Received: 27 January 2018 | Accepted: 26 June 2018

DOI: 10.1002/jcp.27021

ORIGINAL RESEARCH ARTICLE

Combination therapy with KRAS siRNA and EGFR inhibitor

AZD8931 suppresses lung cancer cell growth in vitro

Habib Zarredar1,2* | Shadi Pashapour3* | Khalil Ansarin3 | Majid Khalili4 |

Roghayyeh Baghban 5
| Safar Farajnia 3,6

1
Tuberculosis and Lung Disease Research
Center, Tabriz University of Medical Science, Lung cancer is a leading cause of cancer‐related deaths worldwide, with less than a
Tabriz, Iran 5‐year survival rate for both men and women. Epidermal growth factor receptor
2
Students Research Committee, Tabriz
(EGFR) and Kirsten rat sarcoma oncogene (KRAS) signaling pathways play a critical
University of Medical Sciences, Tabriz, Iran
3
Department of Genetic, Tabriz Branch, role in the proliferation and progression of various cancers, including lung cancer.
Islamic Azad University, Tabriz, Iran Genetic studies have shown that amplification, over‐expression, or mutation of EGFR
4
Department of Basic Science, Maragheh
is an early and major molecular event in many human tumors. KRAS mutation is a
University of Medical Science, Maragheh, Iran
5
Drug Applied Research Center, Tabriz
negative factor in various cancer, including non‐small‐cell lung cancer, and
University of Medical Sciences, Tabriz, Iran complicates therapeutic approaches with adjuvant chemotherapy and anti‐EGFR
6
Biotechnology Research Center, Tabriz directed therapies. This article is dedicated to evaluating the synergistic effect of a
University of Medical Sciences, Tabriz, Iran
novel EGFR inhibitor AZD8931 and KRAS small interfering RNA (siRNA) on the
Correspondence proliferation and apoptosis of lung adenocarcinoma cancer cells. A549 lung cancer
Safar Farajnia, Tuberculosis and Lung Disease
Research Center, Tabriz University of Medical cells were treated with KRAS siRNA and the EGFR inhibitor alone or in combination.
Science, Daneshgah street, Tabriz, Iran. The cytotoxic effects of KRAS siRNA and te EGFR inhibitor were determined
Email: Farajnias@tbzmed.ac.ir
usingMTT assay, and induction of apoptosis was determined by FACS analysis.
Funding information Suppression of KRAS, Her‐2, and EGFR expression by treatments was measured by
Tuberculosis and Lung Disease Research
Center, Tabriz University of Medical Science, qRT‐PCR and western blotting. KRAS siRNA and the EGFR inhibitor significantly
Tabriz, Iran, Grant/Award Number: 73819 reduced the proliferation of A549 cells as well as KRAS and EGFR mRNA levels 24 hr
after treatment. The results also indicated that the silencing of KRAS and EGFR has
synergistic effects on the induction of apoptosis on the A549 cells. These results
indicated that KRAS and EGFR might play important roles in the progression of lung
cancer and could be potential therapeutic targets for treatment of lung cancer.

KEYWORDS
epidermal growth factor receptor (EGFR) inhibitor, gene silencing, Kirsten rat sarcoma oncogene
(KRAS), lung cancer, target therapy

1 | INTRODUCTION the source of two important mutations in lung cancers, Kirsten rat
sarcoma oncogene (KRAS) and epidermal growth factor receptor (EGFR)
Lung cancer is a common cause of cancer related mortality worldwide. mutations. Mutations in KRAS and EGFR are the most usual mutations
Non‐small‐cell lung cancer (NSCLCs) is responsible for over 85% of the that occur in lung cancer, especially in NSCLC (Jorge, Kobayashi, & Costa,
diagnosed lung cancers, whereas small‐cell lung cancers comprise about 2014). EGFR is a multifunctional membrane glycoprotein that is found in
15% of the cases. In the last decade, molecular studies have uncovered various tissues. Recent research has revealed that high expression of
EGFR results in extensive proliferation and malignancy (Jiang, Zhou, & Ji,
*Zarredar and Pashapour have contributed equally to this work. 2014). Genetic studies have shown that EGFR amplification, mutation,
1560 | © 2018 Wiley Periodicals, Inc. wileyonlinelibrary.com/journal/jcp J Cell Physiol. 2019;234:1560–1566.
ZARREDAR ET AL.
and over‐expression are the main and early molecular events in most
human tumors. Nearly 15% of African and European patients with
NSCLCs, 35% of East Asians, and 50% of people who have never smoked
have EGFR mutation (Lindeman et al., 2013). It has been shown that
patients with EGFR mutations develop an acquired resistance against
tyrosine kinase inhibitors (TKIs; Jackman et al., 2010). RAS is a
downstream molecule of EGFR, and KRAS overexpression leads to
resistance to EGFR TKI in tumors (Tammemagi, McLaughlin, & Bull, 1999;
Zarredar, Ansarin, Baradaran, Ahdi Khosroshahi, & Farajnia, 2018a).
