Emilie Claire Schneider

September 27, 2021

Bio 202TA - SJSU MBT

NIH Proposal: Investigating the Link between miRNA-373 and Triple-Negative Breast
Cancer in Mice

Abstract

There is significant opportunity for microRNAs to be identified as unique cancer subtype

biomarkers, allowing for early diagnosis from a simple patient blood draw. MicroRNAs

(miRNAs) are short, non-coding sequences of RNA that are dysregulated by a variety of cancers,

including breast cancer. These altered miRNAs are detectable in both tumor tissue and blood. By

focusing on the differences in miRNA concentrations between healthy and cancerous blood

samples, we can identify a link between certain miRNAs and the cancer they denote. Some

miRNAs have been loosely linked to the presence of specific cancers, such as that of

miRNA-373 and triple negative breast cancer which we will be investigating further. The

specific aims of this research proposal are: 1) confirm the presence of miRNA-373, in a mouse

model with proclivity for triple negative breast cancer. 2) investigate the increase of miRNA-373

as the cancer develops. Upon data analysis we will be able to confirm whether or not exosomal

miRNA-373 concentration increases as triple negative breast cancer develops, allowing us to

confirm miRNA-373 as a biomarker for that cancer subtype.

Specific Aims
This grant focuses on developing a potential method to assign breast cancer subtype

biomarkers to different miRNAs as a form of early breast cancer detection, before patient tumor

cells develop. To narrow the scope of this grant, we will be specifically investigating the

presence of a link between miRNA-373 and triple negative breast cancer. Previous research has

 loosely established a link between several exosomal miRNAs and their presence in early forms

of breast cancer. Our specific aims are as follows:

Aim 1: To determine if mice have the same miRNAs as humans and do these miRNAs present

similarly in mice with breast cancer?

Aim 2: Can miRNA-373 be present in mice with triple-negative breast cancer?

Much like the previous work of Eichelser et al., there should be a link between the levels of

miRNAs present in mice models with triple negative breast cancer. It can be presumed that

miRNA levels will be elevated as a direct result of triple negative breast cancer; following the

human cell model. When looking specifically at miRNA-373, we are hoping to see a strong

correlation between increased exosomal miRNA levels and the presence of triple negative breast

cancer, allowing for the conclusion that miRNA-373 can be used as a early-detection biomarker

for triple negative breast cancer.

By establishing a direct correlation between elevated miRNA-373 levels in the presence

of triple negative breast cancer, miRNA-373 can be assigned as a biomarker for the breast cancer

subtype. Knowledge of this biomarker will allow oncologists to test a patient's blood plasma

specifically for miRNA-373 as a mode of early breast cancer detection.

Significance
This research is highly significant due to the high frequency of breast cancer. While

breast cancer does have a high survivability rate, early detection, diagnosis, and treatment

prevents the need for patients to undergo costly and physically harmful procedures. Current

treatments include hormonal and chemical therapy that can be combined with surgical removal

of the cancerous tissue by either a lumpectomy or mastectomy. The non-surgical methods of

treatment have proven to be moderately effective but many patients elect to receive a

mastectomy due to late-stage diagnoses. If the cancer is localized to only the breast tissue, such

as those that are caught in early stages, the 5-year survival rate is around 99% following non-

surgical treatment. (Komen, 2021) If the cancer is spread to areas of the body in the same region

as the breast tissue, the survival rate drops to 86%. Although breast cancer mortality has

moderately reduced due to currently available treatments, it is estimated that still, more than

450,000 breast cancer-related deaths occur annually worldwide.

