Microbiol. Immunol.

, 51(4), 429–433, 2007

Distinct Function of Pseudomonas aeruginosa Type

IV Pili Disclosed in the Bacterial Pass-Through of
Membrane Filter with Smaller Pore Sizes
Hiroyuki Hasegawa†, 1, Taichiro Tanikawa†, 1, Takashi Nozawa1, Kentaro Nakazawa1,
Yoji Nakagawa1, and Tohey Matsuyama*, 2
1
Department of Applied Biological Chemistry, Faculty of Agriculture, Niigata University, Niigata, Niigata 950–2181, Japan,
and 2Department of Infectious Disease Control and International Medicine, Niigata University Graduate School of Medical
and Dental Sciences, Niigata, Niigata 951–8510, Japan

Received October 31, 2006; in revised form, December 28, 2006. Accepted January 5, 2007

Abstract: Membrane filter pass-through ability of Pseudomonas aeruginosa was analyzed with isogenic
mutants. A flagellum-deficient fliC mutant required two-times longer time (12 hr) to pass through a 0.45-

m pore size filter. With 0.3- and 0.22-
m filters, however, the fliC mutant showed no remarkable disabil-
ity. Meanwhile a pilA mutant defective in twitching motility failed to pass through the 0.22-
m filter.
Complementation of the mutant with pilA gene on a plasmid restored the twitching motility and the 0.22-

m filter pass-through activity. Thus, the distinctive role of P. aeruginosa type IV pili in infiltration into
finer reticulate structures was indicated.

Key words: Pseudomonas aeruginosa, Type IV pili, Filter pass-through activity, Pilus-dependent infiltration

We have recently reported that many bacterial
species point-inoculated on the surface of the mem-
brane filter placed on a hard agar medium passed
through the filter during long time incubation (10–96
hr) (5). These pass-through-permitted filters were
examined for the intactness and destructive effects due
to the bacterial infiltration. The results obtained by the
conventional filtration test and the bubble point test
indicated intactness of the filters (5, 11). Scanning elec-
tron micrographs (SEM) of uninoculated filters showed
broad void spaces with longer distances (
1.0 µm)
between polymer net fibers composing filters (5, 11).
Thus, indicated pore-size values with the membrane fil-
ters are not morphologically determined ones but are
instead functional values for the ordinary pressure filtra-
tion method (11). Consistent with these findings, SEM
also indicated that the bacteria in the process of infiltra-
tion were not remarkably downsizing (5, 11). The
semi-quantitative studies showed that required times for
the bacterial pass-through were dependent on the indi-
cated filter pore sizes and bacterial species and strains
(5). In the ordinary pressure filtration method (done in a
*Address correspondence to Dr. Tohey Matsuyama,
Kamiokawamae-dori 5–64–1–108, Niigata, Niigata 951–8068,
Japan (present address). Fax: 81–25–222–7503. E-mail: hy5s-
mtym@asahi-net.or.jp.
†
These authors contributed equally to this work.
very short time), passively streaming bacteria may be
pushed into the narrow reticulate structure having 150
µm thickness (Fig. 1).
Thus bacterial ability to infiltrate into reticulate
structure was recognized in vitro and became measur-
able by using membrane filters with strictly defined
chemical compositions and graded filtration ability. For
active bacterial translocation in such reticulated struc-
tures, flagella and type IV pili were supposed to work as
motility organs. By mutational studies with isogenic
mutants, peritrichous flagella of Listeria monocytogenes
were shown to work distinctly in the pass-through of
membrane filters with a 0.45-µm pore size, but not with
the 0.22-µm pore size (11). With regard to the type IV
pili of Pseudomonas aeruginosa, twitching motility-
positive strain PAO1 T demonstrated the pass-through
of 0.22-µm pore size filter, but the twitching motility-
negative strain PAO1 C did not (5). Although such
results suggest contribution of type IV pili to the pass-
through of the smaller sized pores, the mutational status
of the strain PAO1 C has been unclear. So, we prepared
an isogenic pilA mutant of a PAO1 T strain then exam-
ined the effects of genetic complementation to confirm
special roles of type IV pili in the pass-through of retic-
Abbreviations: Ap, ampicillin; Cm, chloramphenicol; LB,
Luria-Bertani; PCR, polymerase chain reaction; SEM, scanning
electron micrographs; Tc, tetracycline.

