List of Contributors

P.D. Adelson, Department of Neurosurgery, University of Pittsburgh, Pittsburgh, PA 90095-

1769, USA
F. Andermann, Montreal Neurological Hospital and Institute, McGill University, 3801
University St., Montreal, PQ H3A 2T5, Canada
D.L. Arnold, Epilepsy Clinic and Brain Imaging Center, Montreal Neurological Institute
and Hospital, 3801 University Street, Montreal, PQ H3A 2B4, Canada
B.K. August, Department of Neurology, University of Wisconsin, 1300 University Avenue,
Madison, WI 53706, USA
J.K. Austin, Indiana University School of Nursing, 1111 Middle Drive, NU 492, Indi-
anapolis, IN 46202-5107, USA
R. Baldwin, Epilepsy Research Laboratory, VA Greater Los Angeles Healthcare System,
Department of Neurology and Brain Research Institute, UCLA School of Medicine, Los
Angeles, CA 90095, USA
T.Z. Baram, Departments of Pediatrics and Anatomy/Neurobiology and Neurology, Uni-
versity of California at Irvine, Irvine, CA 92697-4475, USA
D.E Barboriak, Department of Radiology (Neuroradiology), Duke University Medical
Center, Durham, NC 27710, USA
C. Barlow, The Salk Institute for Biological Studies, The Laboratory of Genetics, 10010
North Torrey Pines Road, La Jolla, CA 92037, USA
N.G. Bazan, Neuroscience Center of Excellence and Department of Ophthalmology, LSU
State University Health Sciences Center, 2020 Gravier Street, New Orleans, LA 70112,
USA
A.J. Becker, Department of Neuropathology, University of Bonn Medical Center, Sigmund-
Freud-Str. 25, 53105 Bonn, Germany
B. Bell, Department of Neurology, University of Wisconsin, 600 North Highland Avenue,
Madison, WI 53792, USA
Y. Ben-Ari, Institut National de la Sant6 de la Recherche Medicale, Unit 29, Institut de
Neurobiologie de la M6diterran6e, Marseille, France
R.A. Bender, Departments of Pediatrics and Anatomy/Neurobiology and Neurology,
University of California at Irvine, CA 92697-4475, USA
J. Bengzon, Department of Neurosurgery, University Hospital, S-221 85 Lund, Sweden
A. Bernasconi, Epilepsy Clinic and Brain Imaging Center, Montreal Neurological Institute
and Hospital, 3801 University Street, Montreal, PQ H3A 2B4, Canada
I. Bltimcke, Department of Neuropathology, University of Bonn Medical Center, Sigmund-
Freud-Str. 25, 53105 Bonn, Germany
K.J. Buchheim, Johannes Mtiller Institut ffir Physiologie, Universit~itsklinikum Charit6,
Humboldt Universit~it Berlin, Tucholskystrasse 2, D 10117 Berlin, Germany
L.D. Cahan, Neurosurgery, Southern California Permanente Medical Group, Los Angeles,
CA 15261, USA
F. Cendes, Epilepsy Clinic and Brain Imaging Center, Montreal Neurological Institute and
Hospital, 3801 University Street, Montreal, PQ H3A 2B4, Canada
vi

H.R. Cock, Department of Clinical and Experimental Epilepsy, Institute of Neurology,

Queen Square, London WC1N 3BG, UK
A.J. Cole, MGH Epilepsy Service, VBK 830, Massachusetts General Hospital, 55 Fruit
Street, Boston, MA 02114, USA
J.A. Del Rio, The Salk Institute for Biological Studies, The Laboratory of Genetics, 10010
North Torrey Pines Road, La Jolla, CA 92037, USA
C.B. Dodrill, Harborview Medical Center, Epilepsy Center (Box 359745), 325 9th Avenue,
Seattle, WA 98104-2499, USA
RE. Dudek, Department of Anatomy and Neurobiology, Colorado State University, Fort
Collins, CO 80523, USA
J.S. Duncan, National Society for Epilepsy, Chalfont St. Peter, Buckinghamshire SL9 0LR,
UK
D.W. Dunn, Indiana University School of Nursing, 1111 Middle Drive, NU 492, Indi-
anapolis, IN 46202-5107, USA
A. Ebner, Epilepsy Center Bethel, Epilepsy Surgery Program, Maraweg 21, D-33617
Bielefeld, Germany
M. Eghbal-Ahmadi, Departments of Pediatrics and Anatomy/Neurobiology and Neurol-
ogy, University of California at Irvine, CA 92697-4475, USA
C.T. Ekdahl, Section of Restorative Neurology, Wallenberg Neuroscience Center, BMC
A-11, S-221 84 Lund, Sweden
J. Engel, Jr., Departments of Neurology and Neurobiology, and the Brain Research Institute,
UCLA School of Medicine, 710 Westwood Plaza, Los Angeles, CA 90095-1769, USA
D.J. Ferraro, Department of Anatomy and Neurobiology, Colorado State University, Fort
Collins, CO 80523, USA
S. Gabriel, Johannes MUller Institut ftir Physiologie, Universit~itsklinikum Charitr, Hum-
boldt Universitfit Berlin, Tucholskystrasse 2, D 10117 Berlin, Germany
W.D. Galliard, Clinical Epilepsy Section, National Institutes of Health, Building 10, Room
5N-250, Bethesda, MD 20892, USA
O.H.J. Gr6hn, NMR Research Group, A.I. Virtanen Institute for Molecular Sciences,
University of Kuopio, P.O. Box 1627, FIN-70 211 Kuopio, Finland
R.W. Guillery, Department of Anatomy, University of Wisconsin, 1300 University Avenue,
Madison, WI 53706, USA
W.A. Hauser, Sergievsky Center, Columbia University, College of Physicians and Surgeons,
630 W 168th St, New York, NY 10032, USA
U. Heinemann, Johannes Mtiller Institut ftir Physiologie, Universit~tsklinikum Charitr,
Humboldt Universit~it Berlin, Tucholskystrasse 2, D 10117 Berlin, Germany
J.L. Hellier, Department of Neurology, University of Colorado Health Science Center,
Denver, CO 80262, USA
C. Helmstaedter, University Clinic of Epileptology, University of Bonn, Sigmund Freud
Strasse 25, D-53105 Bonn, Germany
B.P. Hermann, Department of Neurology, University of Wisconsin, 600 North Highland
Avenue, Madison, WI 53792, USA
G.L. Holmes, Clinical Neurophysiology Laboratory, Hunnewell 2, Children's Hospital, 300
Longwood Avenue, Boston, MA 02115, USA
H. Jokeit, Swiss Epilepsy Center, Bleulerstrasse 60, CH-8008 Zurich, Switzerland
R. K~ilvi~iinen, Department of Neurology, Kuopio University Hospital, P.O. Box 1777,
FIN-70 211 Kuopio, Finland
 vii