Breast cancer subtypes are determined by analyzing the distinct tumor characteristics to

find clusters of tumors within a known cancer type. Researchers feed gene expression data from

large tumor sample sets into a clustering algorithm to define subtypes. They can then

characterize those subtypes for mutations, structural variations, and epigenetic features, then

further relate those subtypes to patient outcomes. (Cofactor, n.d.) In the case of breast cancer,

there are five main molecular subtypes that are based on the genes a cancer expresses: The

Luminal A breast cancer subtype is hormone-receptor positive, HER2 negative, and has low

levels of protein Ki-67, which helps control how fast cancer cells grow. The Luminal B subtype

is hormone-receptor positive, and either HER2 positive or HER2 negative with high levels of

Ki-67. Triple-negative/basal-like breast cancer is hormone-receptor negative, HER2 negative,

and more common in patients with BRCA1 gene mutations. The HER2-enriched subtype is

hormone-receptor negative and HER2 positive. The Normal-like subtype is similar to luminal A

disease in that it is hormone-receptor positive, HER2 negative, and has low levels of protein

Ki-67. (breastcancer.org April, 2021) This grant aims to investigate exosomal miRNA levels as a

possible way to diagnose triple-negative breast cancer.

 MicroRNAs (miRNAs) are short, non-coding sequences of RNA that are dysregulated by

a variety of cancers, including breast cancer. These altered miRNAs are detectable in both tumor

tissue and blood. Exosomes, extracellular vesicles released from healthy and tumor cells into the

blood circulation and can be isolated from various bodily fluids. Exosomes were initially only

thought to be a mode of biomolecule removal but have since been found to transport genetic

material, such as miRNA. Analysis of these nanovesicles has shown that their miRNA content

reflects that of the cancer cells, allowing researchers to identify breast cancer and determine the

subtype. Since a patient's survival rate is strongly linked to subtype, the ability to discriminate

between subtypes using a relatively non-invasive technique proves invaluable (Joyce, 2016).

Existing research touches on the possible link between exosomal miRNAs in the plasma

of breast cancer patients but focuses on a wide range of miRNAs. A study by Eichelser et al.

investigated the application of exosomal miRNA in determining specific breast cancer subtypes.

Exosomal fractions were isolated from the serum of 50 breast cancer patients and 12 healthy

controls. Exosomal and cell-free miRNA levels, specifically miRNA-101, 372, and 373, were

compared. Exosomal miRNA-101 and 372 were found to be higher in the exosomes of breast

cancer patients (p=0.024) when compared to the controls (p=0.013), indicating possible

correlation. There were elevated miRNA-373 levels in triple-negative breast cancer subtypes in

comparison to other subtypes and the controls. This specific study indicates a relationship

between high miRNA-373 and the triple-negative subtype but, it is important to note that

variability in the miRNA-373 data set was found. This finding is presenting challenges in

gathering further conclusive data to apply miRNAs into the clinical setting.

 By narrowing the research down to one specific miRNA more conclusive data can be

gathered, allowing for a final assignment of a breast cancer subtype to the miRNA of interest. In

the future more subtype biomarkers could be established, allowing oncologists the ability to fully

diagnose and prescribe treatment for breast cancer before a tumor has even developed.

Approach

Specific Aim #1 - Determine if mice have the same miRNAs as humans and if these

miRNAs present similarly in mice with breast cancer

Rationale: It has been shown that exosomal miRNA levels are increased when cancerous cells

and tumors are present in the patients. This was shown by examining the blood plasma of a

diagnosed triple negative breast cancer patient. miRNA-373 has been identified as a possible

biomarker of the triple-negative breast cancer subtype. It is known that mice models do possess

similar miRNAs to humans so we are investigating whether miRNA-373 exists in the desired

model.

Experimental Design

Mice heterozygous for the Apc1572T truncated allele, B6.129P2-Apctm2Rfo/J (JAXmicesearch,

n.d.), as well as wild type B6 mice will be used for determination of miRNA-373 presence.

