Archives of Physiology and Biochemistry

The Journal of Metabolic Diseases

ISSN: (Print) (Online) Journal homepage: https://www.tandfonline.com/loi/iarp20

Inhibition of notch signalling and mesangial

expansion by combined glucagon like peptide-1
agonist and crocin therapy in animal model of
diabetic nephropathy

Shaimaa Nasr Amin , Eman Mumtaz El-Gamal , Laila Ahmed Rashed , Samaa
Samir Kamar & Maged Ahmed Haroun

To cite this article: Shaimaa Nasr Amin , Eman Mumtaz El-Gamal , Laila Ahmed Rashed ,
Samaa Samir Kamar & Maged Ahmed Haroun (2020): Inhibition of notch signalling and
mesangial expansion by combined glucagon like peptide-1 agonist and crocin therapy
in animal model of diabetic nephropathy, Archives of Physiology and Biochemistry, DOI:
10.1080/13813455.2020.1846203

To link to this article: https://doi.org/10.1080/13813455.2020.1846203

Published online: 07 Dec 2020.

Submit your article to this journal

Article views: 5

View related articles

View Crossmark data

Full Terms & Conditions of access and use can be found at

https://www.tandfonline.com/action/journalInformation?journalCode=iarp20
ARCHIVES OF PHYSIOLOGY AND BIOCHEMISTRY
https://doi.org/10.1080/13813455.2020.1846203

ORIGINAL ARTICLE

Inhibition of notch signalling and mesangial expansion by combined glucagon

like peptide-1 agonist and crocin therapy in animal model of diabetic
nephropathy
Shaimaa Nasr Amina,b , Eman Mumtaz El-Gamalb, Laila Ahmed Rashedc, Samaa Samir Kamard
and
Maged Ahmed Harounb‡
a
Department of Basic Medical Sciences, Faculty of Medicine, Hashemite University, Zarqaa, Jordan; bDepartment of Medical Physiology,
Faculty of Medicine, Cairo University, Cairo, Egypt; cDepartment of Biochemistry, Faculty of Medicine, Cairo University, Cairo, Egypt;
d
Department of Histology and Cell Biology, Cairo University, Cairo, Egypt

ABSTRACT ARTICLE HISTORY

Diabetic nephropathy (DN) is one of the devastating complications in diabetes mellitus (DM). Received 28 April 2020
Glucagon-like peptide-1 (GLP-1) is one of the incretins secreted from L cells in the intestine. Crocin (a Revised 21 October 2020
carotenoid component of saffron) has antioxidants properties. We investigated the renal effects of Accepted 26 October 2020
Exendin-4 as a GLP-1 agonist and Crocin in DN. Published online 26 Novem-
ber 2020
Thirty male rats were divided into five groups: control, type II DM, type II DM þ Exendin-4, type II
DM þ Crocin and type II DM þ Exendine-4 þ Crocin. At the end of the experimental period, systolic KEYWORDS
and diastolic blood pressures were measured, and GFR was calculated. Blood and urine samples were Diabetic nephropathy; GLP-
collected for biochemical analysis. Tissue samples were collected from the kidney for histological 1 agonist; saffron; Crocin;
examination and biochemical measurements of protein expression. notch signalling
Treatment with GLP-1 agonist or Crocin caused a significant improvement in renal function. Better
results were achieved with simultaneous administration of both drugs with inhibition of notch signal-
ling pathway and the related proteins.

Introduction
Diabetic nephropathy (DN) is one of the devastating compli-
cations in diabetes mellitus (DM). The pathophysiological
mechanisms of DN are multifactorial involving immuno-
logical, inflammatory and microvascular abnormalities that
affect the levels and functions of advanced glycation end
products (AGEs) and their receptor; receptor of advanced gly-
cation end products (RAGE), asymmetric dimethylarginine
(ADMA), and intercellular adhesion molecule-1 (ICAM-1)
(Hazman and Bozkurt 2015; Yoon et al. 2016).
There are different proteins and natural substances that
showed a beneficial effect on glucose homeostasis including
glucagon-like peptide-1(GLP-1) and saffron. GLP-1 is one of
the incretins, augments glucose-induced insulin release from
pancreatic b-cells, suppresses glucagon secretion, and slows
gastric emptying. GLP-1 receptor agonist, Exendin-4, amelio-
rates albuminuria and glomerular hyperfiltration (Ozaki
et al. 2000).
The other substance with a protective action is Saffron;
the dried stigmata of the flowers of saffron. Crocin, crocetin,
and safranal are the primary active constituents of saffron.
Saffron, Crocin, crocetin, and safranal have high antioxidant
activities (Bahmani et al. 2016) and improve the insulin resist-
ance caused by a high-fat diet (Mahdavifard et al. 2016).
It is important to elucidate the molecular effects of the
proposed renoprotective agents on critical signalling path-
ways of DN like Notch signalling pathway (Benedito
et al. 2012).
The notch is a single-spanning transmembrane protein.
The cell interaction mechanism depends on interactions
between the Notch receptor expressed on the surface of one
cell, and membrane-bound ligands expressed on the surface
of its neighbours (Guruharsha et al. 2012).
Notch signalling activation requires interaction with other
signalling pathways like; hypoxia-inducible factor (HIF1),
transforming growth factor (TGF-b) and vascular endothelial
growth factor (VEGF) (Niranjan et al. 2009).
Notch signalling may be induced in mature podocytes by
high glucose as in DM, TGF, or ischaemia, and its activation
linked to podocyte dedifferentiation, glomerulosclerosis, and
apoptosis (Yoon et al. 2016).
Therefore, the current study aimed to investigate and
compare the renal protective effect of Exendin-4 as a GLP-1
agonist and Crocin in DN and demonstrate the molecular
mechanism for renal protection offered in DN and more

CONTACT Shaimaa Nasr Amin shaimaa599@yahoo.com Department of Basic Medical Sciences, Faculty of Medicine, Hashemite University, Zarqaa, Jordan;
Department of Medical Physiology, Faculty of Medicine, Cairo University, Cairo, Egypt

