficial
effects of coffee.
K ant ar cı o ğ l u   e t   al . C o ffe e - De r i v e d E xo so m e - L i k e Nano pa rti c l es
carcinoma (HCC) in patients with a variety of chronic
liver diseases.15 They pointed out that coffee consump-
tion is inversely related to each of these outcomes, and
a dose–response relationship exists. We therefore aimed
to isolate and characterize the coffee EPDENs from a hot
roasted coffee drink, which we hypothesized as respon-
sible for the beneficial effects of coffee. Accordingly, we
evaluated the effects of coffee EPDENs on human HCC
cell proliferation and on the expression of α-SMA tran-
scripts, human hepatic stellate cell line.
MATERIALS AND METHODS
Isolation of Coffee EPDENs
All the reagents used were analytical-reagent grade.
ELGA-Q water (18.2 MΩ cm−1; ELGA Purelab OptionQ,
Woodridge, UK) was used where necessary in all the
experiments.
A 35 g roasted ground Arabica coffee sample (Tchibo
Privat Kaffee, Latin Grande, Guatemala) was brewed in
200 mL deionized hot water (65°C) and stirred for 8 min-
utes. The infused coffee sample was filtered consecu-
tively through coarse filter paper and 0.45 µm pore size
membrane filter paper (Isolab, Eschau, Germany)
Two different coffee EPDEN isolation methods, namely,
size exclusion chromatography (SEC) and a com-
mercial kit, were used. The SEC followed the method
described by Böing et al.16,17 An SEC column with a diam-
eter of 1 cm was stacked with 15 mL Sepharose® CL-6B
(Sigma–Aldrich, Merck KGaA, Darmstadt, Germany).
Subsequently, the Sepharose CL-6B was washed with
0.01 M phosphate buffered saline (PBS; Sigma–Aldrich).
Then, 1 mL of coffee was loaded on the column, followed
by elution with 25 mL of PBS (0.01 M). The eluent was
collected in 25 fractions from the column at 1 mL per
Eppendorf tube (Merck KGaA). The fractions between
7 and 18 of the coffee samples were collected in a falcon
tube (Isolab, Eschau, Germany) as described previously.
The glass chromatography columns (300 × 10 mm) were
purchased from Isolab (Eschau, Germany). The Sartorius
model ED224S (Goettingen, Germany) analytical balance
and Labnet S0200 Vortex Mixer (NJ) were used.
In the second EPDEN isolation process, Urine Exosome
Purification Midi Kit (Cat. 57800) was used as described in
the kit protocol manual and was purchased from Norgen
Biotek Corp (Thorold, Ontario, Canada). The ethanol
(96%) used during the extractions was purchased from
Merck (Darmstadt, Germany).
K ant arcıoğlu e t  a l . C o f f e e - D e ri v e d E x o s o m e - L i k e Nano par t i cl e s
The isolated EPDENs were stored at +4°C for fur-
ther experiments, including ultraviolet-visible (UV/
Vis) spectrophotometer analysis, transmission electron
microscopy (TEM) analysis, quantitation, and microRNA
(miRNA) analysis.
Exploration of Coffee EPDEN Fractions Using UV/Vis
Spectrophotometry
To determine the most efficient range of isolated EPDEN
fractions during column elution, an Agilent Cary 60 UV-Vis
spectrophotometer (Santa Clara, Calif, USA) and Jel elec-
trophoresis (Biometra, Compact XS, Endress+Hauser AG,
Switzerland) were used.
Characterization of Coffee EPDENs by Transmission
Electron Microscopy
Transmission electron microscopy is frequently used to
characterize exosomes. This method enables the detec-
tion and characterization of particles down to an imaging
resolution of ~1 nm.18 The coffee EPDEN samples iso-
lated using both the SEC and kit methods were stained
with 2% (w/v) uranyl acetate and fixation. There, the
samples were mounted onto grids. Each grid was then
studied with TEM and imaged to determine the size and
morphology. The images were acquired using an FEI/
Tecnai G2 Spirit model BioTwin TEM operating at 120 kV
and mounted with an FEI Eagle camera (FEI Company,
Waltham, Mass, USA).
