Plant Physiology and Biochemistry 171 (2022) 75–83

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry

journal homepage: www.elsevier.com/locate/plaphy

Evaluation of maize/peanut intercropping effects on microbial assembly,

root exudates and peanut nitrogen uptake
Yuhang Jiang a, b, d, e, Muhammad Umar Khan a, d, e, Xiaoqin Lin c, Zhimin Lin b, Sheng Lin b, d, e,
Wenxiong Lin a, b, d, e, *
a
Agricultural College, Fujian Agriculture and Forestry University, Fuzhou, 350002, PR China
b
College of Life Science, Fujian Agricultural and Forestry University, Fuzhou, 350002, PR China
c
School of Resource Engineering, Longyan University, Longyan, 364000, PR China
d
Key Laboratory of Fujian Province for Agroecological Process and Safety Monitoring, Fujian Agriculture and Forestry University, Fuzhou, 350002, PR China
e
Key Laboratory of Ministry of Education for Crop Genetics/Breeding and Integrative Utilization, Fujian Agriculture and Forestry University, Fuzhou, 350002, PR China

A R T I C L E I N F O A B S T R A C T

Keywords: Legume/cereal intercropping has been widely studied within ecosystem function, owing to its overyield po­
Intercropping tential, predominantly by dinitrogen (N2) fixation. In our 2-year peanut/maize intercropping field experiment,
Root exudates land equivalent ratio (LER) showed an average yield-increase by 41.48%. Performance index of intercropped
Rhizosphere soil
peanut (IP) functional leaves exhibited significant improvement (2.02-fold). Moreover, IP increased dry nodule
Isoflavonoid
Nitrogen nutrition
weight by 58.82% as compared to mono-cropped. Also, the ratio of nodules to aboveground biomass in IP
reduced by 65.8%. In pot experiment, higher urease activity was found in rhizosphere (22.73%). The abundance
of Rhizobium and niƒH gene in the rhizosphere of IP were significantly enhanced by 71.91% and 208%,
respectively. To analyze root exudates, we performed hydroponic coculture, the proportion of total isoflavonoids
in peanut root exudates were increased distinctly by 22.4%. Our findings certainly helped in filling one the
information gaps, that how intercropping increases nitrogen fixation in rhizosphere. Lastly, it can further
facilitate to understand functional significance of intercropping system for agricultural ecological sustainability
and efficient resource utilization.

1. Introduction
Intercropping can also be described as a relationship comprising of
both complementarity and facilitation (Callaway, 2002; Fargione and
Tilman 2005). Intercropping, is a prevailing agricultural practice in
many countries, which is a traditional technique that promotes optimal
exploitation of resources, such as sunlight, water, and fertilizer (Brooker
et al., 2015). Along with other beneficial aspects, it also improves land
productivity in terms of both time and space (Willey, 1990).
Legume/cereal intercropping is a widely researched area because of
its ecosystem biodiversity and yield (Mao et al., 2012; Zhang et al.,
2015; Connie et al., 2020). There are many successful intercropping
combinations, such as, maize/faba bean, maize/soybean, and wheat/­
faba bean, which have proven capabilities to enhance both nitrogen
facilitation and yield by N2 fixation (Li et al., 1999; Xu et al., 2019;
Sanaa et al., 2016). The facilitation role of N2 fixation played by legumes
elevates the N supply level in the ecosystem (Li et al., 2009). The
N-fixing efficiency from legume/maize (Zea mays L.) was found to be
86.88% greater than legume/wheat (Triticum aestivum L.) (Fan et al.,
2006). Moreover, intercropping could also improve both iron nutrition
and light energy utilization in the peanut (Arachis hypogaea)/maize (Zuo
and Zhang, 2011; Awal et al., 2006). Unfortunately, unchecked use of
inorganic N fertilizers not only impair the process of biological N2 fix­
ation in legumes but also cause environmental issues. Recent study
showed that legume/maize intercrop, improves the fertility status of
rhizosphere soil, mainly by alternation in enzyme activities and change
in the soil microbial flora (Li et al., 2018).
Rhizosphere soil is a hub of microbial communities surrounding the
plant roots and act as supply source of abundant nutrients for plants,
facilitated by various root exudates. Interspecific chemical signals

Abbreviations: LER, land equivalent ratio; IP, intercropped peanut; MP, monocropped peanut; YPH, yield per hectare; VIP, variable importance for the projection.
* Corresponding author. Agricultural College, Fujian Agriculture and Forestry University, Fuzhou, 350002, PR China.
E-mail addresses: janmiky@163.com (Y. Jiang), umar.khan018@yahoo.com (M.U. Khan), lxqfj90@163.com (X. Lin), zhoukang@fafu.edu.cn (Z. Lin), jyh@fafu.
edu.cn (S. Lin), lwx@fafu.edu.cn (W. Lin).