Department of Histology and Cell Biology, Armed Forces College of Medicine, Egypt
‡
Department of medical physiology, Faculty of Medicine, Modern University for Technology and Information Cairo, Egypt
ß 2020 Informa UK Limited, trading as Taylor & Francis Group
2 S. N. AMIN ET AL.
specifically we aimed to clarify the role of Notch signalling
and how the given renal protective agents affect
this pathway.
Materials and methods
The ethical and scientific committee of the Physiology
Department and Cairo University approved the research
protocol, experimental steps, animal handling, and
scarification.
Experimental animals and study groups
Thirty male albino rats, body weights ranging from 120 to
150 grams were used as animal models. The rats maintained
under the same environmental conditions with free access to
food and water at standard day time and dark cycles.
Animals acclimatised their environment for one week before
starting the experiment. Rats were divided randomly into the
following five groups (6 rats/group):
-Group I (Control group): fed on standard chow for the
entire study duration, received a vehicle.
-Group II (Type II DM) fed on a high-fat diet (HFD) (60%
Kcal fat) for two weeks followed by injection with a single
dose of streptozocin (STZ) (Sigma-Aldrich Chemical Co., St.
Louis, MO, USA) (45 mg/kg) intraperitoneal (i.p) dissolved in
freshly prepared 0.1 M citrate buffer (pH ¼ 4.5) (Okoduwa
et al. 2017) with no further treatment. We supplied a 5% glu-
cose solution orally to the rats to prevent hypoglycaemia
during the first 24 h following the STZ injection. After one
week, we measured the blood glucose, and rats with blood
glucose levels of more than 200 mg/dl enrolled in the study
(Kaur et al. 2017).
-Group III (DM þ Exendin-4): treated with Exendin-4 as a
GLP-1 agonist (Sigma-Aldrich Chemical Co., St. Louis, Mo,
USA) in Phosphate buffered saline (10 lg/kg body weight)
for four weeks by subcutaneous injection in the morning
once daily (Boshra and Elkashef 2017).
-Group IV (DM þ Crocin): treated with Crocin (Sigma-
Aldrich Chemical Co., St. Louis, Mo, USA), the active ingredi-
ent of saffron (100 mg/kg) for four weeks by IP (Shirali
et al. 2013).
Group V-DM þ Exendin-4þ Crocin: treated with Exendin-4
and Crocin in the same doses and duration as in group III
and IV.
Diagnosis of diabetic nephropathy onset
After induction of diabetes, rats left untreated to induce early
DN (Morsy et al. 2014). After four weeks, albumin: creatinine
ratios on morning spot urine collections calculated. Values
higher than 30 mg albumin/g creatinine considered to have
DN (Haneda et al. 2015).
Blood pressure measurement
The tail-cuff technique is a non-invasive method to measure
systolic pressure in rats. Animals warmed for 30 min at 28  C
in a thermostatically controlled heating cabinet (Ugo Basile,
Italy) for better detection of tail artery pulse, the tail passed
through a miniaturised cuff, and a tail-cuff sensor connected
to an amplifier (model ML 125 NIBP, AD instruments Pty.
Ltd., Sydney, Australia) and BP recorded on a chart (Irvine
et al. 1997).
Blood samples were collected from retro-orbital venous
sinuses to measure serum glucose, insulin, Blood urea nitro-
gen, creatinine, and copeptin. After blood samples collection
for biochemical measurements, rats sacrificed, and euthan-
asia measures followed. Kidneys were removed and blotted
using filter paper to remove traces of blood. The right kid-
neys were prepared for histopathological examination and
the left kidneys taken for biochemical measurements.
Biochemical measurements
Measurement of Fasting Blood Glucose: The blood glucose
assayed by the method adopted by Trinder (1975). The kits
were supplied by Diamond Diagnostics, Cairo, Egypt.
Measurement of serum insulin by enzyme-linked immuno-
assay (ELISA) kits (DRG, USA) according to the manufacturer’s
instructions.
Homeostasis Model Assessment of insulin resistance
(HOMA-IR):
HOMA ¼ glucose (mmol/dL) x insulin (mIU/mL)]/22.5.
HOMA value of more than 4.0 is an index for insulin
resistance (Becker et al. 2005).
Measurement of blood urea nitrogen: Serum urea was esti-
mated by the QuantiChromTM Urea Assay kit (DIUR-500,
USA) according to manufacturer instructions.
Measurement of serum and urine creatinine: Serum and
urine creatinine estimated by QuantiChromTM creatinine
Assay Kit.
Measurement of Urinary albumin execration: urine samples
collected for twenty-four hours using metabolic cages.
Before this stage, rats were fed once before being deprived
of food for one day, yet, still have free access to water.
Assessment of urinary albumin by using Albuwell M Kit:
Murine Microalbuminuria ELISA (DiaComp, USA).
Urine protein Spot test (urine albumin creatinine ratio):
Albumin creatinine ratio (ACR) is a ratio between albumin
(reported in mg/dl) and creatinine (reported in g/dl).
Albuminuria is diagnosed when ACR is higher than 30 mg
albumin/g creatinine (Haneda et al. 2015).
We calculated ACR after 4 weeks of induction of DM
(ACR1) and at the end of the work (ACR2).
Calculation of glomerular filtration rate (GFR): Using modi-
fied Cockcroft-Gault equation for GFR calculation, Creatinine
clearance: Ccr ¼ (Cu/Cs)  V [Cu: concentration of creatinine
in the urine, Cs: the concentration of creatinine in serum,
and V: the urine flow rate in milliliters/minute] (Adewole
et al. 2010).
Measurement of plasma copeptin: By ELISA Kit
(MyBioSource, USA) according to manufacturer’s instructions
Measurement of kidney RAGE, ICAM-1, ADMA: by using
ELISA Kit for RAGE, ICAM-1, and ADMA (kits supplied by
MyBioSource, USA).

Table 1. PCR primer sequence.
Name Sequence
Jagged1 forward primer: 50 AACTGGTAC-CGGTGCGAA30
reverse primer: 50 TGATGCAAGATCTCCCTGAAAC3,
HES-1 forward primer: 50 CGACACCGGACAAACCA-AA30
reverse primer: 50 GAATGTCTGCCTTCTCCAGCTT30
DL4 forward primer, 50 - CTGCCTGCCTGGATGTGAT 30
reverse primer, 50 - AGACAGCCTGGATAGCGGATA 30
HEY-1 forward primer: 50 - AAGAAGGACCTCCGGCTCT 30
reverse primer, 50 -TGACTCAGAATCTGGC5GTATTTC-30
b-actin forward primer, 50 - AAGCCACCCCACTTCTCTCTAA 30
reverse primer, 50 -AATGCTATCACCTCCCCTGTGT-30
HES-1: hairy and enhancer of split; DL4: delta-like 4; Hey1: hairy/enhancer-of-
split related with YRPW motif protein 1.
Measurement of kidney NO product: measured by
Colorimetric Determination (Montgomery and Dymock 1961).
Real-Time PCR
RNA extraction and reverse transcription RNA was extracted
from tissue using the ToTAL LY RNA Kit protocol and
reagents (Ambion, Austin, TX). RNA integrity and quantity
were assessed on Nano Lab Chip Kit (Agilent Technologies).
Reverse transcription performed using the AMV reverse tran-
scriptase kit (A3500; Promega) according to manufacturer’s
instruction.
Real-time PCR analysis real-time PCR performed using
step one plus System (Applied Biosystems). For the PCR step,
SYBR Green 1 Buffer (Applied Biosystems), forward and
reverse primers used shown in Table 1, and complementary
DNA template. Real-time PCR was run for 1 cycle (508 C for
2 min, 958 C for 10 min) followed by 40 cycles (958 C for 15 s,
608 C for 60 s),. Data were analysed using a comparative crit-
ical threshold (Ct) method in which the amount of target
normalised to the amount of endogenous control relative to
control value (Applied Biosystems).
Detection of VEGF and TGF BETA
They were detected by ELISA kit supplied by MyBiosource
(San Diego, USA) according to the manufacturer’s instruction.
Western blot analysis
UsingV3 Western Workflow Complete System, Bio-Rad
Hercules, CA, USA): Briefly, proteins were extracted from tis-
sue homogenates using ice-cold radioimmunoprecipitation
assay buffer supplemented with phosphatase and protease
inhibitors (50 mmol/L sodium vanadate, 0.5 mM phenylme-
thylsulphonyl fluoride, 2 mg/mL aprotinin, and 0.5 mg/mL
leupeptin), then centrifugation at 12,000 rpm for 20 min. The
protein concentration for each sample was determined using
the Bradford assay. Equal amounts of protein (20–30 mg of
total protein) were separated by SDS/polyacrylamide gel
electrophoresis (10% acrylamide gel) using a Bio-Rad Mini-
Protein II system. The protein transferred to polyvinylidene
difluoride membranes (Pierce, Rockford, IL, USA) with a Bio-
Rad Trans-Blot system. After transfer, the membranes were
washed with PBS and were blocked for one h at room
ARCHIVES OF PHYSIOLOGY AND BIOCHEMISTRY 3
temperature with 5% (w/v) skimmed milk powder in PBS.
The manufacturer’s instructions followed for the primary anti-
body reactions. Following blocking, the blots developed
using antibodies for notch and beta-actin supplied by
(Thermo scientific, Rockford, Illinois, USA) incubated over-
night at pH 7.6 at 4  C with gentle shaking. After washing,
peroxidase-labeled secondary antibodies were added, and
the membranes incubated at 37  C for 1 h. Band intensity
was analysed by the ChemiDocTM imaging system with
Image LabTM software version 5.1 (Bio-Rad Laboratories Inc.,
Hercules, CA, USA). The results expressed as arbitrary units
after normalisation for b-actin protein expression
Histological examination
Kidney specimens were obtained, sectioned, and immediately
fixed in 10% formol saline for 24 h. Paraffin blocks were proc-
essed, and 5 lm thick sections were subjected to
Haematoxylin and Eosin (H&E) to elucidate the morpho-
logical changes and Periodic acid Schiff (PAS) reaction coun-
terstained with haematoxylin (Bancroft and Gamble 2008).
Morphometry: Using "Leica Qwin 500 C" image analyser
(Cambridge, UK), assessment of the area percent (%) of the
glomerular mesangium in PAS stained sections measured in
10 non-overlapping high power fields (x400)/rat.
Statistical analysis
By SPSS 21(IBM SPSS Statistics 21; IBM Corporation, New
York, USA), data expressed as mean ± standard deviation
(Mean ± SD), a comparison of quantitative variables between
the groups done using analysis of variance (ANOVA) with
Bonferroni post hoc test. Results were considered statistically
significant at p  0.05 (Altman 2005).
Results
Table 2 demonstrates blood pressure measurements in the
studied group:
-Systolic blood pressure was significantly increased (p 
.05) in the diabetic group compared to the control group.
Treatment with Exendin-4 or Crocin or simultaneous adminis-
tration of both drugs significantly decreased (p  .05) sys-
tolic blood pressure compared to the diabetic group but
could not return SBP to average values.
-Diastolic blood pressure was significantly increased (p 
.05) in the diabetic group compared to the control group.
Treatment with Exendin-4 or Crocin or simultaneous adminis-
tration of both drugs significantly decreased (p  .05) dia-
stolic blood pressure compared to the diabetic group, but
only simultaneous administration of both drugs returned
DBP to normal.
-Mean blood pressure was significantly increased (p  .05)
in the diabetic group compared to the control group.
Treatment with Exendin-4 or Crocin or simultaneous adminis-
tration of both drugs significantly decreased (p  .05) mean
blood pressure compared to the diabetic group, but only
4 S. N. AMIN ET AL.

