Cancer
Tumor and Stem Cell Biology
NRF2 Intensifies Host Defense Systems to Prevent
Lung Carcinogenesis, but After Tumor Initiation
Accelerates Malignant Cell Growth
Hironori Satoh1,2, Takashi Moriguchi1, Daisuke Saigusa3, Liam Baird1, Lei Yu1,
Hirofumi Rokutan2, Keiko Igarashi2, Masahito Ebina4, Tatsuhiro Shibata2,
and Masayuki Yamamoto1
Abstract
Nrf2 activation promotes resistance to chemical carcinogenesis
in animal models, but activating mutations in Nrf2 also confer
malignant characters to human cells by activating antioxidative/
detoxifying enzymes and metabolic reprogramming. In this study,
we examined how these contradictory activities of Nrf2, cancer
chemoprevention and cancer cell growth enhancement, can be
reconciled in an established mouse model of urethane-induced
lung carcinogenesis. Using Keap1-knockdown (kd) mice, which
express high levels of Nrf2, we found that urethane was rapidly
excreted into the urine, consistent with an upregulation in the
expression of urethane detoxification genes. Consequently, ure-
thane-induced tumors were significantly smaller and less frequent
in Keap1-kd mice than in wild-type mice. In contrast, tumor cells
Introduction
The transcription factor Nrf2 plays important roles in the
protective response against environmental stresses, particularly
against oxidative and electrophilic insults (1, 2). In unstressed
conditions, Nrf2 is bound by Keap1 and subjected to degradation
through the ubiquitin–proteasome pathway. Upon exposure to
oxidative or electrophilic stresses, reactive cysteine residues of
Keap1 are chemically modified. Thereafter, the Keap1-mediated
degradation of Nrf2 is eliminated, leading to Nrf2 accumulation
in the nucleus. Subsequently, Nrf2 dimerizes with one of the small
Maf proteins (sMaf) and binds to the specific DNA sequence
referred to as antioxidant/electrophile response element, through
which a variety of target genes, such as NAD(P)H quinone oxido-
1
Department of Medical Biochemistry, Graduate School of Medicine,
Tohoku University, Sendai, Japan. 2Division of Cancer Genomics,
National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan.
3
Department of Integrative Genomics, Tohoku Medical Megabank,
Tohoku University, Aoba-ku, Sendai, Japan. 4Department of Respira-
tory Medicine, Pulmonary Center, Tohoku Pharmaceutical University
Hospital, Miyagino-ku, Sendai, Japan.
Note: Supplementary data for this article are available at Cancer Research
Online (http://cancerres.aacrjournals.org/).
Corresponding Authors: Masayuki Yamamoto, Tohoku University Graduate
School of Medicine, 2-1 Seiryo-machi, Aoba-ku, Sendai 980-8575, Japan. Phone:
812-2717-8084; Fax: 812-2717-8090; E-mail: masiyamamoto@med.tohoku.ac.jp;
and Takashi Moriguchi, moriguch@med.tohoku.ac.jp
doi: 10.1158/0008-5472.CAN-15-1584

2016 American Association for Cancer Research.
3088 Cancer Res; 76(10) May 15, 2016
Research
Downloaded from http://aacrjournals.org/cancerres/article-pdf/76/10/3088/2731790/3088.pdf by Dongguk University user on 01 December 2022
derived from Keap1-kd mice and transplanted into nude mice
exhibited higher tumorigenicity compared with cells derived from
wild-type mice. To identify the factors contributing to the tumor
growth phenotype in the transplantation model, we performed a
microarray analysis and found that many antioxidative stress
genes were upregulated in the Keap1-kd–derived tumors. There-
fore, we suggest that Nrf2 activation in cancer cells enhances their
tumorigenicity, but global Nrf2 activation, as in Keap1-kd mice,
simultaneously enhances anticancer immunity, thereby suppres-
sing the growth potential of Keap1-kd tumors. Our findings
provide relevant insight into the dual role of Nrf2 in cancer and
warrant further studies of Nrf2 function during different stages of
carcinogenesis. Cancer Res; 76(10); 3088–96.
2016 AACR.
reductase (Nqo1), heme oxygenase 1 (Ho-1), and glutamate-cysteine
ligase catalytic subunit (Gclc), are induced. These cytoprotective
enzymes contribute to the cellular protection against oxidative
and electrophilic insults.
Urethane (ethyl carbamate) is a prototypic carcinogen that
induces lung adenoma and adenocarcinoma (3). Upon admin-
istration of urethane to mice, adenomas often develop in the lung,
which later give rise to adenocarcinomas (4). Cytochrome P450
2E1 (Cyp2e1)-mediated oxidization converts urethane into
vinyl carbamate epoxide (VCE), which serves as a potent carcin-
ogen by inducing DNA- and protein–adduct formation (5). VCE
is converted into 1, 2-dihydroxyethyl carbamate by microsomal
epoxide hydrolase (mEH), and subsequently the product is sub-
jected to Gstp1/p2–mediated glutathione conjugation. There-
after, the conjugate is excreted into the urine (6). As the mEH
and Gstp1/p2 genes are targets of NRF2 (1, 7, 8), the detoxifica-
tion pathway of urethane appears to be under the influence of
Nrf2 activity. Many studies have demonstrated that Nrf2-deficient
mice are susceptible to a variety of carcinogens (9–12). In contrast,
Nrf2 activation in cancer cells has also been shown to contribute
to the promotion of tumor growth in many forms of cancer
(13, 14). These two rather contradictory aspects of Nrf2 function
have been referred to as the "Double-Edged Sword of Nrf2"
(15, 16). We have previously demonstrated that Nrf2 activity
exhibits bidirectional stage-specific effects in urethane-induced
lung carcinogenesis (17). Specifically, Nrf2-deficient mice exhib-
ited more abundant microtumor nodules than wild-type mice
at early stages (4–8 weeks) after urethane administration. In
contrast, in the later stages (16 weeks after urethane treatment),
wild-type mice showed large, malignant lung tumors with