https://doi.org/10.1016/j.plaphy.2021.12.024
Received 24 October 2021; Received in revised form 19 December 2021; Accepted 22 December 2021
Available online 26 December 2021
0981-9428/© 2021 Elsevier Masson SAS. All rights reserved.
Y. Jiang et al.
Fig. 1. Crop row arrangements in field study in peanut - maize interactive system.
driven by root exudates can inhibit or facilitate the neighboring species
(Callaway, 2002). Several studies have been conducted to decipher the
interactions between legumes and rhizobia with emphasis given on the
root exudates which attracts rhizobia to enter into symbiosis relation­
ship (Schmidt et al., 1994; Li et al., 2016; Hu et al., 2020). Considerable
root exudates in the form of flavonoids secreted by legume root appear
to participate with nitrogen fixation (Schmidt et al., 1994). Genistein,
which as one kind of isoflavonoid, was an important signal in the faba
bean (legume)/maize nodulation and up-regulated the expression of
rhizobial nod genes in root exudates (Li et al., 2016). Although, it could
improve both nutrient availability and soil health by regulating the soil
microbial diversity (Li et al., 2018). But, when it comes to the status of
root exudation of isoflavonoids in relation to N-fixation by microbes in
rhizosphere, the literature is limited. Therefore, we directed our study
towards importance of major isoflavonoids and found several in peanut
root exudates under maize/peanut intercroping. Furthermore, we also
attempted to understand the facilitative behavior among these two crops
by employing different physiochemical and biological techniques. We
focused on photosynthetic characters of functional peanut leaves, root
nodule properties, and enzyme activities in the rhizosphere. Lastly, we
profiled isoflavonoids which impart their role in mediating the root–r­
hizobia communication.
2. Material and methods
2.1. Field trial
The 2-year experiment was conducted in 2017 and 2018 at Jinshan
district, Fuzhou city, Fujian province, in southeastern of China (26◦ 09′ N,
119◦ 23′ E). The intercropping combination included a 2.65m × 1.2m
peanut bed and a 2.65m × 1m maize bed (six rows of peanut with a 0.2-
m interrow distance, two rows of maize with a 0.4-m inter row distance
and a 0.3-m inter plant distance) (Fig. 1.). Peanut (Arachis hypogaea
Linn. Minhua No. 1) and maize (Z. mays L cv. Zhendan No. 12) were
sown on March 16, 2017 and March 24, 2018, and peanut was harvested
on June 27, 2017 and July 2, 2018, respectively. The maize was har­
vested on August 22, 2017 and September 2, 2018, respectively. During
the growing period, each plot of peanut received 113.94 kg N/ha, 11.84
kg P/ha, and 48.28 kg K/ha, respectively. Maize received 200.94 kg/N
ha, 26.46 kg P/ha, and 55.37 kg K/ha.
2.1.1. Determination of field yields and the land equivalent ratio (LER)
During maturity stage, four pots were randomly selected from
monoculture and intercropping mode of cultivation at same location,
the pots were arranged in a randomized complete block design (RCBD)
with three replications. The survey of grain yields was performed with
independent biological replicates. LER was used to evaluate the effi­
ciency of intercropping with respect to monoculture, the equation as
76
Plant Physiology and Biochemistry 171 (2022) 75–83
shown below.
YIM YIP
LER = + (1)
YMM YMP
(1) : YIM and YMM are the yields of intercropped and monoculture
maize plants; and YIP and YMP are the yields of intercropped and
monoculture peanut plants. According to this formula if the LER
>1, then there is yield advantage. (Mead and Willey, 1980)
2.1.2. Chlorophyll content of peanut functional leaves
During pods swelling stage of peanut (June 1, 2017; June 4, 2018),
functional leaves, which are the second and third uppermost leaves on
main stem, were collected for Chlorophyll calculation (four independent
biological replicates). Concentrations of chlorophyll a, b, total chloro­
phyll and total carotenoid were quantified at optical densities of 665,
645 and 450 nm, with the double-beam spectrophotometer (UH5300,
Hitachi, Tokyo, Japan); Calculation of all contents was carried out using
formulas by Sudhakar et al. (2016).
2.1.3. Chlorophyll fluorescence parameters of peanut functional leaves
During peanut pods swelling period (10–12 a.m., sunny, June 1,
2017; June 4，2018), 16 sampling sites were selected randomly to
collect rhizosphere soil from peanut monoculture and intercropped
system respectively, and samples were collected as independent bio­
logical replicate. The surface of selected functional leaf was covered
with leaf clips for 30 min to initiate oxidization process in all the reac­
tion centers of leaf. The procedure for determination of chlorophyll
fluorescence was followed by manufacturer website (http://www.
ppsystems.com/wp-content/uploads/Pocket-PEA.pdf.). All parameters,
including Fo (minimal fluorescence), Fv (variable fiuorescence), Fm
(maximal fluorescence within 30 min dark reaction), PI abs and DF abs,
which are the vitality indices of the photosynthetic apparatus, were
obtained in ultra-portable modulation chlorophyll fluorimeters (Pocket
PEA, Hansatech, England).
2.2. Greenhouse study (pots experiment)
Total 8 pots were used, each one with capacity of 38.5 L. Four pots
were separated by a plastic sheet barrier to eliminate root contact and
solute movement, while other four pots were kept with no barrier in
order to permit root intermingling to facilitate root exudates exchange.
The pots were filled with field soil, which contained basal nutrients (N,
100 mg/kg; P, 150 mg/kg; K, 150 mg/kg; Mg, 50 mg/kg; Cu, 5 mg/kg;
Zn, 5 mg/kg), and available nutrients (1.230 g/kg total N, 40.65 mg/kg
available N, 12.62 mg/kg Olsen - P, 7.05 g/kg total K, and 10.61 g/kg
organic matter). Each mode was set in a completely randomized design
by 4 independent biological replicates.
Y. Jiang et al.
2.2.1. Determination for enzyme activities and root nodules properties with
peanut
During pods swelling, peanut plants were cautiously pulled out from
soil to keep the root intact, the rhizosphere soil samples were collected
from both monocropped and intercropped peanuts by taking three in­
dependent biological replicates. The enzymatic activities of urease, su­
crase, and phosphor-mono-esterase were determined, as similar to
method by Guan (1986). The aerial and underground parts of same
peanut plant were separated independently; the soil adhered to the roots
was cleaned, and placed into dryer at 105 ◦ C for 2 h. All root nodules of
randomly harvested plant from different areas of each plot were cut
carefully, and 100-grains nodules were weighed. Subsequently, all root
nodules and above ground biomass in same pot were weighed.