Tumors with KRAS mutation seem to be resistant to most available
systemic therapies, making KRAS as a critical target for cancer therapy
(Koivunen et al., 2008). At present, there is no any approved KRAS
specific inhibitor for clinical usage (Zhao et al., 2016). KRAS mutation is a
negative factor in various cancer including NSCLC and complicates
therapeutic approaches with adjuvant chemotherapy and anti‐EGFR
directed therapies (Marzec et al., 2007; Takahashi et al., 2010). It has
been shown that the use of MEK, BCL‐XL, and PI3K inhibitors in
combination with conventional chemotherapy is the most promising
approach to control KRAS mutant lung cancer (Pikor, Ramnarine, Lam, &
Lam, 2013; Stahel et al., 2013). However, RAS mutations remain the most
intriguing and elusive therapeutic targets in NSCLC (Jänne et al., 2016;
Rothschild, 2015). Various strategies have been suggested for targeting
KRAs mutant cancers. Among them, the RNA interference (RNAi)
technology showed promising results. In mammals, small interfering
RNAs (siRNAs) are important tools for gene expression regulation
(Morris, 2006). Hence, this technology has emerged as an efficient tool to
investigate gene expression‐function. In this study, we investigate
whether the combination of EGFR inhibitory agents with KRAS‐specific
siRNA increases therapeutic efficacy.
2 | MATERIALS AND METHOD
2.1 | Reagents
Pooled human KRAS siRNA (sc‐35731) containing three different
nucleotide sequences 19–25 in length siRNA duplex sequences and
negative control (NC) siRNA (Scrambled siRNA had no known homology
with any human genes: sc‐37007) were bought from Santa Cruz
Biotechnology (Santa Cruz, CA). Also, a siRNA transfection reagent (SC‐
29528), a siRNA transfection medium (SC‐36868) and an EGFR
inhibitor AZD8931 (Sapitinib) (SC‐364426), KRAS (sc‐522), EGFR
(sc‐71033), Her‐2 (sc‐71667), β‐actin (sc‐47778) primary antibody were
bought from Santa Cruz Biotechnology (Dallas, TX). Goat Anti‐Mouse
immunoglobulin G (IgG) (H + L) (Cat number: 170‐6516, BIORAD) and
Goat Anti‐Rabbit IgG (H + L) (Cat number: A6154, Sigma) as secondary
antibody were bought from BIORAD (Hercules, CA) and Sigma company
(Munich, Germany), respectively. Chemiluminescence substrates (Cat
number: 34080) (ECL plus western blotting detection reagents) also
were bought from the Thermo Fisher Scientific company (Rockford, IL).
qRT‐PCR SYBR green master mix was purchased from Takara (Tokyo,
Japon) (Cat number: PR820Q). The A549 lung cancer cell line was
purchased from Pasteur Institute, Tehran, Iran.
| 1561
2.2 | Cell culture and siRNA transfection
The A549 lung cancer cell line was grown in Dulbecco modified
Eagles medium (DMEM; GIBCO/BRL Life Technologies) containing
10% fetal bovine serum (FBS; Sigma‐Aldrich, St. Louis, MO) and 1%
antibiotics (100 IU/ml penicillin, 100 μg/ml streptomycin; Sigma‐
Aldrich) at 37 °C in a humidified atmosphere containing 5% CO2.
Just before transfection, the cells were cultivated in DMEM
without serum and antibiotics. The cells were incubated at 37°C in
a CO2 incubator until a confluence of 60%–65% was achieved.
siRNA transfection (at a final concentration of 80 pM) was
performed using the siRNA transfection reagent (Santa Cruz
Biotechnology) according to the manufacturer's recommendations.
Briefly, siRNAs and siRNA transfection reagent were diluted in
siRNA transfection medium (Santa Cruz Biotechnology) separately
and incubated for 15 min at room temperature. The diluted
solutions were then mixed and incubated for 20 min on ice at
room temperature. Subsequently, the mixtures were added to each
well‐containing cell and transfection medium. The cells treated
with only the transfection reagent and scramble siRNA were
considered as a control group. The cell culture plates were
incubated for 6 hr at 37°C in a CO2 incubator. After that, DMEM
containing FBS (final FBS concentration of 20%) was added to the
wells, and incubation was continued under the above‐mentioned
conditions. To evaluate the effects of siRNAs on gene silencing,
transfections (1.5 × 105 cells/well) were done in 6‐well cell culture
plates for 24 hr for fluorescence-activated cell sorting (FACS),
western blot, qRT‐PCR assay and for 48 hr in 96‐well cell culture
plates (104 cells/well) for MTT assay. The cells were harvested by
ethylenediaminetetraacetic acid (EDTA) 2% and washed once with
phosphate‐buffered saline (PBS, pH 7.4).
