Acta Histochemica 119 (2017) 508–515

Contents lists available at ScienceDirect

Acta Histochemica
journal homepage: www.elsevier.com/locate/acthis

Impaired steroidogenesis in the testis of leptin-deficient mice (ob/ob -/-) T

⁎
Fabiane Ferreira Martins, Marcia Barbosa Aguila, Carlos Alberto Mandarim-de-Lacerda
Laboratory of Morphometry, Metabolism, and Cardiovascular Diseases, Biomedical Center, Institute of Biology, State University of Rio de Janeiro, Rio de Janeiro, Brazil

A R T I C L E I N F O A B S T R A C T

Keywords: The obesity and its comorbidities, including resistance to leptin, impacts the reproductive function. Testes
Germinative epithelium express leptin receptors in the germ cells and Leydig cells. Then, leptin-deficient animals are obese and infertile.
Infertility We aimed to evaluate the structure and steroidogenic pathway of the testis of deficient leptin mice. Three
Sertoli cells months old male C57BL/6 mice (wild-type, WT) and deficient leptin (ob/ob) mice had their testes dissected and
Leydig cells
prepared for analyses. Compared to the WT group, the ob/ob group showed a greater body mass with smaller
Molecular biology
testes, and alterations in the germinative epithelium: fewer spermatogonia, spermatocytes, and spermatids. The
Sertoli cells and the germ cells showed condensed nuclei and nuclear fragmentation indicating cell death, in
agreement with a low expression of the proliferating cell nuclear antigen and a high expression of Caspase3. In
the ob/ob group, the sperm was absent in the seminiferous tubules, and the steroidogenic pathway was
compromised (low 3Beta hydroxysteroid dehydrogenase and steroidogenic acute regulatory protein). Further, all
hormone receptors involved in the testicular function were down expressed (androgen, estrogen, follicle-
stimulating, luteinizing, aromatase, and nicotinamide adenine dinucleotide phosphate). In conclusion, the
findings indicate significant morphological, hormonal and enzymatic changes in the testis of the ob/ob mice. The
shifts in the enzymatic steroidogenic pathway and the enzymes related to spermatic activity support the insights
about the failures in the fertility of these animals. The study provides new evidence and contributes to the
understanding of how the lack of leptin and obesity might negatively modulate the testicular function leading to
infertility.

1. Introduction humans and rodents, prevents hypogonadism induced by fasting in

Leptin is primarily secreted from the white adipose tissue and acts
on the hypothalamus controlling eating behavior. Therefore, leptin has
a significant role in maintaining body’s metabolism (Wasim et al.,
2016). Dysregulation in leptin levels generates increased food intake
and loss of satiety, events that result in obesity. Obesity is associated
with diabetes, hypertension, and hyperlipidemia with direct effects on
male reproduction (Hoffmann et al., 2016; Hosoi and Ozawa, 2016),
including negative consequences of father’s obesity before conception
(Binder et al., 2015). Also, the prevalence of male obesity-secondary
hypogonadism in patients with moderate to severe obesity is high
(Calderon et al., 2016).
Leptin is also associated with sexual maturation and advances the
onset of puberty in rodents, through regulation of the reproductive axis
during prepubertal and peripubertal stages (Elias and Purohit, 2013).
Moreover, leptin preserves cyclicity and reproductive functions in
primates, and initiates the suppressed reproductive function in ham-
sters (Boggio et al., 2013). In the testis, leptin receptors (Obr) are
expressed in Sertoli cells, Leydig cells, germ cells and spermatozoa
(Hatami-Baroogh et al., 2010).
A sufficient concentration of leptin is required for normal repro-
ductive function. Overproduction of leptin, leading to hormonal
resistance, may be a major contributor to the development of androgen
deficiency in obese men (Landry et al., 2013). Thus, men suffering from
morbid obesity may have important reproductive abnormalities such as
hypogonadism, hyperestrogenemia, and subfertility associated with
lower testosterone production. Such phenotype may be attributed to
changes in the synthesis and secretion of different adipose-derived
hormones and their modulations of testicular Leydig cells (Roumaud
and Martin, 2015).
The mechanisms whereby leptin regulates reproductive function
involve actions at various levels of the hypothalamic-pituitary-gonadal

Abbreviations: Ar, androgen receptor; BM, body mass; 3bhsd, 3beta hydroxysteroid dehydrogenase; Er, estrogen receptor; Fshr, follicle-stimulating hormone receptor; Lhr, luteinizing
hormone receptor; Nadph-Nox5, nicotinamide adenine dinucleotide phosphate; ob/ob, leptin deficient mouse; OBR, leptin receptor; PCNA, proliferating cell nuclear antigen; Star,
steroidogenic acute regulatory protein; WT, wild-type
⁎
Corresponding author at: Laboratório de Morfometria, Metabolismo e Doença Cardiovascular, Centro Biomédico, Instituto de Biologia, Universidade do Estado do Rio de Janeiro, Av
28 de Setembro 87 fds, 20551-030 Rio de Janeiro, RJ, Brazil.
E-mail addresses: fabifef@yahoo.com.br (F.F. Martins), marciaguila@gmail.com (M.B. Aguila), mandarim@uerj.br, mandarim.ca@gmail.com (C.A. Mandarim-de-Lacerda).