Extraction and determination of plant ureides were carried out
following method by Goos et al. (2015). Total nitrogen (TN) in leaf and
stem was tested by automatic chemical analyzer (Smartchem 140,
AMS-Alliance, France). We adopted protocol for the SmartChem 140
Automatic Chemistry Analyzer from previous study (Chen et al., 2016).
2.2.2. Analysis of bacterial community diversity and major nitrogen-fixing
bacteria in rhizosphere soil of peanut
The process of extraction and purification of rhizosphere soil total
community DNA was done by using CTAB-SDS freeze-thaw method
(Berendsen et al., 2012). The downstream analysis was performed by
amplification of 16S rRNA, using the universal bacterial (V3–V4 region)
primers (27F: 5′ AGAGTTTGATCCTGGCTCAG3’; 1492R:
5 GGTTACCTTGTTACGACTT3′ ) using Illumina Miseq PE300 sequencer.
′
PCR reaction buffer: 12.5 μL 2 × Taq PCR Master Mix, 3 μL BSA (2
ng/μL), 2 μL Primer (5 μM), 2 μL DNA sample, and 5.5 μL ddH2O. The
specific PCR amplification procedure was carried out as in past research
(Li et al., 2018).
2.3. Root exudates study (hydroponic culture experiment)
Foam containers (І: 0.4m × 0.2m × 0.25m; II: 0.4m × 0.4m × 0.25m)
were used for monoculture and co-culture. Foam boards were drilled
with 10 and 20 holes for fixing seedlings. Ten peanut seedlings were
monocultured, while other ten seedlings were co-cultured with 10 maize
seedlings in 12L and 24L Hoagland solutions, respectively and solutions
were replaced every two weeks for three times. The solution containing
root exudates was filtered by 0.22 μm membrane, and evaporated using
evaporimeter (EZ-2, GeneVac, Britain) in aqueous mode settings, then
concentrates were dissolved with 10 mL acetone (HPLC Grade), and
stored at − 20 ◦ C. Hoagland solution without root exudates was used as
the control. We collected maize root exudates separately by following
same hydroponics experiment. The root exudates were collected as in­
dependent biological replicates (five biological replicates were taken in
each treatment).
Samples silylation: adding 0.4 mL silylating reagents (BSTFA: TMCS,
99:1, Adamas-beta, China) in 1.5 mL tube filled with samples dried by
lyophilizer, and water bathed for 2 h at 70 ◦ C after sealing the cap
tightly, 5-min turning upside down at 30 min interval. At the same time,
making the blank sample as a control.
Root exudates derivations were analyzed by GC-MS (TQ8040, Shi­
madzu, Japan). The carrier gas He (99.999%) was flowed into 30 m ×
0.25 mm ID × 0.25 μm df capillary column (SH-Rxi-5Sil MS, Shimadzu,
Japan) by splitless mode, the column oven temperature procedure was
as follow: 60 ◦ C–250 ◦ C by 8.5 ◦ C/min, hold for 5 min, then
250 ◦ C–300 ◦ C by 15 ◦ C/min, hold for 4.5 min. The samples were
vaporized at 280 ◦ C by injection port. The flow linear velocity was 42.8
cm/s, flow rate was set at 1.38 ml/min. Temperature of Ion source (EI)
and interface were 200 and 280 ◦ C respectively, the solvent cut time was
3 min, the ionization energy was 70 eV.
77
Plant Physiology and Biochemistry 171 (2022) 75–83
Table 1
Yields and LER in maize/peanut intercropping system in two-year field study.
Treatments YMM YIM YMP YIP LER
——————kg/ha——————
2017year 3076.58 ± 4835.95 ± 1169.88 ± 1382.75 ± 1.356 ±
163.1 52.2 43.5 10.4 0.01
2018year 3138.08 ± 5407.82 ± 1192.24 ± 1506.95 ± 1.472 ±
358.6 73.0* 21.1 19.6* 0.03
Note: Each value expressed as mean ± standard deviation was the average of four
pots in each cultivated mode test field. those included MP (monocropped pea­
nut), MM (monocropped maize), IM (intercropped maize) and IP (intercropped
peanut). YIM: Yield in IM; YMM: Yield in MM; YIP: Yield in IP; YMP: Yield in MP. *
within the same column indicate statistically significant difference at P < 0.05.
2.4. Statistical analysis
The sequencing data was matched by Silva library, alpha diversity
analysis (Simpson and Shannon-Wiener index) with Mothur software
(version 1.31.2). Isoflavonoids within the root exudates were screened
by NIST 14 library via GCMS post run analysis software (Shimadzu,
Janpan). The compounds with more than 80% similarities were retained
for the analysis. All data from field and greenhouse were analyzed by
PASW Statistics 18 with independent t-test (IBM), and significance level
was set at P < 0.05, and P <0.01, respectively. Statistical analysis of
isoflavonoids between MP and IP was illustrated through Violin plot by
Origin Pro 2019b (Origin Lab, United States). PLAS-DA for variance of
maize root exudates between MM (monocropped maize) and IM
(intercropped maize) was employed by using by SIMCA 14.1 (Mks
Umetrics AB, Sweden).
3. Results and discussion
3.1. The equivalent land ratio in the peanut/maize intercropping
We found considerable change in yields between peanut and maize
in the same region in the two consecutive field study (Table 1). Yield per
hectare (YPH) of intercropped maize (IM) was 11.83% greater than
previous year (2017), and intercropped peanut (IP) had 8.98% increase
in YPH. Consecutive peanut/maize intercropping had a yield advantage,
the average YPH of IP and IM showed 122%, and 165% increase. The
efficiency of the peanut/maize intercropping was greater than 1
(LER>1). Moreover, LER of intercropping system increased 8.55% in
2018 than that in 2017. Interspecific interactions between peanut and
maize crops found to be facilitative, depending on average yield-
increasing effect of 41.4% according to LER of two years.
3.2. Chlorophyll in functional leaves of intercropped peanut
During the swelling of pod, the contents of both chlorophyll a and
chlorophyll b were increased by 27.56% (P<0.01) and 18.24%
(P<0.01) in peanut functional leaves, when intercropped with maize
(Table 2). Furthermore, the total chlorophyll increased about 17.55% in
IP (P<0.01). Chlorophyll fluorescence is a popular technique in plant
physiology used for rapid non-invasive measurement of the vitality of
photosystem II (PSII). Higher photochemical efficiency of PSII (Fv/Fm)
was elevated by 7.69% in IP (P<0.01). Additionally, the driving force
and performance index in light energy absorption was increased by
119%, and 202%, respectively (P<0.01) (Table 3). Chlorophyll, a
nitrogen-rich pigment present in leaves, is able to convert light into
chemical energy (photosynthesis). Meanwhile, both nitrogen uptake of
plant root and nitrogen supply of rhizosphere partially regulates chlo­
rophyll levels and photochemical efficiency in functional leaves (Tóth
et al., 2002). So, it could be inferred that higher absorbability of N in the
peanut root rhizosphere could be due to its intercropping with maize
(Gerik, 1998). It is known that N supply of maize plant provides benefit
Y. Jiang et al. Plant Physiology and Biochemistry 171 (2022) 75–83