O. Kann, Johannes Mtiller Institut fur Physiologie, Universit/itsklinikum Charit6, Humboldt

Universit~it Berlin, Tucholskystrasse 2, D 10117 Berlin, Germany
H. Katsumori, Epilepsy Research Laboratory, VA Greater Los Angeles Healthcare System,
Department of Neurology and Brain Research Institute, UCLA School of Medicine, Los
Angeles, CA 90095, USA
R. Kauppinen, NMR Research Group, A.I. Virtanen Institute for Molecular Sciences,
University of Kuopio, P.O. Box 1627, FIN-70 211 Kuopio, Finland
R. Khazipov, Institut National de la Sant6 de la Recherche Medicale, Unit 29, Institut de
Neurobiologie de la M6diterran6e, Marseille, France
S. Koh, Epilepsy Research Laboratory, Massachusetts General Hospital and Department of
Neurology, Harvard Medical School, Boston, MA 02114, USA
R. Kotloski, Department of Neurology, H6/570, 600 Highland Avenue, University of
Wisconsin, Madison, WI 53792, USA
R. Kovacs, Johannes Mtiller Institut ftir Physiologie, Universitatsklinikum Charit6, Hum-
boldt Universit~it Berlin, Tucholskystrasse 2, D 10117 Berlin, Germany
S. Lauersdorf, Department of Neurology, H6/570, 600 Highland Avenue, University of
Wisconsin, Madison, WI 53792, USA
J.R. Lee, California Medical Review Inc., San Francisco, CA 94104, USA
J.P. Leite, Department of Neurology, Ribeirao Preto School of Medicine, University of S~o
Paulo, Ribeirao Preto, Brazil SA
D.V. Lewis, Department of Pediatrics (Neurology), Duke University Medical Center,
Durham, NC 27710, USA
L.M. Li, Epilepsy Clinic and Brain Imaging Center, Montreal Neurological Institute and
Hospital, 3801 University Street, Montreal, PQ H3A 2B4, Canada
O. Lindvall, Section of Restorative Neurology, Wallenberg Neuroscience Center, BMC
A-11, S-221 84 Lund, Sweden
H. Liu, Epilepsy Research Laboratory, VA Greater Los Angeles Healthcare System,
Department of Neurology and Brain Research Institute, UCLA School of Medicine, Los
Angeles, CA 90095, USA
D.H. Lowenstein, Harvard Medical School and Department of Neurology, Beth Israel-
Deaconess Medical Center, 333 Brookline Avenue, Boston, MA 02215, USA
K. Lukasiuk, Epilepsy Research Laboratory, A.I. Virtanen Institute, University of Kuopio,
Neulaniementie 2, P.O. Box 1627, FIN-70 211 Kuopio, Finland
M. Lynch, Department of Neurology, H6/570, 600 Highland Avenue, University of
Wisconsin, Madison, WI 53792, USA
J.R. MacFall, Department of Radiology (Neuroradiology), Duke University Medical Cen-
ter, Durham, NC 27710, USA
G.W. Mathern, Division of Neurosurgery, Reed Neurological Research Center, 710 West-
wood, Plaza, Room 2123, Los Angeles, CA 90095-1769, USA
A.M. Mazarati, Epilepsy Research Laboratory, VA Greater Los Angeles Healthcare Sys-
tem, Department of Neurology and Brain Research Institute, UCLA School of Medicine,
Los Angeles, CA 90095, USA
B.S. Meldrum, GKT School of Biomedical Sciences, Henriette Raphael House, Guy's
Campus, London SE1 1UL, UK
R. Miettinen, Department of Neurology and Neurosciences, University of Kuopio, P.O.
Box 1777, FIN-70 211 Kuopio, Finland
T.V. Mitchell, Department of Radiology (Neurology), Duke University Medical Center,
Durham, NC 27710, USA
viii

E Mohapel, Section of Restorative Neurology, Wallenberg Neuroscience Center, BMC

A-11, S-221 84 Lurid, Sweden
S.L. Mosh6, Departments of Neurology and Neuroscience, Albert Einstein College of
Medicine, Einstein/Montefiore Epilepsy Management Center, 1410 Pelham Parkway
South, Bronx, NY 10461, USA
J. Nairism~igi, NMR Research Group, A.I. Virtanen Institute for Molecular Sciences,
University of Kuopio, EO. Box 1627, FIN-70 211 Kuopio, Finland
D. Naylor, Epilepsy Research Laboratory, VA Greater Los Angeles Healthcare System,
Department of Neurology and Brain Research Institute, UCLA School of Medicine, Los
Angeles, CA 90095, USA
J. Niquet, Epilepsy Research Laboratory, VA Greater Los Angeles Healthcare System,
Department of Neurology and Brain Research Institute, UCLA School of Medicine, Los
Angeles, CA 90095, USA
J. Nissinen, Epilepsy Research Laboratory, A.I. Virtanen Institute, University of Kuopio,
Neulaniementie 2, EO. Box 1627, FIN-70 211 Kuopio, Finland
J.M. Parent, University of Michigan Medical Center, Neuroscience Laboratory Building,
1103 East Huron Street, Ann Arbor, MI 48104-1687, USA
E. Pauli, Department of Neurology, Epilepsy-Center University, Erlangen-Niimberg,
Schwabachanlage 6, 91054 Erlangen, Germany
A. Pitkanen, Epilepsy Research Laboratory, A.I. Virtanen Institute for Molecular Sciences,
University of Kuopio, Neulaniementie 2, P.O. Box 1627, FIN-70 211 Kuopio, Finland
J.M. Provenzale, Department of Radiology (Neuroradiology), Duke University Medical
Center, Durham, NC 27710, USA
E.B. Rodriguez de Turco, Neuroscience Center of Excellence and Department of Oph-
thalmology, LSU State University Health Sciences Center, New Orleans, LA 70112,
USA
T. Salmenper~i, Department of Neurology, Kuopio University Hospital, P.O. Box 1777,
FIN-70 211 Kuopio, Finland
R. Sankar, Epilepsy Research Laboratory, VA Greater Los Angeles Healthcare System,
Department of Neurology and Brain Research Institute, UCLA School of Medicine, Los
Angeles, CA 90095, USA
N. Santilli, Elan Pharmaceuticals, 800 Gateway Blvd, South San Fransisco, CA 94080,
USA
P. Schauwecker, Department of Cell and Neurobiology, University of Southern California,
Keck School of Medicine, BMT 401, 1333 San Pablo Street, Los Angeles, CA 90089-
9112, USA
S. Schuchmann, Johannes MUller Institut fiir Physiologie, Universit~tsklinikum Charit6,
Humboldt Universit~it Berlin, Tucholskystrasse 2, D 10117 Berlin, Germany
M. Seidenberg, Department of Psychology, Chicago Medical School, North Chicago, IL
60064-3095, USA
S. Shinnar, Comprehensive Epilepsy Management Center, Montefiore Medical Center,
Albert Einstein College of Medicine, 111 E 210th Street, Bronx, NY 10467, USA
Y. Shirasaka, Epilepsy Research Laboratory, VA Greater Los Angeles Healthcare System,
Department of Neurology and Brain Research Institute, UCLA School of Medicine, Los
Angeles, CA 90095, USA
S. Shorvon, Institute of Neurology, Queen Square, London WC1N 3BG, UK
C.E. Stafstrom, Department of Neurology, H6-528, University of Wisconsin, 600 Highland
Avenue, Madison, WI 53792, USA
 ix

K.J. Staley, Department of Neurology, University of Colorado Health Science Center,

Denver, CO 80262, USA
H. Stefan, Department of Neurology, Epilepsy-Center University, Erlangen-Ntirnberg,
Schwabachanlage 6, 91054 Erlangen, Germany
L. Suchomelova, Epilepsy Research Laboratory, VA Greater Los Angeles Healthcare
System, Department of Neurology and Brain Research Institute, UCLA School of
Medicine, Los Angeles, CA 90095, USA
T.E Sutula, Departments of Neurology and Anatomy, H6/570, University of Wisconsin,
Madison, WI 53792, USA
J.W. Swann, The Cain Foundation Laboratories, Department of Pediatrics, Baylor College
of Medicine, 6621 Fannin St., MC3-6365, Houston, TX 77030, USA
E. Tasch, Epilepsy Clinic and Brain Imaging Center, Montreal Neurological Institute and
Hospital, 3801 University Street, Montreal, PQ H3A 2B4, Canada
W.H. Theodore, Clinical Epilepsy Section, National Institutes of Health, Building 10,
Room 5N-250, Bethesda, MD 20892, USA
K.W. Thompson, Epilepsy Research Laboratory, VA Greater Los Angeles Healthcare
System, Department of Neurology and Brain Research Institute, UCLA School of
Medicine, Los Angeles, CA 90095, USA
D.M. Treiman, Barrow Neurological Institute, 350 West Thomas Road, Phoenix, AZ
85013, USA
B. Tu, Neuroscience Center of Excellence and Department of Ophthalmology, LSU State
University Health Sciences Center, New Orleans, LA 70112, USA
K.E. VanLandingham, Department of Medicine (Neurology), Duke University Medical
Center, Durham, NC 27710, USA
L. Veli~ek, Departments of Pediatrics, Neurology and Neuroscience, AECOM, K314, 1410
Pelham Parkway South, Bronx, NY 10461, USA
C.G. Wasterlain, Department of Neurology, VA Medical Center (127), 11301 Wilshire
Boulevard, West Los Angeles, CA 90073, USA
M.J. West, Department of Neurobiology/Anatomy, University of Arhus, 8000 Arhus C,
Denmark
O.D. Wiestler, Department of Neuropathology, University of Bonn Medical Center,
Sigmund-Freud-Str. 25, 53105 Bonn, Germany
EA. Williams, Department of Anatomy and Neurobiology, Colorado State University, Fort
Collins, CO 80523, USA
Y. Zheng, Epilepsy Research Laboratory, Massachusetts General Hospital and Department
of Neurology, Harvard Medical School, Boston, MA 02114, USA
 xi