increased Nrf2 accumulation, whereas Nrf2-deficient mice rarely
developed such malignant cancers (17). These results indicate that
Nrf2 prevents cancer initiation in the early stages, whereas Nrf2
accelerates cancer progression in the advanced stages of urethane-
induced lung carcinogenesis.
Given the above results from the Nrf2-deficient mice, we
next wanted to address whether constitutive Nrf2 activation
affects cancer incidence and malignancy. To this end, we explo-
ited Keap1-knockdown (Keap1-kd) mice that show constitutive
Nrf2 accumulation due to a systemic decrease in Keap1 expres-
sion (18). The Keap1-kd mice survive to adulthood and exhibit
resistance against oxidative and electrophilic insults (19, 20).
Therefore, the Keap1-kd mice serve as an excellent model of
genetic Nrf2 induction.
Considering that Nrf2-deficient mice show increased suscepti-
bility to urethane and develop many micronodules in the early
stage (17), we hypothesized that Keap1-kd mice could be resis-
tant against urethane-induced lung carcinogenesis, due to the
constitutive activation of stress-responsive genes. To address this
hypothesis, we utilized the urethane carcinogenesis model in
Keap1-kd mice. We found that the Keap1-kd mice developed a
significantly lower number of urethane-induced lung tumors than
the wild-type mice. In contrast, when transplanted into nude mice,
the Keap1-kd mice–derived tumor cells showed more vigorous
growth than the wild-type mice–derived tumor cells. These results
demonstrate that systemic activation of Nrf2 prevents urethane-
induced lung carcinogenesis, whereas Nrf2 activation confers
tumorigenicity on the cancer cells.
Materials and Methods
Experimental animals
Keap1-kd mice (5–9 weeks) and age-matched Keap1-wt mice
with ICR genetic background were used (18, 21). The mice were
maintained in a facility free of specific pathogens. Nude mice (8–9
weeks) were purchased from CLEA Japan. We mainly used male
mice in this study to exclude gender biases. All animal experi-
ments were performed under the approval of the Tohoku Uni-
versity Animal Care Committee.
Transplantation of tumors into nude mice
Urethane-induced lung tumors of approximately equal sizes
(f ¼ 0.5–1.5 mm) from Keap1-kd and Keap1-wt mice were trans-
planted subcutaneously into the backs of nude mice. The tumor
diameters were measured each month using a digital caliper. The
tumor volumes were calculated using the following formula:
length (mm)  width (mm)  height (mm)  0.5 (22).
Quantitative RT-PCR
Total RNA was extracted from the tissues using ISOGEN
(Nippon Gene). First-strand cDNA was synthesized from the
total RNA using random hexamers and Superscript III Reverse-
Transcriptase (Invitrogen). Real-time RT-PCR was performed
using 2X SYBR Green PCR Master Mix (Invitrogen) and the ABI
PRISM 7300 sequence detector system (PE-Applied Biosystems).
Sequences of primers and TaqMan probes were described pre-
viously (17). Following primers were newly prepared; Ppargc1a:
forward ACAGCTTTCTGGGTGGATTG, reverse TCTGTGAGAA-
CCGCTAGCAA. Catalase: forward GCTTCAAGTTGGTTAATGC-
AG, reverse GGCAATTTTTGATGCCCTGG, and TaqMan probe
AGAGGCAGTCTATTGCAAG.
www.aacrjournals.org
Genetic Nrf2 Activation in Chemical Lung Carcinogenesis
Urethane-induced lung carcinogenesis experiments
Urethane (ethyl carbamate; 1 g/kg body weight) was intraper-
itoneally administered. At 8 weeks, 16 weeks, and 8 months after
the administration, the mice were euthanized. The lungs were
dissected and the total number of lung surface tumors was
counted macroscopically. The diameter of the tumors was mea-
sured using an electronic caliper.
Gene expression analysis
Surface lung tumors were dissected, and surrounding tissues
were carefully removed under a stereoscopic microscope. Tu-
mors and nontumor tissues in lungs of urethane-administered
mouse were pooled and subjected to a whole-mouse genome
microarray analysis (4  44 k; Agilent Technologies). Expres-
Downloaded from http://aacrjournals.org/cancerres/article-pdf/76/10/3088/2731790/3088.pdf by Dongguk University user on 01 December 2022
sion array data were analyzed with GeneSpring software (Sil-
icon Genetics). Heatmaps were generated utilizing Cluster 3.0
(http://bonsai.hgc.jp/~mdehoon/software/cluster/) and JAVA
Treeview 159 (http://jtreeview.sourceforge.net/). The classifica-
tions of the selected genes according to their biologic and
toxicologic functions were performed using Ingenuity Pathway
Analysis (IPA) software (Ingenuity system). P value, represented
as the negative log ratio of the IPA results, is calculated by the
Fisher exact test.
Statistical analyses
The data are described as the mean  SD. The statistical
significance in differences was calculated by the Student t test or
the Mann–Whitney U test. The values for the incidence of
lung tumors were analyzed with the Fisher exact probability
test. P values < 0.05 were considered significant.
Results
Keap1-kd mice express Nrf2 and its target genes at high levels
Urethane acquires carcinogenic activity through conversion
into the electrophilic metabolite, vinyl carbamate epoxide
(VCE; Fig. 1A). We previously found that intraperitoneal
injection of urethane (1 g/kg body weight) increased Nrf2
protein level and expression of Nrf2 target genes in the lung
of Keap1-wt mice (17). It has previously been shown that
Keap1-kd mice are highly resistant to the damaging effects of
oxidants due to the high expression level of Nrf20 s cytopro-
tective target genes (19, 20). In this study, we found that a
number of genes that directly participate in the detoxifica-
tion of urethane, that is, Cyp2e1, mEH, Gstp1, and Gstp2, were
induced in the lung of Keap1-kd mice compared with Keap1-wt
mice (Fig. 1B). In the liver, mRNA expression of mEH and
Gstp2 was also higher in Keap1-kd mice when compared with
Keap1-wt mice (Supplementary Fig. 1). These results indicate
that the expression of urethane detoxification genes is en-
hanced in Keap1-kd mice.
The constitutive activation of the urethane detoxification
system in Keap1-kd mice suggests that urethane is efficiently
detoxified in Keap1-kd mice. It has previously been reported
that urethane metabolites are mainly excreted into the urine
(23). Therefore, we examined the concentration of urethane
and its metabolite in plasma and urine of Keap1-kd and Keap1-
wt mice after intraperitoneal injection of urethane. We collected
plasma and urine samples one day after the injection of
urethane (1 g/kg body weight) and subjected them to LC/
MS-MS analyses. A selected reaction monitoring (SRM)
Cancer Res; 76(10) May 15, 2016 3089
 Satoh et al.
chromatogram of urethane and its positive control urethane-
d5 (deuterium-labeled urethane as an internal standard) in
plasma are shown in Fig. 1C and a SRM chromatogram of
VCE and urethane-d5 in urine are shown in Fig. 1D.
The urethane level in the plasma was significantly
lower in Keap1-kd mice compared with Keap1-wt mice one
day after the urethane injection (Fig. 1E). Similarly, the
level of VCE in the urine was also lower in the Keap1-kd
mice than in the Keap1-wt mice (Fig. 1F). These results
indicate that urethane and its metabolite VCE is efficiently
detoxified and excreted by Keap1-kd mice, presumably by
virtue of the enhanced activity of the urethane detoxifi-
cation pathway.
3090 Cancer Res; 76(10) May 15, 2016
Downloaded from http://aacrjournals.org/cancerres/article-pdf/76/10/3088/2731790/3088.pdf by Dongguk University user on 01 December 2022
Figure 1.
Urethane metabolism in Keap1-kd mice. A, bioactivation
and detoxification pathway of urethane (ethyl
carbamate). B, RT-qPCR analysis of urethane
detoxification enzymes in the lung of Keap1-wt-mice and
Keap1-kd-mice. mRNA abundance is normalized with
b-actin level. SRM chromatogram of urethane or VCE with
urethane-d5 (deuterium-labeled urethane as an internal
standard) as a control in plasma (C) and urine (D).
Quantification of plasma urethane (E) and urinary VCE (F)
by LC-/MS-MS in the Keap1-wt-mice and Keap1-kd-mice
after vehicle (V) or urethane (U) treatment is depicted.
Plasma urethane level and urinary VCE level are both
lower in the Keap1-kd mice than in the Keap1-wt mice. The
data are presented as the mean  SD. The significant
differences determined by Student t test are indicated
( , P < 0.05;   , P < 0.01; n ¼ 4 in each group).
Keap1-kd mice are resistant against urethane-induced
tumorigenesis
To address the question of whether the susceptibility to ure-
thane is altered in Keap1-kd mice, we applied the urethane-
induced carcinogenesis methodology to the Keap1-kd and
Keap1-wt mice. We analyzed the effects of urethane treatment
under four different experimental conditions: short-term obser-
vation (8 weeks), mid-term observation (16 weeks), long-term
observation (8 months), and long-term observation (8 months)
with multiple administrations of urethane.
We found that in the short-term observation after a single
urethane administration, 100.0% (4/4) of the urethane-treated
Keap1-wt mice developed macroscopic (f > 0.5 mm) lung
Cancer Research