http://dx.doi.org/10.1016/j.acthis.2017.05.003
Received 7 December 2016; Received in revised form 12 April 2017; Accepted 8 May 2017
0065-1281/ © 2017 Elsevier GmbH. All rights reserved.
F.F. Martins et al. Acta Histochemica 119 (2017) 508–515

(HPG) axis (Tena-Sempere and Barreiro, 2002). The genetically obese
ob/ob mouse (with no leptin production) is a model to establish the
significance of leptin in the regulation of the HPG axis. The ob/ob mice,
as well as the obese men, show reduced gonadotropin-releasing
hormone (GnRH) levels, diminished production of gonadotropins
(Luteinizing Hormone − LH and Follicle Stimulating Hormone −
FSH), and low testosterone levels(Roumaud and Martin, 2015; Teerds
et al., 2011). Testosterone is an essential hormone for the maintenance
of male fertility and testicular function. The testosterone is secreted by
Leydig cells on stimulation of LH, a process known as steroidogenesis.
The absence or reduction of the levels of testosterone leads to failures in
spermatogenesis and then infertility(O'Hara and Smith, 2015;
Ramaswamy and Weinbauer, 2014).
The leptin-deficient mouse is a well-studied model of obesity.
Nevertheless, some mechanisms involved in failures in the reproductive
biology of these animals are not entirely understood. Thus, we have
aimed to revisit the morphology and function of the testes of the leptin
deficiency ob/ob mice.
2. Materials and methods
2.1. Animal care and handling
Animals were studied at three months of age (n = 10/group). We
used the wild-type (WT) C57BL6/J mice as a control group. The leptin-
deficient ob/ob mice were purchased from Experimental Models
Development Center for Biology and Medicine (CEDEME, São Paulo,
SP, Brazil), from a colony derived from the Jackson Laboratory (B6.V-
Lepob/J, stock no. 000632, Bar Harbor, ME, USA). The animals were
maintained in ventilated cages under controlled conditions in the
Nexgen system (Allentown Inc., PA, USA), 20 ± 2° C and 12 h/12 h
dark/light cycle, with free access to food and water. In this project, the
procedures adopted were approved by the local Ethics Committee for
Animal Experimentation (Universidade do Estado do Rio de Janeiro,
Protocol N° CEUA/010/2016) in agreement with the current guidelines
for animal experimentation (NIH Publication number 85-23, revised
1996).
fluorochrome-conjugated secondary antibody anti-rabbit IgG-Alexa
488 and anti-mouse IgG-Alexa 546 (Invitrogen, Molecular Probes,
Carlsbad, CA, USA), diluted 1:50 in PBS/1% BSA. After rinsing in
PBS, the slides were mounted with Slow Fade Antifade (Invitrogen,
Molecular Probes, Carlsbad, CA, USA). Digital immunofluorescence
images were obtained using confocal microscopy (Nikon Confocal Laser
Scanning Microscopy − Model C2; Nikon Instruments, Inc., New York,
USA).
2.3. Hormonal measurements
We collected blood samples by cardiac puncture. The blood was
centrifuged (120 G for 10 min) to separate plasma that was frozen at
−80° C for subsequent testosterone level measurement (performed in
duplicate by Enzyme-linked immunosorbent assay for Antigen
Detection ELISA, using the specific kit, Testosterone Cloud-Clone Corp.
CEA458Ge, Katy, TX, USA).
2.4. RT-qPCR
We used Trizol (Invitrogen, CA, USA) for total RNA extraction and
Nanovue spectroscopy (GE Life Sciences) to determine RNA amount of
testis and the adipose tissue. Then, one microgram of RNA was treated
with DNAse I (Invitrogen, CA, USA). Afterward, Oligo (dT) primers for
mRNA and Superscript III reverse-transcriptase (both Invitrogen, CA,
USA) were applied to the synthesis of first strand cDNA. Quantitative
real-time PCR used a thermocycler CFX96 (Bio-Rad, Hercules, CA, USA)
and SYBR Green mix (Invitrogen, CA, USA). Table 1 details the primers
employed in the study. The endogenous beta-actin was used to normal-
ize the expression of the selected genes. After the pre-denaturation and
polymerase-activation program (4 min at 95 °C), 44 cycles of 95 °C for
10 s and 60 °C for 15 s were followed by a melting curve program
(60–95° C with a heating rate of 0.1 °C/s). Negative controls consisted
of wells in which the cDNA was substituted for deionized water. The
relative expression ratio of the mRNA was calculated using the equation
2−ΔΔCt, in which −ΔCT represents the ratio between the quantity of
cycles (CT) of the target genes with the endogenous control.