Preface

People with severe epilepsy may experience multiple seizures each day and hundreds to
thousands of seizures during their lifetimes. Even for people with severe epilepsy, the time
represented by the seizures, which typically last only seconds to minutes, is only a very
small fraction of their total existence. The cumulative adverse impact of the brief seizures,
however, is usually substantial and, in some cases, may be quite debilitating. How do brief
episodes of abnormal brain electrical activity and the accompanying involuntary behaviors
produce prolonged disruption of normal functions that persists beyond the seizures, and
why in some cases does this disruption appear to be progressive and cumulative?
Seizures can be regarded as symptoms of an underlying brain disorder, and progression
of neurological disability may be caused by progression of the primary disorder. In some
cases, the causative lesion may be static, but progression still occurs, which raises questions
about the potentially damaging effects of the repeated seizures. For many patients, recurring
seizures become increasingly frequent and are associated with progressive disability that
may include memory disturbances, cognitive impairments, and diminished quality of life.
These observations and concerns, which are unfortunately familiar for too many
patients, families, and physicians, raise the question "Do seizures damage the brain?"
The association of epilepsy with brain damage is well established, and includes the
observation that as many as 70% of cases of drug refractory epilepsy are accompanied
by obvious hippocampal sclerosis, a lesion characterized by neuronal loss and gliosis
involving the CA3, CA1 subregions of the hippocampus, and the hilus of the dentate
gyrus. The association of epilepsy with hippocampal sclerosis is of interest because the
hippocampus has been implicated in memory formation, and many patients with chronic
epilepsy have significant memory dysfunction. In addition to memory disturbances, the
cognitive dysfunction experienced by patients with long-standing epilepsy may involve
other domains, and may be observed as a cumulative consequence of poorly controlled
seizures even when seizure control is eventually achieved.
What are the cumulative effects of recurring brief seizures? A firm answer to this
question has been surprisingly elusive for a variety of reasons. Clearly there is a subset
of patients who appear to tolerate seizures with relatively limited long-term consequences,
and not all patients are destined to progress to intractability with frequent seizures and
disability. This variability and individual susceptibility has made it difficult to make
statements that fairly apply to the full range of people with epileptic disorders, whose
disorders span a broad spectrum from mild with excellent control and few limitations,
to severe with multiple daily seizures and pronounced disability that affects employment,
educational performance, and personal life.
Another factor that has made it difficult to assess the effects of recurring brief seizures
is the broad range of underlying pathologies, which also vary in respect to severity. As
noted, progression of a primary condition may obscure the potentially progressive adverse
effects of the superimposed symptomatic seizures. When the primary condition is static,
but has produced severe cognitive disability, such as cerebral palsy or syndromes of mental
xii

retardation, the incremental adverse effects of seizures may be difficult to detect on the
background of significant primary impairments. Finally, in an effort to make the best of
unfavorable circumstances, many people afflicted by epilepsy have been understandably
reluctant to draw attention to adverse consequences, and to add to the burden of stigma and
exclusion from many aspects of normal life.
So what are the consequences, if any, of the repeated brief seizures that are the defining
feature of epilepsy? Is there a spectrum of severity of seizure-induced damage? Should
damage be regarded only as loss of neurons or atrophy of hippocampus and other brain
structures? Is damage any change in cells (or properties of cells) that is sufficient to
permanently alter functional properties of neural circuits, as detected by physiological
assessment? In the developing nervous system, is damage any change in cells, properties
of cells, or neural circuits that cumulatively modifies or alters developmental outcome? Is
damage any change in cells (or properties of cells) that cumulatively results in behaviorally
significant alterations?
Few would dispute that inadequately treated status epilepticus produces brain damage
detectable by imaging evidence of reduced brain volume and permanent cognitive dysfunc-
tion. The potential subtlety of incremental effects at the cellular level may make detection
of changes induced by brief seizures quite difficult, but these seizures may still lead to
cumulative structural and functional defects. This volume seeks to explore the spectrum
of severe to more subtle damage that may be a consequence of seizures. The contributing
authors have addressed these questions and related issues using a variety of methods in
experimental models and in patients with epilepsy.
The picture that has emerged in response to the question "Do seizures damage the
brain?" is that cumulative damage from repeated seizures should not be regarded only in
terms of loss of neurons or brain atrophy, but should be broadened to include irreversible
or permanent dysfunction that is a consequence of recurring seizures. The dysfunction may
or may not be associated with clear structural alterations, and may be caused by complex
molecular, cellular, synaptic, and systems level dysfunction that results in permanent
cognitive and behavioral impairments.

T. Sutula
A. Pitk~inen
(Editors)
 xiii

Acknowledgements

The contributions to this volume were initially presented and discussed at a workshop
held in Rovaniemi, Finland from June 27-July 1, 2001, which was supported by grants
from Elan Pharmaceuticals and the American Epilepsy Society. The editors gratefully
acknowledge not only the support, but also the encouragement from Elan and the American
Epilepsy Society to pursue the difficult and sometimes unsettling questions that are the
subject of this volume. We especially thank the participating authors and their 'behind the
scenes' supporters, whose sacrifice of time and dedication have significantly contributed
to this effort to address important questions for people with epilepsy. We also thank the
many members of the Department of Neurology at the University of Wisconsin and the
A.I. Virtanen Institute for Molecular Sciences at the University of Kuopio who organized
the workshop, including Daryn Belden, Carol Chijimatsu, and Greg Zalesak (Madison) and
Samuli Kemppainen, Sanna Viitanen (Kuopio).
T. Sutula and A. Pitkanen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Published by Elsevier Science B.V.

CHAPTER 1

Concept of activity-induced cell death in epilepsy:

historical and contemporary perspectives

Brian S. M e l d r u m *

GKT Department of Biomedical Sciences, Kings College, London, UK

Abstract: Selective neuronal loss following status epilepticus was first described just under 100 years ago. The acute
pathology following status epilepticus was shown to be 'ischemic cell change' and was assumed to arise through
hypoxia/ischemia. Less than 30 years ago it was proposed, from experiments in primates, that the selective neuronal loss
in hippocampus and cortex resulted from the abnormal electrical discharges. Selectively vulnerable neurons show swollen,
calcium-loaded mitochondria in the soma and focally in dendrites. Burst firing with a massive Ca2+ entry needs to be
sustained for 30-120 min to produce necrotic cell death. Lesser stress may produce apoptosis or immediate early gene
expression with enhanced expression of many enzymes and receptor subunits. Changes in enzyme, transporter, ion-channel
or receptor function or in network properties may lead to altered vulnerability to the effects of seizures. This type of
modification and the cumulative effect of oxidative damage to proteins and lipids may explain the long-term consequences
of repetitive brief seizures.

