BR A I N R ES E A RC H 1 2 0 9 ( 2 00 8 ) 1 3 6 –15 0

a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m

w w w. e l s e v i e r. c o m / l o c a t e / b r a i n r e s

Research Report

Ferulic acid provides neuroprotection against oxidative

stress-related apoptosis after cerebral ischemia/reperfusion
injury by inhibiting ICAM-1 mRNA expression in rats

Chin-Yi Cheng a , Shan-Yu Su a,b , Nou-Ying Tang c , Tin-Yun Ho a ,

Su-Yin Chiang a , Ching-Liang Hsieh b,d,⁎
a
Graduate Institute of Chinese Medical Science, China Medical University, Taichung, Taiwan
b
Department of Chinese Medicine, China Medical University Hospital, Taichung, Taiwan
c
School of Chinese Medicine, China Medical University, Taichung, Taiwan
d
Graduate Institute of Integrated Medicine, China Medical University, Taichung, Taiwan

A R T I C LE I N FO AB S T R A C T

Article history: Our previous studies have shown that ferulic acid (4-hydroxy-3-methoxycinnamic acid, FA)
Accepted 24 February 2008 inhibits intercellular adhesion molecule-1 (ICAM-1) expression in the ischemic striatum
Available online 18 March 2008 after 2 h of reperfusion in a transient middle cerebral artery occlusion model in rats. The
purpose of this study is to further investigate the neuroprotective effects of FA during
Keywords: reperfusion after cerebral ischemia. Rats were subjected to 90 min of ischemia; they were
Ferulic acid then sacrificed after 2, 10, 24 and 36 h of reperfusion. ICAM-1 and macrophage-1 antigen
Intercellular adhesion molecule-1 (Mac-1) mRNA were detected using semi-quantitative RT-PCR at 2 h of reperfusion. Mac-1, 4-
mRNA hydroxy-2-nonenal (4-HNE), 8-hydroxy-2′-deoxyguanosine (8-OHdG), active caspase 3,
Macrophage-1 antigen mRNA neuronal nuclei (NeuN) and TUNEL positive cells were measured at 2, 10, 24 and 36 h of
8-Hydroxy-2′-deoxyguanosine reperfusion. FA (100 mg/kg, i.v.) administered immediately after MCAo inhibited ICAM-1 and
4-Hydroxy-2-nonenal Mac-1 mRNA expression in the striatum at 2 h of reperfusion, and reduced the number of
Apoptosis Mac-1, 4-HNE and 8-OHdG positive cells in the ischemic rim and core at 10, 24 and 36 h of
reperfusion. FA decreased TUNEL positive cells in the penumbra at 10 h, and in the ischemic
boundary and core at 24 and 36 h of reperfusion. FA curtailed active caspase 3 expression in
the penumbra at 10 h and restored NeuN-labeled neurons in the penumbra and ischemic
core at 36 h of reperfusion. FA decreased the level of ICAM-1 mRNA and the number of
microglia/macrophages, and subsequently down-regulated inflammation-induced
oxidative stress and oxidative stress-related apoptosis, suggesting that FA provides
neuroprotection against oxidative stress-related apoptosis by inhibiting ICAM-1 mRNA
expression after cerebral ischemia/reperfusion injury in rats.
© 2008 Published by Elsevier B.V.

⁎ Corresponding author. Department of Chinese Medicine, China Medical University Hospital, No 2, Yuh-Der Road, Taichung, Taiwan.
Fax: +886 4 22362871.
E-mail address: clhsieh@mail.cmuh.org.tw (C.-L. Hsieh).
Abbreviations: FA, ferulic acid; ICAM-1, intercellular adhesion molecule-1; Mac-1, macrophage-1 antigen; 4-HNE, 4-hydroxy-2-nonenal;
8-OHdG, 8-hydroxy-2′-deoxyguanosine; I/R, ischemia/reperfusion

0006-8993/$ – see front matter © 2008 Published by Elsevier B.V.

doi:10.1016/j.brainres.2008.02.090
 BR A I N R ES E A RC H 1 2 0 9 ( 2 00 8 ) 1 3 6 –1 50 137

FA, and the possible mechanisms involved in the effects of FA

1. Introduction
against activated microglia/macrophages, oxidative stress and
oxidative stress-related apoptosis in the penumbra and ische-
Inflammatory response and oxidative stress are known to exacer- mic core areas during the cerebral I/R period.
bate the damage caused by acute cerebral ischemia/reperfusion
(I/R) injury (Shin et al., 2006). Cytokines elicit the synthesis of
P-selectin, E-selectin and intercellular adhesion molecule-1 2. Results
(ICAM-1), adhesion molecules that facilitate the adhesion of
activated leukocytes to endothelial cells (ECs). Activated leuko- 2.1. Physiological parameters
cytes then infiltrate the ECs, cross the vascular wall and migrate
into the brain parenchyma (Soriano et al., 1999; Ding et al., 2003; Blood gas parameters (including pH, pO2 and pCO2) and blood
Khan et al., 2007). Macrophage-1 antigen (Mac-1, CD11b/CD18), a sugar levels were measured at 10 min before and 90 min after
heterodimeric protein consisting of α (CD11b) and β (CD18) sub-
units expressed on the surface of activated leukocytes, facilitates
cell–endothelium interactions (Hickstein et al., 1993; Caimi et al., Table 1 – Physiological parameters
2001; Arumugam et al., 2004). Mac-1 acts as an activation marker BS, mg/dl pH pO2, mmHg pCO2, mmHg
for microglia/macrophages (Berliner et al., 2000; Nakase et al.,
2004; Ueno et al., 2006), which release a host of neurotoxic com- 10 min before ischemia
pounds, including reactive oxygen species (ROS), nitric oxide 2 h (n = 6)
(NO), cytokines and lipid peroxidation products, that worsen Sham 119.0 ± 29.2 7.30 ± 0.03 97.5 ± 10.9 28.7 ± 7.0
secondary ischemic neuronal insults (Miyahara et al., 2003; Kao Control 118.3 ± 26.3 7.32 ± 0.04 96.0 ± 13.3 26.8 ± 3.9
et al., 2006; Kapadia et al., 2006). Evidence suggests that necrosis FA 124.7 ± 24.6 7.28 ± 0.03 96.3 ± 5.8 26.2 ± 6.7
and apoptosis are the main characteristics of neuronal death
10 h (n = 5)
following acute cerebral I/R injury (Kao et al., 2006). ROS, which
Sham 111.8 ± 24.1 7.30 ± 0.04 104.0 ± 12.9 28.4 ± 5.0
are robustly produced by activated microglia/macrophages, at- Control 94.4 ± 2.5 7.27 ± 0.03 108.6 ± 8.2 30.5 ± 4.2
tack neuronal components including lipid, protein and DNA, FA 94.0 ± 25.2 7.25 ± 0.03 107.6 ± 8.0 33.1 ± 4.4
causing nuclear DNA oxidation and lipid peroxidation (Won
et al., 2001; Imai et al., 2003). Superoxide anions, primary oxygen 24 h (n = 6)
free radicals produced by mitochondria, are rapidly converted in Sham 120.0 ± 29.0 7.30 ± 0.05 90.8 ± 6.9 29.9 ± 3.2
Control 116.2 ± 23.3 7.29 ± 0.03 103.2 ± 13.6 30.7 ± 6.3
the cell to hydrogen peroxide, which is subsequently converted
FA 118.8 ± 16.0 7.31 ± 0.03 95.0 ± 7.3 29.7 ± 5.3
to the highly reactive hydroxyl radical (Klein and Ackerman,
2003). This radical then hydroxylates the C-8 position of guanine 36 h (n = 3)
residues in G–C rich regions of DNA, leading to a G:C to T:A Sham 119.3 ± 48.5 7.32 ± 0.02 92.7 ± 8.5 31.5 ± 3.4
transversion mutation (Won et al., 2001; Sakurai et al., 2003). The Control 115.0 ± 20.0 7.29 ± 0.02 110.3 ± 8.6 26.7 ± 5.7
well-recognized oxidative stress markers in DNA and lipids are FA 98.3 ± 28.6 7.27 ± 0.03 105.7 ± 9.9 25.2 ± 2.1
8-hydroxy-2′-deoxyguanosine (8-OHdG) and 4-hydroxy-2-none-
90 min after ischemia
nal (4-HNE), respectively. Eight-OHdG is mainly produced in
neurons after transient cerebral ischemia, and the accumulation 2 h (n = 6)
of unrepaired oxidative DNA lesions in the nucleus can lead to Sham 110.7 ± 26.1 7.31 ± 0.02 102.8 ± 10.3 22.4 ± 5.8
either tumorigenesis or apoptosis (Hayashi et al., 1999; Naga- Control 104.7 ± 18.5 7.33 ± 0.04 98.3 ± 9.3 23.5 ± 4.8
FA 126.2 ± 3.3 7.35 ± 0.03 91.3 ± 17.4 21.7 ± 5.9
yama et al., 2000; Sakurai et al., 2003). Four-HNE, a product toxic
to neuronal perikarya, is released from polyunsaturated fatty
10 h (n = 5)
side chains and contributes to the dysfunction of cell membrane Sham 144.6 ± 43.3 7.33 ± 0.04 87.6 ± 6.3 22.8 ± 3.0
transporters via lipid peroxidation, which then leads to apopto- Control 128.2 ± 11.8 7.34 ± 0.03 93.0 ± 11.8 22.6 ± 2.1
sis (McCracken et al., 2000; Gordon et al., 2005; Lee et al., 2005). FA 109.4 ± 28.8 7.35 ± 0.03 89.8 ± 5.1 26.6 ± 4.1
Previous studies demonstrated that drugs designed to inhibit
recruited leukocytes/microglia markedly curtailed inflamma- 24 h (n = 6)
Sham 138.7 ± 44.4 7.31 ± 0.02 93.2 ± 8.7 28.3 ± 4.0
tion and oxidative stress-related apoptosis, and consequently
Control 135.0 ± 28.7 7.34 ± 0.02 93.2 ± 11.2 23.4 ± 4.3
provided neuroprotection in cerebral I/R injury (Storini et al., FA 118.5 ± 28.1 7.35 ± 0.05 92.5 ± 6.2 23.3 ± 3.3
2005; Kao et al., 2006).
Ferulic acid (4-hydroxy-3-methoxycinnamic acid, FA), a com- 36 h (n = 3)
ponent of Anglica sinensis (olivi) Didl. and Ligusticum chuoanxiong Sham 153.3 ± 30.6 7.34 ± 0.02 81.3 ± 8.3 23.3 ± 5.2
Hort., was shown to be a free radical scavenger and to have anti- Control 112.0 ± 25.9 7.37 ± 0.01 88.3 ± 12.9 22.4 ± 3.6
FA 120.7 ± 34.2 7.37 ± 0.03 93.7 ± 7.0 20.7 ± 1.1
inflammatory and antioxidation effects in a transient middle
cerebral artery occlusion (MCAo) model (Wang et al., 2005). In our Mean ± SD. BS: blood sugar; sham: sham group; control: control
previous study, we found that FA (100 mg/kg) effectively inhi- group; FA: ferulic acid-treated group; 10 min before ischemia:
bited ICAM-1 expression in the ischemic striatum and decreased 10 min before cerebral ischemia; 90 min after ischemia: 90 min after
the levels of superoxide anions in the ischemic brain parench- cerebral ischemia; 2 h: sacrificed at 2 h of reperfusion; 10 h:
sacrificed at 10 h of reperfusion; 24 h: sacrificed at 24 h of
yma at 2 h of reperfusion after MCAo (submitted). The purpose of
reperfusion; 36 h: sacrificed at 36 h of reperfusion.
this study is to further investigate the neuroprotective effects of
138 BR A I N R ES E A RC H 1 2 0 9 ( 2 00 8 ) 1 3 6 –15 0