2.2. Morphology and immunofluorescence

2.5. Western-blot
At sacrifice, animals were anesthetized (sodium pentobarbital
The total protein of testis and adipose tissue was extracted in
150 mg/kg intraperitoneal), and their body mass (BM) was measured.
homogenizing buffer containing protease inhibitors. Equivalent quan-
The testis was dissected using a stereomicroscope (Hund, Helmut Hund
tities of total protein resuspended in SDS-containing sample buffer were
GmbH, Wetzlar, Germany), weighed, and the samples were immedi-
heated for 5 min at 100 °C and separated by SDS-PAGE. After electro-
ately frozen and stored at −80 °C for molecular analysis. Additionally,
phoresis, the proteins were electroblotted onto polyvinyl difluoride
adipose tissue samples were collected and stored in freezer −80 for
transfer membranes (Amersham Biosciences, Piscataway, N.J., USA).
molecular analyses. Otherwise, testes were fixed in Bouin’s solution for
The blockade of the membrane was made with nonfat dry milk.
24 h and then technically prepared for light microscopy and immuno-
fluorescence (Kiernan, 1999). Briefly, the samples were embedded in
Table 1
Paraplast Plus (Sigma-Aldrich, St Louis, MO, USA), sectioned with a RT-qPCR primers sequences.
nominal thickness of five micrometers. The sections were stained with
hematoxylin-eosin or periodic acid-Schiff (PAS) with the standard Primer FW (5′-3′) RV
protocols [15]. Testis fragments were fixed in a 3% glutaraldehyde
AR CCGCCGACATTAAAGACATT CTGCTGCCTTCGGAGATTAC
solution, post-fixed in 1% osmium tetroxide and embedded in Epon-812 Aromatase ATCCACACTGTTGTGGGTGA GCCGTCAATTACGTCATCCT
resin (Electron Microscopy Sciences, EMS Hatfield, PA, USA). Semithin Beta actin TGTTACCAACTGGGACGACA GGGGTGTTGAAGGTCTCAAA
sections were stained with toluidine blue (1 μm thick, Leica EMUC6 Caspase3 GGGAGCAAGTCAGTGGACTC CAGAGCGAGATGACATTCCA
ultramicrotome, Leica Mikrosysteme Vertrieb GmbH. Wetzlar, Ger- Er TGCAATGACTATGCCTCTGG CTCCGGTTCTTGTCAATGGT
Fshr CTCTGGGCCAGTCGTTTTAG CTGGCCCTCAACTTCTTCAG
many).
Lhr CTGAAAACTCTGCCCTCCAG CTTTCTTCGGCAAATTCCTG
We analyzed proliferating cell nuclear antigen (PCNA) and Nox5 GATCTTCTTCATCGGCCTTG GATCTTCTTCATCGGCCTTG
Caspase3 immunofluorescence. Tissue sections were submitted to PCNA TAGCCACATTGGAGATGCTG GGTTACCGCCTCCTCTTCTT
citrate buffer, pH 6, at 60° C for 20 min for antigen retrieval, glycine Star TTGGGCATACTCAACAACCA TGACATCAATGACAGCAGCA
2%, and blocking buffer (PBS/5% BSA). The sections were incubated 3Bhsd TGCAGACAAAGACCAAGGTG TGACATCAATGACAGCAGCA

overnight at 4° C with rabbit anti-PCNA antibody diluted 1:50 (SC-

Abbreviations: Androgen receptor, Ar; Estrogen receptor, Er; Follicle-stimulating hormone
7907; Santa Cruz Biotechnology), and mouse anti-Caspase3 (NB-500- receptor, Fshr; Luteinizing hormone receptor, Lhr; Nicotinamide adenine dinucleotide
210; Novus Biologicals) diluted 1:100, in PBS/1% BSA. Furthermore, phosphate, NADPH oxidase 5; Proliferating cell nuclear antigen, PCNA; Steroidogenic
sections were incubated for one hour at room temperature with acute regulatory protein, Star; 3Beta hydroxysteroid dehydrogenase, 3bhsd.

509
F.F. Martins et al. Acta Histochemica 119 (2017) 508–515

Homogenates were incubated with the primary antibodies:

• Estrogen receptor, ER (testis and adipose tissue) (68 kDa; SC-542;

Santa Cruz Biotechnology);
• Follicle-stimulating hormone receptor, FSHR (76 kDa; SC-7798; Santa
Cruz Biotechnology);
• Luteinizing hormone receptor, LHR (85 kDa; SC − 25828; Santa Cruz
Biotechnology);
• OBR (leptin receptor) (100 and 125 kDa; SC-8391; Santa Cruz
Biotechnology);
• Steroidogenic acute regulatory protein, STAR (27 kDa; Ab-58013;
Abcam).