Introduction was given by Bouchet and Cazauvieilh in 1825. In

The concept that it is the abnormal discharges as-
sociated with epileptic activity that cause selectively
vulnerable neurons to die is so widely accepted today
that it appears to be virtually self-evident. I suspect
that most young researchers in epilepsy would be
amazed to learn that the concept did not exist 30
years ago. Thus I am grateful for this opportunity
to give a simple historical account of the develop-
ment of the concept. A fuller account is provided by
Shorvon (1994).
The first account of a selective pattern of brain
damage (unilateral hippocampal sclerosis, diffuse
cortical atrophy, lobular cerebellar atrophy) found
in institutionalized patients with intractable seizures
*Correspondence to: B.S. Meldrum, GKT School of
Biomedical Sciences, Henriette Raphael House, Guy's
Campus, London SE1 1UL, UK. Tel.: +44-207-848-6420;
E-mail: brian.meldrum @kcl.ac.uk
1880, Sommer described the cellular pathology in
the hippocampus very precisely and concluded that
this focal pathology was the cause ('aetiologisches
Moment') of generalized seizures (Sommer, 1880).
Pfleger also in 1880 reviewed a large series of post
mortem studies and remarked that some patients dy-
ing during or a few days after status epilepticus had
what appeared (on gross inspection) to be acute vas-
cular lesions in the amygdala or hippocampus. He
suggested that disturbances in local cerebral circu-
lation might be associated with prolonged seizures
(Pfleger, 1880).
Selective neuronal loss
The first clear account of selective neuronal loss
following status epilepticus appeared in the Amer-
ican Journal of Insanity in three articles by Clark
and Prout (1903-1904). They monitored blood pres-
sure, respiration and temperature throughout status
epilepticus, emphasizing the sinister significance of
hyperthermia. They described a sequence of cellular
changes observed with Nissl staining in the brains
of seven patients dying during the course of status
epilepticus involving pyramidal neurons in lamina II
and III in the cortex. There was initially chroma-
tolysis (loss of Nissl staining) sometimes associated
with protoplasmic vacuolation or shrinkage of the
cytoplasm. Later there were glial cell changes that
could be evidence of neuronophagia.
Classical neuropathology developed in Germany
in the early 1900s. Alzheimer (1907) was the first
of about a dozen noted pathologists to write in Ger-
man on the neuropathology of epilepsy and status
epilepticus (quoted in Scholz, 1951, 1959; Peiffer,
1963). By far the most influential paper concerning
status epilepticus was that of Spielmeyer (1927). He
described the predominant early finding in selec-
tively vulnerable neurons as 'ischemic cell change'
('Ischaemische Zellerkrankung'), a type of necrotic
cell death observed in Nissl stained preparations that
was characteristic of anoxic/ischemic damage. The
selective pattern of damage in the hippocampus, neo-
cortex and cerebellum was also similar to that seen
following cerebral ischemia, as after cardiac arrest,
severe arterial hypotension or strangulation. It was
then thought that vascular spasm ('angiospasmen')
played an important part in the initiation of seizures,
thus it was concluded that selective patterns of brain
damage observed after status epilepticus were the
consequence of cerebral hypoxia/ischemia occur-
ring as a result of vasospasm, or possibly hypoxia
and cerebrovascular problems during or directly af-
ter seizures or associated with later cerebral edema
(Spielmeyer, 1930). The concept of selective vulner-
ability in neurodegenerative disorders was explored
by Vogt and Vogt (1922) who spoke of 'pathoclisis'
evoking a mechanism whereby differences in fine
structure or biochemistry of particular neurons could
account for different patterns of selective vulnerabil-
ity encountered in different degenerative disorders.
Changes in cerebral blood flow and metabolism
in seizures
This concept of the ischemic nature of the damage
was widely accepted, but came into conflict with
a progressive body of evidence that cerebral blood
flow increased during seizures (see review by Chap-
man, 1985). The first such study was from Gibbs
et al. (1934) who used thermocouples in the inter-
nal jugular vein. Similarly Penfield and colleagues
(Penfield et al., 1939; Penfield and Jasper, 1954)
recorded focal seizure discharges with corticography
in the open skull and using thermocouples and direct
observation noted that there was vasodilation in as-
sociation with seizure onset. Indeed, the hyperemia
was such that the venous blood became red, suggest-
ing that blood flow increased relatively more than
oxygen consumption.
Incisural sclerosis
Earle et al. (1953) used suction to remove mesial
temporal structures as a treatment for drug-resistant
complex partial seizures and described the frequent
occurrence (100 of 157 cases) of sclerotic lesions in
the medial tip of the temporal lobe (uncus). They
called this pathology 'incisural sclerosis' to indicate
that it arose from herniation of the medial border of
the anterior temporal lobe over the tentorium causing
ischemic lesions (through compression of branches
of the anterior choroidal and posterior cerebral arter-
ies). The postulation that this event occurred during
moulding of the head in the normal birth process was
supported by experimental studies on fetal brains.
The ischemic lesion was seen as the focal pathology
responsible for the epileptic focus. This view was
very influential for 20-30 years. It was rejected by
Falconer (1968) on the grounds that: (1) postmortem
studies in neonates did not reveal this pattern of
pathology (Veith, 1960); (2) the lack of correlation
of the pathology with a history of difficult birth (as
acknowledged by Penfield) is problematic; and (3)
the extent of the pathology in the anterior temporal
lobe and elsewhere in the brain was not compati-
ble with compression of the anterior choroidal and
posterior cerebral arteries. Nevertheless the clinical
concept remained current in the 1980s (Turner and
Wyler, 1981).
The Meyer hypothesis
The introduction of the en bloc resection of the ante-
rior temporal lobe by Murray Falconer provided ma-
terial suitable for detailed neuropathological study.
The initial analysis of this material by Cavanagh and
Meyer (1956) is a landmark. It showed that laminar
necrosis was widespread in the temporal cortex. It
also noted the striking clinical correlation between
mesial temporal sclerosis and a history of an early
episode of status epilepticus or prolonged febrile
convulsions (11 out of 17 patients with Ammon's
horn sclerosis, compared with 0 out of 9 without
Ammon's horn sclerosis) that preceded the clini-
cal onset of complex partial seizures by 1 or more
years. This clinical correlation whereby approxi-
mately two-thirds of drug-refractory complex partial
seizure patients with mesial temporal sclerosis give
a history of an early (6 months to 5 years) episode
of status epilepticus or complicated febrile convul-
sions (more than 1 in 24 h, or lasting more than 30
min, or with focal features) has been confirmed in a
large number of neurosurgical reports, e.g. Falconer,
1974; Sagar and Oxbury, 1987; Kim et al., 1990;
Cendes et al., 1993; Mathem et al., 1995; Mathem et
al., 2002, this volume). At the 1954 Marseille Col-
loquium Gastaut (1956) described Meyer as having
proposed that the initial event causes the mesial tem-
poral sclerosis and this lesion, after an appropriate