Coffee EPDEN Quantitation
An EXOCET exosome quantitation kit (Palo Alto, Santa
Clara, Calif, USA) was used in accordance with the man-
ufacturer’s recommended protocols for quantifying
exosome-like nanoparticles obtained from roasted fil-
ter coffee column and kit isolations. The EXOCET assay,
which is enzymatic and colorimetric, was evaluated and
read at an optical density (OD) of 405 nm. A standard
curve calibrated for isolated EPDENs by NanoSight analy-
sis was included in the kit.
MTT Cell Proliferation Assay
The MTT assay is a versatile and popular colorimetric cell
viability assay.19 We investigated the proliferative effects
of the coffee EPDENs on a human hepatic stellate cell line
(LX-2) and HCC cell line (Hep 40 cells). Both the LX-2 and
Hep 40 cells were purchased from Sigma–Aldrich. First,
1 × 104 cells/well were seeded into a 96-well plate. The
cells were then incubated at 37°C for 24-72 hours to
determine the optimal incubation time. An MTT Cell
T u r k J G ast r o e nt ero l 2022
Growth Assay Kit (Merck, Penzberg, Germany) was used
in accordance with the manufacturer’s instructions. The
OD values at 570 nm were read using an Epoch micro-
plate reader (Biotek, Winooski, Vt, USA).
To determine the optimal dose (particles/microliter),
we analyzed 10 different concentrations of coffee
EPDENs on the LX-2 cells (8 × 107, 16 × 107, 24 × 107,
32 × 107, 4 × 108, 48 × 107, 56 × 107, 64 × 107, 72 × 107,
and 8 × 108 particles/µL). The incubation periods range
from 24 to 72 hours. Using the MTT assay results we
obtained from the LX-2 cell series, we determined 4 dif-
ferent concentrations of the HCC cells, namely, 2 × 108,
4 × 108, 6 × 108, and 8 × 108 particles/µL.
RNA Isolation and α-SMA Expression—Quantitative
Real-Time Polymerase Chain Reaction
The total RNA isolation from the human LX-2 cells
and Hep 40 cells at the end of the 72-hour treatment
was performed using the RiboEx Total RNA Solution
(GeneAll, Lisbon, Portugal) in accordance with the
manufacturer’s instructions. cDNA synthesis was per-
formed using a Fast SCRIPT cDNA synthesis kit (TONBO
Biosciences, San Diego, Calif, USA). The cDNA was
amplified with the GoTaq qPCR master mix (Promega,
Madison, Wis, USA). The expression of the α-SMA
mRNA was normalized according to the glyceralde-
hyde 3-phosphate dehydrogenase (GAPDH) expression
level. Fold changes in the expression of the genes were
analyzed using the comparative (2−ΔΔCt) method. An
untreated control group was used as the calibrator. The
primer sequences used in this study were GAPDH (for-
ward 5’-GGCTGAGAACGGGAAGCTTGTCAT-3’; reverse
5’-CAGCCTTCTCCATGGTGGTGAAGA-3’) and α-SMA
(forward 5’-TATCAGGGGGCACCACTATG-3’; reverse
5’-GCTGGAAGGTGGACAGAGAG-3’).
The statistical significances between the quantitative real-
time polymerase chain reaction (qRT-PCR) groups were
determined using a paired Student’s t-test. The values
from the qRT-PCR were expressed as means ± standard
deviation (SD) (n = 3). P < .05 was considered statistically
significant.
Statistical Analysis
The statistical significance between the groups of qRT-
PCR and MTT assay was determined by the unpaired
Student’s t-test. The values from qRT-PCR and MTT
were expressed as the means ± SD (n = 3). “N” indicated
the number of biological replicates. P < .05 was chosen
T urk J G ast roe nt e ro l 20 22
statistically significant. All calculations were performed
with GraphPad Prism 8 software (San Diego, Calif, USA).