Table 2. Arterial blood pressure measurement and glomerular filtration rate in the studied groups.
Group I Group II Group III Group IV Group V
SBP (mmHg) 115.667 ± 3.669 160.667 ± 6.282
137.333 ± 2.732
# 137.833 ± 3.544
# 133.667 ± 6.532
#
(
P¼.000) (
#P¼.000) (
#P¼.000) (
#P¼.000)
DBP (mmHg) 86.167 ± 6.675 118.667 ± 3.614
105.333 ± 1.366
# 96.333 ± 2.875
#$ 93.167 ± 5.344 #$
(
P¼.000) (
#P¼.000) (
P¼.005/#P¼.000/$P¼.016) (#P¼.000/$P¼.001)
MBP (mmHg) 95.833 ± 4.792 276.00 ± 11.171
116.00 ± 1.788
# 110.167 ± 3.060
# 106.667 ± 5.428 #
(
P¼.000) (
#P¼.000) (
P¼.005/#P¼.000) (
#P¼.000)
GFR (ml/min/ kg) 19.226 ± 6.206 3.944 ± 1.830
7.350 ± 1.988
5.113 ± 3.246
22.099 ± 13.09#$^
(
P¼.006) (
P¼.05) (
P¼.012) (#P¼.001/$P¼.008/^P¼.002)
Group I: control; Group II: DM; Group III: DM þ Exendin-4; Group IV: DM þ Crocin; Group V: DM þ Exendin-4 þ Crocin.
SBP: systolic blood pressure; DBP: diastolic blood pressure; MBP: mean blood pressure; GFR: glomerular filtration rate.

Significant compared to control at p  .05.
#
Significant compared to T2DM group at p  .05.
$
Significant compared to T2DM þ GLP-1 at p  .05.

Significant compared to T2DM þ Crocin at p  .05.

Table 3. Serum and urine biochemical measurements in the studied groups.

Group I Group II Group III Group IV Group V
Serum glucose (mg/dl) 94.233 ± 13.350 270.533 ± 42.600
140.083 ± 27.477
# 173.517 ± 15.322
# 108.783 ± 10.646#^
(
P¼.000) (
P¼.038/#P¼.000) (
#P¼.000) (#P¼.000/^P¼.001)
Serum Insulin (uIU/l) 6.951 ± 1.465 18.366 ± 3.521
11.033 ± 1.607
# 10.100 ± 1.457# 8.803 ± 1.360#
(
P¼.000) (
P¼.020/#P¼.000) (
#P¼.000) (
#P¼.000)
HOMA-IR 1.639±.502 12.192 ± 2.699
3.835±.982# 4.158±.710
# 1.636±.303#^
(
P¼.000) (
#P¼.000) (
P¼.034/#P¼.000) (
P¼.000/^P¼.034)
Blood urea nitrogen (mg/dl) 39.017 ± 11.133 92.800 ± 18.783
64.250 ± 9.465
# 72.717 ± 8.800
54.367 ± 8.575#
(
P¼.000) (
P¼.012/#P¼.004) (
P¼.001) (#P¼.000)
Serum creatinine (mg/dl) .163±.047 1.468±.502
.555±.201# .635±.082
# .365±.134#
(
P¼.000) (#P¼.000) (
P¼.034/#P¼.000) (#P¼.000)
Serum copeptin (ng/ml) 15.233 ± 2.977 97.133 ± 12.123
50.383 ± 13.432
# 58.203 ± 10.582
# 32.033 ± 12.423#^
(
P¼.000) (
#P¼.000) (
#P¼.000) (#P¼.000/^P¼.004)
ACR 1 (mg/g) 9.524±.450 32.870 ± 3.310
29.760 ± 4.565
31.578 ± 2.906
30.712 ± 1.435

(
P¼.000) (
P¼.000) (
P¼.000) (
P¼.000)
ACR2 (mg/g) 10.293 ± 1.190 61.948 ± 7.539
33.702 ± 4.181
# 48.581 ± 1.7786
$# 18.002 ± 1.58
#$^
(
P¼.000) (
#P¼.000) (
#$P¼.000) (
P¼.028/#$^P¼.000)
Group I: control; Group II: DM; Group III: DM þ Exendin-4; Group IV: DM þ Crocin; Group V: DM þ Exendin-4 þ Crocin; RAGE: receptors for glycation end products,
ICAM 1: intercellular adhesion molecule-1; ADMA: asymmetric dimethyl argentine; NO: nitric oxide, ACR1: albumin creatinine ratio 4 weeks after induction of dia-
betes mellitus; ACR2: albumin creatinine ratio at the end of the work.

Significant compared to control at p  .05.
#
Significant compared to T2DM group at p  .05.
$
Significant compared to T2DM þ GLP-1 at p  .05.