Fig. 1 – The expression of ICAM-1 and Mac-1 mRNA in the ischemic areas of the cortex and striatum were detected at 2 h of
reperfusion. (A) Representative RT-PCR signals showed the expression of ICAM-1 and Mac-1 mRNA in the chosen areas of
cortex and striatum. C: ischemic cortex; S: ischemic striatum; ipsi: ipsilateral; cont: contralateral; sham: sham group; control:
control group; FA: ferulic acid-treated group. GAPDH mRNA was used as the internal control. The relative expression of
(B) ICAM-1 and (C) Mac-1 mRNA was quantified in the chosen striatum of the sham, control and FA groups. Data were presented
as mean ± SD. *p < 0.05 compared with the sham group; #p < 0.05 compared with the control group; &p < 0.05 compared with the
ipsilateral hemisphere (n = 4).

cerebral ischemia. There were no significant differences in
physiological parameters between the sham, control and FA
groups (p N 0.05; Table 1).
2.2. Effects of FA on ICAM-1 and Mac-1 mRNA levels at
2 h of reperfusion
group (0.5-fold, p < 0.05; Fig. 1). Finally, there were no sig-
nificant differences in IL-1β or TNF-α mRNA levels in the
ischemic area between the control and FA groups (data not
shown).
2.3. The effects of FA on Mac-1, 4-HNE and 8-OHdG
positive cells at 2, 10, 24 and 36 h of reperfusion