Determination of the EPDENs RNA Sequence and
Identification of Possible miRNAs
The whole-exosome RNA sequencing was performed by
an outsourced commercial firm. We used the exosome
RNA Purification Midi Kit (Nogen, Thorold, Canada) to
isolate the RNA from the coffee EPDENs harvested, using
the SEC column method. MicroRNAs are small non-
coding RNAs consisting of 18-22 nucleotides that play
a particularly important role in the regulation of gene
expression at a post-transcriptional level.20 The SRNA-
seq data were obtained by RNA sequencing. The miRNAs
were identified directly using the BrumiR tool, which is a
de novo algorithm based on the Bruijn approach.21
RESULTS AND DISCUSSION
The ingredients responsible for coffee’s benefits and
the cellular pathways they affect are unclear. Coffee has
many components, including hydroxycinnamic acids, fla-
vonoids, tocopherols, diterpene alcohols, melanoidins,
and chlorogenic acids. Among the ingredients in cof-
fee, caffeine has received particular interest and atten-
tion.22 The protective effects of coffee, especially in
chronic neurodegenerative diseases, have been attrib-
uted to the caffeine it contains. However, recent evi-
dence has suggested that decaffeinated coffee can also
be highly effective.23
We used an alternative approach to reveal the cause
of the beneficial effects of coffee. Studies on the exo-
some-like nanoparticles of some edible plant products
and their metabolic molecular effects have been con-
ducted.12 However, to the best of our knowledge, no
reports on coffee-derived exosome-like nanoparticles
Figure 1.  UV-Vis spectrophotometer results for (A) the SEC-isolated and (B) kit-isolated exosome-like nanoparticles of
roasted ground coffee.
K ant ar cı o ğ l u   e t   al . C o ffe e - De r i v e d E xo so m e - L i k e Nano pa rti c l es
have been published in the literature to date. For the
first time, we isolated the extracellular vesicles compat-
ible with exosome morphology from a hot coffee drink.
Among the described protocols for extracellular vesicle
isolation, such as ultracentrifugation, filtration, immu-
noaffinity isolation, polymeric precipitation isolation,
and liquid chromatography techniques, we selected
SEC.24 Exosome-like nanoparticles were isolated from
the coffee sample via hydrophobic interaction chroma-
tography using Sepharose CL-6B, and appropriate frac-
tions were decided based on our experimental findings.
The eluent was collected in 25 fractions from the column
as 1 mL per tube. All the fractions between 7 and 18 of the
coffee samples were collected in a falcon tube.
Using UV-Vis spectrophotometry, the absorption spec-
tra of each fraction collected from the SEC were exam-
ined. After comparing the spectra obtained in the EPDEN
absorption band in the range 220-240 nm, the fractions
between 7 and 18 were chosen for further study. The
typical result for a single fraction with column isolation
and whole kit isolation of the UV-Vis spectrophotometer
is shown in Figure 1.
A coffee bean is exposed to high heat twice during its
journey, which starts on the branch of a tree and ends
in a cup. The presence of EPDENs in hot coffee is clear
evidence that these structures are resistant to heat. This
begs the question: what about green coffee? To deter-
mine the “roasting heat” sensitive vesicles in green cof-
fee beans, the same study protocol could be performed
using a ground green coffee drink to complement
our study.
Xiao et al25 described EPDENs that look like exosomes
from a structural perspective. Edible plant-derived
K ant arcıoğlu e t  a l . C o f f e e - D e ri v e d E x o s o m e - L i k e Nano par t i cl e s T u r k J G ast r o e nt ero l 2022

Figure 2.  TEM images of (A) the SEC-isolated and (B) kit-isolated exosome-like nanoparticles of roasted ground coffee. TEM, transmission
electron microscopy; SEC, size exclusion chromatography.

exosome-like nanoparticles are naturally occurring plant
ultra-structures with sizes ranging between 30 and
150 nm.25 A TEM imaging study performed in a University
Central Laboratory revealed that the nanoparticles we
harvested were compatible with the exosomes in terms
of the described sizes. The SEC and kit roasted ground
coffee-derived vesicle sizes ranged between 10 and
80 nm, as presented in Figures 2a and 2b.