Table 2
Effect of intercropping on chlorophyll content of peanut function leaf in test field.
Treatment Chlorophyll a Chlorophyll b Total Carotenoid Total Chlorophyll Chl a/b ratio Car/Chl

— (mg/g)—

MP 4.79 ± 0.23 3.18 ± 0.08 2.56 ± 0.06 10.54 ± 0.14 1.51 ± 0.11 0.24 ± 0.01
IP 6.11 ± 0.64* 3.76 ± 0.20* 2.92 ± 0.28 12.39 ± 0.49* 1.63 ± 0.26 0.24 ± 0.02

Note: All values were mean (n = 12) ± standard deviation. * showed that the date within the same column had significant difference at P < 0.01.

3.3. Effect of intercropping on rhizosphere enzyme activities and nodule

Table 3 properties
Effects of intercropping on fluorescence parameters with peanut functional leaf
in test field. Urease activity in rhizosphere soil increased by 19.35% under
Treatment Minimal Variable Maximal PI abs DF intercropped maize (P<0.01) (Table 4). Whereas,100-grain nodules of
fluorescence fluorescence photochemical abs the peanut, the dry weight of each nodule showed 58.82% increment in
(Fo) (Fv) efficiency of IP (P<0.05). The nodule-to-aboveground biomass ratio in IP was
PSII (Fv/Fm)
decreased by 65.38% (P<0.05). Allantoins are the dominant nitroge­
MP 5506.85 ± 19578.62 ± 0.78 ± 0.008 3.54 0.46 nous (N) products, which are transported from the root nodules to the
149.30* 613.60 ± ±
aerial plant parts with the help of rhizobia-nodulated (Rh+) ureidic
0.69 0.08
IP 4920.31 ± 26120.75 ± 0.84 ± 0.003* 10.71 1.01 legumes. The content of total N in both leaf and stem of IP was 19.33%
68.60 459.20* ± ± and 34.16% higher than in MP (P<0.05), respectively. The allantoin of
0.76* 0.03* leaf in IP also showed 6.64% increase against MP (P<0.05) (Fig. 2). It
Note: All values were mean ± SD, n = 16. * showed that the date within the same had a positive role in N uptake when intercropped with maize plant.
column indicated significant differences at P<0.01, Fm: maximal fluorescence; Besides, peanut root nodules are able to facilitate biological nitrogen
PI abs: performance index based on light energy absorption; DF abs: driving fixation and promote soil fertility and therefore making it a preferred
force based on light energy absorption. land crop (Yang and Nai-Mei, 2011).