There were no significant differences in densitometry mea-

surements of ICAM-1 mRNA in the ischemic area of the cortex
between the sham, control and FA groups (p N 0.05; Fig. 1). In
the ischemic striatum of the ipsilateral hemisphere, the
expression level of ICAM-1 mRNA was 2.1-fold higher in the
control group than in the sham group (p < 0.05; Fig. 1), and 0.7-
fold lower in the FA group than in the control group (p < 0.05;
Fig. 1). In the bilateral striatum in the control group, the
expression of ICAM-1 mRNA in the ipsilateral hemisphere was
1.7-fold higher than that in the contralateral side (p < 0.05;
Fig. 1). There were no marked differences in Mac-1 mRNA
expression in the ischemic cortex between the experimental
groups (p N 0.05; Fig. 1). In the ipsilateral striatum, there were
no differences in Mac-1 mRNA levels between the control and
sham groups (p N 0.05; Fig. 1); however, Mac-1 mRNA expres-
sion was noticeably lower in the FA group than in the control
All positive cells mentioned in the present study were
evaluated within the dotted line squares of the brain coronal
section (Fig. 2).
Mac-1 antigen was expressed in recruited leukocytes and
resident microglia. In the penumbra and ischemic core of the
cortex and striatum, Mac-1 positive cells were rarely found in
the sham, control and FA groups at 2 h of reperfusion.
However, Mac-1 ameboid cells were present in large numbers
in the control and FA groups (both p < 0.01 vs sham group) at
10, 24 and 36 h of reperfusion. The level of Mac-1 positive cells
in the FA group was lower than that in the control group
(p < 0.05; Fig. 3; Table 2). In the ischemic rim and core areas,
there were very few 4-HNE positive cells at 2 h of reperfusion,
whereas there were many 4-HNE positive cells in the control
and FA groups (both p < 0.01 vs sham group) at 10, 24 and 36 h
 BR A I N R ES E A RC H 1 2 0 9 ( 2 00 8 ) 1 3 6 –1 50
Fig. 2 – Representative photograph showed the brain coronal
section (2,3,5-triphenyl tetrazolium chloride stain, TTC stain)
located on the posterior bregma 0.92 mm position. The dotted
line squares indicated the areas for evaluating positive cells.
P: penumbra area of the cortex; C: ischemic core area of the
cortex; S: ischemic core area of the striatum. Dotted
square = 1 mm2.
of reperfusion; however, there were fewer 4-HNE positive cells
in the FA group than in the control group at 10, 24 and 36 h of
reperfusion (p < 0.05; Fig. 4; Table 2). In the ischemic boundary
and core areas, 8-OHdG positive cells were rarely present in
the sham, control and FA groups at 2 h of reperfusion.
However, the number of 8-OHdG positive cells was markedly
increased in the control and FA groups (both p < 0.01 vs sham
group) at 10, 24 and 36 h of reperfusion, although there were
significantly fewer 8-OHdG positive cells in the FA group than
in the control group (p < 0.05; Fig. 5; Table 2).
2.4. The effects of FA on TUNEL positive cells at 2, 10, 24
and 36 h of reperfusion
TUNEL stain was used to detect apoptotic cells. Very few
TUNEL positive cells were found in the ischemic area of the
experimental groups at 2 h of reperfusion. There was a
significant enhancement of TUNEL positive cells in the
penumbra area of the control and FA groups compared with
the sham group (both p < 0.01) at 10, 24 and 36 h of reperfusion.
Moreover, TUNEL positive cells were markedly diminished in
the FA group compared with those in the control group
(p < 0.05; Fig. 6; Table 2). In the ischemic core areas of the cortex
and striatum, the count of TUNEL positive cells in the control
and FA groups was larger than that in the sham group (both
p < 0.01) at 24 and 36 h of reperfusion; however, the count of
TUNEL positive cells in the FA group was smaller than that in
the control group (p < 0.05; Fig. 6; Table 2).
2.5. The effects of FA on active caspase 3-labeled and
active caspase 3-neuronal nuclei (NeuN) double-labeled cells at
10 h of reperfusion
Active caspase 3-labeled cells were barely detectable in the
penumbra area in the sham group at 10 h of reperfusion;
however, they were abundant in the penumbra area in the
control and FA groups (both p < 0.01 vs sham group). The
139
number of active caspase 3-labeled cells in the penumbra area
was significantly lower in the FA group than in the control
group at 10 h of reperfusion (p < 0.05; Fig. 7; Table 3). Numerous
NeuN-labeled cells were expressed in the sham group. Active
caspase 3-labeled cells co-localizing with NeuN were
expressed in the control and FA groups; the distribution
patterns were the same as those obtained by active caspase 3
single staining (Fig. 7).
2.6. The effect of FA on NeuN-labeled cells at 36 h of
reperfusion
The whole brain section of the sham group was rich in NeuN-
labeled cells. Ischemic neurons were shrunken and triangular
in shape (Fig. 8). There were markedly fewer NeuN-labeled
neurons in the penumbra area in the control group than in the
sham group (p < 0.01). Following FA treatment, NeuN-labeled
neurons were effectively rescued in the FA group (p < 0.05 vs
control group; Fig. 8; Table 3). In the ischemic core areas of the
cortex and striatum, NeuN antigenicity was considerably
reduced or lost in the control and FA groups compared with
that in the sham group (both p < 0.01). Moreover, the number of
NeuN-labeled neurons in the FA group was greater than that
in the control group (p < 0.05; Fig. 8; Table 3).
3. Discussion
There were no significant differences in the levels of blood gas
(including pH, pO2 and pCO2) and blood sugar between the
sham, control and FA groups measured at 10 min before and
90 min after cerebral ischemia, indicating that the ischemia
process and FA treatment did not affect the physiological
parameters and all the animals were studied under the same
physiological condition.
Studies have shown that the expression of ICAM-1 mRNA
remarkably increases in the ischemic area at 1–4 h of
reperfusion in transient MCAo models (Liu et al., 2001; Storini
et al., 2005; Khan et al., 2007). The results from our current and
previous researches showed that the expression of ICAM-1
mRNA and immunoreactive cells were simultaneously
enhanced in the ischemic region of the striatum at 2 h of
reperfusion, but were suppressed by the administration of FA
(100 mg/kg i.v.) immediately after MCAo. In the present study,
we found that FA also decreased the level of Mac-1 mRNA even
though Mac-1 mRNA levels had not yet risen in the chosen
striatal region. Noticeably, at 2 h of reperfusion, our data
indicate that FA treatment did not modulate the mRNA
expression of IL-1β and TNF-α, which are the upstream
genes of post-ischemia inflammatory cascade. Following
cerebral I/R injury, ICAM-1 activation elicits circulating
leukocytes to migrate across to endothelium and enter the
injured brain, thereby triggering an inflammatory response
(Kapadia et al., 2006). A number of reports have shown that
potent pharmaceuticals inhibited ICAM-1 mRNA during the
early stage of reperfusion and that the effect is accompanied
by a suppression of recruited leukocytes into the ischemic
brain parenchyma (Liu et al., 2001; Storini et al., 2005; Wang
et al., 2006). Therefore, it is reasonable to suggest that the anti-
inflammatory effect of FA against Mac-1 (marker for microglia/
140 BR A I N R ES E A RC H 1 2 0 9 ( 2 00 8 ) 1 3 6 –15 0

macrophages) immunoreactivity in the penumbra and is- Recruited leukocytes promoted by the ICAM-1-mediated
chemic core areas at 10–36 h of reperfusion is attributed to inflammatory reaction stimulate an over-production of ROS
the suppression of ICAM-1 mRNA during the early stage of during reperfusion (Vemuganti et al., 2004). These free radi-
reperfusion. cals then seriously damage neurons, releasing the oxidation

Fig. 3 – Representative photographs depicted the expression of Mac-1 in the penumbra and ischemic core areas at 10, 24, and
36 h of reperfusion. P: penumbra area of the cortex; C: ischemic core area of the cortex; S: ischemic core area of the striatum; N:
negative control of stain; 10 h: sacrificed at 10 h of reperfusion; 24 h: sacrificed at 24 h of reperfusion; 36 h: sacrificed at 36 h of
reperfusion; sham: sham group; control: control group; FA: ferulic acid-treated group. Arrows indicated Mac-1 positive cells.
Scale bar = 100 μm.
 BR A I N R ES E A RC H 1 2 0 9 ( 2 00 8 ) 1 3 6 –1 50 141

Table 2 – The effects of ferulic acid on Mac-1, 4-HNE, 8- Table 2 (continued)

OHdG and TUNEL positive cells (counts/1 mm2) 2 h (n = 6) 10 h (n = 5) 24 h (n = 6) 36 h (n = 3)
2 h (n = 6) 10 h (n = 5) 24 h (n = 6) 36 h (n = 3)
Mac-1
TUNEL
Mac-1
Striatum
TUNEL
Penumbra Sham 0.0 ± 0.0 0.2 ± 0.4 0.0 ± 0.0 0.0 ± 0.0
Striatum
Sham 0.0 ± 0.0 0.4 ± 0.9 0.3 ± 0.8 0.3 ± 0.6 Control 0.0 ± 0.0 22.2 ± 9.2 104.0 ± 26.4⁎ 657.0 ± 46.5⁎
Sham
FA 0.0 ± 0.0
0.2 ± 0.4 0.2 ± 0.4
13.8 ± 9.1 0.0 ± 0.0
60.2 ± 11.1⁎# 0.0 ±
445.3 0.0
± 106.6⁎#
Control 0.5 ± 0.8 208.6 ± 30.5⁎ 227.3 ± 29.1⁎ 319.7 ± 49.4⁎ Control 0.0 ± 0.0 22.2 ± 9.2 104.0 ± 26.4⁎ 657.0 ± 46.5⁎
FA 0.2 ± 0.4 99.6 ± 11.6⁎# 108.8 ± 27.7⁎# 156.0 ± 47.2⁎# FA ± SD. Mac-1:
0.2 ± 0.4Mac-113.8 ± 9.1 cells; 4-HNE:
60.2 ± 11.1⁎#
Mean positive 4-HNE 445.3 ± 106.6⁎#
positive cells;
8-OHdG: 8-OHdG positive cells; TUNEL: TUNEL positive cells;
Cortex Mean ± SD. Mac-1:
penumbra: penumbra Mac-1 positive
area of the cells;
cortex;4-HNE:
cortex: 4-HNE positive
ischemic corecells;
area
Sham 0.0 ± 0.0 0.4 ± 0.9 0.2 ± 0.4 0.0 ± 0.0 8-OHdG:
of 8-OHdG
the cortex; positive
striatum: cells; TUNEL:
ischemic TUNEL
core area positive
of the cells;sham:
striatum;
Control 0.7 ± 0.8 173.0 ± 24.5⁎ 206.2 ± 41.6⁎ 486.0 ± 56.4⁎ penumbra:
sham penumbra
group; area of group;
control: control the cortex; cortex: acid-treated
FA: ferulic ischemic core area
group;
FA 0.5 ± 0.8 75.0 ± 12.9⁎# 90.3 ± 20.2⁎# 188.0 ± 32.1⁎# 2
of h:
thesacrificed at 2 h of
cortex; striatum: reperfusion;
ischemic 10 h:
core area of sacrificed at 10
the striatum; h of
sham:
reperfusion;
sham group; 24 h: sacrificed
control: controlat 24 h of
group; FA:reperfusion; 36 h: sacrificed
ferulic acid-treated group;
Striatum at 36 h of reperfusion. ⁎p < 0.01 compared with the sham group;
#p < 0.05 compared with the control group. 843504(continued on next page)
Sham 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0
Control 1.3 ± 2.4 116.4 ± 20.3⁎ 194.8 ± 45.0⁎ 345.3 ± 86.5⁎
FA 1.3 ± 2.4 47.2 ± 15.3⁎# 84.7 ± 29.7⁎# 168.7 ± 28.0⁎#