The quantitation kit OD (405 nm) results are presented in
Table 1. The quantitation process helped determine the
minimum number of EPDENs that should be ingested
daily. To obtain the benefits of coffee, it is recommended
that at least 2 cups be consumed daily, and no upper
limit is specified.23 The quantification study and TEM
images showed that a larger number of particles could be
obtained using the kit method.
In our MTT study, we used 2 different cell lines; fibrotic
(LX2) and hepatocellular (HEP40) cell lines. We chose
24 and 72 hours as early and late response of these cell
lines upon EPDENs exposure. As an early response to
EPDENs exposure in LX2, we found that between the
concentration of 80 and 240 × 106, the proliferation of the
cells increased significantly compared to that of control
group (Figure 3a). On the other hand, at higher concen-
trations except 560 × 106, we did not see any significant
changes compared to control group. On the other hand,
we did not observe any significant effect of EPDENs in
the late response in LX2 cells (Figure 3b). Our MTT results
for the effect of EPDENs in HEP40 showed a concen-
tration-dependent significant decrease (2-4 × 108) upon
exposure to EPDENs in HEP40 cells compared to that
of control group in early response (Figure 3c) but not in
late response (Figure 3d). This finding was consistent
with the reported inverse proportion between caffein-
ated and decaffeinated coffee consumption and HCC
prevalence.26 A meta-analysis revealed the ineffective-
ness of caffeine in this process. Like that of LX2, the
early response has not changed in further increased
concentrations. The lack of a significant increase in
higher concentrations of EPDENs at early response may
be related to the content of these EPDENs. To sup-
port this hypothesis, we have identified 15 novel miRNA
sequences in the content of the EPDENs (Table 2). Since
there is no known in vitro function associated with these
miRNAs, we applied an artificial intelligence program; a

Table 1.  Quantitation Kit Optimal Density (405 nm) Results and Concentrations of Coffee EPDENs in Different Volumes and Diluted in
Different Proportions

Coffee EPDEN Sample and Isolation Type Average OD (405 nm) Concentration/1 mL Concentration/200 mL***
Filter coffee size exclusion chromatography 0.310 8 × 1010
16 × 1012
isolation*
Filter coffee kit isolation** 0.410 16 × 1010 32 × 1012
*The amount of coffee EPDENs obtained by the column sepharose gel method; **The amount of coffee EPDENs obtained with commercial kit (Norgen);
***Cup of coffee consumed with daily diet.
OD,optical density.
T urk J G ast roe nt e ro l 20 22 K ant ar cı o ğ l u   e t   al . C o ffe e - De r i v e d E xo so m e - L i k e Nano pa rti c l es

Figure 4.  The transcriptional response of α-SMA to coffee EPDEN

treatment in LX-2 cells. The error bars reflect the SDs of the results
derived from the biological triplicate experiments. The qRT-PCR
data are presented as the fold changes of the mRNA levels in the
Figure 3.  The effects of coffee EPDENs concentrations at
treatment groups relative to the non-treated (control) group based
8 × 107, 16 × 107, 24 × 107, 32 × 107, 4 × 108, 48 × 107, 56 × 107,
on the normalization against the GAPDH. All the data are presented
64 × 107, 72 × 107, and 8 × 108 particles/µL on LX-2 cells (A–B)
as mean ± SD. Significance level, *P < .05 versus control group.
and 2 × 108, 4 × 108, 6 × 108, and 8 × 108 particles/µL on
α-SMA, alpha-smooth muscle actin; EPDENs, edible plant-derived
Hep 40 cells after 24- and 72-hour treatments (C–D). The data
exosome-like nanoparticles; SD, standard deviation; qRT-PCR,
represent the mean and SD of the triplicate samples.
quantitative real-time polymerase chain reaction; GAPDH,
All the data are represented as the mean ± SD (n = 3).
glyceraldehyde 3-phosphate dehydrogenase.
Significance level, *P < .05 versus control group.
