August 26, 2022 (Cell)

Cells
-Basic unit of life
-Synthesis of molecules
-Communication
-Cell metabolism and energy release
-Reproduction and inheritance(DNA)

Chemical level of organization

1. Atom
2. Cells
3. Tissue
4. Organ
5. Organ system
6. Organism

Krebs-cycle - is a series of chemical reactions to release stored energy through the oxidation

myoglobin - muscle protein for movement

hemoglobin - transport oxygen and releases it when RBC reaches oxygen-depleted tissue

Enzymes end with -some and -ase

vacuole - stores water; every plant cell contains vacuole and is typically larger than in animal
cells.

Organelles - organs of cells

Cytoplasm and cytoskeleton holds organelles in place

1. Cell Membrane
-outermost component of a cell
-selective barrier and encloses cytoplasm
-phospholipid bilayer

Extracellular - outside cell

Intracellular - inside cell

Structure
-made of phospholipid and proteins
-has polar region; head and tail; head is polar and hydrophilic, tail is nonpolar and hydrophobic;
only lipid components can pass through here; electrolytes are not lipids and uses another
membrane channel to pass through the cell
Movement through cell membrane
-cell membrane selectively determines what can pass in and out of the cell
-Enzymes,glycogen, and potassium are found in higher concentrations inside the cell.
-sodium, calcium, and chloride and found in higher concentrations outside the cell

Hemolyzed blood can cause an increase in enzymes, glycogen, and potassium in blood.

Ways molecules pass through cell membrane

1. Diffusion - pass through only, very small molecules than can pass through
Hypertonic - high salt concentration, in RBC water moves out to equilibrate the salt-
water content causing it to shrivel
Hypotonic - low salt concentration, water comes into RBC causing it to swell or burst
Isotonic - balanced
2. Membrane channels - electrolytes, entrance for bigger molecules

Sodium-potassium pump system

PISO- (two) potassium in, (three) sodium out

3. carrier molecules
4. Vesicles

Mediated Transport Mechanism

1. Facilitated Diffusion - diffusion via carrier molecules; carrier molecule binds with molecule
outside of cell membrane and diffuses across cell membrane while carrying the molecule.
2. Active transport - uses energy (ATP)

Osmosis - diffusion of water across a cell membrane; movement of water from a less
concentrated solution to a more concentrated solution.

Hypotonic solution - concentration of solutes is lower outside of cell while H2O molecules are
higher; H2O molecules move into the cell to balance the concentration; can cause lysis of
cell(burst of cell)
Hypertonic solution - concentration of solutes is higher outside the cell while H2O molecules
are lower; causes H2O molecules inside the cell to move outside of the cell; can cause
crenation of cell(shrinking of cell)
Isotonic solution - balanced concentration of H2O molecules and solutes outside of the cell;
no water movement and cells remain intact

Endocytosis - process that brings materials into cell using vesicles (Active transport)
Exocytosis - process that brings materials from the intracellular matrix to the extracellular
matrix using vesicles (Active transport)
Phagocytosis - cell eating; cells ingest solid particles
Pinocytosis - cell drinking; cells ingest liquid particles
Golgi apparatus - releases proteins etc. to the vesicles to be excreted to the body

nuclear envelope - "plasma membrane" of the nucleus; selective membrane of the

nucleus;houses DNA
Nuclear pores - where materials pass in and out of the nucleus
Chromosome - found inside the nucleus; contains dna, genes, and protein, to create genetic
makeup; composed of two sister chromatids; DNA in condensed form
Chromatin - thread of chromosomes that is not complete; loosely coiled chromosomes;
uncondensed DNA
Chromatid - identical halves of chromosomes
Nucleolus - produces ribosomes
Ribosomes - is attached to the Rough Endoplasmic Reticulum or cytoplasm; produces proteins
Histones - structural support for chromosomes

Rough ER - has ribosomes; site of protein synthesis

Smooth ER - contains many lipids; site of lipid synthesis

*Rough ER contains ribosomes, Smooth ER does not contain ribosomes

Golgi apparatus - sorting
Vesicles - transports materials in and out of cell
Lysosome - digests foreign material
Mitochondria - produces ATP

DNA Nucleotides
ATCG
-Adenine (Thymine partner)
-Thymine
-Cytosine (Guanine partner)
-Guanine