maturational period, is the focal site of onset of the
complex partial seizures. This causal sequence has
been described as the Meyer hypothesis (Meldrum,
1997).
Primate experimental studies and
activity-dependent cell death
Although several authors had induced generalized
or focal seizures in animals chemically or elec-
trically and looked for pathological changes, none
had successfully addressed the issue of relating
the pathology to local and generalized physiologi-
cal changes. The first studies permitting conclusions
regarding these issues were those of Brierley and
Meldrum in the early 1970s. We monitored a variety
of physiological parameters in adolescent baboons
during prolonged seizures induced by intravenous
bicuculline and studied ischemic cell change in se-
lectively vulnerable neurons in the acutely perfused
brain (Meldrum and Brierley, 1973; Meldrum and
Horton, 1973). We studied the relationship between
physiological changes and acute pathology both in
unmodified seizures and in paralyzed, ventilated an-
imals in which cerebral hypoxia was minimized
(Meldrum et al., 1973). We concluded that, whereas
arterial hypotension and hyperthermia could con-
tribute to cerebellar damage, hippocampal and corti-
cal damage was largely the result of the local seizure
activity itself, with the critical duration of seizure
activity for inducing ischemic cell change lying be-
tween 82 and 120 min. We also used allylglycine to
induce multiple brief seizures (6-63 seizures in 2-11
h) and saw similar selective patterns of ischemic cell
change in the hippocampus, but also saw, with 7-21
day survival, classical appearances of selective neu-
ronal loss, phagocytosis and gliosis in CA1 and CA3
subzones (Meldrum and Brierley, 1972; Meldmm
et al., 1974). The concept that the burst discharges
were the primary (and sufficient) cause of the se-
lective neuronal damage remained controversial, but
was confirmed a decade later when Sloviter (1983)
showed that perforant path stimulation could lead to
damage in the hilus and CA3 (see also Olney et al.,
1983; Sloviter et al., 1996).
Subsequent rodent experiments with generalized
seizures
With the collaboration of Astrid Chapman in Bo
Siesj6's laboratory I subsequently established a sim-
ilar model of status epilepticus induced by bicu-
culline in paralysed ventilated rats, that allowed con-
firmation of the selective pathology occurring in the
hippocampus but also permitted detailed study of
cerebral blood flow and metabolism during seizures
(Meldrum and Nilsson, 1976; Borgstrrm et al., 1976;
Chapman et al., 1977). These studies showed mas-
sive increases in oxygen and glucose consumption
that were, however, fully compensated by the in-
creases in blood flow. It was possible to manipu-
late the critical physiological parameters, confirming
that hyperthermia could exacerbate cerebellar dam-
age but perhaps surprisingly showing that arterial
hypotension and mild hypoxia might be protective,
possibly because they reduced the intensity of the
seizure discharge (Blennow et al., 1978; Nevander et
al., 1985).
Experiments with limbic seizures
We and others showed that limbic seizures induced
by the focal injection of kainate or NMDA (N-
methyl-D-aspartate) into the amygdala or hippocam-
pus in rodents and primates could produce various
patterns of hippocampal and amygdala damage but
with a strong effect on CA3 pyramidal neurons (Ben-
Ari et al., 1980; Menini et al., 1980). NMDA recep-
tor antagonists protect against the remote damage
seen after focal injections of kainate into amygdala
or hippocampus, and most of the damage seen after
seizures induced by systemic kainate (Fariello et al.,
1989; Clifford et al., 1990; Lerner-Natoli et al., 1991;
Jarrard and Meldrum, 1993). Only a limited amount
of the CA3 damage seems to be a direct consequence
of kainate receptor activation; most of the damage is
due to burst activity and NMDA receptor activation
related to seizure spread.
Calcium and mitochondrial swelling
In a series of talks in 1980, I outlined for the first
time the hypothesis that mitochondrial poisoning by
calcium overload was the critical link between the
burst discharges and ischemic cell change (see Mel-
drum, 1981, 1983). This hypothesis derived from the
observations of Schanne et al. (1979) in liver and
Wrogemann and Pena (1976) in muscle. In collabo-
ration with Griffiths and Evans we used the oxalate
pyroantimonate procedure to visualize free calcium
in EM images, during the course of status epilepticus
induced in rats by bicuculline, allylglycine or kainic
acid (Evans et al., 1983, 1984; Griffiths et al., 1983).
In the hippocampus, we observed massive calcium
loading of mitochondria focally in dendritic fields
of CA1 and CA3 after 60-120 min of seizure ac-
tivity, irrespective of the seizure-inducing agent. The
focal dendritic swellings appeared to relate to excita-
tory inputs. We subsequently showed that the grossly
swollen, calcium-loaded mitochondria were visible
after 30 min of seizure-like discharge, but that these
changes were reversible over a 30-60-min period if
the seizure was terminated by diazepam (Evans et
al., 1984; Griffiths et al., 1984). In the hippocampal
dendritic fields, the mitochondrial changes are highly
focal with a large number of mitochondria remaining
morphologically normal. This finding does not ap-
pear to be sufficiently considered in ex vivo studies
of mitochondrial function following seizure activity
(see Cock, 2002, this volume).
Necrotic cell death and apoptotic cell death
Ischemic cell change with its initial stage of mito-
chondrial overload with calcium is the classic form
of necrotic cell death. Apoptotic cell death is the pre-
ferred form of neuronal suicide, but requires energy
in the form of ATP and protein synthesis. It can be
triggered either via cell surface death receptors or
via the mitochondrial release of either cytochrome
c (activating caspase 9, and subsequently the exe-
cutioner caspases) or the apoptosis-inducing factor
(Joza et al., 2001). It is clear that severe and pro-
longed seizure discharges trigger both forms of cell
death, sometimes in the same cell population but
with different time courses or in different cell pop-
ulations. This is seen morphologically in dentate
granule cells with pilocarpine seizures (Covolan et
al., 2000) or repetitive perforant path stimulation
(Sloviter et al., 1996), and with immunocytochem-
istry in CA3 neurons after intra-amygdaloid kainate
(Henshall et al., 1999, 2000). It is clear that dentate
granule cells more readily show apoptosis, and in the
limbic seizure model with intra-amygdaloid kainate
they may show a minimal level of apoptosis when
CA3 neurons are showing severe necrosis. They also
may show increased apoptosis after a single kindling
seizure (Bengzon et al., 1997).
Cumulative effects and'the two hit concept
The conclusion from a large series of experiments
relating to activity-dependent cell death is that the
threshold duration of sustained seizure activity to
produce acute necrotic cell death with an appropriate
selective pattern is around or above 30 min.
Single brief seizures do not cause necrotic cell
death. As shown by Bengzon et al. (2002, this vol-
ume) they may double the natural rate of apoptosis
in certain cell types, such as dentate granule cells,
but they are not documented as inducing selective
patterns of cell loss. Nevertheless, sequences of brief
seizures in various circumstances do appear to be