EPDENs, edible plant-derived exosome-like nanoparticles;
SD, standard deviation. MapReduce-based microRNA target prediction algo-
rithm for these novel miRNAs. This in silico approach
revealed 2 important genes, ZNF773 and KMT2C and
Table 2.  Mature MiRNA Sequences Isolated from Coffee EPDENs
their network in liver fibrosis leading to chronic liver dis-
MiRNA (Mature_ Identical) miRNA seq (Mature_ Sequence)
ease (Figure 5). It is tempting to speculate that these
contents can direct and control the response of EPDENs
novel_1 ccggugcuggccugcgggc
through the progression of liver fibrosis. It is important
novel_11 gguaacccgcugaaccuu to note that this explanation is only applicable for the
novel_14 gaggggaguggcugggga early response (24 hours) not to late response (72 hours).
novel_17 cgagaguuggaccggggg This is particularly important since fibrosis is a progres-
novel_2 acgcccuugugguuugacu
sive condition and early intervention to this progression
is critical, the answer may be in EPDENs. This hypothesis
novel_22 uggacggggucgaugggcgauc
clearly warrants new data to prove which we plan to con-
novel_23 aggggagggggcgggcgg tinue with our future studies.
novel_24 aggucacgaguucgagucuc
Since α-SMA is a known marker of liver fibrosis, we
novel_26 agggugggcaggcuguuaaac
checked the mRNA levels of the α-SMA in the LX-2 cells
novel_27 cuguggaaccucaugcuu (Figure 4). We used 2 different concentrations (i.e.,
novel_3 gauggagggacggagagg 8 × 107 and 8 × 108 particles/µL) to further underline
novel_5 uuccacagcuuucuugaacuu how concentrations affect the mRNA expression of
novel_6 uggggaggggggcggggc α-SMA. Our qRT-PCR results showed that the α-SMA
expression levels increased after the administration
novel_8 uaugcgugcucacucucuauc
of the coffee EPDENs in a concentration-dependent
novel_9 ggaggaggaaagagaaagg manner.
K ant arcıoğlu e t  a l . C o f f e e - D e ri v e d E x o s o m e - L i k e Nano par t i cl e s T u r k J G ast r o e nt ero l 2022

Figure 5.  How miRNAs carried by EPDENs in coffee can affect liver fibrosis in chronic liver diseases via ZNF773 and KMT2C genes is
schematized using a hypothetical mechanism. KMT2C, lysine methyltransferase 2C; MMP, matrix metalloproteinase; TIMP, tissue inhibitor
of metalloproteinase; ZNF, zinc finger.

More studies on the use of coffee EPDENs in chronic liver
damage and fibrosis that includes animal models there-
fore need to be performed.
Comprehensive data were obtained after RNA sequenc-
ing from the RNAs obtained from the coffee EPDENs.
From the obtained sRNA-seq data, miRNAs were identi-
fied using the BrumiR tool, a de novo algorithm based
on the Bruijn approach.21 The mature miRNA sequences
isolated from the coffee EPDENs are presented in
Table 2.
In our study, 2942 target genes were determined from
15 separate miRNAs using the DIANA tool’s MR-microT
(a MapReduce-based microRNA target prediction
method) algorithm. The score cut-off value was selected
using the threshold identifier 0.8.27,28 Among these
targets, 17 common genes were identified as having
coffee EPDEN-derived miRNAs. Each individual cof-
fee EPDEN-derived miRNA was related to a minimum
of 4 and a maximum of 7 of these target genes. The
DIANA tool’s algorithm highlighted 2 genes (KMT2C,
ZNF773), which were specifically associated with the
T urk J G ast roe nt e ro l 20 22 K ant ar cı o ğ l u   e t   al . C o ffe e - De r i v e d E xo so m e - L i k e Nano pa rti c l es
miRNAs we obtained. KMTC2 is a common target gene
for 5 miRNAs. KMT2C is a member of the KMT2 (lysine
methyltransferase) protein family.29 MT2 proteins are
histone-modifying actors that play important roles in cell
development pathways. Moreover, the repair response to
DNA damage is highly managed by KMT2C. With respect
to this mechanism, it has been shown that a cell with low
KMT2C activity has impaired homologous recombina-
tion‐mediated double‐strand break DNA repair abilities.