Figure 2.
Short-term and mid-term urethane-induced lung carcinogenesis. A,
mouse lungs were examined at 8 weeks after urethane administration.
Representative gross observations of surface lung tumors in Keap1-wt and
Keap1-kd mice (top). Arrowhead, the surface tumor. Scale bar, 5 mm.
Representative hematoxylin and eosin–stained sections. Scale bar, 100
mm (bottom). B, number of surface lung tumors in Keap1-wt (n ¼ 4) and
Keap1-kd (n ¼ 10) mice. Each dot represents total number of macroscopic
tumors (f > 0.5 mm) in an individual mouse. The color of the dots
indicates the size of the largest tumor in each mouse lung. C,
representative hematoxylin and eosin–stained sections in Keap1-wt and
Keap1-kd-mice at 16 weeks. Scale bar, 100 mm. D, numbers of surface
tumors (f > 1.0 mm) in Keap1-wt (n ¼ 4) and Keap1-kd (n ¼ 6) mice. Data
are presented as the mean  SD. The significant differences by Student
t test are indicated ( , P < 0.01).
surface tumors, compared with only 20% (2/10) of the
Keap1-kd mice (f > 0.5 mm; Fig. 2A and B; Table 1A). This
result suggests that the induction of Nrf2 in Keap1-kd mice
prevents urethane-induced lung tumorigenesis during the
early phase.
We extended the observation time and examined the total
number and diameter of lung surface tumors 16 weeks after
urethane administration. The total number of lung surface
tumors (f > 1.0 mm) per mouse was significantly increased
during this extended period in the Keap1-wt mice (Fig. 2C and
D; Table 1B). There also exists the possibility that Keap1-kd
tumor cells may grow vigorously during the later stages of the
urethane-induced tumorigenesis, as Nrf2 shows potent onco-
genic activity in many types of human cancers (13, 22). To
examine this possibility, we extended the observation term
www.aacrjournals.org
Genetic Nrf2 Activation in Chemical Lung Carcinogenesis
again and examined the total number and diameter of ure-
thane-induced tumors 8 months after a single administration
of urethane. The total number of surface tumors (f > 1.0 mm)
per mouse was significantly increased in the Keap1-wt mice at 8
months (Fig. 3A and B; Table 1C). In contrast, the numbers of
surface tumors did not significantly increase in the Keap1-kd
mice even at this late time point (Fig. 3A and B; Table 1C). By
determining the average diameter of all of the tumors in both
genotypes, we found that Keap1-kd mice also developed much
smaller tumors when compared with the Keap1-wt mice
(Fig. 3C). These results indicate that constitutive induction of
Nrf2 through the knockdown of Keap1 expression strongly
restricts the growth of urethane-induced lung tumors.
To examine whether an increased amount of urethane and its
Downloaded from http://aacrjournals.org/cancerres/article-pdf/76/10/3088/2731790/3088.pdf by Dongguk University user on 01 December 2022
metabolites could increase urethane-mediated tumorigenesis
in Keap1-kd mice, we conducted a tumorigenesis experiment
using multiple injections of urethane. Both Keap1-kd and Keap1-
wt mice were injected weekly with urethane for four consecutive
weeks, subsequently the mice were examined 8 months after
the first urethane administration (Fig. 3D). Surprisingly, the
initiation of tumorigenesis was not dramatically enhanced by
this treatment, and the number of surface tumors was still
significantly lower in Keap1-kd mice than in Keap1-wt mice
(Fig. 3E; Table 1D). Interestingly, using this experimental pro-
cedure, the diameter of Keap1-kd tumors became similar to that
of Keap1-wt mice (Fig. 3F). In addition, Keap1-kd tumors con-
tained an increased number of Ki67-positive cells compared
with similar sized Keap1-wt tumors (top panels in the Supple-
mentary Fig. S2A), whereas the tumor bearing Keap1-kd lung
tissue harbored a higher number of infiltrating inflammatory
cells than the Keap1-wt lung (bottom panels in the Supplemen-
tary Fig. S2B). These results indicate that the Keap1-kd tumors
have a high tumorigenic potential, but the increased number
of inflammatory cells might attenuate the tumor growth in the
Keap1-kd lung tissue.
Cancer-resistant host microenvironment is activated in Keap1-
kd mice
We previously found that systemic Nrf2 activation in Keap1-kd
mice generates a cancer-resistant host immune environment
by attenuating the activity of myeloid-derived suppressor cells
(MDSC), a potent cancer immunosurveillance cell type (24).
Intracellular accumulation of reactive oxygen species (ROS)
in MDSCs (ROS-in-MDSC) leads to the suppression of CD8þ
T-cell–mediated cancer immunity, hence the ROS level
serves as a good indicator of MDSCs activity (24, 25). There-
fore, we hypothesized that an increase in Nrf2 activity will
decrease the ROS-in-MDSCs level in tumor-bearing Keap1-kd
mice, thereby attenuating the activity of MDSCs, leading to the
generation of a cancer-resistant host immune environment in
Keap1-kd mice.
To test this hypothesis, we conducted tumor cell transplan-
tation studies into immunodeficient nude mice, a gold stan-
dard experiment to evaluate the tumorigenicity of cancer cells
without the influence of host-environment interactions (26).
We dissected lung tumors of approximately equal sizes (f ¼
0.5–1.5 mm) from the Keap1-wt and Keap1-kd mice 8 months
after a single urethane administration, transplanted them into
nude mice, and evaluated their tumorigenicity. Notably, during
the 5-month observation period, tumor cells from Keap1-kd
mice grew much more aggressively than tumor cells from
Cancer Res; 76(10) May 15, 2016 3091
 Satoh et al.