4-HNE
byproducts 4-HNE and 8-OHdG. Increased amounts of these
Penumbra
Sham 0.0 ± 0.0 1.8 ± 3.5 0.7 ± 1.0 0.0 ± 0.0
byproducts can be detected as early as 3 h and might sustain
Control 0.2 ± 0.4 208.0 ± 18.3⁎ 320.5 ± 41.0⁎ 302.3 ± 65.5⁎ for up to 72 h after reperfusion following focal cerebral
FA 1.5 ± 2.4 95.2 ± 16.7⁎# 175.5 ± 27.4⁎# 185.3 ± 11.9⁎# ischemia (Hayashi et al., 1999; Nagayama et al., 2000;
Gordon et al., 2005; Lee et al., 2005; Wang et al., 2005).
Cortex Agents that protect against 4-HNE and 8-OHdG-induced
Sham 0.0 ± 0.0 0.2 ± 0.5 1.2 ± 2.0 0.0 ± 0.0
neurodegeneration in focal cerebral ischemia have been
Control 0.2 ± 0.4 289.0 ± 44.5⁎ 333.3 ± 29.0⁎ 401.7 ± 24.6⁎
highlighted in previous studies (Imai et al., 2003; Zhang et
FA 0.2 ± 0.4 126.0 ± 27.6⁎# 155.2 ± 33.2⁎# 164.7 ± 30.5⁎#
al., 2005). In this study, analysis of the IHC staining on brain
Striatum sections revealed up-regulation of activated microglia/
Sham 0.0 ± 0.0 0.0 ± 0.0 0.8 ± 1.2 0.0 ± 0.0 macrophages (Mac-1) and the oxidative stress markers
Control 2.2 ± 4.0 214.4 ± 34.0⁎ 232.5 ± 35.0⁎ 260.7 ± 50.6⁎ 4-HNE and 8-OHdG in both the penumbra and ischemic
FA 2.7 ± 2.4 78.4 ± 13.2⁎# 104.8 ± 41.1⁎# 98.7 ± 17.5⁎# core areas (cortex and striatum) in the control group during
10–36 h of reperfusion, whereas FA treatment significantly
8-OHdG
ameliorated the severity of oxidative stress in the penumbra
Penumbra and ischemic core areas at the above time points. Our
Sham 0.2 ± 0.4 3.8 ± 8.5 0.3 ± 0.8 0.0 ± 0.0 present findings showed that the effect of FA against
Control 0.0 ± 0.0 147.2 ± 23.7⁎ 278.7 ± 48.0⁎ 250.7 ± 52.0⁎
inflammation-induced oxidative stress was at least partially
FA 0.8 ± 1.6 53.8 ± 15.0⁎# 102.0 ± 21.0⁎# 137.0 ± 28.2⁎#
due to the preceding curtailment of activated microglia/
Cortex macrophages at 10–36 h of reperfusion.
Sham 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 During cerebral ischemia, a very severe ischemic circum-
Control 1.0 ± 1.7 155.6 ± 20.6⁎ 334.7 ± 34.8⁎ 430.3 ± 25.9⁎ stance causes rapid and irreversible destruction of cells, where-
FA 0.2 ± 0.4 62.4 ± 17.0⁎# 140.3 ± 26.0⁎# 229.3 ± 7.8⁎# as mild ischemic insult undergoes apoptosis (Kirino, 2000). The
majority of cells in the ischemic brain that undergo apoptosis
Striatum
are neurons (Zhang et al., 2001; Khan et al., 2004). Apoptosis
Sham 0.0 ± 0.0 0.2 ± 0.5 0.0 ± 0.0 2.0 ± 2.7
Control 1.8 ± 3.6 90.4 ± 36.6⁎ 234.5 ± 42.0⁎ 258.0 ± 56.2⁎
primarily occurs in the penumbra at 6 h and then sharply
FA 0.0 ± 0.0 31.6 ± 9.2⁎# 111.0 ± 37.0⁎# 142.0 ± 13.0⁎# increases in the ischemic rim and core areas at 24–48 h post-
ischemia (Yamada et al., 1999; Hu et al., 2002). In our TUNEL
TUNEL assay, the intensity of apoptosis increased in the penumbra
area at 10 h of reperfusion and robustly increased in the is-
Penumbra
Sham 0.0 ± 0.0 0.6 ± 1.3 2.3 ± 2.7 3.3 ± 2.9 chemic rim and core regions during 24–36 h reperfusion; these
Control 1.5 ± 3.2 102.6 ± 20.7⁎ 184.3 ± 26.4⁎ 587.7 ± 57.1⁎ results confirmed those reported in previous studies (Yamada
FA 0.2 ± 0.4 45.8 ± 20.0⁎# 93.3 ± 31.2⁎# 445.3 ± 27.6⁎# et al., 1999; Hu et al., 2002). It has been well-documented that
free radicals attack cell components and exacerbate oxidative
Cortex stress-related neuronal apoptosis during cerebral I/R period
Sham 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0
(Sakurai et al., 2003; Xia et al., 2004, 2006); moreover, potent
Control 0.2 ± 0.4 25.3 ± 29.3 119.3 ± 26.6⁎ 506.0 ± 62.4⁎
FA 0.0 ± 0.0 16.8 ± 12.6 66.0 ± 15.3⁎# 314.3 ± 49.2⁎#
antioxidants have neuroprotective effects against cerebral I/R
injury by reducing apoptosis (Miyamoto et al., 2003; Khan et al.,
843504 2004; Wang et al., 2005). FA treatment, as mentioned earlier,
reduced the levels of 4-HNE and 8-OHdG. FA also had an anti-
apoptotic effect in the peri-infarct area beginning at 10 h of
142 BR A I N R ES E A RC H 1 2 0 9 ( 2 00 8 ) 1 3 6 –15 0

reperfusion, and the benefit against oxidative stress-related Apoptosis can be divided into caspase-dependent and
apoptosis was seen in the ischemic core areas of the cortex and caspase-independent signaling pathways in the penumbra
striatum at 24 and 36 h of reperfusion. area following MCAo. The crucial effectors leading to DNA

Fig. 4 – Representative photographs depicted the expression of 4-HNE in the penumbra and ischemic core areas at 10, 24 and
36 h of reperfusion. P: penumbra area of the cortex; C: ischemic core area of the cortex; S: ischemic core area of the striatum;
N: negative control of stain; 10 h: sacrificed at 10 h of reperfusion; 24 h: sacrificed at 24 h of reperfusion; 36 h: sacrificed at 36 h of
reperfusion; sham: sham group; control: control group; FA: ferulic acid-treated group. Arrows indicated 4-HNE positive cells.
Scale bar = 100 μm.
 BR A I N R ES E A RC H 1 2 0 9 ( 2 00 8 ) 1 3 6 –1 50 143

fragmentation in caspase-dependent and independent routes tivation of caspase 3 following cerebral ischemic insult (Zhang
are active caspase 3 and apoptosis-inducing factor, respec- et al., 2001; Awasthi et al., 2003). Active caspase 3, a pivotal
tively (Ferrer et al., 2003). Studies have reported that 4-HNE and apoptotic executioner, irreversibly elicits cells to undergo nu-
8-OHdG-induced neuronal apoptosis are closely related to ac- clear condensation and DNA fragmentation; moreover, active