Recent data have emphasized that the downregulation
of KMT2C is an accompanying feature in human epithe-
lial cancers.30 The other target gene for 7 of the coffee
EPDEN-derived miRNAs in our study was ZNF773. There
is insufficient information on the functional properties of
ZNF773 in the medical literature. According to the hypo-
thetical mechanism we propose, miRNAs ingested with
coffee EPDENs may alter the expression of the KMT2C
gene, and these changes may affect the ZNF773 gene
methylation pattern. In terms of the reported functional
features of KMT2C, we therefore schematized a hypo-
thetical mechanism to explain how miRNAs carried by
coffee EPDENs can affect liver fibrosis in chronic liver dis-
eases (Figure 5). In 2007, Valadi et al10 demonstrated that
adding exosomes from mouse mast cells to human mast
cell cultures caused these vesicles to fuse with the human
cells, and as a result, the human cells began to produce
mouse proteins. The same interaction mechanism may be
valid for EPDENs. Based on their findings, many research-
ers have suggested that plant-derived exosome-like par-
ticles may enter the cells of different species and affect
their metabolic activities.12 Plant-derived microRNAs play
the main role in this cross-kingdom communication.31 A
particularly good example of this interaction is MIR168a.
Zhang et al32 demonstrated the circulation of MIR168a
in the sera of Chinese subjects. This exogenous plant
miRNA is mostly found in rice. The researchers demon-
strated that MIR168a can bind to human/mouse low-
density lipoprotein receptor adapter protein 1 mRNA, and
eventually LDL removal from mouse plasma decreases.
A stunning paper was published by Chuang et al33 who
found some differentially methylated CpGs located in the
genes of people with diseases who benefit from drinking
coffee. Coffee consumption was reported to be associ-
ated with DNA methylation levels.
We defined 15 novel miRNAs derived from coffee
EPDENs that seemed to mostly associate with KMT2C
and ZNF773. While KMT2C reportedly provides a pro-
tective and repairing response to DNA damage,30 not
enough information is available about ZNF773. In our bio-
informatic study, we have summarized our hypotheses
regarding the possible interaction pathways in a diagram
(Figure 5).
Due to our limited project budget, we could not study the
in vivo effects of coffee EPDEN particles on other cancer
cell lines. Genomic and proteomic studies are needed to
determine the common target genes of the miRNAs we
have obtained. These studies also require funding.
CONCLUSION
Coffee EPDENs are a new candidate for plant-derived
miRNA-based therapies in chronic liver diseases and
HCC. These genetic interactions and functional mecha-
nisms should be explored further in future studies.
Ethics Committee Approval: Ethics committee approval was not
obtained because the main research subject was only the content of
hot coffee drinks.
Peer-Review: Externally peer-reviewed.
Author Contributions: Concept – M.K.; Design – A.E.K., M.K.;
Supervision – A.E.K., K.C.A.; Resources – E.B., Ü.E.; Materials – S.Y.,
K.C.A., D.F.A.B., D.Y.S.; Data Collection and/or Processing – G.Y.,
P.A.O., S.Y., Z.B.Ö., S.Ö.; Analysis and/or Interpretation – G.Y., P.A.O.,
K.C.A., Z.B.Ö., A.E.K., M.K., S.Ö.; Literature Search – M.K., A.E.K., P.A.O.,
D.Y.S., G.Y.; Writing Manuscript – M.K., G.Y., P.A.O., Z.B.Ö., A.E.K.;
Critical Review – A.E.K., K.C.A.
Acknowledgments: This study was carried out with the Turkish
Society of Gastroenterology research scholarship and The authors
would like to thank the officials of the association. The authors
would like to thank Beypazarı Company for their finan­cial contribu-
tion to the research budget. The authors would like to express their
gratitude to Prof. Dr. Hilal Özdağ Sevgili for her contributions.