RNA Nucleotides
AUCG
-Adenine (Uracil partner)
-Uracil (Thymine replaced by Uracil during DNA-mRNA transcription; becomes Adenine during
mRNA-tRNA translation)
-Cytosine (Guanine partner)
-Guanine

Mitosis-cell divison
composes 2 chromatid
centromere-where chromatid are connected
centrioles-also holds chromatids;helps in separation of chromatids into chromosomes
IPMAT
Interphase - preparation of cell for cell division
Prophase - chromatin condense into chromosome, centrioles move them into opposite ends
Metaphase - chromosomes are in the middles, align in the middles
Anaphase - start of cleavage, chromosomes separate to 2 set of chromosomes.chromosomes
move towards centrioles
Telophase - two cells made, cleavage more visible
Cytokinesis - physical separation of parental cell to two daughter cells

September 2, 2022 (Cell Division)

Mitosis - division of somatic cells in eukaryotic organisms. All cells except for gametes or sex
cells are somatic cells. A single cell divides into two identical daughter cells - Daughter cells
have the same number of chromosomes as does parent cell.
Cells have 23 pairs of chromosomes.

1. Interphase - preparation phase between cell divisions

Gap 1 - cells grow in size - organelles replicated
Synthesis - replication of DNA - synthesis of proteins associated with DNA
Gap 2 - synthesis of proteins associated with mitosis

Chromatin - uncondensed form of chromosomes

When the cell is preparing for division

Main phases of Mitosis

Once condensed mitosis occurs
1. Prophase - chromatin condense to form chromosomes prior to division
Each chromosomes is a single molecule of DNA
Centrioles (microtubule) go to opposite poles.
2. Metaphase - chromosome lines in the middle, centrioles have spindle fiber attached to the
chromosome. The spindle fiber pulls the chromosome towards opposite poles.
3. Anaphase - formation cleavage; sister chromatids split; the two chromatids are pulled toward
opposite poles
4. Telophase - cleavage is most prominent in this phase. chromosomes start to become
uncondensed. The nucleus forms.
Cytokinesis - physical separation of parental cells to two daughter cells.
plants - cell plate
animal - cleavage furrow

centrioles pull chromosomes until they split into two.

Meiosis - like mitosis, but cells undergo two division (1 becomes 2; then 2 becomes 4)
Girl - XX chromosomes
Boy - XY chromosomes
Meiosis 1 - diploid parent cell creates two haploid daughter cells; unlike in mitosis these are not
identical.
Meiosis 2 - creation of four haploid cells from the two haploid daughter cells
*Haploid refers to single set of chromosomes

Chromosomes come from parents

Prophase I
Crossing of gene sequence from alleles. Homologous chromosomes from parents form new
genetic combinations.
Why is there a crossing over of gene sequence? Greater variation of genetic sequence;
strengthens idea that each individual is unique

Metaphase - paired chromosomes line up in the middle

Anaphase - homologous chromosomes split

Telophase - Chromosomes are enclosed in nuclei

After which, Cytokinesis occurs

Haploid - one copy of each chromosome; designated as n, the number of chromosome in one
set; gametes(sex cells; egg cells and sperm cells)
Diploid - two sets of chromosomes (two of each chromosome); designate as 2n; somatic cells
Homologues - exists in two dipoid egg cells; happens in every chromosome except in sex
chromomse X and Y

Karyotype - an individual’s complete set of chromosomes

During sexual reproduction in humans, at fertilization, 23 chromosome are donated by each

parent

September 9, 2022 (Genes/DNA)

DNA replication not part of central dogma
Happens when it is used in cellular reproduction

DNA is a double-stranded helix

those helices contain sequence of nucleotides

DNA Nucleotides
adenine
thymine
cytosine
guanine
DNA is your body recipe; is you

The strands of the helix are unzipped or opened by DNA helicase. One sequence of nucleotides
of the DNA strand is replicated by the DNA polymerase and undergoes pairing.

central dogma - flow of genetic information

RNA pairing
Adenine - Uracil
Guanine - Cytosine

DNA pairing
Adenine - Thymine
Guanine -Cytosine

The DNA is too large to exit the nucleus; A process called transcription creates a template of a
single strand of DNA copied by mRNA. mRNA is translated into tRNA. tRNA is used to create
proteins.