capable of inducing cell loss. There is a wide range
of possible mechanisms for such an effect.
A single brief seizure is associated with intra-
cellular changes in ionic concentration well outside
the physiological ranges that have multiple conse-
quences with complex time courses (see Holmes
et al., 2002, this volume). Immediate early gene
expression is seen 0.5-4 h following the seizure
and mRNA and protein for a variety of enzymes,
receptors and ion channel subunits can be shown
to be altered subsequently, including for example
COX-2 (see Bazan et al., 2002, this volume). These
changes will alter the vulnerability of an individ-
ual neuron to subsequent 'excitotoxic' stresses and
will modify network responses to future abnormal
inputs. There is of course a wide variety of ex-
perimental evidence that the consequences of brief
episodes of cerebral ischemia or of epileptic activity
or both combined are different if they occur with a
brief separation (in the range 0.5-24 h) compared
with longer intervals. Of course, some functional
consequences of a single seizure may be long-term
and therefore cumulative. These include long-term
changes in gene expression, oxidative damage to
membrane lipids and proteins or damage to nu-
clear or mitochondrial DNA. The changes in gene
expression may result in altered subunit composi-
tion for excitatory or inhibitory receptors with major
effects on synaptic function. GABAA receptor sub-
units are hanged after pilocarpine seizures (Rice et
al., 1996) or after absence seizures (Banerjee et
al., 1998). Altered expression of GABA receptor
subunits may alter epileptogenesis (Poulter et al.,
1999). There may also be changes in ion channel
function as described by Chen et al. (2001) and Ben-
der et al. (2001) after hyperthermic seizures (where
the function of hyperpolarization activated, cyclic-
nucleotide-gated cation channels is altered) and by
Becker et al. (2002, this volume) in the pilocarpine
status model (where spontaneous limbic seizures are
associated with enhanced expression of the cL-1H
subunit of the T-type voltage-sensitive calcium chan-
nel).
Genetic influences
There has long been evidence that different strains
of mice have different seizure susceptibilities. This
applies to almost all seizure models, including elec-
troshock, chemically induced seizures and reflex
epilepsies. These models offer the possibility of de-
tecting single locus differences (see Frankel et al.,
2001 for electroconvulsive shock in inbred strains,
Ferraro et al., 1997 for kainic acid seizures, Fer-
raro et al., 1999 for pentylenetetrazol seizures and
Skradski et al., 1998 for sound-induced seizures).
The altemative approach of using microchip ar-
rays to identify differentially expressed genes com-
paring brain regions in different mouse strains and
the effects of seizures in those strains is described
by Sandberg et al. (2000) and Del Rio and Bar-
low (2002, this volume). This approach shows that
the induction of immediate early genes 60 min af-
ter pentylenetetrazol seizures is closely similar in
129SvEv and C57BL/6 mice and confirms the early
induction of COX2.
Genetic factors also influence the consequences
of seizures. This has been elegantly demonstrated
by Schauwecker (2002, this volume). Kainic acid-
induced cell death in the mouse hippocampus is
strongly modulated by genetic factors (Schauwecker
and Steward, 1997), with some standard mouse
strains C57BL/6, 129/SvJ and BALB/c) being rel-
atively resistant to hilar and pyramidal cell loss
(compared to 129/SvEMS and DBA/2J) in spite of
similar seizure severity. As Dr. Schauwecker shows,
strain crosses suggest that one or more genes with
a dominant effect are responsible for the resistance
to kainate-induced cell death. The complexity of
the genetic factors influencing the development of
Ammon's horn sclerosis following prolonged febrile
convulsions in man can be broken down into several
headings. The tendency to show convulsions during
the course of a febrile illness is under strong genetic
control (Hauser et al., 1985). The extent to which
this gives rise to selective neuronal death is proba-
bly under a separate genetic Control. The nature and
severity of the inflammatory response is probably
independently genetically controlled as is suggested
by the recent study showing specific polymorphisms
in interleukin receptor antagonist genes in patients
with temporal lobe epilepsy (Kanemoto et al., 2000).
There may be additional genetic influences that
influence the subsequent process of epileptogenesis.
This has been clearly demonstrated in the rodent
amygdala kindling model (Mclntyre et al., 1999)
where fast and slow kindling strains have been iden-
tified. Responsiveness to anti-epileptic drug therapy
may also be under genetic control as is suggested by
studies on phenytoin resistance in kindled rats (Ebert
and L6scher, 1999).
TABLE 1
Some consequences of burst firing
1. Increase in [Ca2+]i
2. Activation of phospholipase A2 and phospholipase C
3. Immediate early gene expression
4. Altered kinase activity, altered phosphorylation of enzymes,
receptors, ion channels
5. Altered ion channel function
6. Altered subunit expression of excitatory and inhibitory
receptors
7. Altered synaptic morphology, remodelled dendritic spines
8. Enhanced neurogenesis in dentate
9. Sprouting, altered connectivity
10. Oxidative damage to proteins, lipids and DNA
11. Apoptosis (caspase activation)
12. Necrosis (mitochondrial Ca 2+ poisoning)
Conclusions
The burst firing associated with epileptic discharges
when sustained for 30-120 min leads to selective
neuronal necrosis in hippocampus, amygdala and
cortex that is a consequence of calcium overload-
ing of mitochondria. Some consequences of less
sustained burst firing are listed in Table 1. At the
threshold, there will be effects mediated via actin on
dendritic spine shapes that are indistinguishable from
physiological effects of AMPA and NMDA receptor
activation (Fischer et al., 2000).
Activation of phospholipase 2 initiates the arachi-
donic acid cascade with many complex conse-
quences for gene expression, free radical production
and apoptosis as discussed by Bazan et al. (2002, this
volume). Functional changes occur through altered
phosphorylation of many enzymes and receptors
and through altered expression of receptor subunits.
These and various morphological changes will lead
to significant changes in network function and ex-
citability. These types of change provide one mech-
anism whereby single seizures can have cumulative
effects; the other mechanism is by the progressive
accumulation of oxidative damage to proteins, lipids
and DNA. Understanding these mechanisms allows
the design and testing of a wide variety of neuro-
protective strategies, as discussed in Meldrum (2002,
this volume).
References
Alzheimer, A. (1907) Die Gruppierung der Epilepsie. Alg. Z
Psychiatric, 64: 418-448.
Banerjee, P.K., Tillakaratne, N.J., Brailowsky, S., Olsen, R.W.,
Tobin, AJ. and Snead, O.C. (1998) Alterations in GABAA
receptor alphal and alpha4 subunit mRNA levels in thala-
mic relay nuclei following absence-like seizures in rats. Exp.
Neurol., 154: 213-223.
Bazan, N.G., Tu, B. and Rodriguez de Turco, E.B. (2002) What
synaptic lipid signaling tells us about seizure-induced damage
and epileptogenesis. In: T. Sutula and A. Pitk~inen (Eds.), Do
Seizures Damage the Brain. Progress in Brain Research, Vol.
135. Elsevier, Amsterdam, pp. 175-185.