2.3 | RNA isolation, complementary DNA synthesis
and qRT‐PCR
After 24 hr of siRNA transfection and EGFR inhibitor treatment, the
cells were used for total cellular RNA extraction by Trizol (Takara
Biotechnology CO). Complementary DNA (cDNA) was synthesized
from 2.5 to 3.5 μg of total RNA by the use of MMLV reverse
transcriptase (Takara, Cat number: RR037Q) with a random hexamer
and oligo dt primers according to the manufacturer's instructions.
The quality and quantity of the extracted RNA were determined by
Nano‐drop instrument (Thermo Fisher Scientific ONEc). The PCR
reaction contained 10 μl of SYBR green reagent, 0.35 μM of each
primer, 1 μl of cDNA template, and 8.3 μl of nuclease‐free water. The
initial denaturation step at 95°C for 3 min was followed by 45 cycles
at 95°C for 20 s, 59–63°C for 30 s, and 72°C for 20 s for different
primers. The products were detected by 2% agarose gel (Bio Basic
Canada Inc.) electrophoresis. qRT‐PCR was performed in the Applied
Biosystems StepOne. The primers used in the study were designed by
oligo 7 software (Table 1). The relative KRAS, EGFR, and Her2 mRNA
expressions were measured with the 2(−ΔΔCt) method using β‐actin
as the housekeeping gene.
1562 | ZARREDAR
T A B L E 1 The primer sequences
Forward
Primers and reverse Sequences
KRAS Forward 5′‐AGGTGCGGGAGAGAGGCCTG‐3′
Reverse 5′‐ACTGTACTCCTCTTGACCTGCTGTG‐3′
EGFR Forward 5′‐GAGGAGAACTGCCAGAAACTGA3′
Reverse 5′‐TCACGCAGGTGGCACCAAA‐3′
Her2 Forward 5′‐TGTGACTGCCTGTCCCTACA‐3′
Reverse 5′‐CCAGACCATAGCACACTCGG‐3′
β‐actin Forward 5′‐TCCCTGGAGAAGAGCTACG‐3′
Reverse 5′‐GTAGTTTCGTGGATGCCACA‐3′
Note. EGFR: epidermal growth factor receptor; KRAS: Kirsten rat sarcoma
oncogen.
2.4 | Cytotoxicity assay
The effects of siRNAs and EGFR inhibitor individually and together on
the cell viability of A549 cells were determined by using 3‐(4,5‐
dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide (MTT) assay. The
cells were seeded in 96‐well cell culture plates for 24–48 hr with an initial
concentration of 10 cells/ml in 200 μl medium. The treated cells were
4 membranes were subjected to chemiluminescence detection and
divided into five groups: EGFR inhibitor, KRAS siRNA, cotreated (KRAS
siRNA and EGFR inhibitor), NC containing scramble siRNA, and untreated
cells. A549 cells were transfected with 0 (control, no siRNA added), 40,
60, and 80 pM of KRAS siRNA. The most effective and optimum silencing
was observed at 48 hr after transfection using 80 pM siRNA. Six hours
after the siRNA transfection, the cells were treated with different
concentrations of the EGFR inhibitor (50, 25, 12.5, 6.25, and 3.125 μM).
Statistical analysis indicated that the IC50 concentration for the EGFR
inhibitor in the A549 cell line was14 μM at 48 hr. Also, to determine the
effect of KRAS siRNA and the EGFR inhibitor simultaneously, 40 pM and
7 μM concentrations of siRNA and the EGFR inhibitor were used,
respectively. After a 48‐hr incubation period, 50 μl of a 5 mg/ml MTT
solution was added to each well, and the plate was further incubated at
37°C for 4 hr. Then, the medium was aspirated, the wells were washed
twice with PBS, and 200 μl of DMSO plus 25 μl Sorenson buffer was
added to the wells. The plate was placed on a shaker (30 min) to dissolve
the dye. After the formazan crystals had dissolved, the absorbance was
determined spectrophotometrically at 570 nm using an ELX800 UV
universal microplate reader (Bio‐Tek Instruments Inc.). The half inhibitory
concentration (IC50) was calculated using GraphPad Prism 6.01 software
(GraphPad Software Inc., San Diego, CA).
2.5 | Detection of apoptosis by flow
cytometry (FASC)
A549 cells were seeded at a density of 1.5 × 105 cell/well in
six‐well plates. The experiment was divided into the five groups as
mentioned above. After 24 hr, the cells were harvested by EDTA 2% (Bio
Basic Canada), washed once with PBS (pH 7.4), and centrifuged. Then the
cells were suspended in 200 μg binding buffer (Invitrogen Co.). Then the
ET AL.
FITC‐annexin V reagent was added to the plate and incubated in the dark
on ice for 10 min. Thereafter, the cells were resuspended in another
200 μl binding buffer, and 10 μl of Propidium iodide (PI) was added to
determine the apoptosis by flow cytometry (Hamishehkar, Khani,
Kashanian, Ezzati Nazhad Dolatabadi, & Eskandani, 2014).