Table 1. Summary of urethane-induced lung carcinogenesis experiments

A. Short-term observation (8 weeks) after single urethane administration in Keap1-wt and Keap1-kd mice
Average number of lung surface tumors per
Incidence of lung surface tumors mouse
Tumor size (mm) f > 0.5 f > 0.5
Keap1-wt (n ¼ 4) 4/4 (100.0%) 2.5  1.3
Keap1-kd (n ¼ 10) 2/10 (20.0%)a 0.2  0.4a

B. Mid-term observation (16 weeks) after single urethane treatment in Keap1-wt and Keap1-kd mice
Average number of lung surface tumors per
Incidence of lung surface tumors mouse
Tumor size (mm) f > 1.0 f > 1.0
Keap1-wt (n ¼ 4) 4/4 (100.0%) 6.0  3.7
Keap1-kd (n ¼ 6) 1/6 (16.7%)a 0.2  0.4a

C. Long-term observation (8 months) after single urethane treatment in Keap1-wt and Keap1-kd mice

Downloaded from http://aacrjournals.org/cancerres/article-pdf/76/10/3088/2731790/3088.pdf by Dongguk University user on 01 December 2022

Average number of lung surface tumors per
Incidence of lung surface tumors mouse
Tumor size (mm) f > 1.0 f > 3.0 f > 1.0 f > 3.0
Keap1-wt (n ¼ 7) 7/7 (100.0%) 7/7 (100.0%) 12.7  6.1 3.1  2.4
Keap1-kd (n ¼ 8) 7/8 (87.6%) 2/8 (25.0%)a 1.8  1.5a 0.4  0.7a

D. Long-term observation (8 month) after four times urethane treatment in Keap1-wt and Keap1-kd mice
Average number of lung surface tumors per
Incidence of lung surface tumors mouse
Tumor size (mm) f > 1.0 f > 3.0 f > 1.0 f > 3.0
Keap1-wt (n ¼ 3)b 3/3 (100.0%) 3/3 (100.0%) 47.0  23.1 9.3  9.1
Keap1-kd (n ¼ 7) 7/7 (100.0%) 4/7 (57.1%) 10.9  4.6a 1.3  1.4c
a
P < 0.01 compared with wild-type mice.
b
Three of Keap1-wt mice dropped out during the experimental term.
c
P < 0.05 compared with wild-type mice.