Fig. 5 – Representative photographs depicted the expression of 8-OHdG in the penumbra and ischemic core areas at 10, 24 and
36 h of reperfusion. P: penumbra area of the cortex; C: ischemic core area of the cortex; S: ischemic core area of the striatum; N:
negative control of stain; 10 h: sacrificed at 10 h of reperfusion; 24 h: sacrificed at 24 h of reperfusion; 36 h: sacrificed at 36 h of
reperfusion; sham: sham group; control: control group; FA: ferulic acid-treated group. Arrows indicated 8-OHdG positive cells.
Scale bar = 100 μm.
144 BR A I N R ES E A RC H 1 2 0 9 ( 2 00 8 ) 1 3 6 –15 0

caspase 3 was found to be expressed in the penumbra area at 6– the intensity of apoptosis, resided in neurons and were
12 h after cerebral ischemia (Cho et al., 2003; Shin et al., 2006). markedly increased in the penumbra area at 10 h of reperfu-
In our study, double staining for active caspase 3 and NeuN sion. However, the enhancement of active caspase 3-labeled
revealed that active caspase 3-labeled cells, consistent with cells was clearly suppressed by FA treatment. On the basis of

Fig. 6 – Representative photographs depicted the distribution of TUNEL positive cells in the penumbra and ischemic core areas
at 10, 24 and 36 h of reperfusion. P: penumbra area of the cortex; C: ischemic core area of the cortex; S: ischemic core area of the
striatum; 10 h: sacrificed at 10 h of reperfusion; 24 h: sacrificed at 24 h of reperfusion; 36 h: sacrificed at 36 h of reperfusion;
sham: sham group; control: control group; FA: ferulic acid-treated group. Arrows indicated TUNEL positive cells. Scale
bar = 100 μm.
 BR A I N R ES E A RC H 1 2 0 9 ( 2 00 8 ) 1 3 6 –1 50 145

Fig. 7 – Representative photographs depicted active caspase 3 and NeuN expression in the penumbra area at 10 h of
reperfusion. Sham: sham group; control: control group; FA: ferulic acid-treated group; I: active caspase 3 single staining; II:
active caspase 3–NeuN double staining; N: negative control of stain. Arrows in I and II showed active caspase 3-labeled cells and
active caspase 3–NeuN double-labeled cells, respectively. Scale bars = 100 μm.

these findings, we assume that FA attenuates active caspase 3-
induced neuronal apoptosis in the peri-infarct region, and this
result implies that FA provides neuroprotection in the area of
potential therapeutic intervention at 10 h of reperfusion and
prevents further neuronal damage from occurring during the
later stages of reperfusion.
NeuN, a mature neuronal marker, has been shown to be
present in nuclei and cell bodies of most neuronal cells in
rodents (Unal-Cevik et al., 2004). Whether the intensity of
NeuN immunoreactivity provides evidence in support of
neuron survival still remains controversial (Davoli et al.,
2002; Xu et al., 2002; Unal-Cevik et al., 2004). However, in our
current study, the NeuN antigenicity was markedly decreased
in the infarct rim and core in the control group at 36 h of
reperfusion; whereas NeuN antigenicity was effectively
restored by FA treatment. Recent studies have reported that
apoptotic cascades are triggered in NeuN-labeled cells follow-
ing transient focal cerebral ischemia in rats (Yin et al., 2003; Lei
et al., 2004). Interestingly, we found that the apoptosis and the
expression of NeuN seemed to reveal the existence of a
negative feedback loop among the experimental groups at 36 h
of reperfusion. It is possible that neurons lost NeuN anti-
genicity or even died during apoptosis, and the precise cause
requires further investigation. Nevertheless, FA treatment
effectively prevented apoptotic changes in neurons at 36 h of
reperfusion. Based on our findings, we suggest that the neu-
roprotection provided by FA is mediated primarily via redu-
cing the level of ICAM-1 mRNA expression and by suppressing
146 BR A I N R ES E A RC H 1 2 0 9 ( 2 00 8 ) 1 3 6 –15 0

Table 3 – The effects of ferulic acid on active caspase 3

and NeuN-labeled cells (counts/1 mm2) 4. Experimental procedures
10 h (n = 5) 36 h (n = 3)
4.1. General preparation
Active caspase 3
Adult male Sprague–Dawley rats weighing 300–350 g were
Penumbra
Sham 0.1 ± 1.1 employed in this study. Rats were fasted overnight with free
Control 115.8 ± 12.9⁎ access to water. All experimental procedures were performed
FA 61.8 ± 8.9⁎# under the guidelines approved by the Care and Use of Labo-
ratory Animals Committee of the China Medical University.
NeuN
4.2. Occlusion model
Penumbra
Sham 1429.0 ± 139.9
Control 815.7 ± 147.6⁎ Ischemia was induced by intraluminal suture occlusion of the
FA 1178.7 ± 64.4# right middle cerebral artery (MCA) as previously described
(Longa et al., 1989). Briefly, rats were anesthetized with chloral
Cortex hydrate (400 mg/kg, i.p.). A PE-50 catheter was then introduced
Sham 1624.7 ± 190.9
into the right femoral artery to monitor arterial blood pressure
Control 591.0 ± 105.1⁎
FA 1018.7 ± 151.1⁎#
and sample blood for analysis of blood gas and blood sugar.
The right common carotid artery (CCA) and internal carotid
Striatum artery (ICA) were exposed through a neck midline incision.
Sham 1650.3 ± 246.3 The pterygopalatine artery was ligated close to its origin. A 3-0
Control 476.3 ± 36.5⁎ nylon filament suture, blunted at the tip by a flame and coated
FA 924.3 ± 108.7⁎#
with poly-L-lysine (Sigma, USA), was advanced from the right
Mean ± SD. Active caspase 3: active caspase 3-labeled cells; NeuN: external carotid artery (ECA) through the CCA and up to the
NeuN-labeled cells; penumbra: penumbra area of the cortex; cortex: ICA for a distance of 20–25 mm to block the origin of the MCA.
ischemic core area of the cortex; striatum: ischemic core area of the After 90 min of ischemia, the nylon suture was removed to
striatum; sham: sham group; control: control group; FA: ferulic allow reperfusion. The right distal MCA was exposed via a
acid-treated group; 10 h: sacrificed at 10 h of reperfusion; 36 h:
cranial burr hole (2.5 mm lateral and 2.0 mm posterior to the
sacrificed at 36 h of reperfusion. ⁎p < 0.01 compared with the sham
group; #p < 0.05 compared with the control group.
bregma). The MCA blood flow was monitored by Laser-Doppler
flowmetry (DRT4, Moor Instruments Inc. Wilmington, USA) at
pre-ischemia (N500 U), ischemia (<100 U) and reperfusion
(N300 U) periods, and the Laser-Doppler flow measurements
were used to verify the success of the cerebral I/R procedure.
Mac-1 mRNA expression in the striatal region at 2 h of reper-
fusion. By down-regulation of activated microglia/macrophages 4.3. Grouping
in the striatal lesion, FA possesses the beneficial actions
against inflammation and inflammation-induced oxidative Rats were randomly divided into 3 groups: FA group, control
stress, and the benefits are seen in the ischemic boundary group and sham group. Rats in the FA group were subjected to
and core areas of the cortex during 10–36 h of reperfusion. By MCAo and simultaneously administrated (i.v.) FA (Sigma, USA)
attenuation of oxidative stress (4-HNE and 8-OHdG) in the at a dose of 100 mg/kg. After 90 min of ischemia, rats were
penumbra and ischemic core regions, FA protects against subjected to reperfusion and sacrificed at 2, 10, 24 and 36 h of
oxidative stress-related apoptosis in the penumbra area at reperfusion. Rats in the control group were subjected to the
10 h and restores neurons in the ischemic rim and core areas same procedure as rats in the FA group, but FA was not
at 36 h of reperfusion. We have demonstrated for the first administered. Rats in the sham group underwent the same
time that FA provides neuroprotection during reperfusion by operation as rats in the control group, but the origin of the
inhibiting the expression of ICAM-1 mRNA in transient MCAo. MCA was not occluded.
Previous studies have shown that treatment with anti-ICAM-1
antibody in combination with tissue plasminogen activator 4.4. Physiological parameters
(tPA) can prolong the therapeutic time window of cerebral
ischemia in animal models (Zhang et al., 1999; Vemuganti Rectal temperature was monitored by a rectal thermometer
et al., 2004). In our study, FA attenuated ICAM-1 mRNA ex- and maintained at 37.0 ± 0.5 °C by an electrical heating pad
pression during early reperfusion, suggesting that FA is a throughout the experiment. Blood gas parameters (including
potential therapeutic modality that can extend the time win- pH, pO2 and pCO2) and blood sugar levels were measured at
dow in transient MCAo. 10 min before and 90 min after cerebral ischemia.
In summary, FA significantly reduces the expression of
ICAM-1 mRNA at 2 h of reperfusion and thereby provides neu- 4.5. RNA isolation
roprotection against oxidative stress-related apoptosis during
the late reperfusion period after MCAo. Our data suggest that Following transient MCAo, rats were sacrificed at 2 h (n = 4) of
FA is a promising drug for ischemic stroke and is worthy of reperfusion, and the brains were immediately removed. Total
further investigation. RNA was isolated from bilateral cortex and striatum tissues
 BR A I N R ES E A RC H 1 2 0 9 ( 2 00 8 ) 1 3 6 –1 50 147