Beta-actin (SC81178; Santa Cruz Biotechnology) served as a loading

control. All blots were normalized by Beta-actin. We used ECL for
protein expression detection system and the Bio-Rad Molecular Imaging
ChemiDoc XRS Systems (Bio-Rad, Hercules, CA, USA). The chemilumi-
nescence intensity of the bands was quantified using the ImageJ
software, version 1.51 (NIH, imagej.nih.gov/ij, USA).

2.6. Statistical analysis

We evaluated the data for normal distribution and then presented

the results as the means and standard deviation. We tested the
differences between the groups with the unpaired t-test. In all cases, a
P-value < 0.05 was considered statistically significant (GraphPad
Prism version 7.03 for Windows, La Jolla, CA, USA).
3. Results
3.1. Body differences and gross anatomy
As expected, the body differences were paramount between the
groups. The ob/ob mice showed a BM 83% greater than the WT mice
(P < 0.0001) (Fig. 1A–C). The testis mass of the ob/ob group was 13%
Fig. 2. Testis structure. In the germinative epithelium of the seminiferous tubules in the
ob/ob group, there are apparent fewer cells than in the wild-type (WT) group. A–B: EA −
elongated spermatids; ER − round spermatids; SC − Sertoli cells; SG − spermatogonia;
SPs − spermatocytes. C–D: arrow heads − sperm. Note the absence of sperm in the
lumen (L) of the seminiferous tubules in the ob/ob group. E–F: arrowheads −
spermatogonia, white arrows − Sertoli cells, asterisks − spermatocytes. In the ob/ob
group, the Sertoli cells, spermatocytes, and spermatogonia (arrowheads) showed
condensed nuclei suggesting fragmentation (apoptosis). Scale bars A-D = 10 μm; E-
F = 5 μm.

Fig. 1. Differences between the groups (wild type, WT, and ob/ob): (A–B) dorsal view of the animals; (C) body mass; (D–E) right testis; (F) testis mass. Values are the mean ± SD, n = 5
per group. Significant differences are indicated (unpaired t-test).