Table 4 3.4. The activity of nitrogen-fixing bacteria in peanut rhizosphere soil

The status of rhizosphere soil enzymes activity and root nodules with peanut in
pot experiment.
Through analysis of the bacterial community, IP exhibited improved
Treatments Urase Sucrase Phosphatase 100-grian Nodule alpha diversity, the Simpson and Shannon-Wiener indexes (P<0.05)
nodules weight/ (Table 5). The nitrogen-fixing microbes were selected on the basis of
Above-
—IU (μmoL/min)— (g)
ground
OTUs taxonomy, and were mainly consisted of rhizobium and
biomass

MP 0.031 ± 1.11 ± 7.69 ± 0.034 ± 0.026 ± Table 5

0.000 0.013 0.319 0.002 0.008* Activity of nitrogen fixation bacteria in peanut rhizosphere soil.
IP 0.037 ± 1.13 ± 7.82 ± 0.054 ± 0.009 ± Treatments Simpson Shannon- Rhizobium Azospirillum niƒH
0.000* 0.056 0.406 0.016* 0.006 index(J) Wiener (%) (%) (gene
Note: For each column, *: mean(n = 10)±SD within the same line indicated index(H) copy
number
significant differences at P < 0.05.
× 106
g− 1of
to peanut plant, but how the converse functions for peanut has not been soil)
explored yet (Li et al., 2018). From our findings, it can be concluded that MP 0.982 5.596 0.89 7.72 1.05
peanut/maize intercropping can enhance light use efficiency as well. IP 0.985* 5.826* 1.53** 11.67* 2.18*

Note: For each column, * and ** indicated that the data had significant difference
at p < 0.05 or p < 0.01 respectively.

Fig. 2. The effect of intercropping on the content of allantoin (A) and total N (B) in peanut leaf and stem. Values were expressed as means (n = 4) ± SD. * Significant
differences between peanut intercropped and non-intercropped with maize in allantoin (P < 0.05).

78
Y. Jiang et al. Plant Physiology and Biochemistry 171 (2022) 75–83

Fig. 3. The effects of intercropping with maize on major isoflavonoids secreted by peanut root. The total ion chromatogram of isoflavonoids in peanut root exudates
from MP (a) and IP (b); (c)The structure of isoflavonoid compounds in peanut root exudates; (d)The violin plot of major isoflavonoids between monocropped peanut
and intercropped peanut. Inside of each violin plot is box plot (BP), and the outer package is nuclear density plot (NDP). Larger graphic area in NDP indicates that the
certain value has greater probability of the nearby distribution. Each NDP has unimodal, indicating that the data had uniform distribution. Outlines of NDP marked
with red and blue were labeled as MP and IP, respectively. Inner line with BP represented the mean of data (n = 5). * & ** indicated that it had significant difference
at P <0.05, and P<0.01, respectively by the independent samples t-test. (For interpretation of the references to colour in this figure legend, the reader is referred to
the Web version of this article.)

79
Y. Jiang et al. Plant Physiology and Biochemistry 171 (2022) 75–83

Fig. 4. The effect of intercropping maize on major fatty acids secreted by peanut root
*: it indicates these two modes have significant difference level at P < 0.01.

azospirillum in peanut rhizosphere soil. The relative abundances in both
rhizobium and azospirillum from IP were 71.91% and 51.17%, higher
than in MP (P<0.01, P<0.05). Nitrogen fixation is a complex process
and a series of genes take part in nitrogen fixation including niƒH, which
was significantly increased by 208% (P<0.05) in IP. This implies that
more N-fixing microbes could be recruited around intercropped peanut
roots. Intercropping can affect the mobilization of major soil nutrients
considerably in the rhizosphere soil, contributing to nutrient acquisition
efficiency (Wasaki et al., 2003). High level of available N in peanut roots
was detected in IP, which on the other hand could be the reason, which
affected both the activity and abundance of N-fixing bacteria, especially
Rhizobium, Bacillus, and Burkholderia (Li et al., 2018). Furthermore,
microbial diversity not only enhances the soil ecosystem stability, but
also promotes availability of nitrogen in the rhizosphere (Weidner et al.,
2015). Our findings also suggested that root–root communications
significantly stimulated nodulation and symbiotic nitrogen fixation be­
tween maize and peanut (Li et al., 2016).
3.5. Distribution of major isoflavonoid compounds in peanut root
exudates
There were number of isoflavonoids found in monocultured maize

Fig. 5. The effects of maize root exudates on secretion of peanut root exudates, rhizosphere microbes, and nodules property. Peanut root could promote secretion of
isoflavonoids and fatty acids (especially unsaturated fatty acid) by maize root exudates. On the one hand, fatty acids, as an important source of microbial C, can
greatly recruit a large number of various rhizosphere microbial populations and enhance their rhizosphere microbial diversity. On the other hand, abundant iso­
flavonoids can promote nitrogen fixation by peanut root nodules, improve the nitrogen nutrition of root, and normalize the growth of peanut plant.