Significant compared to T2DM þ Crocin at p  .05.

simultaneous administration of both drugs returned MBP
to normal.
-GFR was significantly decreased (p  .05) in the diabetic
group compared to the control group. Simultaneous admin-
istration of both drugs significantly increased (p  .05) GFR
compared to the diabetic group and compared to treatment
with each drug alone.
Table 3 shows the results of serum and urine biochemical
measurements:
-The serum glucose level was significantly increased (p 
.05) in the diabetic group compared to the control group.
Treatment with Exendin-4or Crocin or simultaneous adminis-
tration of both drugs significantly decreased (p  .05) serum
glucose compared to the diabetic group, with only simultan-
eous administration of both drugs returned serum glucose to
average values.
-Serum insulin level and HOMA-IR were significantly
increased (p  .05) in the diabetic group compared to the
control group. Treatment with Exendin-4 or Crocin or simul-
taneous administration of both drugs significantly decreased
(p  .05) serum insulin and HOMA-IR compared to the dia-
betic group. Treatment with Exendin-4 and simultaneous
administration of GLP-1 agonist and Crocin returned HOMA-
IR to near normal and control levels, respectively.
-Albumin creatinine ratio1 (after four weeks of induction
of DM) was significantly increased (p  .05) in all four groups
compared to the control group. No significant difference in
albumin creatinine ratio (p  .05) between the four groups.
-Albumin creatinine ratio2 (at the end of the experiment;
after eight weeks of DM) significantly increased (p  .05) in the
diabetic group compared to the control group. Treatment with
Exendin-4 or Crocin or simultaneous administration of both
drugs significantly decreased (p  .05) albumin creatinine ratio
compared to the diabetic group but still significantly increased
(p  .05) compared to control group. Treatment with Crocin
alone significantly increased (p  .05) albumin creatinine ratio
compared to treatment with Exendin-4. Combined treatment
significantly decreased (p  .05) albumin creatinine ratio com-
pared to treatment with each separate drug.
-Blood urea nitrogen, serum creatinine, and copeptin
were significantly increased (p  .05) in the diabetic group
compared to the control group. Treatment with Exendin-4
alone and combined treatment by GLP-1 agonist and Crocin
significantly decreased (p  .05) blood urea nitrogen and
plasma creatinine compared to the diabetic group.
-Table 4 shows the measurements of renal biochemical
measurements (notch1, JAGGED1, DL4, HES1, HEY1), TGF-b,
VEGF, RAGE, ICAM-1, and ADMA: there was as significant (p
 ARCHIVES OF PHYSIOLOGY AND BIOCHEMISTRY 5

Table 4. Kidney biochemical measurements in the studied groups.

Group I Group II Group III Group IV Group V
NOTCH1(Relative Expression) 1.006±.01033 6.616 ± 1.2205
3.258±.27279
# 3.350±.59582
# 1.636±.27869#$^
(
P¼.000) (
#P¼.000) (
#P¼.000) (P#^.000/$P¼.002)
JAGGED1(Relative Expression) 1.0067±.008 6.410±.694
3.7017±.2778
# 3.4967±.557
# 2.65±.333
#$^
(
P¼.000) (
#P¼.000) (
#P¼.000) (
#^P¼ .000 /$P¼.003)
DL4(Relative Expression) 1.01±.01549 8.35 ± 1.11669
4.093±.23619
# 4.33±.46332
# 3.038±.6741
#$^
(
P¼.000) (
#P¼.000) (
#P¼.000) (
#P¼.000/$P¼.007/^P¼.014
HES1(Relative Expression) 1.001±.00408 6.083±.702
2.783±.47504
# 3.250±.62530
# 1.905±.2781
#$^
(
P¼.000) (
#P¼.000) (
#P¼.000) (
P¼.019/#P¼.000/$P¼.002/^P¼.021)
HEY1(Relative Expression) 1.0033±.008 5.1833±.904
2.6683±.22807
# 2.6900±.3885
# 2.1700±.21194
#
(
P¼.000) (
#P¼.000) (
#P¼.000) (
#P¼.000)
TGF-b (pg/mg protein) 58.46 ± 5.90 159.11 ± 18.57
87.5 ± 2.501
# 95.75 ± 6.8570
# 74.43 ± 9.082#$^
(
P¼.000) (
#P¼.000) (
#P¼.000) (#P¼.000/$P¼.077/^P¼.010)
VEGF (pg/mg protein) 34.13 ± 3.0237 111.13 ± 7.56
62.53 ± 10.57
# 52.70 ± 3.7218
# 48.71 ± 3.79
#$
(
P¼.000) (
#P¼.000) (
P¼.001/#P¼.000) (
P¼.044/#P.000/$P¼.049)
RAGE (pg/mg protein) 96.333 ± 14.112 207.467 ± 18.359
137.783 ± 15.305
# 142.617 ± 17.141
# 121.367 ± 13.387#
(
P¼.000) (
P¼.001/#P¼.000) (
#P¼.000) (#P¼.000)
ICAM 1 (pg/ml) 30.233 ± 5.867 128.836 ± 24.655
71.800 ± 12.002
# 84.583 ± 4.889
# 49.666 ± 12.954 #^
(
P¼.000) (
#P¼.000) (
#P¼.000) (#P¼.000/ ^P¼.002)
ADMA (ng/mg protein) 2.558±.657 13.150 ± 4.291
6.768 ± 2.251# 7.090 ± 1.241
# 3.995 ± 1.715#
(
P¼.000) (#P¼.001) (
P¼.030/#P¼.002) (#P¼.000)
NO product (nmol/mg protein) 27.116 ± 7.659 8.323 ± 1.580
15.333 ± 2.802
# 13.583 ± 2.819
17.550 ± 3.035
#
(
P¼.000) (
P¼.000/#P¼.047) (
P¼.000) (
P¼.005/#P¼.007)
Group I: control; Group II: DM; Group III: DM þ Exendin-4; Group IV: DM þ Crocin; Group V: DM þ Exendin-4 þ Crocin; RAGE: receptors for glycation end products;
ICAM 1: intercellular adhesion molecule -1; ADMA: asymmetric dimethyl argentine; NO: nitric oxide.

Significant compared to control at p  .05.
#
Significant compared to T2DM group at p  .05.
$
Significant compared to T2DM þ GLP-1 at p  .05.

Significant compared to T2DM þ Crocin at p  .05.

Figure 1. Relative expression of renal notch1 by western blot analysis.