510
F.F. Martins et al.
lower in comparison to the WT group (P < 0.0001) even being the ob/
ob mice heavier than the WT mice (Fig. 1D–F), indicating testicular
atrophy in the ob/ob mice.
3.2. Structure of the testis
The seminiferous tubules were narrow, and the cell types of the
germinative epithelium (spermatogonia, spermatocytes, round and
elongated spermatids) were observed with a smaller frequency in the
ob/ob group in comparison with the WT group (Fig. 2A–B). Also, the
PAS staining confirmed the absence of sperm in the lumen of the
seminiferous tubules in the ob/ob group (Fig. 2C–D). The toluidine blue
staining in semithin sections demonstrated a smaller nuclear volume of
the Sertoli cells, spermatogonia, and spermatocytes in the ob/ob group
compared to the WT group. Besides, it was evident the nuclear
fragmentation in spermatogonia with a less proliferative germinative
epithelium, events that characterize cell death processes in the ob/ob
group (Fig. 2E–F).
3.3. Hormonal analysis
The levels of testosterone were different comparing the ob/ob and
the WT groups. The testosterone level in the ob/ob group was lower by
51% compared to the WT group (P < 0.0001) (Fig. 3).
3.4. PCNA and caspase3 expressions
Double labeling revealed the PCNA expression in the germinative
epithelium of the groups, but it was more intense in the WT group than
in the ob/ob group. Caspase3 was expressed only in the germinative
epithelium of the ob/ob animals. These results corroborate with the
data from the PCNA and Caspase3 gene expression. In ob/ob group the
PCNA gene expression was 188% lower (P < 0.024), but the Caspase3
gene expression was 166% higher (P < 0.001) than in the WT group
(Fig. 4A–H).
3.5. Gene and protein expressions of hormonal receptors
We observed lower gene expressions for Fshr (−70%, P = 0.001),
Lhr (−68%, P = 0.006), Er (−52%, P = 0.015) and Ar (-108%,
P = 0.029) in the ob/ob group compared to the WT group (Fig. 5). In
agreement, the protein expressions were reduced in the ob/ob group
compared to the WT group: for FSHR (-107%, P = 0.013), LHR
(−139%, P = 0.018), ER (−75%, P = 0.010), OBR (−77%,
P = 0.016) (Fig. 6).
Fig. 3. Hormonal analysis of testosterone in the testis of the wild-type group (WT) and
ob/ob group: Values are the mean ± SD, n = 5 per group. Significant differences are
indicated (unpaired t-test).
511
Acta Histochemica 119 (2017) 508–515
3.6. Gene and protein expressions of aromatase and estrogen receptors in
the adipose tissue
The aromatase and the estrogen receptor (Er) gene expressions were
higher in the adipose tissue of the ob/ob group than in the WT group:
Aromatase (+50%, P = 0.0006), Er (+35%, P = 0.0416). The ER
protein expression was also higher in the ob/ob group than in the WT
group: ER (+52%, P = 0.0005) (Fig. 7).
3.7. Gene and protein expressions of steroidogenesis enzymes
Star, 3Bhsd and Aromatase gene expressions were compromised in
the ob/ob group compared to the WT group: Star (−97%, P = 0.020),
3Bhsd (−88%, P = 0.009), Aromatase (−131%, P = 0.006). The
protein expression of STAR was reduced in the ob/ob group in
comparison with the WT group (−43%, P = 0.021) (Fig. 8).
3.8. NADPH oxidase 5 gene expression
NADPH oxidase 5 gene expression was extremely lower in the ob/ob
group (−220%, P = 0.001) than in the WT group (Fig. 9).
4. Discussion
Although obesity effects on reproduction have been studied, are not
entirely clear some morphological and molecular mechanisms involved
in the axis leptin-obesity-male reproduction. This study shows how the
absence of leptin and concomitant obesity negatively modulates critical
pathways in the testis, which are factors that damage the human
reproductive function (Elias and Purohit, 2013).
Our findings suggest that leptin has a major role in the modulation
of testicular function through the regulation and maintenance of BM,
which was greater in the ob/ob animals (almost twice) in comparison
with the WT group. Leptin regulates the BM by inhibiting food intake
and increasing thermogenesis via sympathetic innervation of brown
adipose tissue (Sainz et al., 2015).
We observed a testicular atrophy in the ob/ob mice. Moreover, the
seminiferous tubules of ob/ob mice were smaller with an abnormal
cellularity in the germinative epithelium and no luminal sperm,
contrarily with the observed in the WT mice. Also, the germ cells
(spermatogonia, spermatocytes, and spermatids) were fewer with
reduced proliferation and suggestion of cell death. Apoptosis declines
the production of early germ cells and is characterized by an inter-
nucleosomal fragmentation of DNA, and chromatin condensation (Bhat
et al., 2006).
In the study, we used the PCNA (Proliferating Cell Nuclear Antigen)
as a marker for cell proliferation. PCNA plays important roles in the
metabolism of nucleic acid, its main function is in DNA replication, but
it is also involved in DNA excision repair, cell cycle control, chromatin
assembly, and RNA transcription (Jurikova et al., 2016). In our study,
the ob/ob group compared to the WT group showed a significant
diminishing of the PCNA stain in the germinal epithelium.
The absence of sperm in the seminiferous tubule lumen reinforces
the idea that the ob/ob animals have failures in spermatogenesis.
Indeed, the leptin deficiency causes a disturbance in the HPG axis,
and the ob/ob mice are infertile because they are not able of producing
the hypothalamic GnRH. As a consequence, the release of LH and FSH
from the pituitary is affected, with a following adverse effect on the
release of testosterone (Tsatsanis et al., 2015).
The HPG axis dysregulation impairs the testosterone secretion.
Therefore, the plasmatic levels of testosterone were significantly lower
in the ob/ob animals than in the WT animals. This point is critical for
the fertility of these animals, because the testosterone is the main male
hormone, and a reduction of its levels reinforces and supports the
evidenced changes in the spermatogenesis and the steroidogenesis.
Recently, it was demonstrated that lower testosterone concentrations in
F.F. Martins et al. Acta Histochemica 119 (2017) 508–515

Fig. 4. Immunofluorescence and RT-qPCR: Proliferating cell nuclear antigen(PCNA) and Caspase3 expressions were detected by immunofluorescence (A-F) and RT-qPCR (G-H) in the
testis of the wild-type group (WT) and ob/ob group. In the ob/ob mice, we observed a lower PCNA expression associated with a higher Caspase3 expression in the seminiferous tubules
compared to the WT animals. Values are the mean ± SD, n = 5 per group. Significant differences are indicated (unpaired t-test). Scale bars = 10 μm.

the ob/ob mice and the following modifications in spermatogenesis and
steroidogenesis in these animals could be restored by the administra-
tion of different leptin doses (Hoffmann et al., 2016). The reduction in
the expressions of gonadotropic hormone receptors (Fshr/FHSR, Lhr/
LHR), associated with the decrease of sex hormone receptors (AR, Er/
ER) in the ob/ob mice, indicates that the own hormones (LH, FSH,
testosterone, and estradiol) are equally diminished in the testis of ob/ob
mice.
Although the ob/ob mice do not express leptin, they express
receptors for leptin (Obr). In the testis, a previous report in the
literature demonstrated expression of the Obr receptors in the germ
cells at different stages of the spermatogenesis, as well as in the Leydig
cells (Gao and Chen, 2009). We measured and verified that the ob/ob
group expressed Obr with diminished levels in comparison to the WT
mice. It is licit to consider that the down-regulation of the OBr receptor
expression in the ob/ob group should be modulated by the absence of
leptin in the ob/ob animals.
Besides the LH, the activity of steroidogenic Leydig cells is mediated
by mitochondrial and cytoplasmic enzymes related to the conversion of
cholesterol into testosterone (Neto et al., 2016; Stocco et al., 2017). In

Fig. 5. Gene expressions of the hormone receptors in the testis: in the wild-type (WT) and the ob/ob groups. Values are the mean ± SD, n = 5 per group. Significant differences are
indicated (unpaired t-test). Abbreviations: Follicle-stimulating hormone receptor, Fshr; Luteinizing hormone receptor, Lhr; Estrogen receptor, Er; Androgen receptor, Ar.