80
Y. Jiang et al. Plant Physiology and Biochemistry 171 (2022) 75–83

Fig. 6. The effects of inter cropping with peanut plant on maize root exudates.
(a) the analysis of two–class (MM and IM) separation in scatter plot of scores t1 vs t1o. It shows that a high within class variability in MM by the vertical (t1o)
direction and it had obvious separation in the two-class of observations by the horizontal (t1) direction. Hence, it could uncover the variables with class discrim­
inating ability. (b) The permutations plot for M2 (OPLS-DA) of maize root exudates between MM and IM. The plot strongly indicates that the original model is valid
(all blue Q2-values to the left are lower than the original points to the right), and M2 (OPLS-DA) had goodness of fit based on data where the order of the Y-ob­
servations has been randomly permuted, while the X-matrix has been kept intact. (c) OPLS-DA S-plot. X-axis and Y-axis represent the co-correlation coefficient and
correlation coefficient between the principal components and root exudates, respectively, and the component located closely with the upper right corner and lower
left corner, indicating that it has significant difference. Both red triangles and green inverted triangles labeled VIP (Variable importance for the projection) ≥ 1, and
blue circles showed that VIP <1. . (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

root exudates (S1), which indicate that these compounds are not derived
from maize root exudates. Sixteen isoflavonoids, including isoflavone,
genistein, formononetin, taxifolin, rotenone, biochanin A, daidzein, and
quercetin, were found in both monocropped and intercropped peanut
root exudates (Fig. 3 (a) and (b)). Isoflavonoids were categorized into
several types based on their structure (Fig. 3 (c)). The total amounts of
isoflavonoids were significantly increased by 22.4% in IP (P<0.05).
Among them, 3.69-fold secretion of tri-O-methylparvisoflavone, 2.64-
fold secretion of isoflavone, and 2.05-fold secretion of biochanin A
were found in root exudates of IP in comparison with monocultured
system (P<0.01, Fig. 3 (d), S2). Meanwhile, a kind of fatty acid methyl
ester (FAMEs), including methyl hexadecanoate (13.33-fold), methyl
linoleate (2.9-fold), and methyl linolenate (6.83-fold), were secreted
largely by co-cultured peanut/maize (Fig. 4).
A plant can release a large amount of root exudates, which possibly
act as signaling molecules in root–root interactions between plant spe­
cies (Lian et al., 2002). Here, maize root exudates induced more secre­
tion of corresponding compounds derived from the peanut root. This
feedback mechanism was not only in response to biological stress but
also as a particular signal to mediate root nodule induced symbiotic
nitrogen fixation and mediate in recruiting abundant rhizosphere mi­
crobes (Fig. 5). Several isoflavonoids, such as hespertin, genistein, and 7,
4-dihydroxyflavone, induce nod genes in Rhizobium (Maj, et al., 2010).
Isoflavonoid possibly drives interspecific facilitation by enhancing the
nodulation and nitrogen fixation in legume when intercropped with
maize (Li et al., 2016). We also found that high secretion of isoflavonoids
in peanut root exudates in IP. Which could play a central role in regu­
lating symbiosis between legumes and rhizobium, and also contributes
to promote symbiotic nitrogen fixation in plant root exudates (Walker
et al., 2003; Hwang and Choi, 2015). Hence, it could be deduced that the
abundant nitrogen nutrients present in peanut plants was due to the
large amount of isoflavonoids secreted by its roots. Also, we identified
eighteen metabolites (VIP≥1) from collective fifty-five maize root exu­
dates in mono and intercropping systems. These metabolites could be of
key importance in regulating the secretions level of isoflavoniods in
peanut root exudates (Hu et al., 2018; Li et al., 2016; Zhang et al., 2020),
especially the chemical compound α-Cedrene and nonanoic acid (S3 and
Fig. 6).
4. Conclusions
The cultivation of peanut/maize improved availability of N nutrient,
which is an indicator of the positive effects on the vitality and richness of
nitrogen-fixing bacteria. Mainly, intercropping boosts the productivity
of aboveground biomass on account of an increased biological nitrogen
fixation efficiency. Through hydroponic experiment, we preliminarily

