Professional Documents
Culture Documents
Cytomls - Prelims Reviewer
Cytomls - Prelims Reviewer
Cells
-Basic unit of life
-Synthesis of molecules
-Communication
-Cell metabolism and energy release
-Reproduction and inheritance(DNA)
Krebs-cycle - is a series of chemical reactions to release stored energy through the oxidation
vacuole - stores water; every plant cell contains vacuole and is typically larger than in animal
cells.
1. Cell Membrane
-outermost component of a cell
-selective barrier and encloses cytoplasm
-phospholipid bilayer
Structure
-made of phospholipid and proteins
-has polar region; head and tail; head is polar and hydrophilic, tail is nonpolar and hydrophobic;
only lipid components can pass through here; electrolytes are not lipids and uses another
membrane channel to pass through the cell
Movement through cell membrane
-cell membrane selectively determines what can pass in and out of the cell
-Enzymes,glycogen, and potassium are found in higher concentrations inside the cell.
-sodium, calcium, and chloride and found in higher concentrations outside the cell
Hemolyzed blood can cause an increase in enzymes, glycogen, and potassium in blood.
3. carrier molecules
4. Vesicles
Osmosis - diffusion of water across a cell membrane; movement of water from a less
concentrated solution to a more concentrated solution.
Hypotonic solution - concentration of solutes is lower outside of cell while H2O molecules are
higher; H2O molecules move into the cell to balance the concentration; can cause lysis of
cell(burst of cell)
Hypertonic solution - concentration of solutes is higher outside the cell while H2O molecules
are lower; causes H2O molecules inside the cell to move outside of the cell; can cause
crenation of cell(shrinking of cell)
Isotonic solution - balanced concentration of H2O molecules and solutes outside of the cell;
no water movement and cells remain intact
Endocytosis - process that brings materials into cell using vesicles (Active transport)
Exocytosis - process that brings materials from the intracellular matrix to the extracellular
matrix using vesicles (Active transport)
Phagocytosis - cell eating; cells ingest solid particles
Pinocytosis - cell drinking; cells ingest liquid particles
Golgi apparatus - releases proteins etc. to the vesicles to be excreted to the body
DNA Nucleotides
ATCG
-Adenine (Thymine partner)
-Thymine
-Cytosine (Guanine partner)
-Guanine
RNA Nucleotides
AUCG
-Adenine (Uracil partner)
-Uracil (Thymine replaced by Uracil during DNA-mRNA transcription; becomes Adenine during
mRNA-tRNA translation)
-Cytosine (Guanine partner)
-Guanine
Mitosis-cell divison
composes 2 chromatid
centromere-where chromatid are connected
centrioles-also holds chromatids;helps in separation of chromatids into chromosomes
IPMAT
Interphase - preparation of cell for cell division
Prophase - chromatin condense into chromosome, centrioles move them into opposite ends
Metaphase - chromosomes are in the middles, align in the middles
Anaphase - start of cleavage, chromosomes separate to 2 set of chromosomes.chromosomes
move towards centrioles
Telophase - two cells made, cleavage more visible
Cytokinesis - physical separation of parental cell to two daughter cells
Meiosis - like mitosis, but cells undergo two division (1 becomes 2; then 2 becomes 4)
Girl - XX chromosomes
Boy - XY chromosomes
Meiosis 1 - diploid parent cell creates two haploid daughter cells; unlike in mitosis these are not
identical.
Meiosis 2 - creation of four haploid cells from the two haploid daughter cells
*Haploid refers to single set of chromosomes
Prophase I
Crossing of gene sequence from alleles. Homologous chromosomes from parents form new
genetic combinations.
Why is there a crossing over of gene sequence? Greater variation of genetic sequence;
strengthens idea that each individual is unique
Haploid - one copy of each chromosome; designated as n, the number of chromosome in one
set; gametes(sex cells; egg cells and sperm cells)
Diploid - two sets of chromosomes (two of each chromosome); designate as 2n; somatic cells
Homologues - exists in two dipoid egg cells; happens in every chromosome except in sex
chromomse X and Y
DNA Nucleotides
adenine
thymine
cytosine
guanine
DNA is your body recipe; is you
The strands of the helix are unzipped or opened by DNA helicase. One sequence of nucleotides
of the DNA strand is replicated by the DNA polymerase and undergoes pairing.
RNA pairing
Adenine - Uracil
Guanine - Cytosine
DNA pairing
Adenine - Thymine
Guanine -Cytosine
The DNA is too large to exit the nucleus; A process called transcription creates a template of a
single strand of DNA copied by mRNA. mRNA is translated into tRNA. tRNA is used to create
proteins.
Law of independent assortment - two or more pair of alleles separate independently during
the formation of gametes
Autosomal trait - comes from other non-sex chromosomes
Sex-linked trait - involves 23rd chromosome
Y-linked trait - only males will have copy of the allele
X - normal allele
Xa - X chromosome carrying recessive allele
XA - X chromosome carrying dominant allele
Dihybrid cross - two organisms involved while looking at two different genes; uses 4x4 punnett
square and always produces a 9:3:3:1 ratio
*Central dogma starts with transcription of mRNA, and translation to tRNA, then translation in
ribosome
James Watson and Francis Crick - was awarded the nobel Prize for DNA
Rosalind Franklin - first to photograph DNA
Structure of DNA
1. Outside of twisted ladder are made of deoxyribose sugar and phosphates
2. The rungs of the ladder are nitrogenous bases.
Nitrogenous bases
-Adenine
-Thymine
-Cytosine
-Guanine
DNA: ATGAAAAGCAGGCCATATTAA
Complementary DNA strand/DNA pairing: TACTTTTCGTCCGGTATAATT
DNA to mRNA: AUGAAAAGCAGGCCAUAUUAA
mRNA to tRNA: UACUUUUCGUCCGGUAUAAUU
tRNA to Amino Acid: UAC-UUU-UCG-UCC-GGU-AUA-AUU
Tyr-Phe-Ser-Ser-Gly-Ile-Met(Start)