Becker, A.J., Wiestler, O.D. and Bltimcke, I. (2002) Functional
genomics in experimental and human temporal lobe epilepsy:
powerful new tools to identify molecular disease mechanisms
of hippocampal damage. In: T. Sutula and A. Pitk'anen (Eds.),
Do Seizures Damage the Brain. Progress in Brain Research,
Vol. 135. Elsevier, Amsterdam, pp. 161-173.
Ben-Aft, Y., Tremblay, E., Ottersen, O.P. and Meldrum, B.S.
(1980) The role of epileptic activity in hippocampal and 're-
mote' cerebral lesions induced by kainic acid. Brain Res., 191:
79-97.
Bender, R.A., Brewster, A., Santoro, B., Ludwig, A., Hofmann,
F., Biel, M. and Baram, T.Z. (2001) Differential and age-
dependent expression of hyperpolarization activated, Cyclic
nucleotide-gated cation channel iso-forms 1-4 suggest evolv-
ing roles in the developing rat hippocampus. Neuroscience (in
press).
Bengzon, J., Kokala, Z., Elmer, E., Nanobashvili, A., Kokaia, M.
and Lindvall, O. (1997) Apoptosis and proliferation of dentate
gyms neurons after single and intermittent limbic seizures.
Proc. Natl. Acad. Sci. USA, 94: 10432-10437.
Bengzon, J., Mohapel, P., Ekdahl, C. and Lindvall, O. (2002)
Neuronal apoptosis after brief and prolonged seizures. In: T.
Sutula and A. Pitk~inen (Eds.), Do Seizures Damage the Brain.
Progress in Brain Research, Vol. 135. Elsevier, Amsterdam,
pp. 111-119.
Blennow, G., Brierley, J.B., Meldrum, B.S. and Siesj6, B.K.
(1978) Epileptic brain damage. The role of systemic factors
that modify cerebral energy metabolism. Brain, 101: 687-700.
Borgstr6m, L., Chapman, A.G. and Siesj6, B.K. (1976) Glucose
consumption in the cerebral cortex of rat during bicuculline-
induced status epilepticus. J. Neurochem., 27: 971-973.
Bouchet, C. and Cazauvieilh, M. (Bouchet and Cazauvieilh)
De l'6pilepsie consider6e dans ses rapports avec l'ali6nation
mentale. Arch. G(n. Med., 9: 510-542.
Cavanagh, J.B. and Meyer, A. (1956) Aetiological aspects
of Ammon's horn sclerosis associated with temporal lobe
epilepsy. Br. Med. J., 2: 1403-1407.
Cendes, E, Andermann, E, Dubeau, E, Gloor, P., Evans, A. and
Jones-Gotman, M. et al. (1993) Early childhood prolonged
febrile convulsions, atrophy and sclerosis of mesial structures,
and temporal lobe epilepsy: An MRI volumetric study. Neu-
rology, 43: 1083-1087.
Chapman, A.G. (1985) Cerebral energy metabolism and seizures.
 In: T.A. Pedley and B.S. Meldrnm, Recent Advances in
Epilepsy, Vol. 2. Churchill Livingstone, Edinburgh, pp. 19-
63.
Chapman, A.G., Meldrum, B.S. and Siesj6, B.K. (1977) Cerebral
metabolic changes during prolonged epileptic seizures in rats.
J. Neurochem., 28: 1025-1035.
Chen, K., Aradi, I., Thon, N., Eghbal-Ahmadi, M., Baram, T.Z.
and Soltesz, I. (2001) Persistently modified H-channels after
complex febrile seizures convert the seizure-induced enhance-
ment of inhibition to hyperexcitability. Nat. Med., 7: 1-7.
Clark, L.E, Prout, T.R (1903-1904) Status epilepticus: A clinical
and pathological study in epilepsy. Am. J. Insanity 60: 291-
306, 645-675; 61: 81-108.
Clifford, D.B., Olney, J.W., Benz, A.M., Fuller, T.A. and Zo-
rumski, C.E (1990) Ketamine, phencyclidine, and MK-801
protect against kalnic acid-induced seizure-related brain dam-
age. Epilepsia, 31: 382-390.
Cock, H.R. (2002) The role of mitochondria and oxidative stress
in neuronal damage after brief and prolonged seizures. In: T.
Sutula and A. Pitk~inen (Eds.), Do Seizures Damage the Brain.
Progress in Brain Research, Vol. 135. Elsevier, Amsterdam,
pp. 187-196.
Covolan, L., Smith, R.L. and Mello, L.E. (2000) Ultrastructural
identification of dentate granule cell death from pilocarpine
induced-seizures. Epilepsy Res., 41: 9-21.
Del Rio, J.A. and Barlow, C. (2002) Genomics and neurological
phenotypes: applications for seizure-induced damage. In: T.
Sutula and A. Pitk~inen (Eds.), Do Seizures Damage the Brain.
Progress in Brain Research, Vol. 135. Elsevier, Amsterdam,
pp. 149-160.
Earle, K.M., Baldwin, M. and Penfield, W. (1953) Incisural
sclerosis and temporal lobe seizures produced by hippocampal
herniation at birth. Arch. Neurol. Psychiatry, 69: 27-42.
Ebert, U. and Ltischer, W. (1999) Characterization of phenytoin-
resistant kindled rats, a new model of drag resistant partial
epilepsy: influence of genetic factors. Epilepsy Res., 33: 217-
226.
Evans, M., Griffiths, T. and Meldrum, B.S. (1983) Early changes
in the rat hippocampus following seizures induced by bicu-
culline or L-allylglycine: A light and electron microscope
study. Neuropathol. Appl. Neurobiol., 9: 39-52.
Evans, M.C., Griffiths, T. and Meldrum, B.S. (1984) Kainic acid
seizures and the reversibility of calcium loading in vulnerable
neurons in the hippocampus. Neuropathol. Appl. Neurobiol.,
10: 285-302.
Falconer, M.A. (1968) The significance of mesial temporal scle-
rosis (Ammon's horn sclerosis) in epilepsy. Guy's Hosp. Rep.,
117: 1-12.
Falconer, M.A. (1974) Mesial temporal (Ammon's horn) sclero-
sis as a common cause of epilepsy. Aetiology, treatment and
prevention.. Lancet, 2: 767-770.
Fariello, R.G., Golden, G.T., Smith, G.G. and Reyes, P.E (1989)
Potentiation of kainic acid epileptogenicity and sparing from
neuronal damage by an NMDA receptor antagonist. Epilepsy
Res., 3: 206-213.
Ferraro, T.N., Golden, G.T., Smith, G.G., Schork, N.J., St Jean,
P., Ballas, C., Cho, H. and Berrettini, W.H. (1997) Mapping
murine loci for seizure response to kainic acid. Mammalian
Genome, 8: 200-208.
Ferraro, T.N., Golden, G.T., Smith, G.G., St Jean, P., Schork,
N.J., Mulholland, N., Ballas, C., Schill, J., Buono, R.J. and
Berrettini, W.H. (1999) Mapping loci for pentylenetetrazol-
induced seizure susceptibility in mice. J. Neurosci., 19, 6733-
6739.
Fischer, M., Kaech, S., Wagner, U., Brinkhaus, H. and Matus, A.
(2000) Glutamate receptors regulate actin-based plasticity in
dendritic spines. Nat. Neurosci., 3: 887-894.
Frankel, W.N., Taylor, L., Beyer, B., Tempel, B.L. and White,
H.S. (2001) Electroconvulsive thresholds of inbred mouse
strains. Genomics, 74: 306-312.
Gastaut, H. (1956) Colloque sur les probl~mes d'anatomie nor-
male et pathologique poses par les drcharges 6pileptiques
Marseille. Acta NeuroL Belg., 56:29 (discussion).
Gibbs, E, Lennox, W.G. and Gibbs, E.L. (1934) Cerebral blood
flow preceding and accompanying epileptic seizures in man.
Arch. Neurol. Psychiatry, 32: 257-272.
Griffiths, T., Evans, M.C. and Meldrum, B.S. (1983) Intracellu-
lar calcium accumulation in rat hippocampus during seizures
induced by bicuculline or L-allylglycine. Neuroscience, 10:
385-395.
Griffiths, T., Evans, M.C. and Meldrum, B.S. (1984) Status
epilepticus: The reversibility of calcium loading and acute
neuronal pathological changes in the rat hippocampus. Neuro-
science, 12: 557-567.
Hauser, W.A., Annegers, J.F., Anderson, V.E. and Kurland, L.T.
(1985) The risk of seizure disorders among relatives of chil-
dren with febrile convulsions. Neurology, 35: 1268-1273.
Henshall, D.C., Sinclair, J. and Simon, R.P. (1999) Relationship
between seizure-induced transcription of the DNA damage-
inducible gene GADD45, DNA fragmentation, and neuronal
death in focally evoked limbic epilepsy. J. Neurochem., 73:
1573-1583.
Henshall, D.C., Sinclair, J. and Simon, R.P. (2000) Spatio-
temporal profile of DNA fragmentation and its relationship
to patterns of epileptiform activity following focally evoked
limbic seizures. Brain Res., 858: 290-302.
Holmes, G.L., Khazipov, R. and Ben-Ari, Y. (2002) Seizure-
induced damage in the developing human: relevance of ex-
perimental models. In: T. Sutula and A. Pitkiinen (Eds.), Do