81
Y. Jiang et al.
explored isoflavonoids derived from peanut root exudates, when co-
cultured with maize. There was higher amount of isoflavonoids secre­
tion in co-culture rather than monoculture. These findings provide base
for subsequent studies on key signaling molecules. Lastly, these findings
can increase our understanding of the positive relationship between
productivity and microbial diversity in certain ecosystem environment.
Data availability
The datasets analyzed during the current study are available from the
corresponding author on reasonable request.
Funding
This study was financially supported by Young Teachers’ programs
on educational science research from the Provincial Education Depart­
ment of Fujian (JT180140) and 948 programs from the Ministry of
Agriculture, China (2014-Z36) for the experiment, National Key
Research and Development (R & D)China plan (2016YFD0200900). The
funders have no role in designing and executing this study.
CRediT authorship contribution statement
Yuhang Jiang: Conceptualization, Visualization, Methodology,
Writing – original draft, Formal analysis, Writing – review & editing,
Funding acquisition. Muhammad Umar Khan: Formal analysis,
Writing – review & editing. Xiaoqin Lin: Methodology, Investigation,
Writing – original draft. Zhimin Lin: Formal analysis, Writing – review
& editing. Sheng Lin: Methodology, Investigation. Wenxiong Lin:
Conceptualization, Visualization, Methodology, Writing – original draft,
Formal analysis, Writing – review & editing, Funding acquisition.
Declaration of competing interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.plaphy.2021.12.024.
References
Awal, M.A., Koshi, H., Ikeda, T., 2006. Radiation interception and use by maize/peanut
intercrop canopy. Agric. For. Meteorol. 139, 74–83. https://doi.org/10.1016/j.
agrformet.2006.06.001.
Berendsen, R.L., Pieterse, C.M., Bakker, P.A., 2012. The rhizosphere microbiome and
plant health. Trends Plant Sci. 17 (8), 478–486. https://doi.org/10.1016/j.
tplants.2012.04.001.
Brooker, R.W., Bennett, A.E., Cong, W., Daniell, T.J., George, T.S., Hallett, P.D., White, P.
J., 2015. Improving intercropping: a synthesis of research in agronomy, plant
physiology and ecology. New Phytol. 206 (1), 107–117. https://doi.org/10.1111/
nph.13132.
Callaway, R.M., 2002. The detection of neighbors by plants. Trends Ecol. Evol. l7 (3),
104–105. https://doi.org/10.1016/S0169-5347(01)02438-7.
Chen, J.L., Xie, W.X., Cui, Y.Q., Zhang, Y., 2016. Research on the determination of total
nitrogen and total phosphorus in soil using SmartChem140 automatic chemical
analyzer. J. Anal. Sci. 32 (1), 84–88 (in Chinese).
Connie, Madembo, Blessing, Mhlanga, Christian, Thierfelder, 2020. Productivity or
stability? Exploring maize-legume intercropping strategies for smallholder
Conservation Agriculture farmers in Zimbabwe. Agric. Syst. 185, 102921 https://
doi.org/10.1016/j.agsy.2020.102921.
Fan, F., Zhang, F., Song, Y., Sun, J., Bao, X., Guo, T., Li, L., 2006. Nitrogen fixation of
faba bean (Vicia faba L.) interacting with a non-legume in two contrasting
intercropping systems. Plant Soil 283, 275–286. https://doi.org/10.1007/s11104-
006-0019-y.
Fargione, J., Tilman, D., 2005. Niche differences in phenology and rooting depth
promote coexistence with a dominant C4 bunchgrass. Oecologia 143 (4), 598–606.
https://doi.org/10.1007/s00442-005-0010-y.
82
Plant Physiology and Biochemistry 171 (2022) 75–83
Gerik, T.J., Oosterhuis, D.M., Torbert, H.A., 1998. Managing cotton nitrogen supply.
Adv. Agron. 64 (8), 115–147. https://doi.org/10.1016/S0065-2113(08)60503-9.
Goos, R.J., Abdraimova, N., Johnson, B.E., 2015. Method for determination of ureides in
soybean tissues. Commun. Soil Sci. Plant Anal. 46 (4), 424–429. https://doi.org/
10.1080/00103624.2014.981276.
Guan, S.Y., 1986. Soil Enzyme and its Research methods[M]. Agriculture Press, Beijing,
pp. 274–338 (in Chinese).
Hu, Lingfei, Robert Christelle, A.M., Selma, Cadot, Zhang, Xi, Meng, Ye, Li, Beibei,
Daniele, Manzo, Noemie, Chervet, Thomas, Steinger, van der Heijden Marcel, G.A.,
Klaus, Schlaeppi, Matthias, Erb, 2018. Root exudate metabolites drive plant-soil
feedbacks on growth and defense by shaping the rhizosphere microbiota. Nat.
Commun. 9 (1), 2738. https://doi.org/10.1038/s41467-018-05122-7.
Hu, Falong, Tan, Yan, Yu, Aizhong, Zhao, Cai, Fan, Zhilong, Yin, Wen, Chai, Qiang,
Coulter Jeffrey, A., Cao, Weidong, 2020. Optimizing the split of N fertilizer
application over time increases grain yield of maize-pea intercropping in arid areas.
Eur. J. Agron. 119, 126117 https://doi.org/10.1016/j.eja.2020.126117.
Hwang, K., Choi, K., 2015. Endocrine-disrupting chemicals with estrogenicity posing the
risk of cancer progression in Estrogen-Responsive Organs. Adv. Mol. Toxicol. 9,
1–33. https://doi.org/10.1016/B978-0-12-802229-0.00001-3.