512
F.F. Martins et al. Acta Histochemica 119 (2017) 508–515

Fig. 6. Protein expressions of the hormone receptors in the testis: in the wild-type (WT) and the ob/ob group. Values are the mean ± SD, n = 5 per group. Significant differences are
indicated (unpaired t-test). Abbreviations: Follicle-stimulating hormone receptor, FSHR; Luteinizing hormone receptor, LHR; Estrogen receptor, ER; Leptin receptor, OBR.

Fig. 7. Gene and protein expressions of aromatase and estrogen receptors in adipose tissue: in the wild-type (WT) and the ob/ob group. Values are the mean ± SD, n = 5 per group.
Significant differences are indicated (unpaired t-test). Abbreviations: Estrogen receptor, ER.

our study, we evaluated the gene and the protein expressions of the key
enzymes involved in this process. As expected, Star/STAR, Aromatase,
and 3Bhsd expressions were diminished in the ob/ob group compared to
the WT group, which strongly emphasizes failures in steroidogenesis.
The analysis of the testosterone deficit reported in these animals was
reinforced in the current study by the observation of a low expression of
the Ar receptor. Likewise, the previous report in rat stated that obesity
induced by a high-fat diet decreased circulating testosterone levels
(Vigueras-Villasenor et al., 2011).
Estradiol, the predominant form of estrogen, plays a role in male
sexual function. Estradiol in men is essential for modulating libido,
erectile function, and spermatogenesis. ER and aromatase, the enzyme
that converts testosterone to estrogen, are abundant in the penis and
testis (Taylor et al., 2016; Wu et al., 2016). In the testis of the ob/ob
group, the Er/ER expressions were reduced. This set of changes in the
hormone receptors summed to the modified steroidogenic enzyme

513
F.F. Martins et al. Acta Histochemica 119 (2017) 508–515

Fig. 8. Gene and protein expressions in the steroidogenic pathway in the testis: in the wild-type (WT) and the ob/ob group. Values are the mean ± SD, n = 5 per group. Significant
differences are indicated (unpaired t-test). Abbreviations: Steroidogenic acute regulatory protein, Star/STAR; 3Beta hydroxysteroid dehydrogenase,3Bhsd.

reactive oxygen species (Sumimoto, 2008). The testicular NADPH

Fig. 9. Gene expression of Nadph oxidase 5 in the testis: in the wild-type (WT) and the ob/
ob group. Values are the mean ± SD, n = 5 per group. Significant differences are
indicated (unpaired t-test). Abbreviation: nicotinamide adenine dinucleotide phosphate,
Nadph oxidase 5.
pathway in the ob/ob group might explain relevant points about
infertility in these animals. The diminishing in the intratesticular Er
expression in ob/ob animals could be explained by the counterbalance
and a high aromatase expression in peripheral tissues such as adipose
tissue. Our data showed an increase in the aromatase gene expression
and the gene/protein expression of estrogen receptor in adipose tissue
of the ob/ob group. It is reported that obese men have a higher
aromatase activity in peripheral tissues, which results in increased
estrogen levels and decreased testosterone levels (Costanzo and
Knoblovits, 2016; Mammi et al., 2012).
We also evaluated the activity of the NADPH oxidase 5 in the testis.
As we know, the NADPH oxidases of the NOX family happen in
numerous groups of eukaryotes and are significant in different biolo-
gical responses. Most of the host defense, signal transduction, and
hormone synthesis depend on the NADPH oxidases. In conjunction with
NADPH oxidation, NOX enzymes reduce molecular oxygen to super-
oxide as a primary product, which is further converted to various
oxidase 5 mRNA is usually abundant, found particularly in pachytene
spermatocytes and to a lesser extent in the round spermatids. High
levels of NADPH oxidase 5 gene expression are seen in the lumen of the
seminiferous tubules. In association with maturing spermatids and
ejaculated spermatozoa, NADPH oxidase 5 is present in the flagella
region and the acrosome, which is related to sperm motility (Chen
et al., 2015). The NADPH oxidase 5 gene expression was clearly lower
in the ob/ob animals compared to the WT group, corroborating with the
findings (diminishing of the spermatogenic lineage cells and absence of
sperm in the seminiferous tubules). Although it is an important family
of enzymes, studies that relate NADPH oxidase activity to leptin and
obesity are scarce. Studies show that the expression and activity of
NADPH family enzymes, including the NADPH oxidase 5 − NOX 5
isoform, have a high plasticity and may change according to the tissue
and the stimuli of obesity (Jiang et al., 2011). In general, the NADPH
oxidase regulation by the leptin occurs through the activation of the
Janus Kinase pathway (Morawietz and Bornstein, 2006).
In conclusion, the present findings indicate significant morphologi-
cal, hormonal and enzymatic changes in the testis of the ob/ob mice.
The shifts in the enzymatic steroidogenic pathway and the enzymes
related to spermatic activity support the insights about the failures in
the fertility of these animals. The study provides new evidence and
contributes to the understanding of how the lack of leptin and obesity
might negatively modulate the testicular function leading to infertility.
Complementary studies could separate more the effects of leptin and
obesity on the morphophysiology of reproduction of the ob/ob animals.
Authors’ contribution section
FFM and CML were involved in study conception and design. FFM
was involved in study execution and acquisition of data. FFM, MBA,
and CML contributed to data analysis and interpretation. FFM and CML
drafted the manuscript. All authors provided substantial intellectual
contributions and approved the final version of the manuscript.