429
430 H. HASEGAWA ET AL

Basic DNA manipulation procedures were carried

Fig. 1. Side view of a membrane filter (pore size, 0.3 µm) visu-
alized by scanning electron microscopy as described previously
by using an ion sputter (E-1030, Hitachi) and an S-5000N
microscope (Hitachi) (5). The membrane filter was mechanically
torn to see the thick reticulate structure of the membrane filter.
Bar, 100 µm.
ulate structures of membrane filters.
The bacterial strains and plasmids used in this study
are listed in Table 1. Luria-Bertani (LB) broth or agar
medium was used routinely as described previously
(10). Bacterial suspensions (5108 CFU/ml of saline)
for examination of the pass-through activity were pre-
pared by centrifugation and washing of late-log phase
bacterial cells grown in LB broth. Susceptibility of P.
aeruginosa PAO1 T and its derivatives to fimbriae-spe-
cific bacteriophage PP7 (ATCC 15692-B2, purchased
from American Type Culture Collection, Rockville,
Md., U.S.A.) (2) was carried out by spotting of the
phage lysate on a bacterial sheet on an LB plate.
out as described by Ausubel et al. (1) and Sambrook et
al. (12). Southern hybridization and preparation of a
labeled probe were performed by using AlkPhos Direct
(Amersham Biosciences) as described by the manufac-
turer. PCR primers used are listed in Table 2. DNA of
fliC and pilA genes were obtained by PCR using primer
pairs FLIF2/FLIR2 and PILF2/PILR2, respectively,
with genomic DNA template of PAO1 T. Then, XbaI-
SphI digested DNA of fliC and pilA were inserted into
the XbaI-SphI digested pUC19 and pFS200GM to create
pPF and pFPIL, respectively. For cassette mutagenesis
using antibiotics selection, DNA 1 and 2 of chloram-
phenicol resistant gene (Cmr) were obtained by PCR
using primer pairs CPF/CPR and CPFK/CPRK, respec-
tively, with template DNA of pFS200. The Cmr DNA 1
was inserted into partial DNA of fliC in pPF by TA
cloning to create pPFCM, then XbaI-SphI digested
pPFCM fragment was inserted into the XbaI-SphI
cleavage site of pFS200GM to create pFPFCM. The
Cmr DNA 2 was digested with KpnI and inserted into
the KpnI cleavage site of pilA in pFPIL to create
pFPILCM. Thereafter, these constructed conjugative
vector pFPFCM and pFPILCM were transferred into
PAO1 T via Escherichia coli S17-1 λpir. Cm-resistant
transconjugants generated by homologous recombina-
tion were selected as a mutant (TF2 or TP2) and con-
firmed by PCR analysis, Southern hybridization with
probes specific to fliC, pilA, and Cmr genes. For confir-
mation of phenotypes of mutants and a revertant, fla-
gella staining by Leifson’s method, PP7 phage-suscepti-
bility test, and motility test in agar plates were carried

Table 1. Strains and plasmids used in this study

Strain or plasmid Relevant characteristics Source or reference
P. aeruginosa
PAO1 T Twitching motility-positive wild type 5
PAO1 TF2 fliC::Cmr This study
PAO1 TP2 pilA::Cmr This study
E. coli
JM109 Used for propagation of pUC19 and pME6032 15
S17-1 λpir Used for propagation of pFS200 13
Plasmids
pFS200 pGP704, Apr, Cmr, delivery vector 14
pFS200GM pFS200, Gmr, delivery vector This study
pFPIL pFS200GM carrying SphI-XbaI fragment containing pilA This study
pFPILCM pFS200GM carrying Cmr gene-inserted pilA This study
pFPFCM pFS200GM carrying Cmr gene-inserted partial fliC This study
pUC19 Apr, cloning vector 15
pPF pUC19 carrying partial fliC This study
pPFCM pUC19 carrying Cmr gene-inserted partial fliC This study
pME6032 Tcr, cloning vector 6
pMP2 pME6032 carrying pilA This study
 NOTES 431

out as described previously (2, 5, 8). For complementa-
tion of the mutant TP2, a vector pMP2 was generated by
insertion of pilA DNA (EcoRI-KpnI digested PCR
product made by primer pair PILA2F/PILA2R and
genomic DNA template of PAO1 T) into pME6032.
For examination of filter pass-through activity, an
autoclaved membrane filter (Millipore; diameter, 47
mm; pore size, 0.22, 0.3, and 0.45 µm; thickness, 150
µm; Bedford; ADVANTEC; diameter, 47 mm; pore
size, 0.2 µm; thickness, 133 µm; pore size, 0.1 µm;
thickness, 110 µm; Tokyo) was placed on an LB agar
plate. The filter was inoculated at its center with 3 µl of
the bacterial suspension, then incubated at 30 C. At 6-
hr or 24-hr time intervals, the membrane filter was
removed and the remaining agar plate was incubated
for 24 hr and examined for the bacterial growth at the
agar surface corresponding to the inoculated locus of
the filter. Since the examinations were carried out at
intervals, the bacterium was considered to have filter
pass-through activity within the designated time of filter
removal from the agar plate. Three independent experi-
ments with three filters were carried out by using filters
with the same lot number. Recovered bacteria in the
pass-through tests were examined for the original prop-
erties (e.g., twitching motility) as described previously
(5).
P. aeruginosa passed through 0.2 µm pore-size filter
within 144 hr and failed to pass through 0.1 µm filter
during incubation for 240 hr (data not shown). Thus,
the limiting pore size for passing through of P. aerugi-
nosa may be between 0.2 µm and 0.1 µm. The equal
level of limiting pore size has been indicated in experi-
ments with L. monocytogenes (11).
To pass through membrane filters, bacteria have to
infiltrate progressively into the reticulate structure and
travel the long way of 150-µm distance. So, isogenic
mutants deficient in flagella or pili were isolated and
examined for the filter pass-through ability (Table 3).
fliC mutant TF2 passed through membrane filter of pore
size 0.45 µm a little slower, but it passed through filters