2.6 | Western blot analysis
After being treated with siRNA for 24 hr, the cells were washed with
PBS and lysed in lysis buffer (Santa Cruz; Cat number:
sc‐24948). The lysates were centrifuged at 13,000g for 20 min at
4°C and boiled for 10 min. 20 μg of each sample was separated on
sodium dodecyl sulfate‐polyacrylamide gel electrophoresis (12.5%),
and the proteins were then transferred to the polyvinylidene fluoride
membranes for 60 min at 45 mA. The membrane was incubated with
an EGFR (sc‐71033; 1:1,000 dilution), KRAS (sc‐522; 1:500 dilution),
Her‐2 (sc‐71667; 1:750 dilution), and beta‐actin (housekeeping)
antibodies (1:1,000 dilution) for 3 hr. The membrane was then
washed and exposed to the secondary antibody for 1 hr. Primary
antibodies were detected with an horseradish peroxidase (HRP)‐
conjugated secondary antibody (1:2,500 dilution). Finally the
visualized by an imaging system (ECL plus western blotting detection
reagents; Thermo Fisher Scientific, Cat number: 34080). Experiments
were repeated in triplicate.
2.7 | Statistics methods
All the results of this study were presented as the mean ± standard
deviation. The statistical significance of differences between
groups was evaluated by analysis of variance followed by
Bonferroni’s and Sidak's multiple comparisons, and for two groups,
it was done using the unpaired Student t test. p values less than
0.05 were considered significant. Three independent experiments
were performed for each assay. All statistical analyses were
performed using the GraphPad Prism software (La Jolla, CA;
http://www.graphpad.com).
3 | RESULT
3.1 | Cytotoxic activity of KRAS siRNA and EGFR
inhibitor
To compare the effect of KRAS siRNA and the EGFR inhibitor
alone or in combination on cell viability, the A549 cells were
treated with the EGFR inhibitor, KRAS siRNAs and their combina-
tion, and after 48 hr, the viability was analyzed by MTT assay. The
results showed that the combination of KRAS siRNAs and the
EGFR inhibitor decreased the cell survival rate to 25.35%,
compared with the control cells. Also, the EGFR inhibitor and
KRAS siRNA decreased the survival rate to 38.96% and 54.78%,
respectively (p < 0.5; Figure 1).
ZARREDAR ET AL.
F I G U R E 1 Effect of KRAS siRNA (80 pM) and EGFR inhibitor
(14 μM) alone and in combination (40 pM siRNA + 7 μM inhibitor) on
A549 cell line. Eight hours after transfection of KRAS siRNA or NC
siRNA, cells were exposed to the EGFR inhibitor at indicated doses. After
48 hr, the cytotoxicity of treatments was determined by MTT assay. The
data represented as mean ± SD (N = 3); p < 0.05. EGFR: epidermal
growth factor receptor; KRAS: Kirsten rat sarcoma oncogene; MTT:
3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide; NC:
negative control; SD: standard deviation; siRNA: small interfering RNA
3.2 | Downregulation of KRAS, EGFR, and Her2
mRNA expression in A549 cells by KRAS siRNA and
EGFR inhibitor
The effects of treatment with KRAS siRNA and EGFR inhibitor on the
expression of KRAS, Her2, and EGFR in human lung cancer (A549)
cell line was evaluated by real‐time PCR. KRAS siRNA transfection
and EGFR inhibitor reduced the expression of KRAS, Her2, and EGFR
mRNA. In the siRNA‐treated group at 24 hr post‐transfection, the
level of KRAS mRNA expression was about 26.7%. Treatment with
EGFR inhibitor leads to a reduction of EGFR to 60.1% and Her2 to
81.7%. There was no significant difference between NC siRNA group
and untreated cells. The levels of mRNA expression were statistically
significant compared to the controls in A549 cells (p < 0.05; Figure 2).
Also, western blotting analysis confirmed the KRAS, Her‐2, and EGFR
qRT‐PCR results (Figure 4).
F I G U R E 2 Analysis of KRAS, Her2, and EGFR mRNA level after treatment with KRAS siRNA (80 pM) and EGFR inhibitor (14 μM) in A549
cell line (in vitro cells), p < 0.05. EGFR: epidermal growth factor receptor; KRAS: Kirsten rat sarcoma oncogene; siRNA: small interfering RNA
[Color figure can be viewed at wileyonlinelibrary.com]
| 1563
3.3 | Analysis the effects of KRAS siRNA and EGFR
inhibitor on induction of apoptosis by flow cytometry
The effect of KRAS siRNA (80 pM) and the EGFR inhibitor (14 µm) on
the apostsis of lung cancer cells was determined by FACS after 24 hr.
We introduced 1,000 cells for Blank control, NC siRNA, and treated
cells for every assay. The cells were stained with annexin‐V‐FITC and
PI after treatment with KRAS siRNA and the EGFR inhibitor. The
lower left (LL) quadrant indicates live cell population, the lower right
quadrant (LR) represents the cell population in the early stage of
apoptosis, the upper left (UL) quadrant shows the population of cells
in the late necrosis stage, and the upper right (UR) quadrant is
considered as the population of cell at late apoptosis and early
necrosis stages (Figure 3).