6 S. N. AMIN ET AL.
 .05) increase of their relative expression in diabetic group
compared to control. Treatment with either Exendin-4 or
Crocin significantly (p  .05) decreased the expression of
these proteins compared to the diabetic group; however, the
expression was significantly (p  .05) increased compared to
control. Simultaneous treatment with both drugs showed a
synergistic effect, and the expression of notch1 (Figure 1),
TGF-b, RAGE, ICAM 1, and ADMA was restored to normal.
-NO product was significantly decreased (p  .05) in the
diabetic group compared to the control group. Only the sim-
ultaneous administration of both drugs significantly
increased (p  .05) NO product compared to the dia-
betic group.
Histological analysis of diabetic renal sections (Group II)
demonstrated dilated Bowman’s space, inflammatory cells
infiltration, and degenerated vacuolation of the tubular epi-
thelium with sloughed epithelium in the lumen. Treatment
of diabetic rats with Exendin-4 (Group III) or Crocin (Group
IV), displayed amelioration of renal injury, yet mild tubular
dilatation with few sloughed cells. Combined treatment with
Exendin-4 agonist and Crocin (Group V) provided further pro-
tection of the kidney indicated by the restoration of renal
histology and architecture (Figure 2).
Figure 3 illustrates a substantial increase in the mesangial
matrix deposition and destruction of the brush border of the
tubular epithelium in the diabetic group (Group II).
Application of GLP-1 agonist (Group III) or Crocin (Group IV)
demonstrated moderate protection of the renal tissue indi-
cated by a decrease in the mesangial expansion and pre-
served brush border. However, Group V (diabetic þ Exendin-4
þCrocin) illustrated the full protection of the renal cortex
from diabetic injury.
Quantitative analysis of the PAS-positive (þve) mesangial
matrix showed significantly increased mean area % of the
mesangial expansion in the diabetes group. Meanwhile,
Exendin-4 and Crocin treatment significantly ameliorated the
mesangial matrix expansion compared to the diabetic group.
However, combined Exendin-4 and Crocin treatment eluci-
dated a significant decrease in the mesangial expansion as
compared to Group 2, 3, and 4 (Figure 4).
Discussion
In this work, we compared the protective effects of Crocin,
Exendin-4 as a GLP-1 agonist and a combination of
Crocin þ exendin-4 to treat DNand evaluated the molecular
changes especially on notch signalling pathway proteins and
other markers and measurements involved in the patho-
physiology of DN. We showed a protective effect for both
drugs and more protection offered with simultaneous ther-
apy by Crocin and Exendin-4. The protective effects are
reflected by the changes in the measured parameters
(physiological, biochemical, and histological) as following:
In our study, vascular effects as reflected by measurement
of blood pressure and calculation of GFR showed that; sys-
tolic, diastolic, and mean blood pressures were significantly
increased (p  .05) in the diabetic group compared to the
control group. There is an association between the
development of DN and higher systemic pressures (Arauz-
Pacheco et al. 2002), which may be explained by the failure
of insulin to stimulate the secretion of NO by endothelial
cells (Ginsberg 2000).
Treatment with Exendin-4 caused a significant decrease (p
 .05) in systolic, diastolic, and mean blood pressures com-
pared to the diabetic group. Golpon et al. (2001) proposed
direct dilatory effects on peripheral vasculature by GLP-
through NO. Moreover, Yu et al. (2003) reported a diuretic
and natriuretic effects of GLP-1. Also, exogenous GLP-1
reduced circulating angiotensin II levels (Skov et al. 2013).
Treatment with Crocin significantly decreased (p  .05)
systolic, diastolic, and mean blood pressures compared to
the diabetic group, which agrees with Fatehi et al. (2003),
where Saffron extract reduced the blood pressure in a dose-
dependent manner. Another study by Imenshahidi et al.
(2010) reported that aqueous extract of saffron reduced the
MBP and suggested that both heart function and blood ves-
sels involved in this effect.
We revealed that better control of blood pressure (SBP,
DBP, and MBP) was achieved with simultaneous administra-
tion of both Exendin-4 and Crocin.
GFR was significantly decreased (p  .05) in the diabetic
group compared to the control group, and this is in accord-
ance to Fernandes et al. (2016). Oxidative stress can promote
the formation of vasoactive mediators, causing renal vaso-
constriction or decreasing the glomerular capillary ultrafiltra-
tion coefficient (Craven et al. 1992).
In our study, treatment with Exendin-4 or Crocin alone
causes a non-significant increase in GFR compared to the
diabetic group. However, Simultaneous administration of
both drugs significantly increased (p  .05) GFR compared to
the diabetic group and compared to treatment with each
drug alone. In accordance with our results, a study by
Thomson et al. (2013) found that GLP-1 agonists caused GFR
to increase due to the vasodilation of the glomerulus.
Moreover, Mahmoudzadeh et al. (2017) reported that ischae-
mia-reperfusion with pre-treatment with saffron extract
caused a significant increase in GFR.
Our results of the biochemical indicators that reflect the
glucose homeostasis and degree of renal dysfunction sup-
ported the protective effect of the given therapy.
Diabetic rats had significantly (p  .05) elevated blood
glucose and insulin compared to the control group. Exendin-
4 treatment significantly (p  .05) decreased blood glucose
level and insulin compared to the diabetic group. The effect
of Exendin-4 on blood glucose level found in our study
agrees with a study by Lotfy et al. (2014) and Kapucu (2020);
however, their study contrasted with ours regarding the
effect of GLP-1 agonist on serum insulin. Furthermore, Wu
et al. (2016) found that exenatide significantly decreased
serum insulin compared to control or diabetic rats.
GLP-1 agonist enhances glucose-dependent insulin syn-
thesis by beta cells, decreases glucagon production, and
slows gastric emptying time (Ozaki et al. 2000). Moreover,
GLP-1 potentiates Ca2þ-dependent exocytosis in isolated
human b cells (Drucker 2006).
 ARCHIVES OF PHYSIOLOGY AND BIOCHEMISTRY 7

Figure 2. Photomicrograph of H&E stained sections of renal cortex (400) (scale bar 20).

Figure 3. Photomicrograph of PAS stained sections of renal cortex (400) (scale bar 20).

In our study, the HOMA-IR in the Exendin-4 treated group
rats was significantly (p  .05) lower than that in the diabetic
group. Our results agree with a study by Wu et al. (2014).
We showed that treatment with Crocin significantly
decreased (p  .05) serum glucose, serum insulin, and
HOMA-IR compared to the diabetic group. Our findings
agree with Shirali et al. (2013); however, it was against what
is demonstrated by Kianbakht and Hajiaghaee (2011).
Saffron extract produces hypoglycaemia by reducing insu-
lin resistance (Xi et al. 2007), stimulating glucose uptake by
peripheral tissues, and inhibition of intestinal glucose absorp-
tion (Youn et al. 2004).
In our study, treatment with Exendin-4 or Crocin alone
did not normalise blood glucose, but the simultaneous
administration of both drugs returned serum glucose to
average values. Also, treatment with Exendin-4 or Crocin
alone decreased serum insulin and HOMA-IR, but more
decrease with simultaneous administration of both drugs.
In this work, blood urea nitrogen and serum creatinine
were significantly increased (p  .05) in the diabetic group
8 S. N. AMIN ET AL.
Figure 4. Morphometry of mean area% of mesangial expansion in PAS stained sections of renal cortex.
compared to the control group. Treatment with Exendin-4
significantly decreased (p  .05) blood urea nitrogen and
serum creatinine compared to the diabetic group, which
agrees with a study by El-Gohary and Said (2016). We also
found that; treatment with Crocin decreased blood urea
nitrogen (non-significant) and significantly (p  .05)
decreased plasma creatinine compared to the diabetic group.
These results are in agreement with Altinoz et al. (2015).
We reported a significant increase in urinary albumin
excretion (UAE) (p  .05) in the diabetic group compared to
the control group, and Exendin-4 treatment significantly (p 
.05) reduced UAE, and therefore, albumin creatinine ratio
(ACR) compared to diabetic group. This finding agrees with a
study by Kodera et al. (2011). Treatment with Crocin in this
work significantly (p  .05) decreased UAE and, therefore,
ACR compared with that of the diabetic group, which is in
agreement with Li et al. (2017). These data indicate that
Exendin-4 and Crocin relatively decrease renal dysfunction
and damage that develop in DN.
Copeptin, the stable COOH-terminal portion of the precur-
sor of vasopressin, is an easily measurable marker of vaso-
pressin. Plasma copeptin and vasopressin correlate strongly
over a wide range of osmolalities (Balanescu et al. 2011). In
our study, plasma copeptin significantly increased (p  .05)
in the diabetic group compared to the control group. Similar
to our results, Velho et al. (2013) demonstrated that high
plasma copeptin concentration is strongly associated with
the risk of severe renal outcomes in type II diabetes.
We found that treatment with Exendin-4 significantly
decreased (p  .05) plasma copeptin compared to the dia-
betic group; this is in contrast to what is reported by
Frøssing et al. (2018) who investigated the effect of liraglu-
tide on plasma copeptin level in polycystic ovary syndrome
and reported no change in levels of copeptin in the liraglu-
tide group compared with placebo.
Glycation reaction is the modification of proteins by
reducing sugars, and then progressive modification occurs
with the formation of irreversible cross-links. These molecules
are called AGEs. The cellular effect of AGEs mediated by
specific receptors (RAGE) (Yan et al. 2003). AGE and RAGE
interaction stimulates oxidative stress, inflammation, and
renal damage architecture in diabetes (Reiniger et al. 2010).
The simultaneous administration of Exendin-4 and Crocin
caused more decrease in kidney RAGE agrees with
Samarghandian et al. (2014). This effect of Crocin may be
related to its antioxidant potential, its serum Glucose lower-
ing function, or its function as an inhibitor of protein glyca-
tion (Shirali et al. 2013).
NO is a paracrine mediator that inhibits inflammatory
reactions in vessels and exerts anti-thrombogenic and endo-
thelial cell-protective properties (Yamagishi and Matsui 2011)
so, impaired production of NO plays a role in vascular com-
plications in diabetes.
Oxidative stress (OS) lowers the production of NO and
enhances degradation (Mortensen and Lykkesfeldt 2014).
During the early phases of nephropathy, NO increased, which
may contribute to hyperfiltration and microalbuminuria in
this phase. As the duration of exposure to the DM increases,
factors that suppress NO bioavailability eventually prevail
(Prabhakar 2004).
Einbinder et al. (2016) demonstrated an up-regulation of
endothelial nitric oxide synthase) eNOS (expression after
GLP-1 treatment, indicating that GLP-1 may improve the
endothelial dysfunction in diabetes, which is in accordance
with our results.
Yosri et al. (2017) observed that Crocin increased antioxi-
dant defences, the suppressed incidence of oxidative stress,
and recovered proinflammatory cytokines to normal.
Endogenous NOS inhibitors, in particular, ADMA, increased
in chronic kidney diseases, including DN. The kidney partici-
pates in the elimination of endogenous ADMA (Baylis 2008).
Increased serum ADMA concentration in DM may be a
consequence of decreased ADMA degradation or through an
axis that induces the secretion of proinflammatory cytokines
(Za
ciragic et al. 2014).
In agreement with our study, Ojima et al. (2013) revealed
that AGEs significantly increased ADMA-modified protein lev-
els in tubular cells, and the treatment with GLP-1agonist