Table 2. Oligonucleotides used in this study

Primers Sequence (5' to 3')a)
PILF2 GCTCTAGAGCTGGAAGCTTCCGGCGGAATC (XbaI)
PILR2 ACATGCATGCCTCTCATCGAGAAAGGAACC (SphI)
FLIF2 GCTCTAGAAGCGCAACCTGAATGCTTCT (XbaI)
FLIR2 ACATGCATGCTTGCCGAAGACCTGCGAA (SphI)
CPFK GGGGTACCTGATCGGCACGTAAGAGGTT (KpnI)
CPRK GGGGTACCCGGTAAACCAGCAATAGACA (KpnI)
CPF TGATCGGCACGTAAGAGGTT
CPR CGGTAAACCAGCAATAGACA
PILA2F CGGAATTCGGGGAAGGAATCGCAGAAGG (EcoRI)
PILA2R CATGCCATGGTGGAAGCTTCCGGCGGAATC (NcoI)
a)
The additional restriction site is underlined, and the restriction
enzyme is shown in the parentheses.

Table 3. Filter pass-through by P. aeruginosa PAO1 T and its isogenic mutants

Cumulative No.a) of positive pass-throughs during
Filter pore size Incubation
incubation of nine filters inoculated with
(µm) time (hr)
Wild type fliC mutant TF2 pilA mutant TP2
0.45 6 9 0 4
12 9 9
0.3 18 1 0 0
24 9 8 0
30 9 0
36 0
42 0
54 1
0.22 120 2 4 0
144 9 9 0
168 0
a)
Cumulative No. 9 means the end of the examination.
432 H. HASEGAWA ET AL
of pore size 0.3 and 0.22 µm in comparable time to the
wild type PAO1 T. On the other hand, pilA mutant TP2
was unable to pass through membrane filters with
smaller pore sizes (0.22 µm). Thus polar flagella of P.
aeruginosa seemed to be workable only for the pass-
through of the reticulate structures with broader void
spaces. The same limitation regarding the role of pe-
ritrichous flagella in the filter pass-through has been
indicated by the study with L. monocytogenes (11). In
that previous study, SEM of 0.22 µm and 0.45 µm pore
size filter has suggested the different spatial situations
for workability of flagella (11).
The mutant TP2 which was resistant to pili specific
phage PP7 and defective in the twitching motility (data
not shown) was not severely disabled in the pass-
through of 0.45-µm pore size filter. However, failure in
the passing through of smaller pore size filter (0.3 and
0.22 µm) is evident (Table 3). To confirm that this
mutational effect is really related to type IV pili of P.
aeruginosa, complementation experiments with PCR
product pilA DNA was performed by using the vector
pME6032. The results (Table 4) show distinct restora-
tion of the pass-through ability in TP2/pMP2. Thus,
type IV pili of P. aeruginosa seem to exert unique func-
tion which is impossible for flagella in the infiltration
processes in reticulate structures with smaller void
spaces.
P. aeruginosa has motility organs, i.e., polar flagella
and type IV pili (3, 7), but why are two types necessary?
A loop structure with the conservative amino acid
sequence at the C-terminal of PilA protein (pilin) has
been reported as the critical domain for the attachment
to universal surfaces, such as nasal epithelium, steel
and plastics (4). Furthermore, proposed dynamic
mechanisms in elongation and retraction of type IV
pilus of Neisseria gonorrhoeae are persuasive and fasci-
Table 4. Filter pass-through activity of the pilA mutant TP2 of P. aeruginosa and the pilA
gene complemented transformant TP2/pMP2
Cumulative No.a) of positive pass-throughs during
Filter pore size Incubation
incubation of nine filters inoculated with
(µm) time (hr)
TP2
0.3 30
36
42
48
54
0.22 120
144
168
a)
Cumulative No. 9 means the end of the examination.
b)
Control vector.
nating (9). The type IV pili working by such sophisti-
cated manner seemed to have special role which is diffi-
cult to be performed by bacterial flagella. The real
example of such a unique role of type IV pili in the
reticulated environments was brought to light in the
present study.