Fig. 8 – Representative photographs depicted NeuN expression in the penumbra and ischemic core areas at 36 h of reperfusion.
P: penumbra area of the cortex; C: ischemic core area of the cortex; S: ischemic core area of the striatum; N: negative control of
stain; sham: sham group; control: control group; FA: ferulic acid-treated group. Scale bar = 100 μm.

(bregma: 1.7 to −4.3 mm) using an acid guanidinium thiocya-
nate–water-saturated phenol–chloroform mixture (Chomc-
zynski and Sacchi, 1987). Briefly, tissues were weighed and
placed in denaturing solution (4 M guanidinium thiocyanate,
25 mM sodium citrate (pH 7.0) and 0.5% (w/v) sodium lauroyl
sarcosinate). After tissue homogenization, 2 M sodium acetate
(pH 4.0), water-saturated phenol (pH 4.0) and a chloroform/
isoamyl alcohol mixture (49:1, v/v) were added step-by-step.
The contents were placed on ice for 15 min. After centrifuga-
tion at 14,000 rpm for 15 min at 4 °C, the upper aqueous phase
was subjected twice to leder phenol (water-saturated phenol
(pH 4.0), chloroform and isoamyl alcohol mixture, 25:24:1)
isolations. An equal volume of ice-cold isopropanol was added
to the supernatant and stored for at least 15 min at −70 °C.
After centrifugation at 14,000 rpm for 5 min at 4 °C, the pellet
was dissolved in DEPC-treated double-distilled water and
stored at −70 °C.
4.6. Semi-quantitative reverse transcriptase-polymerase
chain reaction (RT-PCR)
One microgram of total RNA was added to a solution containing
0.5 μg/μl oligo dT, 10 mM dNTP (Promega) and DEPC-treated
water (total 13 μl), and then incubated for 5 min at 65 °C. A
reverse transcriptase (RT) reactive mixture including 4 μl of 5×
first-strand buffer (Promega), 1 ul of 0.1 M DTT (Promega), 1 μl of
40 U/μl RNasin (Promega) and 1 μl of 200 U/μl superscript Ш
(Invitrogen) was prepared. After mixing, the samples were
incubated at 37 °C for 45 min, 95 °C for 5 min and 4 °C for 5 min.
Two microliters of RT product (cDNA) was added to 48 μl of
148 BR A I N R ES E A RC H 1 2 0 9 ( 2 00 8 ) 1 3 6 –15 0

polymerase chain reaction (PCR) mixture containing 10 μM
primer (ICAM-1, Mac-1, IL-1β, TNF-α or GAPDH) (Invitrogen)
(Table 4), 10 mM dNTP (Promega), 10× PCR buffer (Promega),
25 mM MgCl2 (Promega), 5 U/μl Go Taq (Promega) and DEPC-
treated water. PCR was initiated for denaturation at 94 °C for
12 min followed by 33 or 35 cycles (Table 4) of 1 min at 94 °C,
1 min at 55 °C, and 2 min at 72 °C and a final extension at 72 °C for
6 min. The PCR products were subjected to 2% agarose gel elec-
trophoresis and visualized with EtBr stain. Densitometric quan-
tification of PCR products was processed with Gel-Pro Analyzer
Software. The relative transcript abundance is expressed as the
percentage of the target transcript level to that of GAPDH.
4.7. Immunohistochemistry (IHC) assay
After 90 min of cerebral ischemia, rats were sacrificed under
deep anesthesia at 2 (n = 6), 10 (n = 5), 24 (n = 6) and 36 h (n = 3) of
reperfusion. Rats were transcardially perfused with 200 ml of
0.9% saline and 200 ml of 4% paraformaldehyde (PFA, pH 7.4).
Rat brains were removed quickly and postfixed in 4% PFA
followed by 30% sucrose (wt/vol) for 3 days and then cut into
15 µm sections using a cryostat. Brain sections were rinsed with
Dulbecco's phosphate buffered saline (DPBS, Sigma, USA)
containing 0.01% Tween-20 and immersed in 3% H2O2/metha-
nol for 15 min to inhibit endogenous peroxidase activity. There-
after, sections were incubated with 10% normal animal serum
(Zymed, CA, USA) for 20 min at room temperature (RT). The
sections were incubated in moist chambers with primary anti-
Mac-1 (1:200 dilution, Chemicon) antibody for 1 h at RT, anti-4-
HNE (1:400 dilution, MHN-100P, JaICA) antibody overnight at
4 °C and anti-8-OHdG (1:100 dilution, MOG-020P, JaICA) anti-
body overnight at 4 °C, respectively. In addition, brain sections
acquired at 10 and 36 h time points were incubated with rabbit
anti-active caspase 3 (17kD, 1:100 dilution, Chemicon) for 1.5 h at
37 °C and mouse anti-NeuN (1:200 dilution, Chemicon) anti-
bodies for 1.5 h at 37 °C, respectively. Following incubation with
secondary antibody and avidin–biotin peroxidase complex (ABC
kit, Zymed, CA, USA), sections were colored with a 3,3′-diamino-
benzidine (DAB) kit, and then stained with hematoxylin (except
the sections which were incubated with active caspase 3 and
NeuN primary antibodies) as a counterstain. The stained sec-
tions were mounted with mounting media (Assistant-Histokitt,
Germany) and immunoreactive cells were detected under the
microscope (Axioskop 40, Zeiss). Negative control stains of Mac-1,
4-HNE and 8-OHdG were performed on adjacent sections in the
control group and subjected to the same IHC assay but without
primary antibodies; in addition, the negative control stain of
NeuN was also subjected to the same IHC assay on the adjacent
section in the sham group except that the primary antibody was
omitted.
4.8. Terminal deoxynucleotidyl transferase-mediated
dUTP-biotin nick end labeling (TUNEL) assay
TUNEL assay was used to identify cells with nuclear DNA frag-
mentation in the penumbra and ischemic core areas. TUNEL
staining was performed according to the manufacturer's
instructions (Calbiochem). Briefly, the brain sections adjacent
to those used for the evaluation of IHC were incubated with
20 µg/ml proteinase K for 20 min at RT, rinsed with TBS and
incubated with 1× TdT equilibration buffer for 30 min at RT, and
then incubated with TdT labeling reaction mixture for 1.5 h at
37 °C. After addition of stop solution and blocking buffer, sec-
tions were incubated with 1× conjugate solution for 30 min at RT
and TUNEL positive cells were visualized with a DAB kit. Finally,
sections were counterstained with methyl green.