prevented that by the cAMP pathway. Moreover, Guo et al.
(2014) found that Quercetin prevented ADMA-induced apop-
totic endoplasmic reticulum stress pathway activation.
ICAM-1 is an intercellular adhesion molecule involved in
atherogenesis. Increased circulating ICAM-1 plasma levels in
type II DM patients with or without vascular complications.
AGE’s interaction with RAGE increases ROS in cells and stimu-
lates the expression of adhesion molecules in endothelial
cells such as ICAM-1 (Yan et al. 2003).
A study by Sancar-Bas et al. (2015) in which Exendin-4
attenuated the levels of proinflammatory cytokines, chemo-
kine monocyte chemoattractant protein-1(MCP-1), ICAM-1,
prevented macrophage infiltration and decreased oxidative
stress and NF-jB activation in kidney tissue (Kodera et al.
2011). We showed that; Crocin significantly decreased (p 
.05) ICAM-1 level compared to the diabetic group, which is
in agreement with a study by Xiang et al. (2006).
The molecular effects of the GLP-1 agonist Exendin-4 and
Crocin have been evaluated on notch signalling pathway as
revealed by estimation of the related signalling proteins:
notch1, JAGGED1, DL4, HES1, HEY1, TGF-b, VEGF, RAGE,
ICAM-1, and ADMA significantly (p  .05) increased in dia-
betic group compared to control. Treatment with either
Exendin-4 or Crocin significantly (p  .05) decreased the
expression of these proteins compared to the diabetic group;
however, the expression was significantly (p  .05) increased
compared to control. Simultaneous treatment with both
drugs showed a synergistic effect, and the expression of
notch1, TGF-b, RAGE, ICAM 1, and ADMA was restored
to normal.
Notch signalling inhibition promotes the health of islet
cells and affecting insulin production and secretion and
decreases FoxO1-driven hepatic glucose output (Billiard et al.
2018). These effects may explain the best glucose homeosta-
sis and insulin sensitivity when both drugs are simultan-
eously administered.
Pathogenic Notch signalling in the tubular cells may occur
in the DM due to TGF-b induced expression of Jag1, which
produces tubulointerstitial fibrosis (Bielesz et al. 2010).
Furthermore, Notch1 and phosphatase and tensin homo-
log deleted on chromosome ten (PTEN) signalling linked to
fibrosis. In diabetes, fibrosis is enhanced through the Notch1
pathway via Hes1, together with inhibition of the PTEN and
autophagy (Liu et al. 2018).
ICAM-1 downregulation by Crocin in this study is sug-
gected to be the result of its Monocyte chemoattractant pro-
tein–1 (MCP-1) as it decreases serum level of MCP-1 which
has a positive impact on cell adhesion and inflammation
(Abedimanesh et al. 2020).
Furthermore; The effect of Crocin in our study on TGF-b
may be related to its effect on PTEN; Kapucu (2020) showed
that crocin increased the expression of PTEN and he sug-
gested that as one of the renoprotective effects against
injury induced by diabetes as PTEN downregulation is
involved in pathogenesisi of DN.
Nephropathy is part of the microvascular complication
group of diabetes in a process involving notch signalling
activation (Fioretto et al. 2008). Notch signalling regulates
ARCHIVES OF PHYSIOLOGY AND BIOCHEMISTRY 9
angiogenesis in malignant tumours and ischaemia. The
effective new vessel needs a delicate balance that is needed
between the sprouting of new vessels and the maintenance
of the developing vascular tube. Notch signalling causes the
formation of non-functional new vessels (Segarra et al. 2008).
Histopathological results were in parallel and confirmatory
to the biochemical and functional measurements: H&E
stained sections of the renal cortex of diabetic renal sections
demonstrated dilated Bowman’s space, inflammatory cells
infiltration, and degenerated vacuolation of the tubular epi-
thelium with sloughed epithelium in the lumen. Treatment
of diabetic rats with Exendine-4 or Crocin displayed amelior-
ation of renal injury, yet mild tubular dilatation with few
sloughed cells. PAS stained sections of the renal cortex
showed a Substantial increase in the mesangial matrix
deposition and destruction of the brush border of the tubu-
lar epithelium in the diabetic group. Application of Exendine-
4 or Crocin demonstrated moderate protection of the renal
tissue indicated by a decrease in the mesangial expansion
and preserved brush border. However, the simultaneous
administration of both drugs illustrated the full protection of
the renal cortex from diabetic injury.
Microscopic abnormalities described in type II DM include
thickening of the glomerular basement membrane, mesan-
gial matrix accumulation, and increased mesangial cells. The
mesangial expansion linked to deteriorating glomerular filtra-
tion (Østerby et al. 1990). Changes in the tubulointerstitium
that reported in DN include thickening of the tubular base-
ment membrane, tubular atrophy, interstitial fibrosis, and
arteriosclerosis (Gilbert and Cooper 1999).
The podocytes support the glomerular capillaries, buffers
intraglomerular pressure, and is part of the filtration barrier.
Like the basement membrane, the podocyte is covered by
negatively-charged molecules, which help repel anionic pro-
teins such as albumin (Pavenstadt et al. 2003).
In diabetes, podocyte foot processes broaden and efface.
Eventually, there is a loss of the podocyte itself. Podocytes
cannot regenerate, so this loss cannot be compensated for
(White et al. 2002). A study by Einbinder et al. (2016) demon-
strated enlarged glomerular size because of mesangial
expansion followed by nodular glomerulosclerosis in DN; this
ameliorated by GLP-1 treatment.
Hazman and Bozkurt (2015) found that diabetic renal sec-
tions showed interstitial inflammation and connective tissue
proliferation, flattening of the tubular epithelium, intratubular
debris or hyaline formation, hydropic degeneration in the
epithelium, epithelial desquamation, and necrosis. The
lesions decreased in the saffron treated group. Moreover;
Kapucu (2020) showed that Crocin therapy improved renal
injury caused by diabtes with improved glomerular atrophy,
brush border loss, bowman’s space widening and luminal
cast formation.
Conclusion
This work demonstrated the synergistic effects between GLP-
1 agonist and Crocin and the impact of this synergistic effect
on the notch signalling pathway and the related proteins
10 S. N. AMIN ET AL.
and markers that are involved in the pathogenesis of DN.
Further studies needed to evaluate the prophylactic rather
than therapeutic benefits of GLP-1 agonist and Crocin in DN,
follow up therapeutic effects of GLP-1 agonist and Crocin for
longer duration (> 4 weeks follow up in our study) and to
investigate sex difference in response to the used drugs
in DN.
Disclosure statement
No potential conflict of interest was reported by the authors.
ORCID