We thank Drs. J. Kato, D. Haas, N. Gotoh, J. Fukushima, and
T. Watanabe for providing bacterial strains and plasmids. The
Electron Microscope Core Facility at Niigata University is
acknowledged for the scanning electron microscopy studies.
This work was supported in part by a grant from the Urakami
Foundation, Japan.
References
1) Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seid-
man, J.G., Smith, J.A., and Struhl, K. 1990. Current proto-
cols in molecular biology, Greene Publishing/Wiley Inter-
science, New York.
2) Bradley, D.E. 1980. Mobilization of chromosomal determi-
nants for the polar pili of Pseudomonas aeruginosa PAO
by FP plasmids. Can. J. Microbiol. 26: 155–160.
3) Déziel, E., Comeau, Y., and Villemur, R. 2001. Initiation of
biofilm formation by Pseudomonas aeruginosa 57RP corre-
lates with the emergence of hyperpiliated and highly adher-
ent phenotypic variants deficient in swimming, swarming
and twitching motilities. J. Bacteriol. 183: 1195–1204.
4) Giltner, C.L., van Schaik, E.J., Audette, G.F., Kao, D.,
Hodges, R.S., Hassett, D.J., and Irvin, R.T. 2006. The
Pseudomonas aeruginosa type IV pilin receptor binding
domain functions as an adhesion for both biotic and abiotic
surfaces. Mol. Microbiol. 59: 1083–1096.
5) Hasegawa, H., Naganuma, K., Nakagawa, Y., and Matsuya-
ma, T. 2003. Membrane filter (pore size, 0.22–0.45 µm;
thickness, 150 µm) passing-through activity of
Pseudomonas aeruginosa and other bacterial species with
indigenous infiltration ability. FEMS Microbiol. Lett. 223:
41–46.
TP2/pME6032b) TP2/pMP2
0 0 0
0 0 6
0 0 8
0 0 9
1 1
0 0 0
0 0 6
0 0 9
 NOTES
6) Heeb, S., Blumer, C., and Haas, D. 2002. Regulatory RNA
as mediator in GacA/RsmA-dependent global control of
exoproduct formation in Pseudomonas fluorescens CHA0. J.
Bacteriol. 184: 1046–1056.
7) Köhler, T., Curty, L.K., Barja, F., van Delden, C., and
Pechère, J.-C. 2000. Swarming of Pseudomonas aerugi-
nosa is dependent on cell-to-cell signaling and requires fla-
gella and pili. J. Bacteriol. 182: 5990–5996.
8) Leifson, E. 1951. Staining, shape, and arrangement of bac-
terial flagella. J. Bacteriol. 62: 377–389.
9) Maier, B. 2006. Manipulation of single molecules in living
bacteria. Microbe 1: 330–335.
10) Matsuyama, T., Bhasin, A., and Harshey, R.M. 1995. Muta-
tional analysis of flagellum-independent surface spreading
of Serratia marcescens 274 on a low-agar medium. J. Bac-
teriol. 177: 987–991.
11) Nakazawa, K., Hasegawa, H., Nakagawa, Y., and Matsuya-
ma, T. 2005. Factors influencing the ability of Listeria
monocytogenes to pass through a membrane filter by active
infiltration. Appl. Environ. Microbiol. 71: 7571–7574.
433
12) Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecu-
lar cloning: a laboratory manual, Cold Spring Harbor Labo-
ratory Press, Cold Spring Harbor, N.Y.
13) Suzuki, K., Uchiyama, T., Suzuki, M., Nikaidou, N.,
Regué, M., and Watanabe, T. 2001. LysR-type transcrip-
tional regulator ChiR is essential for production of all chiti-
nases and a chitin-binding protein, CBP21, in Serratia
marcescens 2170. Biosci. Biotechnol. Biochem. 65:
338–347.
14) Uchiyama, T., Kaneko, R., Yamaguchi, J., Inoue, A.,
Yanagida, T., Nikaidou, N., Regué, M., and Watanabe, T.
2003. Uptake of N, N'-diacetylchitobiose [(GlcNAc)2] via
the phosphotransferase system is essential for chitinase pro-
duction by Serratia marcescens 2170. J. Bacteriol. 185:
1776–1782.
15) Yanisch-Perron, C., Vieira, J., and Mesing, J. 1985.
Improved M13 phage cloning vectors and host strains:
nucleotide sequences of the M13mp18 and pUC19 vectors.
Gene 33: 103–119.