Keap1-wt mice. Representative tumors taken from the back of
nude mice are shown in Fig. 4A, and the sizes of the tumors
measured every month are depicted in Fig. 4B. These results
indicate that the tumor cells derived from Keap1-kd mice are
more highly proliferative compared with those from the wild-
type mice when transplanted into an immunodeficient host
environment.
Expression profile of cancer-related genes in Keap1-kd tumor
cells
To explore the mechanisms underlying the enhanced
growth of Keap1-kd cancer cells in nude mice, we conducted
expression microarray analysis and compared the gene expres-
sion profile between Keap1-kd and Keap1-wt tumor cells. For
this purpose, we extracted total RNA from tumors and non-
cancerous normal tissue from both Keap1-kd and Keap1-wt
mice 8 months after a single administration of urethane. We
selected genes that were induced more than 2-fold in the
tumors relative to normal lung tissue in both genotypes of
mice and subjected the expression array data to IPA to identify
enriched gene ontology terms. From this analysis, the gene set
annotated as "cancer-related genes" was identified and sepa-
rated into three groups depending on whether they were
commonly or differentially expressed between Keap1-kd and
Keap1-wt tumors (depicted in the Venn diagram; Fig. 5A). A set
of 566 genes were found to be commonly upregulated in both
the Keap1-kd and Keap1-wt cancer tissues, including genes that
regulate lung development, such as Sox9, Id2, and Foxa2 (data
not shown). These three genes have previously been shown to
participate in lung cancer progression under the regulation of
Nrf2 (17).
A distinct set of 489 genes was exclusively upregulated in
the Keap1-kd tumors. Employing IPA analysis, we identified
20 downstream genes responsible for the enhanced growth
of Keap1-kd tumors and confirmed their differential expres-
sion patterns between the Keap1-wt and the Keap1-kd tumors
(Fig. 5B). Most of the genes encode antioxidant and detoxi-
fication enzymes, which are well-known downstream target
genes of Nrf2 (Supplementary Table S1; refs. 27–31). Of the
20 genes, Glutathione peroxidase 2 (Gpx2), Catalase (Cat),
Ppargc1A, Glutathione-S-transferase a4 (Gsta4), and Glutathione
reductase (Gsr) were found to be highly expressed in the Keap1-
kd cancers in comparison with the Keap1-wt cancers (pink dots
in Fig. 5B), and all five of these genes have been reported to
contribute to cancer cell proliferation through eliminating
cellular ROS level (32–35). We confirmed this change in gene
expression by means of manual quantitative RT-PCR (Fig.
5C). In addition, we noticed an increase in Multidrug resistance
protein 3 (Mrp3) expression, which contributes to cellular
multidrug resistance (36). These results suggest that the
Keap1-kd cancer cells retain higher level of drug resistance
than do the Keap1-wt cancer cells.
However, it should be noted that the tumors in Keap1-kd
mice were all small, and that the cancer cells from the
Keap1-kd mice only proliferated vigorously in the micro-
environment of the nude mouse. Therefore, these results
demonstrate that, although increased expression of antiox-
idant genes contributes to the enhanced proliferation of
Keap1-kd cancer cells, the proliferation of these tumors is
severely repressed by the anticancer immunity mediated by
the global increase in Nrf2 activity in Keap1-kd mice (sum-
marized in Fig. 6).

3092 Cancer Res; 76(10) May 15, 2016 Cancer Research

 Genetic Nrf2 Activation in Chemical Lung Carcinogenesis

Figure 3.
Long-term urethane-induced lung carcinogenesis. A,
experimental protocol for one-shot urethane
administration. Mouse lungs were examined 8 months
after urethane administration. Representative gross
observations of surface lung tumors in Keap1-wt and
Keap1-kd-mice are depicted. Arrowheads, the surface
tumors. Scale bar, 10 mm. Representative hematoxylin and
eosin–stained sections (bottom). Scale bar, 40 mm. B,
number of surface lung tumors (f > 1 mm) in Keap1-wt (n ¼
7) and Keap1-kd (n ¼ 8) mice. The color of the dots

Downloaded from http://aacrjournals.org/cancerres/article-pdf/76/10/3088/2731790/3088.pdf by Dongguk University user on 01 December 2022

indicates the size of the largest tumor in each individual
mouse of both genotypes. Each dot represents the total
number of macroscopic tumors (f > 0.5 mm) in an
individual mouse. The color of the dots indicates the size of
the largest tumor in each mouse lung. C, average tumor
diameter in each genotype of mouse. D, experimental
protocol for the four consecutive urethane administration
experiment. Mouse lungs are examined 8 months after four
consecutive administrations of urethane. Representative
gross observations of surface lung tumors in Keap1-wt and
Keap1-kd-mice. Arrowheads, the surface tumor. Scale bar,
10 mm. Representative hematoxylin and eosin–stained
sections (bottom). Scale bar, 40 mm. E, number of surface
lung tumors (f > 1 mm) in in Keap1-wt (n ¼ 3) and Keap1-kd
(n ¼ 7) mice. The color of dots indicates size of the largest
tumor in each individual mouse of both genotypes. Each
dot represents total number of macroscopic tumors (f >1.0
mm) in individual mouse. The color of dots indicates size of
the largest tumor in each mouse lung. F, average tumor
diameter in each genotype of mouse. The data are
presented as the mean  SD. The significant differences by
Student t test are indicated ( , P < 0.05;   , P < 0.01).

Discussion
It is widely accepted that Nrf2 attenuates toxicities of many
oncogenic compounds by inducing the expression of a series of
detoxifying and antioxidative stress enzyme genes (1). For
example, urethane treatment induces Nrf2 accumulation, and
the subsequent induction of detoxifying and antioxidative
stress enzymes alleviates the initiation of lung cancers in
wild-type mice (17). In this study, we have demonstrated that
Keap1-kd mice, which express cytoprotective enzymes at a high
level, are significantly resistant to urethane-induced lung car-
cinogenesis, indicating that the cytoprotective enzymes regu-
lated by Nrf2 are crucial for the prevention of urethane-induced
carcinogenesis. Intriguingly, while the number and size of
urethane-induced tumors was significantly decreased in the Figure 4.
Keap1-kd mice, tumor cells derived from the Keap1-kd mice Keap1-kd mice tumors transplanted into nude mice grow larger than that
grew much more vigorously upon transplantation into nude of Keap1-wt mice. A, gross observations of tumors transplanted in
mice than the wild-type mouse–derived cancer cells. These nude mice. Scale bar, 0.5 mm. Representative hematoxylin and
eosin–stained sections (bottom). Scale bar, 20 mm. B, growth curve of
results demonstrate that, while the Keap1-kd mouse–derived
Keap1-wt and Keap1-kd tumors transplanted in nude mice. The data
cancer cells acquire a strong cue for malignant transformation, are presented as the mean  SEM. The statistically significant differences
their proliferation ability is severely repressed by the anticancer by Mann–Whitney unpaired U test are depicted ( , P < 0.05; n ¼ 6–8
immunity mediated by the global increase in Nrf2 activity in in each group).