Regular blood draws will be performed on a sample set of both control and model mice, four of

each initially, scaling up to 10 as needed. Four protocols will be followed using the blood

samples: exosomal extraction, RNA extraction, microarray analysis, and qRT-PCR with western

blot. These protocols have been used to successfully isolate and identify miRNA-4448 by

Zhenan Xu in 2020. (Xu, Z 2020)

Method

 Preparation of Mouse Models: Breeding and Sample Extraction

Both the wild type (control) and gene-specific mice will be purchased from JAX. Breeding pairs

will be established to ensure longevity of the experiment. These pairs will be established before

experimentation happens, by putting two males and two females from the JAX purchased mice

into breeding-specific cages for wildtype and Apc. The progeny from the original JAX mice will

be genotyped using typical DNA extraction, purification, and PCR protocols. Most progeny will

be used for the miRNA determination experiments but those with favorable genotypes,

homozygous positive for Apc or wildtype, will be used for new breeding pairs, further supporting

the colony.

0.18-0.2 ml blood samples will be taken from 4 wildtype, and 4 heterozygous Apc mice

following the JAXMice guidelines. (The Jackson Laboratory, n.d.) This will be repeated 4 times

per mouse sample set to ensure appropriate data collection. If this data is inconclusive, the blood

draws will be repeated using the genotyped progeny.

Isolation, Extraction, and Analysis

Each sample will be centrifuged in different rounds at 300 g for 10 min, 2000 g for 10 min,

10,000 g for 30 min, and 100,000 g for 1 h, re-suspended, and centrifuged at 100,000 g for 1 h to

form an exosome pellet. The pellet will be transferred to carbon-coated 200-mesh copper

electron microscopy grids (5 min), stained with uranyl acetate, and washed with PBS. A

PureLink™ miRNA extraction Kit (Thermo Fisher) will be used on the treated pellet. NanoDrop

ND-1000 will be used to assess the concentration, using a 2ul sample. All qualified samples

(1.8-2.0 minimum) will be used for subsequent experiments.

miRNA will be marked by cyanine 3-pCp with T4 ligase. Cells will then be incubated for 30 min

in a 10× blocking agent plus 25×fragmentation buffer with cRNA at 60°C. GE hybridization

buffer will be added to the mixture. The final hybridization solution will be dispensed onto the

slide for 17 h at 65°C, followed by washing, fixing, and scanning, allowing opportunity for the

tagged cells to proliferate and later become identifiable. qRT-PCR will be used to assess

expression of miRNA-373 from exosomes isolated from blood of 4 wildtype and 4 Apc mice

using a Sigma Aldrich Primer and ReadyMix with the following sequence:

Forward GAAGUGCUUCGAUUUUGGGGUGU
Reverse CUUCAGAAGCUAAAACCCCACA

Specific Aim #2 - Investigating whether miRNA-373 will be increased in mice with triple-

negative breast cancer

Rationale: Confirming the correlation between miRNA-373 and the presence of early-stage

triple-negative breast cancer involves measuring exosomal miRNA levels throughout the cancer

development. We will perform regular blood draws and analysis for the presence of our target

miRNA. In addition, we will assess the rate at which miRNA-373 increases in correlation with

tumor development.

Experimental Design

A minimum of 10 Apc mice and 4 wildtype mice will be examined for increasing amounts of

exosomal miRNA-373 through bi-weekly blood draws for three months. The wildtype mice will

be used as the control group, allowing us to establish a baseline miRNA level and compare to the

Apc mice as their cancer develops. The Apc mice, or experimental group, will be examined

 under the assumption that they do possess miRNA-373 and that this concentration will increase

as tumors develop. An additional set of 10 Apc mice will be examined as needed. With an

additional step of miRNA quantification, the relationship between triple-negative breast cancer

development and increasing miRNA levels will be investigated.

Method

The same methodology as the previous specific aim will be applied to this experiment for both

the preparation of the mouse model samples and the isolation-extraction procedure. Additionally,

a TaqMan Array MicroRNA kit (Thermo Fisher) will be used to quantify the levels of exosomal

miRNA-373 in each sample. First, the blood samples will be prepared with the TaqMan™

miRNA ABC Purification Kit, which enables single-tube isolation of specific miRNA from small

inputs. Primers specific for miRNA-373 are introduced to the prepared sample, increasing

reverse transcription. Each sample is added to the TaqMan Array card and ran through real-time

PCR. Finally, the qPCR results are examined; this quantification will be performed for each

blood draw, allowing examination of the miRNA-373 levels as breast cancer develops in the

models. The quantified data will be presented graphically for both the control and cancerous

mice.