4 | D I S C U SS I O N
EGFR (40%–80%) and KRAS (15%–25%) are commonly over
expressed in non‐small‐cell lung cancer and are involved in the
pathogenesis of the disease (Scagliotti, Selvaggi, Novello, & Hirsch,
2004; Zarredar, Ansarin, Baradaran, Ahdi Khosroshahi, & Farajnia,
2018b). The main objective of this study was to evaluate the role of
KRAS, EGFR, and Her2 suppression in the lung cancer A549 cell line.
Among oncogenes, EGFR, KRAS, and Her2 are considered to have
critical roles in lung carcinogenesis. Previous findings from in vivo
and in vitro studies suggested that mutant KRAS and EGFR are
sufficient to initiate, but not to complete, the progress to lung
adenocarcinomas (Iwanaga et al., 2008; Shirakusa, Noda, &
Matsuzoe, 2002). Mutation in KRAS has been reported to associate
with poor response to EGFR‐TKIs therapy (Lakshmikuttyamma, Sun,
Lu, Undieh, & Shoyele, 2014). EGFR‐TKI therapy is effective in EGFR
mutation‐positive patients but not in patients with the mutation in
both KRAS and EGFR (Mitsudomi et al., 2010; Morita et al., 2009;
Linardou et al., 2008). Then, inhibition of mutant KRAS is important
for effective NSCLC treatment. We used KRAS siRNA and AZD8931
to investigate the effect of KRAS, ERBb2, and EGFR expression levels
on the proliferation of A549 human lung cancer cells. In our study,
the effective concentration of KRAS and AZD8931 was 80 pM and
14 µm, respectively. The results of qRT‐PCR showed that KRAS
1564 | ZARREDAR
F I G U R E 3 The effect of KRAS siRNA and EGFR inhibitor on lung cancer cells' apoptosis rate by FACS flow cytometry. EGFR: epidermal
growth factor receptor; FACS: fluorescence‐activated cell sorting (FACS); KRAS: Kirsten rat sarcoma oncogene; siRNA: Small interfering RNA
[Color figure can be viewed at wileyonlinelibrary.com]
siRNA and AZD8931 decreased the expression of KRAS, ERBb2, and
EGFR gene to 26.7%, 81.7%, and 60.1%, respectively. Western
blotting analysis confirmed the suppression of the KRAS, Her‐2, and
EGFR by KRAS siRNA and AZD8931. Although, AZD8931 is a
reversible, ATP competitive inhibitor of EGFR, ErbB2, and ErbB3
molecules and suppresses these receptors in protein level, we saw
that treatment with the AZD8931 results in reduced expression of
ERBb2 and EGFR as well (Hickinson et al., 2010). We found that
suppression of oncogenic KRAS, EGFR, and Her‐2 led to reduced
growth and proliferation accompanied with increased apoptosis in
the A549 cell line. Several strategies, like farnesyltransferase
inhibitors, were explored as possible inhibitors of KRAS in lung
adenocarcinoma but were not successful. RNAi technology using
siRNA has shown to be very effective and specific in the knockdown
of specific mutant KRAS and EGFR (Riely, Marks, & Pao, 2009). KRAS
mutation in NSCLC has been related to increased resistance to
EGFR‐TKIs. Hence, it was hypothesized that knockdown of mutant
KRAS in A549 cells can lead to increased sensitivity to EGFR‐TKIs.
We found that suppression of oncogenic KRAS, EGFR, and Her‐2 led
F I G U R E 4 KRAS, EGFR, Her‐2, and β‐actin proteins expression
levels in treated human lung cancer cell line A549. Representative
western blot bands of β‐actin, KRAS, EGFR, and Her‐2 proteins from
A549 cells transfected with siRNA and treated with AZD8931 after
24 hr. The density of each band was quantified by the Image J
software (NIH, Bethesda, MD) and the expression of each KRAS and
EGFR normalized to the corresponding β‐actin. Results are expressed
in relation to the blank control. EGFR: epidermal growth factor
receptor; KRAS: Kirsten rat sarcoma oncogene; siRNA: small
interfering RNA
ET AL.
to reduced growth and proliferation accompanied with increased
apoptosis in the A549 cell line. Sunaga et al found that the treatment
with gefitinib and KRAS knockdown led to significant growth
suppression in H23, H1792, and H358 cell lines compared with the
treatment with gefitinib without KRAS knockdown. Also, treatment
by cetuximab and knockdown by KRAS siRNA resulted in significant
growth inhibition in H1792. These results indicate that suppression
of KRAS could be effective in controlling KRAS mutation positive
NSCLC by EGFR TK inhibitors (Sunaga et al., 2011). Slamon et al.