514
F.F. Martins et al.
Funding
The laboratory is supported by Conselho Nacional de
Desenvolvimento Cientifico e Tecnologico, CNPq (grant numbers
302.154/2011-6, and 442673/2014-0), and Fundação Carlos Chagas
de Amparo à Pesquisa do Estado do Rio de Janeiro, FAPERJ (grant
numbers E-26/201.186/2014, and E-26/010.002659/2014).
Conflict of interest
The authors have no competing interests to declare.
Ethical approval
Ethics Committee for Animal Experimentation of the State
University of Rio de Janeiro has approved the study (Protocol
Number CEUA/010/2016).
References
Bhat, G.K., Sea, T.L., Olatinwo, M.O., Simorangkir, D., Ford, G.D., Ford, B.D., Mann, D.R.,
2006. Influence of a leptin deficiency on testicular morphology, germ cell apoptosis,
and expression levels of apoptosis-related genes in the mouse. J. Androl. 27 (2),
302–310.
Binder, N.K., Beard, S.A., Kaitu'u-Lino, T.J., Tong, S., Hannan, N.J., Gardner, D.K., 2015.
Paternal obesity in a rodent model affects placental gene expression in a sex-specific
manner. Reproduction 149 (5), 435–444.
Boggio, V., Cutrera, R., Carbone, S., Scacchi, P., Ponzo, O.J., 2013. Leptin inhibits the
reproductive axis in adult male Syrian hamsters exposed to long and short
photoperiod. Reprod. Biol. 13 (3), 203–208.
Calderon, B., Gomez-Martin, J.M., Vega-Pinero, B., Martin-Hidalgo, A., Galindo, J.,
Luque-Ramirez, M., Escobar-Morreale, H.F., Botella-Carretero, J.I., 2016. Prevalence
of male secondary hypogonadism in moderate to severe obesity and its relationship
with insulin resistance and excess body weight. Andrology 4 (1), 62–67.
Chen, F., Wang, Y., Barman, S., Fulton, D.J., 2015. Enzymatic regulation and functional
relevance of NOX5. Curr. Pharm. Des. 21 (41), 5999–6008.
Costanzo, P.R., Knoblovits, P., 2016. Male gonadal axis function in patients with type 2
diabetes. Horm. Mol. Biol. Clin. Invest. 26 (2), 129–134.
Elias, C.F., Purohit, D., 2013. Leptin signaling and circuits in puberty and fertility. Cell.
Mol. Life Sci. 70 (5), 841–862.
Gao, L., Chen, B., 2009. Expression, distribution and biological function of leptin receptor
in the testis. Zhonghua Nan Ke Xue 15 (6), 551–555.
Hatami-Baroogh, L., Razavi, S., Zarkesh-Esfahani, H., Tavalaee, M., Tanhaei, S., Ghaedi,
K., Deemeh, M.R., Rabiee, F., Nasr-Esfahani, M.H., 2010. Evaluation of the leptin
receptor in human spermatozoa. Reprod. Biol. Endocrinol. 8, 17.
Hoffmann, A., Manjowk, G.M., Wagner, I.V., Kloting, N., Ebert, T., Jessnitzer, B., Lossner,
U., Stukenborg, J.B., Bluher, M., Stumvoll, M., Soder, O., Svechnikov, K., Fasshauer,
M., Kralisch, S., 2016. Leptin within the subphysiological to physiological range dose
dependently improves male reproductive function in an obesity mouse model.
Endocrinology 157 (6), 2461–2468.
515
Acta Histochemica 119 (2017) 508–515
Hosoi, T., Ozawa, K., 2016. Possible pharmacological approach targeting endoplasmic
reticulum stress to ameliorate leptin resistance in obesity. Front. Endocrinol.
(Lausanne) 7, 59.
Jiang, F., Lim, H.K., Morris, M.J., Prior, L., Velkoska, E., Wu, X., Dusting, G.J., 2011.
Systemic upregulation of NADPH oxidase in diet-induced obesity in rats. Redox Rep.
16 (6), 223–229.
Jurikova, M., Danihel, L., Polak, S., Varga, I., 2016. Ki67, PCNA, and MCM proteins:
markers of proliferation in the diagnosis of breast cancer. Acta Histochem. 118 (5),
544–552.
Kiernan, J.A., 1999. Histological and Histochemical Methods, 3rd ed. Butterworth-
Heinemann, Oxford.
Landry, D., Cloutier, F., Martin, L.J., 2013. Implications of leptin in neuroendocrine
regulation of male reproduction. Reprod. Biol. 13 (1), 1–14.
Mammi, C., Calanchini, M., Antelmi, A., Cinti, F., Rosano, G.M., Lenzi, A., Caprio, M.,
Fabbri, A., 2012. Androgens and adipose tissue in males: a complex and reciprocal
interplay. Int. J. Endocrinol. 2012, 789653.
Morawietz, H., Bornstein, S.R., 2006. Leptin, endothelin, NADPH oxidase, and heart
failure. Hypertension 47 (5), e20.
Neto, F.T., Bach, P.V., Najari, B.B., Li, P.S., Goldstein, M., 2016. Spermatogenesis in
humans and its affecting factors. Semin. Cell Dev. Biol. 59, 10–26.
O'Hara, L., Smith, L.B., 2015. Androgen receptor roles in spermatogenesis and infertility.
Best Pract. Res. Clin. Endocrinol. Metab. 29 (4), 595–605.
Ramaswamy, S., Weinbauer, G.F., 2014. Endocrine control of spermatogenesis: role of
FSH and LH/testosterone. Spermatogenesis 4 (2), e996025.
Roumaud, P., Martin, L.J., 2015. Roles of leptin, adiponectin and resistin in the
transcriptional regulation of steroidogenic genes contributing to decreased Leydig
cells function in obesity. Horm. Mol. Biol. Clin. Invest. 24 (1), 25–45.
Sainz, N., Gonzalez-Navarro, C.J., Martinez, J.A., Moreno-Aliaga, M.J., 2015. Leptin
signaling as a therapeutic target of obesity. Expert Opin. Ther. Targets 19 (7),
893–909.
Stocco, D.M., Zhao, A.H., Tu, L.N., Morohaku, K., Selvaraj, V., 2017. A brief history of the
search for the protein(s) involved in the acute regulation of steroidogenesis. Mol.
Cell. Endocrinol. 441, 7–16.
Sumimoto, H., 2008. Structure, regulation and evolution of Nox-family NADPH oxidases
that produce reactive oxygen species. FEBS J. 275 (13), 3249–3277.
Taylor, A.P., Lee, H., Webb, M.L., Joffe, H., Finkelstein, J.S., 2016. Effects of testosterone
and estradiol deficiency on vasomotor symptoms in hypogonadal men. J. Clin.
Endocrinol. Metab. 101 (9), 3479–3486.
Teerds, K.J., de Rooij, D.G., Keijer, J., 2011. Functional relationship between obesity and
male reproduction: from humans to animal models. Hum. Reprod. Update 17 (5),
667–683.
Tena-Sempere, M., Barreiro, M.L., 2002. Leptin in male reproduction: the testis paradigm.
Mol. Cell. Endocrinol. 188 (1–2), 9–13.
Tsatsanis, C., Dermitzaki, E., Avgoustinaki, P., Malliaraki, N., Mytaras, V., Margioris,
A.N., 2015. The impact of adipose tissue-derived factors on the hypothalamic-
pituitary-gonadal (HPG) axis. Hormones (Athens) 14 (4), 549–562.
Vigueras-Villasenor, R.M., Rojas-Castaneda, J.C., Chavez-Saldana, M., Gutierrez-Perez,
O., Garcia-Cruz, M.E., Cuevas-Alpuche, O., Reyes-Romero, M.M., Zambrano, E.,
2011. Alterations in the spermatic function generated by obesity in rats. Acta
Histochem. 113 (2), 214–220.
Wasim, M., Awan, F.R., Najam, S.S., Khan, A.R., Khan, H.N., 2016. Role of leptin
deficiency, inefficiency, and leptin receptors in obesity. Biochem. Genet. 54 (5),
565–572.
Wu, F., Chen, T., Mao, S., Jiang, H., Ding, Q., Xu, G., 2016. Levels of estradiol and
testosterone are altered in Chinese men with sexual dysfunction. Andrology 4 (5),
932–938.