Potential Problems

1. There is potential for the mouse model to not possess identical miRNAs to humans.

2. miRNA-373 may present in varying levels across the sample set and may be found in

high concentration in the “healthy” control samples. Previous data has shown that

variable results have led to in-concrete conclusions about the relationship between

 miRNA-373 and triple-negative breast cancer; upsetting the potential for it to be assigned

as a triple-negative breast cancer biomarker.

3. The mice may develop breast cancer too quickly, leading to premature death.

Solutions/Alternatives

The solution to problem 1 is to have alternative breast cancer model mice available. There is a

large variety of potential mouse models that could be used for this experiment, B6.129P2-

Apctm2Rfo/J happens to most closely resemble that of a human triple-negative breast cancer

patient. Alternative models can be found listed on JAX’s site.

The solution to problem 2 is to closely examine the relationship between increasing miRNA-373

and breast cancer development. Different mice may have varying “base levels” of miRNA-373.

A base level can be estimated for the sample set and outliers should be noted. Even if a mouse

originates with a relatively high miRNA-373 level, that level may still increase as the triple-

negative breast cancer continues to develop. Additionally, by establishing several controls we can

more easily determine the presence of outliers.

The solution to problem 3 is to have extra mice on hand. By establishing breeding cages from

the originally purchased mice, the experiment will have longevity and replicability. If a few mice

become unusable for the purposes of this experiment, new experimentation and analysis can be

done using the prodigy.

Expected Results

We expect to find a clear correlation between the increased presence of exosomal miRNA-373

and triple negative breast cancer development. Much like previously concluded studies, the value

for miRNA-373 concentration needs to be at least .1 more than the control’s value. The data

 collected will be normalized against the control mouse models and will enable statistical

conclusions through comparison of the qPCR graphical results between the wildtype and Apc

positive mice. By focusing on one specific subtype of breast cancer as opposed to all BRCA1

mutation types, it is hoped that significant results will be observed.

Budget and Justification

Budget Category Budget Period

Personnel $60,000
Consultant Costs $5,000
Equipment $40,000
Supplies $10,000
Animal Maintenance $5,000
Veterinary Service $1,000
Alterations and Renovations
Other Expenses $5,000
Direct Consortium/Contractual Costs
Subtotal Direct Costs $126,000
F&A Consortium/Contractual Costs
Total Direct Costs $126,000
Total Direct Costs for Entire Proposed Project Period $126,000

Justification:

Joe Doe (Principal Investigator, 70% effort) will be responsible for the experimental design and

implementation. Additionally, they will coordinate the research team's efforts and will enact

much of the experimentation and analysis required.

10

 Graduate Student (Research Associate, 35% effort) will be responsible for carrying out the

various protocols including: sample extraction, qPCR, and data analysis. It is expected that the

graduate student will devote approximately 35% of their time to this research project.

Undergraduate Student (Research Assistant, 10% effort) will participate in the experiments while

under the supervision of the Principal Investigator or the Graduate Student. They will be

primarily involved in the smaller steps of each protocol.

Vertebrate Animals

Vertebrate animals are used to support this experiment. For significant aim 1, 4 blood draws are

performed per animal and repeated as necessary. For significant aim 2, biweekly blood draws are

performed for the duration of the experiment. Mice will not be experimented on until they reach

at least day 21 in age, allowing them ample time to develop into adult mice. All blood draws will

be done according to the JAXMice guidelines. (The Jackson Laboratory, n.d.) with

approximately 0.18-0.2 ml taken each time. Additionally, blood draws will be done while the

mouse is under Isoflurane anesthesia to ensure as little stress to the mouse as possible. Breeding

cages and progeny will be housed according to the IACUC breeding and housing guidelines and

San Jose State University animal housing guidelines with no more than 5 mice per cage.