(2001) showed that the anti‐HER2 antibody, trastuzumab, which was
shown to be effective in HER2 positive breast cancers patients, is not
effective in NSCLC. It has been supposed that differences in
expression of the EGFR family members may be responsible for
differences in response to EGFR‐blocking drugs (Cappuzzo et al.,
2003). Also, the results of three recent studies showed that
mutations in the TK domain of Her2 and EGFR are associated with
sensitivity of NSCLC to TKIs like gefitinib or erlotinib (Lynch et al.,
2004; Pao et al., 2004; Stephens et al., 2004). KRAS is a key
downstream EGFR signaling pathway, and mutation in this gene
results in poorer clinical outcomes when treated with erlotinib, a TK
inhibitor, and chemotherapy. In our study, the results of MTT and
FACS analysis indicated that cotreatment with KRAS siRNA and
AZD8931 could reduce the viability of A549 cells more effectively
than treatment with each of these agents. This result demonstrated
the synergistic effect of siRNA and AZD8931 in induction of the
apoptotic pathway. Henri Wichmann et al compared the effects of
mAbs against EGFR (Cetuximab) and Her2 (Trastuzumab) with Her2
and EGFR siRNA in glioblastoma U251MG and LN‐229 cell lines.
They showed that four and eight‐fold concentrations of cetuximab or
trastuzumab, respectively, had no significant influence on the growth
rate of U251MG or LN‐229 cells. But the knockdown of EGFR and
Her2 by siRNA reduced the growth rate in both cell lines by
approximately 40% and 60%, respectively. Chen et al. determined the
effect of specific EGFR siRNA in comparison with TKIs gefitinib,
erlotinib, afatinib and cetuximab in lung cancer cell lines. They found
that combination of siRNA with TKIs and mAb is more effective in
proliferation suppression and induction of apoptosis. In their study,
afatinib plus EGFR siRNA was the most effective combination (Chen,
Kronenberger, Teugels, Umelo, & De Grève, 2012). Han et al. (2010)
showed that down regulation of EGFR and upregulation of PTEN by
the specific plasmid in U251 malignant glioma cell line could
ZARREDAR ET AL.
effectively induce cell apoptosis and suppress proliferation in this
tumor. In another study, Jiang showed that after treatment of the
A549 cell line with an anti‐EGFR monoclonal antibody Nimotuzumab,
the cancer cells did not express STAT3 or phosphorylated‐STAT3 and
showed proliferation inhibition, accelerated apoptosis, weakened
invasiveness, and arrested cell cycles (Jiang, Zhou, & Ji, 2014). Taking
together, the results of our study demonstrated that downregulation
of EGFR, KRAS, and Her‐2 by a specific inhibitor and siRNAs can lead
to a significant inhibition of cell proliferation and promote apoptosis
in lung cancer cell line. These result indicate that combined blockage
of multiple cell signaling pathways could be more effective than
suppression of one signaling pathway alone.
5 | CONC LU SION
We found that KRAS and EGFR have a key role in the controlling
apoptosis and cell proliferation in human lung cancer A549 cells in
vitro. Specific knockdown of KRAS expression by siRNA and EGFR by
an EGFR inhibitor induced synergistic cell proliferation stoppage and
induced apoptosis in lung cancer cells. Our research indicated that
the siRNA silencing of KRAS plus EGFR suppression may be
considered as a new treatment strategy in the future to overcome
recurrent lung cancer.
FUNDING
This study was funded by a grant no. 73819 from Tuberculosis and
Lung Disease Research Center, Tabriz University of Medical Science,
Tabriz, Iran.
E TH I C A L A P P R O V A L
This article does not contain any studies with human participants or
animals performed by any of the authors.
CO NFLICTS OF INTE RES T
The authors declare that they have no conflict of interests.
OR CID
Safar Farajnia http://orcid.org/0000-0002-6087-9147
REFERENC ES
Cappuzzo, F., Gregorc, V., Rossi, E., Cancellieri, A., Magrini, E., Paties, C. T., …
Crinò, L. (2003). Gefitinib in pretreated non‐small‐cell lung cancer
(NSCLC): Analysis of efficacy and correlation with HER2 and epidermal
growth factor receptor expression in locally advanced or metastatic
NSCLC. Journal of Clinical Oncology, 21(14), 2658–2663.
Chen, G., Kronenberger, P., Teugels, E., Umelo, I. A., & De Grève, J. (2012).
Targeting the epidermal growth factor receptor in non‐small cell lung
| 1565
cancer cells: The effect of combining RNA interference with tyrosine
kinase inhibitors or cetuximab. BMC Medicine, 10(1), 28.
Hamishehkar, H., Khani, S., Kashanian, S., Ezzati Nazhad Dolatabadi, J., &
Eskandani, M. (2014). Geno‐ and cytotoxicity of propyl gallate food
additive. Drug and Chemical Toxicology, 37(3), 241–246.
Han, L., Zhang, A., Xu, P., Yue, X., Yang, Y., Wang, G., … Kang, C. (2010).