4.9. IHC double staining

Table 4 – Primer sequences
Brain sections that had been subjected to single staining of
Primers (5′ → 3′) Cycles Product size (bp)
active caspase 3 were incubated with diluted normal blocking
ICAM-1 33 234 serum (Vector) for 25 min at RT. Sections were incubated with
Sense:
mouse anti-NeuN (1:200 dilution, Chemicon) for 1.5 h at 37 °C
AGACACAAGCAAGAGAAGAA
and washed with DPBS. After incubation with diluted biotiny-
Antisense:
GAGAAGCCCAAACCCGTATG lated secondary antibody and ABC-AP reagent (AK-5002,
Mac-1 35 150 Vectastain), sections were stained with alkaline phosphatase
Sense: substrate solution (SK-5300, Vector Blue), dried and mounted
CTGCCTCAGGGATCCGTAAAG in mounting media (Assistant-Histokitt, Germany). Finally,
Antisense: the immunoreactive cells were detected under a microscope
CCTCTGCCTCAGGAATGACATC
(Axioskop 40, Zeiss). The negative control stain was subjected
IL-1β 35 241
to the same IHC double assay on the adjacent section in the
Sense:
CACCTTCTTTTCCTTCATCTTTG control group without active caspase 3 and NeuN antibodies.
Antisense:
GTCGTTGCTTGTCTCTCCTTGTA 4.10. Statistical analysis
TNF-α 35 196
Sense: Data are expressed as mean ± SD. Distribution of all variables
GTAGCCCACGTCGTAGCAAAC
was approximately normal and parametric tests such as
Antisense:
TGTGGGTGAGGAGCACATAGTC
ANOVA and paired t-test were used as appropriated. Data
GAPDH 33 452 from all experimental groups were compared using One-way
Sense: ANOVA followed by post-hoc Scheffe's test. In addition, the
ACCACAGTCCATGCCATCAC mRNA expression within individual cohorts (ipsilateral vs
Antisense: contralateral) was compared using paired t-test. A probability
TCCACCACCCTGTTGCTGTA
value less than 0.05 was considered statistically significant.
 BR A I N R ES E A RC H 1 2 0 9 ( 2 00 8 ) 1 3 6 –1 50
Acknowledgment
This study was supported by grants from the National Science
Council (NSC 96-2320-B-039-017), Taiwan.
REFERENCES
Arumugam, T.V., Salter, J.W., Chidlow, J.H., Ballantyne, C.M., Kevil,
C.G., Granger, D.N., 2004. Contributions of LFA-1 and Mac-1
to brain injury and microvascular dysfunction induced by
transient middle cerebral artery occlusion. Am. J. Physiol.,
Heart Circ. Physiol. 287, H2555–H2560.
Awasthi, Y.C., Sharma, R., Cheng, J.Z., Yang, Y., Sharma, A.,
Singhal, S.S., Awasthi, S., 2003. Role of 4-hydroxynonenal in
stress-mediated apoptosis signaling. Mol. Aspects Med. 24,
219–230.
Berliner, S., Rogowski, O., Rotstein, R., Fusman, R., Shapira, I.,
Bornstein, N.M., Prochorov, V., Roth, A., Keren, G., Eldor, A.,
Zeltser, D., 2000. Activated polymorphonuclear leukocytes and
monocytes in the peripheral blood of patients with ischemic
heart and brain conditions correspond to the presence of
multiple risk factors for atherothrombosis. Cardiology 94,
19–25.
Caimi, G., Canino, B., Ferrara, F., Montana, M., Musso, M., Porretto,
F., Carollo, C., Catania, A., Lo Presti, R., 2001. Granulocyte
integrins before and after activation in acute ischaemic stroke.
J. Neurol. Sci. 186, 23–26.
Cho, S., Liu, D., Gonzales, C., Zaleska, M.M., Wood, A., 2003.
Temporal assessment of caspase activation in experimental
models of focal and global ischemia. Brain Res. 982, 146–155.
Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA
isolation by acid guanidinium thiocyanate–phenol–chloroform
extraction. Anal. Biochem. 162, 156–159.
Davoli, M.A., Fourtounis, J., Tam, J., Xanthoudakis, S., Nicholson,
D., Robertson, G.S., Ng, G.Y., Xu, D., 2002.
Immunohistochemical and biochemical assessment of
caspase-3 activation and DNA fragmentation following
transient focal ischemia in the rat. Neuroscience 115, 125–136.
Ding, Y., Young, C.N., Li, J., Luan, X., McAllister 2nd, J.P., Clark, J.D.,
Diaz, F.G., 2003. Reduced inflammatory mediator expression
by pre-reperfusion infusion into ischemic territory in rats: a
real-time polymerase chain reaction analysis. Neurosci. Lett.
353, 173–176.
Ferrer, I., Friguls, B., Dalfo, E., Justicia, C., Planas, A.M., 2003.
Caspase-dependent and caspase-independent signalling of
apoptosis in the penumbra following middle cerebral artery
occlusion in the adult rat. Neuropathol. Appl. Neurobiol. 29,
472–481.
Gordon, K.B., Macrae, I.M., Carswell, H.V., 2005. Effects of
17beta-oestradiol on cerebral ischaemic damage and lipid
peroxidation. Brain Res. 1036, 155–162.
Hayashi, T., Sakurai, M., Itoyama, Y., Abe, K., 1999. Oxidative
damage and breakage of DNA in rat brain after transient MCA
occlusion. Brain Res. 832, 159–163.
Hickstein, D.D., Grunvald, E., Shumaker, G., Baker, D.M., Back, A.L.,
Embree, L.J., Yee, E., Gollahon, K.A., 1993. Transfected
leukocyte integrin CD11b/CD18 (Mac-1) mediates phorbol
ester-activated, homotypic cell:cell adherence in the K562 cell
line. Blood 82, 2537–2545.
Hu, X., Johansson, I.M., Brannstrom, T., Olsson, T., Wester, P., 2002.
Long-lasting neuronal apoptotic cell death in regions with
severe ischemia after photothrombotic ring stroke in rats. Acta
Neuropathol. (Berl) 104, 462–470.
Imai, H., Graham, D.I., Masayasu, H., Macrae, I.M., 2003.
Antioxidant ebselen reduces oxidative damage in focal
cerebral ischemia. Free Radic. Biol. Med. 34, 56–63.
149
Kao, T.K., Ou, Y.C., Kuo, J.S., Chen, W.Y., Liao, S.L., Wu, C.W., Chen,
C.J., Ling, N.N., Zhang, Y.H., Peng, W.H., 2006. Neuroprotection
by tetramethylpyrazine against ischemic brain injury in rats.
Neurochem. Int. 48, 166–176.
Kapadia, R., Tureyen, K., Bowen, K.K., Kalluri, H., Johnson, P.F.,
Vemuganti, R., 2006. Decreased brain damage and curtailed
inflammation in transcription factor CCAAT/enhancer binding
protein beta knockout mice following transient focal cerebral
ischemia. J. Neurochem. 98, 1718–1731.
Khan, M., Sekhon, B., Jatana, M., Giri, S., Gilg, A.G., Sekhon, C.,
Singh, I., Singh, A.K., 2004. Administration of N-acetylcysteine
after focal cerebral ischemia protects brain and reduces
inflammation in a rat model of experimental stroke.
J. Neurosci. Res. 76, 519–527.
Khan, M., Elango, C., Ansari, M.A., Singh, I., Singh, A.K., 2007.
Caffeic acid phenethyl ester reduces neurovascular
inflammation and protects rat brain following transient focal
cerebral ischemia. J. Neurochem. 102, 365–377.
Kirino, T., 2000. Delayed neuronal death. Neuropathology 20
(Suppl), S95–S97.
Klein, J.A., Ackerman, S.L., 2003. Oxidative stress, cell cycle, and