www.aacrjournals.org Cancer Res; 76(10) May 15, 2016 3093

 Satoh et al.

consequently a reduction in both tumor number and size in

response to urethane-induced carcinogenesis (summarized
in Fig. 6).
To clarify the mechanisms underlying the strong proliferative
activity of the transplanted Keap1-kd cells, we examined the gene
expression signature of the Keap1-kd tumors. Our microarray
analysis revealed that a battery of Nrf2 downstream genes is
highly expressed in the Keap1-kd tumors. Particularly, expressions
of Gpx2, Gsr, Cat, Mrp3, Gsta2, and Ppargc1A genes, all of which
have been reported to be regulated by Nrf2, are increased (27–31,
36, 40, 41). Of these antioxidant proteins, Catalase encoded by
Cat is known to play a crucial role in the ROS-scavenging system
by converting hydrogen peroxide to water (31). A recent study
revealed the contribution of Catalase to the enhancement of lung

Downloaded from http://aacrjournals.org/cancerres/article-pdf/76/10/3088/2731790/3088.pdf by Dongguk University user on 01 December 2022

cancer malignancy by reducing ROS level (32). PPAR gamma
coactivator-1a (Pgc1a), a transcriptional coactivator encoded by
Ppargc1A, also plays important roles in cellular protection against
ROS by increasing the expression of antioxidant enzymes (27). In
addition, Pgc1a has also been shown to be highly expressed in
several types of epithelial cancer where it contributes to ROS
scavenging (34). Given these previous reports, our current results
indicate that constitutively activated Nrf2 in the Keap1-kd tumor
cells contributes to malignant progression by reducing ROS levels
through inducing the expression of multiple antioxidant genes.
Similarly, treatment of tumor-bearing mice with antioxidants,
such as N-acetylcysteine (NAC) and vitamin E, have been shown
to reduce intracellular ROS levels and promote cancer progression

Figure 5.
Identification of the gene expression signature in the Keap1-kd and
Keap1-wt tumors. A, Venn diagram depicting the numbers of genes
induced more than 2-fold in tumors over nontumor lung tissues of
Keap1-wt and Keap1-kd mice. B, heat map comparisons of differentially
expressed genes in the lung tumors of Keap1-wt and Keap1-kd mice.
Pink dots, Nrf2 target genes that contribute to cancer cell malignancy.
C, qRT-PCR analyses of Nrf2 target genes. Statistical significance in
differences by Student t test is indicated (  , P < 0.01).

Keap1-kd mice. Consequently, the size of the tumors is kept

small in the Keap1-kd mice.
It has been shown that the immunosuppressive activity by
MDSCs is primarily regulated by the intracellular ROS level
(37) and that the Nrf2-mediated antioxidant system appears to
play a crucial role for the reduction of immunosuppressive
activity in MDSCs (24, 38). Recently, ex vivo experiment of
bone marrow–derived macrophage using Nrf2-deficient mice
showed that Nrf2 contributes to CD8þ T-cell function by
regulating g-GCS and xCT (39). We recently reported that the
immune microenvironment of Keap1-kd mice leads to resis-
tance against metastasis of lung cancer cells and that activation
of Nrf2 by chemical inducers reduces ROS levels in MDSCs,
which in turn strengthens host immunity against metastatic Figure 6.
cancer cells (38). We found that when Keap1-kd tumors were High-level Nrf2 expression in the Keap1-kd lung cancer cells enhances the
transplanted into T-cell–deficient nude mice, they proliferated tumorigenicity through activating antioxidative stress system. Meanwhile,
vigorously, supporting the notion that Nrf2-mediated increased level of Nrf2 intensifies carcinogen detoxifying system and
anticancer immunity in the host environment (depicted in the "Host
enhancement of anticancer immunity is critically important
Defense"). Balance between these two aspects of Nrf2 function is a critical
to regulate the cancer-resistant host microenvironment. We determinant for tumor growth. In the Keap1-kd mice, the tumor-resistant
would postulate that, the genetic induction of Nrf2 by knock- environment dominates the tumorigenicity of the cells, thereby diminishing
down of the Keap1 gene results in reduced MDSCs activity, and tumor growth.