Combination gene therapy with PTEN and EGFR siRNA suppresses
U251 malignant glioma cell growth in vitro and in vivo. Medical
Oncology, 27(3), 843–852.
Hickinson, D. M., Klinowska, T., Speake, G., Vincent, J., Trigwell, C.,
Anderton, J., … Ogilvie, D. (2010). AZD8931, an equipotent, reversible
inhibitor of signaling by epidermal growth factor receptor, ERBB2
(HER2), and ERBB3: A unique agent for simultaneous ERBB receptor
blockade in cancer. Clinical Cancer Research: An Official Journal of the
American Association for Cancer Research, 16(4), 1159–1169.
Iwanaga, K., Yang, Y., Raso, M. G., Ma, L., Hanna, A. E., Thilaganathan, N., …
Kurie, J. M. (2008). Pten inactivation accelerates oncogenic K‐ras‐
initiated tumorigenesis in a mouse model of lung cancer. Cancer
Research, 68(4), 1119–1127.
Jackman, D., Pao, W., Riely, G. J., Engelman, J. A., Kris, M. G., Jänne, P. A., …
Miller, V. A. (2010). Clinical definition of acquired resistance to
epidermal growth factor receptor tyrosine kinase inhibitors in non‐
small‐cell lung cancer. Journal of Clinical Oncology: Official Journal of the
American Society of Clinical Oncology, 28(2), 357–360.
Jänne, P. A., Shaw, A. T., Camidge, D. R., Giaccone, G., Shreeve, S. M., Tang,
Y., … Solomon, B. J. (2016). Combined Pan‐HER and ALK/ROS1/MET
inhibition with dacomitinib and crizotinib in advanced non‐small cell
lung cancer: Results of a phase I study. Journal of Thoracic Oncology, 11
(5), 737–747.
Jiang, Y. ‐Q., Zhou, Z. ‐X., & Ji, Y. ‐L. (2014). Suppression of EGFR‐STAT3
signaling inhibits tumorigenesis in a lung cancer cell line. International
Journal of Clinical and Experimental Medicine, 7(8), 2096–2099.
Jorge, S. E., Kobayashi, S. S., & Costa, D. B. (2014). Epidermal growth factor
receptor (EGFR) mutations in lung cancer: Preclinical and clinical data.
Brazilian Journal of Medical and Biological Research, 47(11), 929–939.
Koivunen, J. P., Mermel, C., Zejnullahu, K., Murphy, C., Lifshits, E., Holmes, A.
J., … Janne, P. A. (2008). EML4‐ALK fusion gene and efficacy of an ALK
kinase inhibitor in lung cancer. Clinical Cancer Research: An Official Journal
of the American Association for Cancer Research, 14(13), 4275–4283.
Lakshmikuttyamma, A., Sun, Y., Lu, B., Undieh, A. S., & Shoyele, S. A.
(2014). Stable and efficient transfection of siRNA for mutated KRAS
silencing using novel hybrid nanoparticles. Molecular Pharmaceutics, 11
(12), 4415–4424.
Linardou, H., Dahabreh, I. J., Kanaloupiti, D., Siannis, F., Bafaloukos, D.,
Kosmidis, P., … Murray, S. (2008). Assessment of somatic k‐RAS
mutations as a mechanism associated with resistance to EGFR‐
targeted agents: A systematic review and meta‐analysis of studies in
advanced non‐small‐cell lung cancer and metastatic colorectal cancer.
The Lancet Oncology, 9(10), 962–972.
Lindeman, N. I., Cagle, P. T., Beasley, M. B., Chitale, D. A., Dacic, S.,
Giaccone, G., … Ladanyi, M. (2013). Molecular testing guideline for
selection of lung cancer patients for EGFR and ALK tyrosine kinase
inhibitors: Guideline from the College of American Pathologists,
International Association for the Study of Lung Cancer, and
Association for Molecular Pathology. The Journal of Molecular
Diagnostics, 15(4), 415–453.
Lynch, T. J., Bell, D. W., Sordella, R., Gurubhagavatula, S., Okimoto, R. A.,
Brannigan, B. W., … Haber, D. A. (2004). Activating mutations in the
epidermal growth factor receptor underlying responsiveness of non‐
small‐cell lung cancer to gefitinib. New England Journal of Medicine, 350
(21), 2129–2139.
Marzec, M., Kasprzycka, M., Liu, X., El‐Salem, M., Halasa, K., Raghunath, P.
N., … Wasik, M. A. (2007). Oncogenic tyrosine kinase NPM/ALK
induces activation of the rapamycin‐sensitive mTOR signaling path-
way. Oncogene, 26, 5606–5614.
1566 | ZARREDAR
Mitsudomi, T., Morita, S., Yatabe, Y., Negoro, S., Okamoto, I., Tsurutani, J., …
Fukuoka, M. (2010). Gefitinib versus cisplatin plus docetaxel in patients
with non‐small‐cell lung cancer harbouring mutations of the epidermal
growth factor receptor (WJTOG3405): An open label, randomised phase
3 trial. The Lancet Oncology, 11(2), 121–128.