neurodegeneration. J. Clin. Invest. 111, 785–793.
Lee, E.J., Lee, M.Y., Chen, H.Y., Hsu, Y.S., Wu, T.S., Chen, S.T.,
Chang, G.L., 2005. Melatonin attenuates gray and white matter
damage in a mouse model of transient focal cerebral ischemia.
J. Pineal Res. 38, 42–52.
Lei, B., Popp, S., Capuano-Waters, C., Cottrell, J.E., Kass, I.S., 2004.
Lidocaine attenuates apoptosis in the ischemic penumbra and
reduces infarct size after transient focal cerebral ischemia in
rats. Neuroscience 125, 691–701.
Liu, S.J., Zhou, S.W., Xue, C.S., 2001. Effect of tetrandrine on
neutrophilic recruitment response to brain ischemia/
reperfusion. Acta Pharmacol. Sin. 22, 971–975.
Longa, E.Z., Weinstein, P.R., Carlson, S., Cummins, R., 1989.
Reversible middle cerebral artery occlusion without
craniectomy in rats. Stroke 20, 84–91.
McCracken, E., Valeriani, V., Simpson, C., Jover, T., McCulloch, J.,
Dewar, D., 2000. The lipid peroxidation by-product
4-hydroxynonenal is toxic to axons and oligodendrocytes.
J. Cereb. Blood Flow Metab. 20, 1529–1536.
Miyahara, S., Kiryu, J., Tsujikawa, A., Katsuta, H., Nishijima, K.,
Miyamoto, K., Yamashiro, K., Nonaka, A., Honda, Y., 2003.
Argatroban attenuates leukocyte- and platelet-endothelial cell
interactions after transient retinal ischemia. Stroke 34, 2043–2049.
Miyamoto, O., Tamae, K., Kasai, H., Hirakawa, H., Hayashida, Y.,
Konishi, R., Itano, T., 2003. Suppression of hyperemia and DNA
oxidation by indomethacin in cerebral ischemia. Eur. J.
Pharmacol. 459, 179–186.
Nagayama, T., Lan, J., Henshall, D.C., Chen, D., O'Horo, C., Simon,
R.P., Chen, J., 2000. Induction of oxidative DNA damage in the
peri-infarct region after permanent focal cerebral ischemia.
J. Neurochem. 75, 1716–1728.
Nakase, T., Sohl, G., Theis, M., Willecke, K., Naus, C.C., 2004.
Increased apoptosis and inflammation after focal brain
ischemia in mice lacking connexin43 in astrocytes. Am. J.
Pathol. 164, 2067–2075.
Sakurai, M., Nagata, T., Abe, K., Horinouchi, T., Itoyama, Y.,
Tabayashi, K., 2003. Oxidative damage and reduction of redox
factor-1 expression after transient spinal cord ischemia in
rabbits. J. Vasc. Surg. 37, 446–452.
Shin, D.H., Bae, Y.C., Kim-Han, J.S., Lee, J.H., Choi, I.Y., Son, K.H.,
Kang, S.S., Kim, W.K., Han, B.H., 2006. Polyphenol
amentoflavone affords neuroprotection against neonatal
hypoxic–ischemic brain damage via multiple mechanisms.
J. Neurochem. 96, 561–572.
Soriano, S.G., Coxon, A., Wang, Y.F., Frosch, M.P., Lipton, S.A.,
Hickey, P.R., Mayadas, T.N., 1999. Mice deficient in Mac-1
(CD11b/CD18) are less susceptible to cerebral ischemia/
reperfusion injury. Stroke 30, 134–139.
150 BR A I N R ES E A RC H 1 2 0 9 ( 2 00 8 ) 1 3 6 –15 0
Storini, C., Rossi, E., Marrella, V., Distaso, M., Veerhuis, R., Vergani,
C., Bergamaschini, L., De Simoni, M.G., 2005. C1-inhibitor
protects against brain ischemia–reperfusion injury via inhibition
of cell recruitment and inflammation. Neurobiol. Dis. 19, 10–17.
Ueno, M., Tomita, S., Ueki, M., Iwanaga, Y., Huang, C.L., Onodera,
M., Maekawa, N., Gonzalez, F.J., Sakamoto, H., 2006. Two
pathways of apoptosis are simultaneously induced in the
embryonal brains of neural cell-specific HIF-1alpha-deficient
mice. Histochem. Cell Biol. 125, 535–544.
Unal-Cevik, I., Kilinc, M., Gursoy-Ozdemir, Y., Gurer, G., Dalkara,
T., 2004. Loss of NeuN immunoreactivity after cerebral
ischemia does not indicate neuronal cell loss: a cautionary
note. Brain Res. 1015, 169–174.
Vemuganti, R., Dempsey, R.J., Bowen, K.K., 2004. Inhibition
of intercellular adhesion molecule-1 protein expression by
antisense oligonucleotides is neuroprotective after
transient middle cerebral artery occlusion in rat. Stroke 35,
179–184.
Wang, Q., Sun, A.Y., Simonyi, A., Jensen, M.D., Shelat, P.B.,
Rottinghaus, G.E., MacDonald, R.S., Miller, D.K., Lubahn, D.E.,
Weisman, G.A., Sun, G.Y., 2005. Neuroprotective mechanisms of
curcumin against cerebral ischemia-induced neuronal apoptosis
and behavioral deficits. J. Neurosci. Res. 82, 138–148.
Wang, Y.H., Wang, W.Y., Chang, C.C., Liou, K.T., Sung, Y.J.,
Liao, J.F., Chen, C.F., Chang, S., Hou, Y.C., Chou, Y.C.,
Shen, Y.C., 2006. Taxifolin ameliorates cerebral
ischemia–reperfusion injury in rats through its
anti-oxidative effect and modulation of NF-kappa B
activation. J. Biomed. Sci. 13, 127–141.
Won, M.H., Kang, T., Park, S., Jeon, G., Kim, Y., Seo, J.H., Choi, E.,
Chung, M., Cho, S.S., 2001. The alterations of
N-methyl-D-aspartate receptor expressions and oxidative DNA
damage in the CA1 area at the early time after
ischemia–reperfusion insult. Neurosci. Lett. 301, 139–142.
Xia, C.F., Yin, H., Borlongan, C.V., Chao, L., Chao, J., 2004. Kallikrein
gene transfer protects against ischemic stroke by promoting
glial cell migration and inhibiting apoptosis. Hypertension 43,
452–459.
Xia, C.F., Yin, H., Borlongan, C.V., Chao, J., Chao, L., 2006.
Postischemic infusion of adrenomedullin protects against
ischemic stroke by inhibiting apoptosis and promoting
angiogenesis. Exp. Neurol. 197, 521–530.
Xu, G.P., Dave, K.R., Vivero, R., Schmidt-Kastner, R., Sick, T.J.,
Perez-Pinzon, M.A., 2002. Improvement in neuronal survival
after ischemic preconditioning in hippocampal slice cultures.
Brain Res. 952, 153–158.
Yamada, A., Isono, M., Hori, S., Shimomura, T., Nakano, T., 1999.
Temporal and spatial profile of apoptotic cells after focal
cerebral ischemia in rats. Neurol. Med.-Chir. (Tokyo) 39,
575–583 discussion 583–584.
Yin, D., Zhou, C., Kusaka, I., Calvert, J.W., Parent, A.D., Nanda, A.,
Zhang, J.H., 2003. Inhibition of apoptosis by hyperbaric oxygen
in a rat focal cerebral ischemic model. J. Cereb. Blood Flow
Metab. 23, 855–864.
Zhang, R.L., Zhang, Z.G., Chopp, M., Zivin, J.A., 1999.
Thrombolysis with tissue plasminogen activator alters adhe-
sion molecule expression in the ischemic rat brain. Stroke 30,
624–629.
Zhang, W.R., Hayashi, T., Sasaki, C., Sato, K., Nagano, I., Manabe,
Y., Abe, K., 2001. Attenuation of oxidative DNA damage with a
novel antioxidant EPC-K1 in rat brain neuronal cells after
transient middle cerebral artery occlusion. Neurol. Res. 23,
676–680.
Zhang, N., Komine-Kobayashi, M., Tanaka, R., Liu, M.,
Mizuno, Y., Urabe, T., 2005. Edaravone reduces early
accumulation of oxidative products and sequential
inflammatory responses after transient focal ischemia in
mice brain. Stroke 36, 2220–2225.