Shaimaa Nasr Amin http://orcid.org/0000-0001-9232-2389
Samaa Samir Kamar http://orcid.org/0000-0002-9040-584X
Data availability statement
The data that support the findings of this study are available from the
corresponding author, [SN. Amin], upon reasonable request.
References
Abedimanesh, N., et al., 2020. Effects of crocin and saffron aqueous
extract on gene expression of SIRT1, AMPK, LOX1, NF-jB, and MCP-1
in patients with coronary artery disease: a randomized placebo-con-
trolled clinical trial. Phytotherapy research, 34 (5), 1114–1122. May
Epub 2019 Dec 3. PMID: 31797473.
Adewole, S., et al., 2010. Effect of melatonin on carbon tetrachloride-
induced kidney injury in Wistar rats. African journal of biomedical
research, 10 (2), 153–164.
Altinoz, E., et al., 2015. Protective effects of saffron (its active constituent,
crocin) on nephropathy in streptozotocin-induced diabetic rats.
Human & experimental toxicology, 34 (2), 127–134.
Altman, G. D., 2005. Comparing groups: Three or more independent groups
of observations in practical statistics for medical research. London:
Chapman and Hall.
Arauz-Pacheco, C., Parrott, M.A., and Raskin, P., 2002. The treatment of
hypertension in adult patients with diabetes. Diabetes care, 25 (1),
134–147.
Bahmani, F., et al., 2016. Inhibitory effect of crocin(s) on lens a-crystallin
glycation and aggregation, results in the decrease of the risk of dia-
betic cataract. Molecules (Basel, Switzerland)), 21 (2), 143.
Balanescu, S., et al., 2011. Correlation of plasma copeptin and vasopres-
sin concentrations in hypo-, iso-, and hyperosmolar States. The journal
of clinical endocrinology and metabolism, 96 (4), 1046–1052.
Bancroft, J. D., and Gamble, M., 2008. Theory and practice of histological
techniques. 6th ed. London: Churchill Livingstone, Elsevier.
Baylis, C., 2008. Nitric oxide deficiency in chronic kidney disease.
American journal of physiology renal physiology, 294 (1), F1–F9.
Becker, R.H., et al., 2005. Insulin glulisine, a new rapid-acting insulin ana-
logue, displays a rapid time-action profile in obese non-diabetic sub-
jects. Experimental and clinical endocrinology & diabetes, 113 (8),
435–443.
Benedito, R., et al., 2012. Notch-dependent VEGFR3 upregulation allows
angiogenesis without VEGF-VEGFR2 signalling. Nature, 18484 (7392),
110–114.
Bielesz, B., et al., 2010. Epithelial Notch signaling regulates interstitial
fibrosis development in the kidneys of mice and humans. The journal
of clinical investigation, 120 (11), 4040–4054.
Billiard, F., et al., 2018. Delta-like ligand-4-notch signaling inhibition regu-
lates pancreatic islet function and insulin secretion. Cell reports, 2322
(4), 895–904.
Boshra, V., and Elkashef, W., 2017. Renal insulin sensitizing effect of exe-
natide in a high-fat diet obesity rat model. British journal of medicine
and medical research, 20 (6), 1–13.
Craven, P.A., Melhem, M.F., and DeRubertis, F.R., 1992. Thromboxane in
the pathogenesis of glomerular injury in diabetes. Kidney inter-
national, 42 (4), 937–946.
Drucker, D.J., 2006. The biology of incretin hormones. Cell metabolism, 3
(3), 153–165.
Einbinder, Y., et al., 2016. Glucagon-like peptide-1 and vitamin D: anti-
inflammatory response in diabetic kidney disease in db/db mice and
in cultured endothelial cells. Diabetes/metabolism research and
reviews, 32 (8), 805–815.
El-Gohary, O.A., and Said, M.A., 2016. Protective effect of exenatide (glu-
cagon-like peptide-1 receptor agonist) on renal ischemia–reperfusion
injury in diabetic rats. Benha medical journal, 33 (1), 24.
Fatehi, M., Rashidabady, T., and Fatehi-Hassanabad, Z., 2003. Effects of
crocus sativus petals’ extract on rat blood pressure and on responses
induced by electrical field stimulation in the rat isolated vas deferens
and guinea-pig ileum. Journal of ethnopharmacology, 84 (2-3),
199–203.
Fernandes, S.M., et al., 2016. The role of oxidative stress in streptozoto-
cin-induced diabetic nephropathy in rats. Archives of endocrinology
and metabolism, 60 (5), 443–449.
Fioretto, P., Caramori, M.L., and Mauer, M., 2008. The kidney in diabetes:
dynamic pathways of injury and repair. The Camillo Golgi Lecture
2007. Diabetologia, 51 (8), 1347–1355.
Frøssing, S., et al., 2018. Effect of liraglutide on atrial natriuretic peptide,
adrenomedullin, and copeptin in PCOS. Endocrine connections, 7 (1),
115–123.
Gilbert, R.E., and Cooper, M.E., 1999. The tubulointerstitium in progres-
sive diabetic kidney disease: more than an aftermath of glomerular
injury? Kidney international, 56 (5), 1627–1637.
Ginsberg, H.N., 2000. Insulin resistance and cardiovascular disease. The
journal of clinical investigation, 106 (4), 453–458.
Golpon, H.A., et al., 2001. Vasorelaxant effect of glucagon-like peptide-(7-
36) amide and amylin on the pulmonary circulation of the rat.
Regulatory peptides, 102 (2-3), 81–86.
Guo, W., et al., 2014. The inhibitory effect of quercetin on asymmetric
dimethylarginine-induced apoptosis is mediated by the endoplasmic
reticulum stress pathway in glomerular endothelial cells. International
journal of molecular sciences, 15 (1), 484–503.
Guruharsha, K.G., Kankel, M.W., and Artavanis-Tsakonas, S., 2012. The
notch signalling system: recent insights into the complexity of a con-
served pathway. Nature reviews genetics, 13 (9), 654–666.
Haneda, M., et al.,; Joint Committee on Diabetic Nephropathy. 2015. A
new classification of diabetic nephropathy 2014: a report from joint
committee on diabetic nephropathy. Journal of diabetes investigation,
6 (2), 242–246.
Hazman, O., € and Bozkurt, M.F., 2015. Anti-inflammatory and antioxidative
activities of safranal in the reduction of renal dysfunction and dam-
age that occur in diabetic nephropathy. Inflammation, 38 (4),
1537–1545.
Imenshahidi, M., Hosseinzadeh, H., and Javadpour, Y., 2010. Hypotensive
effect of aqueous saffron extract (Crocus sativus L.) and its constitu-
ents, safranal and crocin, in normotensive and hypertensive rats.
Phytotherapy research, 24 (7), 990–994.
Irvine, R.J., White, J., and Chan, R., 1997. The influence of restraint on
blood pressure in the rat. Journal of pharmacological and toxicological
methods, 38 (3), 157–162.
Kapucu, A., 2020. Crocin ameliorates oxidative stress and suppresses
renal damage in streptozotocin induced diabetic male rats. Biotechnic
and histochemistry., Aug 24, 1–8. Epub ahead of print. PMID:
32835521.
Kaur, N., Kishore, L., and Singh, R., 2017. Therapeutic effect of Linum usi-
tatissimum L. in STZ-nicotinamide induced diabetic nephropathy via
inhibition of AGE’s and oxidative stress. Journal of food science and
technology, 54 (2), 408–421.
Kianbakht, S., and Hajiaghaee, R., 2011. Anti-hyperglycemic effects of saf-
fron and its active constituents, crocin and safranal, in alloxan-
induced diabetic rats. Journal of medicinal plants, 3 (39), 82–89.