Morita, S., Okamoto, I., Kobayashi, K., Yamazaki, K., Asahina, H., Inoue, A., …
Nukiwa, T. (2009). Combined survival analysis of prospective clinical
trials of gefitinib for non‐small cell lung cancer with EGFR mutations.
Clinical Cancer Research, 15(13), 4493–4498.
Morris, K. V. (2006). Therapeutic potential of siRNA‐mediated transcrip-
tional gene silencing. Biotechniques, 40, 7–13.
Pao, W., Miller, V., Zakowski, M., Doherty, J., Politi, K., Sarkaria, I., …
Varmus, H. (2004). EGF receptor gene mutations are common in lung
cancers from “never smokers” and are associated with sensitivity of
tumors to gefitinib and erlotinib. Proceedings of the National Academy
of Sciences of the United States of America, 101(36), 13306–13311.
Pikor, L. A., Ramnarine, V. R., Lam, S., & Lam, W. L. (2013). Genetic
alterations defining NSCLC subtypes and their therapeutic implica-
tions. Lung Cancer, 82(2), 179–189.
Riely, G. J., Marks, J., & Pao, W. (2009). KRAS mutations in non‐small cell
lung cancer. Proceedings of the American Thoracic Society, 6(2), 201–205.
Rothschild, S. (2015). Targeted therapies in non‐small cell lung cancer—
Beyond EGFR and ALK. Cancers, 7(2), 0816–0949.
Scagliotti, G. V., Selvaggi, G., Novello, S., & Hirsch, F. R. (2004). The biology
of epidermal growth factor receptor in lung cancer. Clinical Cancer
Research, 10(12), 4227s–4232s.
Shirakusa, T., Noda, N., & Matsuzoe, D. (2002). Genetic investigations for
lung carcinoma. Nihon Geka Gakkai Zasshi, 103(6), 482–486.
Slamon, D. J., Leyland‐Jones, B., Shak, S., Fuchs, H., Paton, V., Bajamonde,
A., … Norton, L. (2001). Use of chemotherapy plus a monoclonal
antibody against HER2 for metastatic breast cancer that over-
expresses HER2. New England Journal of Medicine, 344(11), 783–792.
Stahel, R., Peters, S., Baas, P., Brambilla, E., Cappuzzo, F., De Ruysscher, D.,
… Adjei, A. A. (2013). Strategies for improving outcomes in NSCLC: A
look to the future. Lung Cancer, 82(3), 375–382.
ET AL.
Stephens, P., Hunter, C., Bignell, G., Edkins, S., Davies, H., Teague, J., …
Stratton, M. R. (2004). Lung cancer: Intragenic ERBB2 kinase
mutations in tumours. Nature, 431(7008), 525–526.
Sunaga, N., Shames, D. S., Girard, L., Peyton, M., Larsen, J. E., Imai, H., …
Minna, J. D. (2011). Knockdown of oncogenic KRAS in non‐small
cell lung cancers suppresses tumor growth and sensitizes tumor
cells to targeted therapy. Molecular Cancer Therapeutics, 10(2),
336–346.
Takahashi, T., Sonobe, M., Kobayashi, M., Yoshizawa, A., Menju, T.,
Nakayama, E., … Date, H. (2010). Clinicopathologic features of non‐
small‐cell lung cancer with EML4–ALK fusion gene. Annals of Surgical
Oncology, 17(3), 889–897.
Tammemagi, M. C., McLaughlin, J. R., & Bull, S. B. (1999). Meta‐analyses of
p53 tumor suppressor gene alterations and clinicopathological
features in resected lung cancers. Cancer Epidemiology Biomarkers &
Prevention, 8(7), 625–634.
Zarredar, H., Ansarin, K., Baradaran, B., Ahdi Khosroshahi, S., & Farajnia, S.
(2018a). Potential molecular targets in the treatment of lung cancer
using siRNA technology. Cancer Investigation, 36, 1–22.
Zarredar, H., Ansarin, K., Baradaran, B., Ahdi Khosroshahi, S., & Farajnia, S.
(2018b). Potential molecular targets in the treatment of lung cancer
using siRNA technology. Cancer Investigation, 36(1), 37–58.
Zhao, S., Yang, X. F., Shen, D. F., Gao, Y., Shi, S., Wu, J. C., … Zheng, H. C.
(2016). The down‐regulated ING5 expression in lung cancer:
A potential target of gene therapy. Oncotarget, 7, 54596–54615.
How to cite this article: Zarredar H, Pashapour S, Ansarin K,
Khalili M, Baghban R, Farajnia S. Combination therapy with
KRAS siRNA and EGFR inhibitor AZD8931 suppresses lung
cancer cell growth in vitro. J Cell Physiol. 2019;234:
1560–1566. https://doi.org/10.1002/jcp.27021