Declaration of Interests: The authors declare that they have no
competing interest.
Funding: The study was funded by the Turkish Society of
Gastroenterology with research project support (30.000 TL) and
Beypazari Mineral Water Company donation (10.000 TL) in December
2017.
REFERENCES
1. Freedman ND, Park Y, Abnet CC, Hollenbeck AR, Sinha R. Associa-
tion of coffee drinking with total and cause-specific mortality.
N Engl J Med. 2012;366(20):1891-1904. [CrossRef]
2. Liu F, Wang X, Wu G, et al. Coffee consumption decreases risks for
hepatic fibrosis and cirrhosis: a meta-analysis. PLOS ONE.
2015;10(11):e0142457. [CrossRef]
3. Friedrich K, Smit M, Wannhoff A, et al. Coffee consumption pro-
tects against progression in liver cirrhosis and increases long-term
survival after liver transplantation. J Gastroenterol Hepatol.
2016;31(8):1470-1475. [CrossRef]
4. Qiu C, Kivipelto M, von Strauss E. Epidemiology of Alzheimer’s dis-
ease: occurrence, determinants, and strategies toward intervention.
Dial Clin Neurosci. 2009;11(2):111-128. [CrossRef]
K ant arcıoğlu e t  a l . C o f f e e - D e ri v e d E x o s o m e - L i k e Nano par t i cl e s
5. Wierzejska R. Can coffee consumption lower the risk of Alzhei-
mer’s disease and Parkinson’s disease? A literature review. Arch Med
Sci. 2017;13(3):507-514. [CrossRef]
6. Wadhawan M, Anand AC. Coffee and liver disease. J Clin Exp
Hepatol. 2016;6(1):40-46. [CrossRef]
7. Stoorvogel W, Kleijmeer MJ, Geuze HJ, Raposo G. The biogenesis
and functions of exosomes. Traffic. 2002;3(5):321-330. [CrossRef]
8. Raposo G, Stoorvogel W. Extracellular vesicles: exosomes,
microvesicles, and friends. J Cell Biol. 2013;200(4):373-383. [CrossRef]
9. Yáñez-Mó M, Siljander PR, Andreu Z, et al. Biological properties of
extracellular vesicles and their physiological functions. Yáñez-Mó M.
J Extracell Vesicles. 2015;4:27066. [CrossRef]
10. Valadi H, Ekström K, Bossios A, Sjöstrand M, Lee JJ, Lötvall JO.
Exosome-mediated transfer of mRNAs and microRNAs is a novel
mechanism of genetic exchange between cells. Nat Cell Biol.
2007;9(6):654-659. [CrossRef]
11. Halperin W, Jensen WA. Ultrastructural changes during growth
and embryogenesis in carrot cell cultures. J Ultrastruct Res.
1967;18(3):428-443. [CrossRef]
12. Mu J, Zhuang X, Wang Q, et al. Interspecies communication
between plant and mouse gut host cells through edible plant derived
exosome-like nanoparticles. Mol Nutr Food Res. 2014;58(7):1561-
1573. [CrossRef]
13. Brenner DA , Kisseleva T, Scholten D, et al. Origin of myofibro-
blasts in liver fibrosis. Fibrogenesis Tissue Repair. 2012;5(Suppl 1):
S17. [CrossRef]
14. Kawasaki Y, Imaizumi T, Matsuura H, et al. Renal expression of
alpha-smooth muscle actin and c-Met in children with Henoch-
Schönlein purpura nephritis. Pediatr Nephrol. 2008;23(6):913-919.
[CrossRef]
15. Feld JJ, Lavoie ÉG, Fausther M, Dranoff JA. I drink for my liver, Doc:
emerging evidence that coffee prevents cirrhosis. F1000Research.
2015;4:95.
16. Böing AN, van der Pol E, Grootemaat AE, Coumans FAW, Sturk A,
Nieuwland R. Single-step isolation of extracellular vesicles by size-
exclusion chromatography. J Extracell Vesicles. 2014;3:23430.