3094 Cancer Res; 76(10) May 15, 2016 Cancer Research


in experimental carcinogenesis in multiple tissues (42). These
wide-ranging observations suggest that antioxidants may exert
accelerating effects on cancer progression at the late stages of
carcinogenesis.
Constitutive activation of Nrf2 in Keap1-kd mice produces
the same positive effect on the proliferation of tumor cells,
but as Nrf2 concomitantly activates anticancer immunity, it
does not promote unrestricted tumor growth. Thus, our
results show that the systemic activation of Nrf2 prior to the
administration of carcinogens prevents urethane-induced
lung carcinogenesis.
Disclosure of Potential Conflicts of Interest
No potential conflicts of interest were disclosed.
Authors' Contributions
Conception and design: H. Satoh, T. Moriguchi, M. Yamamoto
Development of methodology: H. Satoh, D. Saigusa
Acquisition of data (provided animals, acquired and managed patients,
provided facilities, etc.): H. Satoh, T. Moriguchi, D. Saigusa, L. Baird, L. Yu,
T. Shibata
Analysis and interpretation of data (e.g., statistical analysis, biostatistics,
computational analysis): H. Satoh, T. Moriguchi, D. Saigusa, L. Baird, L. Yu,
T. Shibata, M. Yamamoto
Writing, review, and/or revision of the manuscript: H. Satoh, T. Moriguchi,
D. Saigusa, L. Baird, T. Shibata, M. Yamamoto
References
1. Itoh K, Mimura J, Yamamoto M. Discovery of the negative regulator of Nrf2,
Keap1: a historical overview. Antioxid Redox Signal 2010;13:1665–78.
2. Itoh K, Chiba T, Takahashi S, Ishii T, Igarashi K, Katoh Y, et al. An Nrf2/small
Maf heterodimer mediates the induction of phase II detoxifying enzyme
genes through antioxidant response elements. Biochem Biophys Res
Commun 1997;236:313–22.
3. Anderson N, Paul SH, Henry M. Induction of pulmonary tumors in mice
with ethyl carbamate (Urethane). J Natl Cancer Inst 1943;4:309–19.
4. Horio Y, Chen A, Rice P, Roth JA, Malkinson AM, Schrump DS. Ki-ras and
p53 mutations are early and late events, respectively, in urethane-induced
pulmonary carcinogenesis in A/J mice. Mol Carcinog 1996;17:217–23.
5. Ghanayem BI, Hoffler U. Investigation of xenobiotics metabolism, geno-
toxicity, and carcinogenicity using Cyp2e1(-/-) mice. Curr Drug Metab
2007;8:728–49.
6. Kemper RA, Myers SR, Hurst HE. Detoxification of vinyl carbamate
epoxide by glutathione: evidence for participation of glutathione S-
transferases in metabolism of ethyl carbamate. Toxicol Appl Pharmacol
1995;135:110–8.
7. Su S, Yang X, Omiecinski CJ. Intronic DNA elements regulate Nrf2 chemical
responsiveness of the human microsomal epoxide hydrolase gene
(EPHX1) through a far upstream alternative promoter. Biochim Biophys
Acta 2014;1839:493–505.
8. Hu R, Xu C, Shen G, Jain MR, Khor TO, Gopalkrishnan A, et al. Gene
expression profiles induced by cancer chemopreventive isothiocyanate
sulforaphane in the liver of C57BL/6J mice and C57BL/6J/Nrf2 (-/-) mice.
Cancer Lett 2006;243:170–92.
9. Xu C, Huang MT, Shen G, Yuan X, Lin W, Khor TO, et al. Inhibition of 7,12-
dimethylbenz(a)anthracene-induced skin tumorigenesis in C57BL/6 mice
by sulforaphane is mediated by nuclear factor E2-related factor 2. Cancer
Res 2006;66:8293–6.
10. Ramos-Gomez M, Kwak MK, Dolan PM, Itoh K, Yamamoto M, Talalay P,
et al. Sensitivity to carcinogenesis is increased and chemoprotective
efficacy of enzyme inducers is lost in nrf2 transcription factor-deficient
mice. Proc Natl Acad Sci U S A 2001;98:3410–5.
11. Osburn WO, Karim B, Dolan PM, Liu G, Yamamoto M, Huso DL, et al.
Increased colonic inflammatory injury and formation of aberrant crypt foci
www.aacrjournals.org
Genetic Nrf2 Activation in Chemical Lung Carcinogenesis
Administrative, technical, or material support (i.e., reporting or organiz-
ing data, constructing databases): H. Satoh, L. Yu, H. Rokutan, K. Igarashi,
M. Ebina, M. Yamamoto
Study supervision: M. Yamamoto
Acknowledgments
The authors thank Dr. Yasuhito Arai, Dr. Takanori Hidaka, and Mr. Kohei
Tsuchida for the insightful advice and helpful discussions. The authors also
thank the Biomedical Research Core of Tohoku University Graduate School of
Medicine for its technical support.
Grant Support
This work was supported in part by Grants-in-Aid for Scientific Research from
the Ministry of Education, Culture, Sports, Science, and Technology and the
Japan Society for Promotion of Science (T. Moriguchi and M. Yamamoto),
Scientific Research on Priority Areas (M. Yamamoto) and Specially Promoted
Downloaded from http://aacrjournals.org/cancerres/article-pdf/76/10/3088/2731790/3088.pdf by Dongguk University user on 01 December 2022
Research (M. Yamamoto). H. Satoh was supported by Research Fellowships of
Japan Society for the Promotion of Science for Young Scientists. This study was
also supported in part by MEXT/JSPS KAKENHI (24249015 and 26111002
to M. Yamamoto; 24590371 to T. Moriguchi; 25870071 and 25870071
and 268771 to H. Satoh), AMED-CREST, AMED (chronic inflammation;
M. Yamamoto), P-DIRECT, AMED (M. Yamamoto), and Takeda Science Foun-
dation (M. Yamamoto).
The costs of publication of this article were defrayed in part by the payment of
page charges. This article must therefore be hereby marked advertisement in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received June 15, 2015; revised February 10, 2016; accepted February 26,
2016; published OnlineFirst March 28, 2016.
in Nrf2-deficient mice upon dextran sulfate treatment. Int J Cancer 2007;
121:1883–91.
12. Iida K, Itoh K, Kumagai Y, Oyasu R, Hattori K, Kawai K, et al. Nrf2 is
essential for the chemopreventive efficacy of oltipraz against urinary
bladder carcinogenesis. Cancer Res 2004;64:6424–31.
13. Shibata T, Ohta T, Tong KI, Kokubu A, Odogawa R, Tsuta K, et al. Cancer
related mutations in NRF2 impair its recognition by Keap1-Cul3 E3