Kodera, R., et al., 2011. Glucagon-like peptide-1 receptor agonist amelio-
rates renal injury through its anti-inflammatory action without lower-
ing blood glucose level in a rat model of type 1 diabetes.
Diabetologia, 54 (4), 965–978.
Li, S., et al., 2017. Crocin protects podocytes against oxidative stress and
inflammation induced by high glucose through inhibition of NF-jB.
Cellular physiology and biochemistry, 42 (4), 1481–1492.
Liu, X., et al., 2018. Notch1 regulates PTEN expression to exacerbate
renal tubulointerstitial fibrosis in diabetic nephropathy by inhibiting
autophagy via interactions with Hes1. Biochemical and biophysical
research communications, 497 (4), 1110–1116.
Lotfy, M., et al., 2014. Mechanism of the beneficial and protective effects
of exenatide in diabetic rats. The journal of endocrinology, 220 (3),
291–304.
Mahdavifard, S., et al., 2016. The synergistic effect of antiglycating agents
(MB-92) on inhibition of protein glycation, misfolding and diabetic
complications in diabetic-atherosclerotic rat. European journal of medi-
cinal chemistry, 121, 892–902. Oct 4 Epub 2015 Dec 18. PMID:
26733359.
Mahmoudzadeh, L., et al., 2017. Anti-inflammatory and protective effects
of saffron extract in ischaemia/reperfusion-induced acute kidney
injury. Nephrology (Carlton, Vic.).), 22 (10), 748–754.
Montgomery, H., and Dymock, J.F., 1961. Determination of nitrite in
water. Analyst, 86 (102), 414.
Morsy, M.A., et al., 2014. Carvedilol ameliorates early diabetic nephrop-
athy in streptozotocin-induced diabetic rats. Biomed research inter-
national, 2014, 105214
Mortensen, A., and Lykkesfeldt, J., 2014. Does vitamin C enhance nitric
oxide bioavailability in a tetrahydrobiopterin-dependent manner? In
vitro, in vivo and clinical studies. Nitric oxide: biology and chemistry,
36, 51–57.
Niranjan, T., Murea, M., and Susztak, K., 2009. The pathogenic role of
notch activation in podocytes. Nephron experimental nephrology, 111
(4), e73–e79.
Ojima, A., et al., 2013. Glucagon-like peptide-1 receptor agonist inhibits
asymmetric dimethylarginine generation in the kidney of streptozoto-
cin-induced diabetic rats by blocking advanced glycation end produc-
t–induced protein arginine methyltranferase-1 expression. The
American journal of pathology, 182 (1), 132–141.
Okoduwa, S.I.R., et al., 2017. Appropriate insulin level in selecting forti-
fied diet-fed, streptozotocin-treated rat model of type 2 diabetes for
anti-diabetic studies. PloS One, 12 (1), e0170971.
Østerby, R., et al., 1990. Glomerular structure and function in diabetic
nephropathy: Early to advanced stages. Diabetes, 39 (9), 1057–1063.
Ozaki, N., et al., 2000. cAMP-GEFII is a direct target of cAMP in regulated
exocytosis. Nat Cell Biol, 2 (11), 805–811.
Pavenstadt, H., Kriz, W., and Kretzler, M., 2003. Cell biology of the glom-
erular podocyte. Physiological reviews, 83 (1), 253–307.
Prabhakar, S.S., 2004. Role of nitric oxide in diabetic nephropathy.
Seminars in nephrology, 24 (4), 333–344.
Reiniger, N., et al., 2010. Deletion of the receptor for advanced glycation
endproducts reduces glomerulosclerosis and preserves renal function
in the diabetic OVE26 mouse. Diabetes, 59 (8), 2043–2054.
Samarghandian, S., Azimi-Nezhad, M., and Samini, F., 2014. Ameliorative
effect of saffron aqueous extract on hyperglycemia, hyperlipidemia,
and oxidative stress on diabetic encephalopathy in streptozotocin
induced experimental diabetes mellitus. Biomed research international,
2014, 1–12.
Sancar-Bas, S., Gezginci-Oktayoglu, S., and Bolkent, S., 2015. Exendin-4
attenuates renal tubular injury by decreasing oxidative stress and
ARCHIVES OF PHYSIOLOGY AND BIOCHEMISTRY 11
inflammation in streptozotocin-induced diabetic mice. Growth factors
(Chur, Switzerland)), 33 (5-6), 419–429.
Segarra, M., et al., 2008. Dll4 activation of Notch signaling reduces tumor
vascularity and inhibits tumor growth. Blood, 112 (5), 1904–1911.
Shirali, S., Zahra Bathaie, S., and Nakhjavani, M., 2013. Effect of crocin on
the insulin resistance and lipid profile of streptozotocin-induced dia-
betic rats. Phytotherapy research, 27 (7), 1042–1047.
Skov, J., et al., 2013. Glucagon-like peptide-1 (GLP-1): effect on kidney
hemodynamics and renin-angiotensin-aldosterone system in healthy
men. The journal of clinical endocrinology and metabolism, 98 (4),
E664–E671.
Thomson, S.C., Kashkouli, A., and Singh, P., 2013. Glucagon-like peptide-1
receptor stimulation increases GFR and suppresses proximal reabsorp-
tion in the rat. American journal of physiology. renal physiology, 304
(2), F137–F144.
Trinder, E., 1975. Instrument for the on-line measurement of the slow
phase of nystagmus. Aviation, space, and environmental medicine, 46
(4 Sec 1), 441–444.
Velho, G., et al., 2013. Plasma copeptin and renal outcomes in patients
with type 2 diabetes and albuminuria. Diabetes care, 36 (11),
3639–3645.
White, K.E., et al., 2002. Podocyte number in normotensive type 1 dia-
betic patients with albuminuria. Diabetes, 51 (10), 3083–3089.
Wu, H., et al., 2016. Effects of exenatide therapy on insulin resistance in
the skeletal muscles of high-fat diet and low-dose streptozotocin-
induced diabetic rats. Endocrine research, 41 (1), 1–7.
Wu, H., et al., 2014. The GLP-1 analogue exenatide improves hepatic and
muscle insulin sensitivity in diabetic rats: tracer studies in the basal
state and during hyperinsulinemic-euglycemic clamp. Journal of dia-
betes research, 2014, 1–10.
Xi, L., et al., 2007. Crocetin attenuates palmitate-induced insulin insensi-
tivity and disordered tumor necrosis factor-alpha and adiponectin
expression in rat adipocytes. British journal of pharmacology, 151 (5),
610–617.
Xiang, M., et al., 2006. Crocetin inhibits leukocyte adherence to vascular
endothelial cells induced by AGEs. Journal of ethnopharmacology, 107
(1), 25–31.
Yamagishi, S.I., and Matsui, T., 2011. Nitric oxide, a janus-faced thera-
peutic target for diabetic microangiopathy-Friend or foe?
Pharmacological research, 64 (3), 187–194.
Yan, S.F., et al., 2003. Glycation, inflammation, and RAGE: a scaffold for
the macrovascular complications of diabetes and beyond. Circulation
research, 93 (12), 1159–1169.
Yoon, C.H., et al., 2016. Diabetes-induced jagged1 overexpression in
endothelial cells causes retinal capillary regression in a murine model
of diabetes mellitus: insights into diabetic retinopathy. Circulation,
134 (3), 233–247.
Yosri, H., et al., 2017. Crocin modulates IL-4/IL-13 signaling and amelio-
rates experimentally induced allergic airway asthma in a murine
model. International immunopharmacology, 50, 305–312.
Youn, J.Y., Park, H.Y., and Cho, K.H., 2004. Anti-hyperglycemic activity of
Commelina communis L.: inhibition of a-glucosidase. Diabetes research
and clinical practice, 66, S149–S155.
Yu, M., et al., 2003. Antihypertensive effect of glucagon-like peptide 1 in
Dahl salt-sensitive rats. Journal of hypertension, 21 (6), 1125–1135.
Za
ciragic, A., et al., 2014. An assessment of correlation between serum
asymmetric dimethylarginine and glycated haemoglobin in patients
with type 2 diabetes mellitus. Bosnian journal of basic medical scien-
ces, 14 (1), 21–24.