Li, L., Yang, S., Li, X., Zhang, F., Christie, P., 1999. Interspecific complementary and
competitive interactions between intercropped maize and faba bean. Plant Soil 212
(2), 5–114. https://doi.org/10.1023/A:1004656205144.
Li, Yu-Ying, Yu, Chang-Bin, Cheng, Xu, Li, Chun-Jie, Sun, Jian-Hao, Zhang, Fu-Suo, 2009.
Intercropping alleviates the inhibitory effect of N fertilization on nodulation and
symbiotic N2 fixation of faba bean. Plant Soil 323 (1–2), 295–308. https://doi.org/
10.1007/s11104-009-9938-8.
Li, B., Li, Y.Y., Wu, H.M., Zhang, F.F., Li, L., 2016. Root exudates drive interspecific
facilitation by enhancing nodulation and N2 fixation. Proc. Natl. Acad. Sci. Unit.
States Am. 113 (23), 6496–6501. https://doi.org/10.1073/pnas.1523580113.
Li, Q., Chen, J., Wu, L., Luo, X., Li, N., Arafat, Y., Lin, W., 2018. Belowground
interactions impact the soil bacterial community, soil fertility, and crop yield in
maize/peanut intercropping systems. Int. J. Mol. Sci. 19 (2), 622. https://doi.org/
10.3390/ijms19020622.
Lian, B., Souleimanov, A., Zhou, X., Smith, D.L., 2002. In vitro induction of lipo-
chitooligo saccharide production in bradyrhizobium japonicum cultures by root
extracts from non-leguminous plants. Microbiol. Res. 157 (3), 157–160. https://doi.
org/10.1078/0944-5013-00145.
Maj, D., Wielbo, J., Marek-Kozaczuk, M., Skorupska, A., 2010. Response to flavonoids as
a factor influencing competitiveness and symbiotic activity of Rhizobium
leguminosarum. Microbiol. Res. 165 (1), 50–60. https://doi.org/10.1016/j.
micres.2008.06.002.
Mao, Lili, Zhang, Lizhen, Li, Weiqi, van der Werf, Wopke, Sun, Jianhao, Spiertz, Huub,
Li, Long, 2012. Yield Advantage and Water Saving in Maize/pea Intercrop, 138,
pp. 11–20. https://doi.org/10.1016/j.fcr.2012.09.019.
Mead, R., Willey, R., 1980. The concept of a ‘land equivalent ratio’ and advantages in
yields from intercropping. Exp. Agric. 16, 217–228. https://doi.org/10.1017/
S0014479700010978.
Sanaa, W., Yves, P., Jean, T., Hervé, Sanguin, Ezékiel, Baudoin, Tasnime, M., 2016.
Impact of wheat/faba bean mixed cropping or rotation systems on soil microbial
functionalities. Front. Plant Sci. 7 (432), 1364. https://doi.org/10.3389/
fpls.2016.01364.
Schmidt, P.E., Broughton, W.J., Werner, D., 1994. Nod factors of Bradyrhizobium
japonicum and Rhizobium sp. NGR234 induce flavonoid accumulation in soybean
root exudate. Mol. Plant Microbe Interact. 7 (3), 384–390. https://doi.org/10.1094/
MPMI-7-0384.
Sudhakar, P., Latha, P., Reddy, P.V., 2016. Chapter 2: Seed Physiological and
Biochemical Traits. Phenotyping Crop Plants for Physiological & Biochemical Traits.
Academic Press, pp. 17–24.
Tóth, Viktor R., Mészáros, Ilona, Veres, Szilvia, Nagy, János, 2002. Effects of the
available nitrogen on the photosynthetic activity and xanthophyll cycle pool of
maize in field, 159(6), 0-634. https://doi.org/10.1078/0176-1617-0640.
Walker, T.S., Bais, H.P., Grotewold, E., Vivanco, J.M., 2003. Root exudation and
rhizosphere biology. Plant Physiol. 132 (1), 44–51. https://doi.org/10.1104/
pp.102.019661.
Wasaki, J., Yamamura, T., Shinano, T., Osaki, M., 2003. Secreted acid phosphatase is
expressed in cluster roots of lupin in response to phosphorus deficiency. Plant Soil
248 (1), 29–136. https://doi.org/10.1023/A:1022332320384.
Weidner, S., Koller, R., Latz, E., Kowalchuk, G., Bonkowski, M., Scheu, S., Jousset, A.,
2015. Bacterial diversity amplifies nutrient-based plant–soil feedbacks. Funct. Ecol.
29, 1341–1349. https://doi.org/10.1023/A:1022332320384.
Willey, R.W., 1990. Resource use in intercropping systems. Agric. Water Manag. 17,
215–231. https://doi.org/10.1016/0378-3774(90)90069-B.
Xu, Z., Li, C., Zhang, C., Yu, Y., Zhang, F., 2019. Intercropping maize and soybean
increases efficiency of land and fertilizer nitrogen use; a meta-analysis. Field Crop.
Res. 246 https://doi.org/10.1016/j.fcr.2019.107661.
Yang, Wen-Yu, Nai-Mei, Tu, 2011. Monograph of Crop Cultivation: the Southern [M].
China Agriculture Press (in Chinese).
Y. Jiang et al.
Zhang, J., Yin, B., Xie, Y., Li, J., Yang, Z., Zhang, G., 2015. Legume-cereal intercropping
improves forage yield, quality and degradability. PLoS One 10 (12), e0144813.
https://doi.org/10.1371/journal.pone.0144813.
Zhang, He, Yang, Yuxin, Mei, Xinyue, Ying, Li, Wu, Jiaqing, Li, Yiwen, Wang, Huiling,
Huang, Huichuan, Yang, Min, He, Xiahong, Zhu, Shusheng, Liu, Yixiang, 2020.
Phenolic acids released in maize rhizosphere during maize-soybean intercropping
83
Plant Physiology and Biochemistry 171 (2022) 75–83
inhibit phytophthora blight of soybean. Front. Plant Sci. 11, 886. https://doi.org/
10.3389/fpls.2020.00886.
Zuo, Y.M., Zhang, F.S., 2011. Soil and crop management strategies to prevent iron
deficiency in crops. Plant Soil 339, 83–95. https://doi.org/10.1007/s11104-010-
0566-0.