Citations

1. Breast Cancer. JAXMice Search. (n.d.). Retrieved November 1, 2021, from https://
mice.jax.org/?searchTerm=breast+cancer.

2. Eichelser, C., Stückrath, I., Müller, V., Milde-Langosch, K., Wikman, H., Pantel, K., &
Schwarzenbach, H. (2014, October 30). Increased serum levels of circulating exosomal
microRNA-373 in receptor-negative breast cancer patients. Oncotarget. Retrieved
October 13, 2021, from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4259427/.

11

 3. Ghosh, A., Sarkar, S., Banerjee, S., Behbod, F., Tawfik, O., McGregor, D., Graff, S., &
Banerjee, S. K. (2018, May 29). Mind model for triple-negative breast cancer in
syngeneic mice for quick and sequential progression analysis of lung metastasis. PloS
one. Retrieved October 13, 2021, from https://www.ncbi.nlm.nih.gov/pmc/articles/
PMC5973560/.

4. Güller, I., McNaughton, S., Crowley, T., Gilsanz, V., Kajimura, S., Watt, M., & Russell,
A. P. (2015, October 19). Comparative analysis of microrna expression in mouse and
human brown adipose tissue. BMC Genomics. Retrieved November 1, 2021, from https://
bmcgenomics.biomedcentral.com/articles/10.1186/s12864-015-2045-8.

5. How much blood can I take from a mouse without endangering its health? The Jackson
Laboratory. (n.d.). Retrieved November 1, 2021, from https://www.jax.org/news-and-
insights/2005/october/how-much-blood-can-i-take-from-a-mouse-without-endangering-
its-health.

6. Joyce, D. P., Kerin, M. J., & Dwyer, R. M. (2016, May 31). Exosome encapsulated
micrornas as circulating biomarkers for breast cancer. Wiley Online Library. Retrieved
October 13, 2021, from https://onlinelibrary.wiley.com/doi/full/10.1002/ijc.30179.

7. Kaur, P., Nagaraja, G. M., Zheng, H., Gizachew, D., Galukande, M., Krishnan, S., &
Asea, A. (2012, March 27). A mouse model for triple-negative breast cancer tumor-
initiating cells (TNBC-tics) exhibits similar aggressive phenotype to the human disease.
BMC Cancer. Retrieved October 13, 2021, from https://bmccancer.biomedcentral.com/
articles/10.1186/1471-2407-12-120.

8. Joyce, D. P., Kerin, M. J., & Dwyer, R. M. (2016, May 31). Exosome encapsulated
micrornas as circulating biomarkers for breast cancer. Wiley Online Library. Retrieved
December 1, 2021, from https://onlinelibrary.wiley.com/doi/full/10.1002/ijc.30179.

9. Lehmann, B. D., Bauer, J. A., Chen, X., Sanders, M. E., Chakravarthy, A. B., Shyr, Y., &
Pietenpol, J. A. (2011, July). Identification of human triple-negative breast cancer
subtypes and preclinical models for selection of targeted therapies. The Journal of
clinical investigation. Retrieved October 13, 2021, from https://www.ncbi.nlm.nih.gov/
pmc/articles/PMC3127435/.

10. Luo, X.-L., Lin, L., Hu, H., Hu, F.-L., Lin, Y., Luo, M.-L., Wang, L., & He, Y.-Q. (2020,
March 13). Development and characterization of mammary intraductal (mind)
spontaneous metastasis models for triple-negative breast cancer in Syngeneic Mice.
Nature News. Retrieved October 13, 2021, from https://www.nature.com/articles/
s41598-020-61679-8.

11. Molecular subtyping and cancer – cofactor genomics. (n.d.). Retrieved December 6,
2021, from https://cofactorgenomics.com/wk-5-2020-molecular-subtyping/.

12

‐
‐

 12. Molecular subtypes of breast cancer. Breastcancer.org. (2021, April 7). Retrieved
December 6, 2021, from https://www.breastcancer.org/symptoms/types/molecular-
subtypes.