ligase and promote malignancy. Proc Natl Acad Sci U S A 2008;105:
13568–73.
14. Shibata T, Kokubu A, Gotoh M, Ojima H, Ohta T, Yamamoto M, et al.
Genetic alteration of Keap1 confers constitutive Nrf2 activation and
resistance to chemotherapy in gallbladder cancer. Gastroenterology 2008;
135:1358–68.
15. Hayes JD, McMahon M. The double-edged sword of Nrf2: subversion of
redox homeostasis during the evolution of cancer. Mol Cell 2006;21:
732–4.
16. Ma Q.Role of nrf2 in oxidative stress and toxicity. Annu Rev Pharmacol
Toxicol 2013;53:401–26.
17. Satoh H, Moriguchi T, Takai J, Ebina M, Yamamoto M. Nrf2 prevents
initiation but accelerates progression through the Kras signaling pathway
during lung carcinogenesis. Cancer Res 2013;73:4158–68.
18. Taguchi K, Maher JM, Suzuki T, Kawatani Y, Motohashi H, Yamamoto M.
Genetic analysis of cytoprotective functions supported by graded expres-
sion of Keap1. Mol Cell Biol 2010;30:3016–26.
19. Reisman SA, Csanaky IL, Aleksunes LM, Klaassen CD. Altered disposition
of acetaminophen in Nrf2-null and Keap1-knockdown mice. Toxicol Sci
2009;109:31–40.
20. Wu KC, Liu JJ, Klaassen CD. Nrf2 activation prevents cadmium-induced
acute liver injury. Toxicol Appl Pharmacol 2012;263:14–20.
21. Uruno A, Furusawa Y, Yagishita Y, Fukutomi T, Muramatsu H, Negishi T,
et al. The Keap1-Nrf2 system prevents onset of diabetes mellitus. Mol Cell
Biol 2013;33:2996–3010.
22. Singh A, Boldin-Adamsky S, Thimmulappa RK, Rath SK, Ashush H, Coulter
J, et al. RNAi-mediated silencing of nuclear factor erythroid-2-related factor
2 gene expression in non-small cell lung cancer inhibits tumor growth and
increases efficacy of chemotherapy. Cancer Res 2008;68:7975–84.
Cancer Res; 76(10) May 15, 2016 3095
 Satoh et al.
23. Hoffler U, Ghanayem BI. Increased bioaccumulation of urethane in
CYP2E1-/- versus CYP2E1þ/þ mice. Drug Metab Dispos 2005;33:
1144–50.
24. Satoh H, Moriguchi T, Taguchi K, Takai J, Maher JM, Suzuki T, et al. Nrf2-
deficiency creates a responsive microenvironment for metastasis to the
lung. Carcinogenesis 2010;31:1833–43.
25. Nagaraj S, Gabrilovich DI. Tumor escape mechanism governed by mye-
loid-derived suppressor cells. Cancer Res 2008;68:2561–3.
26. Cardoso CC, Bornstein SR, Hornsby PJ. New methods for investigating
experimental human adrenal tumorigenesis. Mol Cell Endocrinol 2009;
300:175–9.
27. Baldelli S, Aquilano K, Ciriolo MR. Punctum on two different tran-
scription factors regulated by PGC-1alpha: nuclear factor erythroid-
derived 2-like 2 and nuclear respiratory factor 2. Biochim Biophys Acta
2013;1830:4137–46.
28. Harvey CJ, Thimmulappa RK, Singh A, Blake DJ, Ling G, Wakabayashi N,
et al. Nrf2-regulated glutathione recycling independent of biosynthesis is
critical for cell survival during oxidative stress. Free Radic Biol Med 2009;
46:443–53.
29. Malhotra D, Portales-Casamar E, Singh A, Srivastava S, Arenillas D, Happel
C, et al. Global mapping of binding sites for Nrf2 identifies novel targets in
cell survival response through ChIP-Seq profiling and network analysis.
Nucleic Acids Res 2010;38:5718–34.
30. Singh A, Rangasamy T, Thimmulappa RK, Lee H, Osburn WO, Brigelius-
Flohe R, et al. Glutathione peroxidase 2, the major cigarette smoke-
inducible isoform of GPX in lungs, is regulated by Nrf2. Am J Respir Cell
Mol Biol 2006;35:639–50.
31. Vaziri ND. Protective effect of Nrf2 and catalase in maternal diabetes-
induced perinatal hypertension and kidney disease. Diabetes 2012;61:
2400–2.
32. Kinnula VL, Paakko P, Soini Y. Antioxidant enzymes and redox regulating
thiol proteins in malignancies of human lung. FEBS Lett 2004;569:1–6.
3096 Cancer Res; 76(10) May 15, 2016
33. Naiki T, Naiki-Ito A, Asamoto M, Kawai N, Tozawa K, Etani T, et al. GPX2
overexpression is involved in cell proliferation and prognosis of castration-
resistant prostate cancer. Carcinogenesis 2014;35:1962–7.
34. Salem AF, Whitaker-Menezes D, Howell A, Sotgia F, Lisanti MP. Mitochon-
drial biogenesis in epithelial cancer cells promotes breast cancer tumor
growth and confers autophagy resistance. Cell Cycle 2012;11:4174–80.
35. Singh S.Cytoprotective and regulatory functions of glutathione S-trans-
ferases in cancer cell proliferation and cell death. Cancer Chemother
Pharmacol 2015;75:1–15.
36. Maher JM, Dieter MZ, Aleksunes LM, Slitt AL, Guo G, Tanaka Y, et al.
Oxidative and electrophilic stress induces multidrug resistance-associated
protein transporters via the nuclear factor-E2-related factor-2 transcrip-
tional pathway. Hepatology 2007;46:1597–610.
37. Nagaraj S, Gupta K, Pisarev V, Kinarsky L, Sherman S, Kang L, et al. Altered
recognition of antigen is a mechanism of CD8þ T cell tolerance in cancer.
Nat Med 2007;13:828–35.
38. Hiramoto K, Satoh H, Suzuki T, Moriguchi T, Pi J, Shimosegawa T, et al.
Downloaded from http://aacrjournals.org/cancerres/article-pdf/76/10/3088/2731790/3088.pdf by Dongguk University user on 01 December 2022
Myeloid lineage-specific deletion of antioxidant system enhances tumor
metastasis. Cancer Prev Res 2014;7:835–44.
39. Sha LK, Sha W, Kuchler L, Daiber A, Giegerich AK, Weigert A, et al. Loss of
Nrf2 in bone marrow-derived macrophages impairs antigen-driven CD8
(þ) T cell function by limiting GSH and Cys availability. Free Radic Biol
Med 2015;83:77–88.
40. Jung KA, Kwak MK. The Nrf2 system as a potential target for the develop-
ment of indirect antioxidants. Molecules 2010;15:7266–91.
41. Zahlten J, Kim YJ, Doehn JM, Pribyl T, Hocke AC, García P, et al. Strep-
tococcus pneumoniae-induced oxidative stress in lung epithelial cells
depends on pneumococcal autolysis and is reversible by resveratrol.
J Infect Dis 2015;211:1822–30.
42. Sayin VI, Ibrahim MX, Larsson E, Nilsson JA, Lindahl P, Bergo MO.
Antioxidants accelerate lung cancer progression in mice. Sci Transl Med
2014;6:221ra15.
Cancer Research