Transcription - copies information from DNA to mRNA

Codon - sequence of three nucleotides

CODON WHEEL
 CODON CHART

Genetics and Inheritance

Gregor Mendel - father of Genetics
started studying pea plants. noticed hereditary

P1 - parents, number relates to generation

F1 - filial or offspring, number relates to generation

Discovered when he bred two tall plants had tall offsprings

Bred green pea pod and yellow pea pod. F1 had green offspring. These offspring became P2,
and produced an offspring with a yellow pea pod in F2.

23rd chromosomes are the sex chromosomes (determines an individual’s sex)

Phenotype - physically observed.

Genotype - incorporated in the gene

Dominant trait - powerful trait that shows up more often

Recessive trait - traits that sometimes disappear and show less often

Complete dominance - Dominant trait always cover up the recessive trait

Mendel did the same experiment with poppies. F1 all purple. F2 75% purple. There he
discovered complete dominance of the purple trait
Principal of Segregation - members of each pair of genes separate when gametes are formed

Alleles - different representation of a gene

Genes - units of heredity
Two dominant alleles = dominant
one dominant, one recessive = dominant
two recessive genes = recessive

Prophase 1 - crossing over of chromosomes

Locus - location of genome on a chromosome

Homozygous - organism has two alleles that have same trait; PP or pp

Heterozygous - organism has two alleles that have different trait; Pp

(Capital letter) P is dominant trait, (small letter) p is recessive trait

Codominant - occur when both alleles are visible in phenotype

incomplete dominance - blend of traits

Law of independent assortment - two or more pair of alleles separate independently during
the formation of gametes
Autosomal trait - comes from other non-sex chromosomes
Sex-linked trait - involves 23rd chromosome
Y-linked trait - only males will have copy of the allele

X - normal allele
Xa - X chromosome carrying recessive allele
XA - X chromosome carrying dominant allele

Pedigrees-term for mode of inheritance

Polygenic inheritance - inherit of one or more gene

Dihybrid cross - two organisms involved while looking at two different genes; uses 4x4 punnett
square and always produces a 9:3:3:1 ratio

Ribose - sugar of RNA

Deoxyribose - sugar of DNA

*Central dogma starts with transcription of mRNA, and translation to tRNA, then translation in
ribosome

DNA - combination of deoxyribose and nucleic acid

RNA - combination of ribose and nucleic acid
Multi-allele system
Some traits are the result of more than 2 alleles at a locus

Ex. ABO blood system

IA - produces A antigen, produces B antibody
IB - produces B antigen, produces A antibody
i - produces no antigen, produce both A and B antibodies

September 16, 2022(DNA structure)

DNA - combination of deoxyribose and nucleic acid

RNA - combination of ribose and nucleic acid

Phenotype - physically observed

Genotype - genetic code

*DNA is the code, RNA is the printer

Nucleic acid are made up of nucleotides

Nucleotides have 3 basic parts:
1. A 5-Carbon Sugar
2. Phosphate group
3. A nitrogenous base

Genomic DNA - total makeup of the human DNA

23 pairs or 46-number of chromosomes in humans

James Watson and Francis Crick - was awarded the nobel Prize for DNA
Rosalind Franklin - first to photograph DNA

Structure of DNA
1. Outside of twisted ladder are made of deoxyribose sugar and phosphates
2. The rungs of the ladder are nitrogenous bases.

Nitrogenous bases
-Adenine
-Thymine
-Cytosine
-Guanine

Nucleotides are nitrogenous bases attached to their carbon group

Major types Rna

mRNA (messenger RNA) - transcription

tRNA(transport RNA) - amino acids
rRNA(ribosomal RNA) - makes up ribosome

Protein synthesis starts at START codon

Methionine(Met)-most common start codon
Protein synthesis stops at STOP codon
DNA to mRNA to tRNA to Amino Acids

DNA: ATGAAAAGCAGGCCATATTAA
Complementary DNA strand/DNA pairing: TACTTTTCGTCCGGTATAATT
DNA to mRNA: AUGAAAAGCAGGCCAUAUUAA
mRNA to tRNA: UACUUUUCGUCCGGUAUAAUU
tRNA to Amino Acid: UAC-UUU-UCG-UCC-GGU-AUA-AUU
Tyr-Phe-Ser-Ser-Gly-Ile-Met(Start)