13. MystiCq® microrna qPCR Assay Primer HSA-mir-373-3P: Sigma-aldrich. hsa-

miR-373-3p. (n.d.). Retrieved December 1, 2021, from https://www.sigmaaldrich.com/
US/en/product/sigma/mirap00353.

14. PureLink™ mirna isolation kit. Thermo Fisher Scientific - US. (n.d.). Retrieved
November 1, 2021, from https://www.thermofisher.com/order/catalog/product/K157001.

15. Race, ethnicity, and breast cancer. Susan G. Komen®. (2021, September 27). Retrieved
October 13, 2021, from https://www.komen.org/breast-cancer/risk-factor/race-ethnicity/.

16. Ramshani, Z., Zhang, C., Richards, K., Chen, L., Xu, G., Stiles, B. L., Hill, R., Senapati,
S., Go, D. B., & Chang, H.-C. (2019, May 20). Extracellular vesicle microrna
quantification from plasma using an integrated microfluidic device. Nature News.
Retrieved November 1, 2021, from https://www.nature.com/articles/s42003-019-0435-1.

17. Survival and risk of recurrence. Susan G. Komen®. (2021, May 24). Retrieved October
13, 2021, from https://www.komen.org/breast-cancer/survivorship/medical-care/survival-
and-risk-of-recurrence/.

18. Taqman MicroRNA profiling using 384-well array cards: Thermo fisher scientific - US.
TaqMan MicroRNA Profiling Using 384-Well Array Cards | Thermo Fisher Scientific -
US. (n.d.). Retrieved November 1, 2021, from https://www.thermofisher.com/us/en/
home/life-science/pcr/real-time-pcr/real-time-pcr-assays/mirna-ncrna-taqman-assays/
taqman-microrna-profiling-using-384-well-array-cards.html?
cid=gsd_pcr_sbu_r01_us_cp1297_pjt4711_gsd00000_0se_gaw_nt_pur&s_kwcid=AL%2
13652%213%21349821522426%21b%21%21g%21%21mirna+taqman&ef_id=CjwKCA
jwoP6LBhBlEiwAvCcthBpYh2q3wsXAiWF33h1TaSmR5c0OCePc9nqLS4ekyrp2Pt-
ALhYcOhoCivAQAvD_BwE%3AG%3As&gclid=CjwKCAjwoP6LBhBlEiwAvCcthBp
Yh2q3wsXAiWF33h1TaSmR5c0OCePc9nqLS4ekyrp2Pt-ALhYcOhoCivAQAvD_BwE.

19. Xu, Z., Wang, Z., Sun, H., & Xin, H. (2020, May 23). Evaluation of exosomal MIRNA in
blood as a potential diagnostic biomarker for human non-small cell lung cancer. Medical
science monitor : international medical journal of experimental and clinical research.
Retrieved November 1, 2021, from https://www.ncbi.nlm.nih.gov/pmc/articles/
PMC7261001/.

20. Yersal, O., & Barutca, S. (2014, August 10). Biological subtypes of breast cancer:
Prognostic and therapeutic implications. World journal of clinical oncology. Retrieved
December 1, 2021, from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4127612/.

13

21. Yuan X;Qian N;Ling S;Li Y;Sun W;Li J;Du R;Zhong G;Liu C;Yu G;Cao D;Liu Z;Wang
Y;Qi Z;Yao Y;Wang F;Liu J;Hao S;Jin X;Zhao Y;Xue J;Zhao D;Gao X;Liang S;Li
Y;Song J;Yu S;Li Y; (n.d.). Breast cancer exosomes contribute to pre-metastatic niche
formation and promote bone metastasis of tumor cells. Theranostics. Retrieved October
13, 2021, from https://pubmed.ncbi.nlm.nih.gov/33391543/.

22. Zhang, W., Moore, L., & Ji, P. (2011, March). Mouse models for cancer research.
Chinese journal of cancer. Retrieved November 1, 2021, from https://
www.ncbi.nlm.nih.gov/pmc/articles/PMC4013310/.

14