[CrossRef]
17. Wang L, Bruce TF, Huang S, Marcus RK. Isolation and quantita-
tion of exosomes isolated from human plasma via hydrophobic
interaction chromatography using a polyester, capillary-channeled
polymer fiber phase. Anal Chim Acta. 2019;1082:186-193.
[CrossRef]
18. Cizmar P, Yuana Y. Detection and characterization of extracel-
lular vesicles by transmission and cryo-transmission electron micros-
copy. Methods Mol Biol. 2017;1660:221-232. [CrossRef]
T u r k J G ast r o e nt ero l 2022
19. Kumar P, Nagarajan A, Uchil PD. Analysis of cell viability by the
MTT assay. Cold Spring Harb Protoc. 2018;2018(6). [CrossRef]
20. Lu TX, Rothenberg ME. MicroRNA. J Allergy Clin Immunol.
2018;141(4):1202-1207. [CrossRef]
21. Moraga C, Sanchez E, Ferrarini MG, Gutierrez RA, Vidal EA,
Sagot MF. BrumiR: a toolkit for de novo discovery of microRNAs from
sRNA-seq data. bioRxiv. 2020. Available from: URL: https://www.
biorxiv.org/content/10.1101/2020.08.07.240689v1. [CrossRef]
22. Gökcen BB, Şanlier N. Coffee consumption and disease correla-
tions. Crit Rev Food Sci Nutr. 2019;59(2):336-348. [CrossRef]
23. Colombo R, Papetti A. An outlook on the role of decaffeinated
coffee in neurodegenerative diseases. Crit Rev Food Sci Nutr.
2020;60(5):760-779. [CrossRef]
24. Liangsupree T, Multia E, Riekkola ML. Modern isolation, and sep-
aration techniques for extracellular vesicles. J Chromatogr A.
2021;1636:461773. [CrossRef]
25. Xiao J, Feng S, Wang X, et al. Identification of exosome-like nan-
oparticle-derived microRNAs from 11 edible fruits and vegetables.
PeerJ. 2018;6:e5186. [CrossRef]
26. Kennedy OJ, Roderick P, Buchanan R, Fallowfield JA, Hayes PC,
Parkes J. Coffee, including caffeinated and decaffeinated coffee,
and the risk of hepatocellular carcinoma: a systematic review and
dose-response meta-analysis. BMJ Open. 2017;7(5):e013739.
[CrossRef]
27. Kanellos I, Vergoulis T, Sacharidis D, et al. MR-microT: a MapRe-
duce-based microRNA target prediction method. SSDBM. 2014;47.
[CrossRef]
28. Reczko M, Maragkakis M, Alexiou P, Grosse I, Hatzigeorgiou AG.
Functional microRNA targets in protein coding sequences. Bioinfor-
matics. 2012;28(6):771-776. [CrossRef]
29. Fagan RJ, Dingwall AK. COMPASS Ascending: emerging clues
regarding the roles of MLL3/KMT2C and MLL2/KMT2D proteins in
cancer. Cancer Lett. 2019;458:56-65. [CrossRef]
30. Rampias T, Karagiannis D, Avgeris M, et al. The lysine-specific
methyltransferase KMT2C/MLL3 regulates DNA repair components
in cancer. EMBO Rep. 2019;20(3):e46821. [CrossRef]
31. Xie W, Weng A, Melzig MF. MicroRNAs as new bioactive compo-
nents in medicinal plants. Planta Med. 2016;82(13):1153-1162.
[CrossRef]
32. Zhang L, Hou D, Chen X, et al. Exogenous plant MIR168a specifi-
cally targets mammalian LDLRAP1: evidence of cross-kingdom regu-
lation by microRNA. Cell Res. 2012;22(1):107-126. [CrossRef]
33. Chuang YH, Quach A, Absher D, Assimes T, Horvath S, Ritz B.
Coffee consumption is associated with DNA methylation levels of
human blood. Eur J Hum Genet. 2017;25(5):608-616. [CrossRef]