Seizures Damage the Brain. Progress in Brain Research, Vol.
135. Elsevier, Amsterdam, pp. 321-334.
Jarrard, L.E. and Meldrum, B.S. (1993) Selective excitotoxic
pathology in the rat hippocampus. NeuropathoL AplJl. Neuro-
biol., 19: 381-389.
Joza, N., Susin, S.A., Daugas, E., Stanford, W.L., Cho, S.K. and
Li, C.Y.J. et al. (2001) Essential role of the mitochondrial
apoptosis-inducing factor in programmed cell death. Nature,
410: 549-554.
Kanemoto, K., Kawasaki, J., Miyamoto, T., Obayashi, H. and
Nishimura, M. (2000) Interleukin (IL)-ll3, IL-lct, and IL-
l receptor antagonist gene polymorphisms in patients with
temporal lobe epilepsy. Ann. NeuroL, 47: 571-574.
Kim, J.H., Guimaraes, P.O., Shen, M.Y., Masukawa, L.M. and
Spencer, D.D. (1990) Hippocampal neuronal density in tempo-
10
ral lobe epilepsy with and without gliomas. Acta NeuropathoL,
80: 41-45.
Lerner-Natoli, M., Rondouin, G., Relaidi, M., Baldy-Moulinier,
M. and Kamenka, J.M. (1991) N-(2-thienyl)cyclohexyl 1-
piperidine (TCP) does not block kainic acid-induced status
epilepticus but reduces secondary hippocampal damage. Neu-
rosci. Lett., 122: 174-178.
McIntyre, D., Kelly, M.E. and Dufresne, C. (1999) Fast and
slow arnygdala kindling rat strains: comparison of amygdala,
hippocampal, piriform and perirhinal cortex kindling. Epilepsy
Res., 35: 197-209.
Mathern, G.W., Pretorius, J.K. and Babb, T.L. (1995) Influence
of the type of initial precipating injury and at what age it
occurs on course and outcome in patients with temporal lobe
seizures. J. Neurosurg., 82: 220-227.
Mathern, G.W., Adelson, ED., Cahan, L.D. and Leite, J.E (2002)
Hippocampal neuron damage in human epilepsy: Meyer's hy-
pothesis revisited. In: T. Sutula and A. Pitk~inen (Eds.), Do
Seizures Damage the Brain. Progress in Brain Research, Vol.
135. Elsevier, Amsterdam, pp. 237-251.
Meldrum, B.S. (1981) Metabolic effects of prolonged epileptic
seizures and the causation of epileptic brain damage. In:
EC. Rose (Ed.), Metabolic Disorders of the Nervous System.
Pitman, London, pp. 175-187.
Meldrum, B.S. (1983) Metabolic factors during prolonged
seizures and their relation to nerve cell death. Adv. Neurol.,
34: 261-275.
Meldrum, B.S. (1997) The First Alfred Meyer memorial lecture.
Epileptic brain damage: a consequence and a cause of seizures.
Neuropathol. Appl. Neurobiol., 23: 185-202.
Meldrum, B.S. (2002) Implications for neuroprotective treat-
ments, ln: T. Sutula and A. Pitk~inen (Eds.), Do Seizures
Damage the Brain. Progress in Brain Research, Vol. 135.
Elsevier, Amsterdam, pp. 487-495.
Meldrum, B.S. and Brierley, J.B. (1972) Neuronal loss and glio-
sis in the hippocampus following repetitive epileptic seizures
induced in adolescent baboons by allylglycine. Brain Res., 48:
361-365.
Meldrum, B.S. and Brierley, J.B. (1973) Prolonged epileptic
seizures in primates: ischaemic cell change and its relation to
ictal physiological events. Arch. Neurol., 28: 10-17.
Meldrum, B.S. and Horton, R.W. (1973) Physiology of status
epilepticus in primates. Arch. Neurol., 28: 1-9.
Meldrum, B.S. and Nilsson, B. (1976) Cerebral blood flow and
metabolic rate early and late in prolonged epileptic seizures
induced in rats by bicuculline. Brain, 99: 523-542.
Meldrum, B.S., Vigoroux, R.A. and Brierley, J.B. (1973) Sys-
temic factors and epileptic brain damage. Prolonged seizures
in paralysed artificially ventilated baboons. Arch. Neurol., 29:
82-87.
Meldrum, B.S., Horton, R.W. and Brierley, J.B. (1974) Epilep-
tic brain damage in adolescent baboons following seizures
induced by allylglycine. Brain, 97: 417-428.
Menini, C., Meldrum, B.S., Riche, D., Silva-Comte, C. and
Stutzmann, J.M. (1980) Sustained limbic seizures induced by
intraamygdaloid kainic acid in the baboon: symptomatology
and neuropathological consequences. Ann. Neurol., 8: 501-
509.
Nevander, G., Ingvar, M., Auer, R.N. and Siesjo, B.K. (1985)
Status epilepticus in well-oxygenated rats causes neuronal
necrosis. Ann. Neurol, 18: 281-290.
Olney, J.W., De Gubareff, T. and Sloviter, R.S. (1983) 'Epileptic'
brain damage in rats induced by sustained electrical stimula-
tion of the perforant path. II. Ultrastructural analysis of acute
hippocampal pathology. Brain Res. Bull., 10:699-712.
Peiffer, J. (1963) Morphologische aspekte der epilepsien. Patho-
genetische, Pathogisch-Anatomische und Klinische Probleme
der Epilepsien, Springer Verlag, Berlin, pp. 1-185.
Penfield, W. and Jasper, H. (1954) Epilepsy and the Functional
Anatomy of the Human Brain. Churchill, London, pp. 1-896.
Penfield, W., von Sfintha, K. and Cipriani, A. (1939) Cerebral
blood flow during induced epileptiform seizures in animals
and man../. Neurophysiol., 2: 257-267.
Pfleger, L. (1880) Beobachtungen tiber Schrumpfung und
Sklerose des Ammonshorns bei Epilepsie. Alg. Z. Psychia-
trie, 36: 359-365.
Poulter, M.O., Brown, L.A., Tynan, S., Willick, G., William,
R. and McIntyre, D.C. (1999) Differential expression of al-
phal, alpha2, alpha3 and alpha5 GABAA receptor subunits in
seizure-prone and seizure-resistant rat models of temporal lobe
epilepsy. J. Neurosci., 19: 4654-4661.
Rice, A., Rafiq, A., Shapiro, S.M., Jakoi, E.R., Coulter, D.A. and
De Lorenzo, R.J. (1996) Long-lasting reduction of inhibitory
function and gamma-aminobutyric acid type A receptor sub-
unit mRNA expression in a model of temporal lobe epilepsy.
Proc. Natl. Acad. Sci. USA, 93: 9665-9669.
Sagar, H.J. and Oxbury, J.M. (1987) Hippocampal neuron loss
in temporal lobe epilepsy: Correlation with early childhood
convulsions. Ann. Neurol., 22: 334-340.
Sandberg, R., Yasuda, R., Pankratz, D.G., Carter, T.A., Del Rio,
J., Wodicka, L., Mayford, M., Lockhart, D.J. and Barlow, C.
(2000) Regional and strain-specific gene expression mapping
in the adult mouse brain. Proc. Natl. Acad. Sci. USA, 97:
11038-11043.
Schanne, EA.X., Kane, A.B., Young, E.E. and Farber, J.L.
(1979) Calcium dependence of toxic cell death: a final com-
mon pathway. Science, 206: 700-702.
Schauwecker, EE. (2002) Complications associated with genetic
background effects in models of experimental epilepsy. In: T.
Sutula and A. Pitk~inen (Eds.), Do Seizures Damage the Brain.
Progress in Brain Research, Vol. 135. Elsevier, Amsterdam,
pp. 139-148.
Schauwecker, EE. and Steward, O. (1997) Genetic determinants
of susceptibility to excitotoxic cell death: Implications for
gene targeting approaches. Proc. Natl. Acad. Sci. USA, 94:
4103-4108.
Scholz, W. (1951) Die Krampfschiidigungen des Gehirns.
Springer, Berlin.
Scholz, W. (1959) The contribution of patho-anatomical research
to the problem of epilepsy. Epilepsia, 1: 36-55.
Shorvon, S. (1994) Status Epilepticus. Cambridge University
Press, Cambridge.
Skradski, S.L., White, H.S. and Ptacek, L.J. (1998) Genetic

mapping of a locus (mass 1) causing audiogenic seizures in
mice. Genomics, 49: 188-192.
Sloviter, R.S. (1983) 'Epileptic' brain damage in rats induced by
sustained electrical stimulation of the perforant path, I. Acute
electrophysiological and light microscopic studies. Brain Res.,
10: 675-697.
Sloviter, R.S., Dean, E., Sollas, A.L. and Goodman, J.H. (1996)
Apoptosis and necrosis induced in different hippocampal neu-
ron populations by repetitive perforant path stimulation in the
rat. J. Comp. Neurol., 366: 516-533.
Sommer, W. (1880) Erkrankung des Ammonshornes als aetiolo-
gisches Moment der Epilepsie. Arch. Psychiat. Nervenkrank.,
10: 631-675.
Spielmeyer, W. (1927) Die Pathogenese des epileptischen
11
Krampfes. Z. Ges. NeuroL Psychiatrie, 109: 501-520.
Spielmeyer, W. (1930) Anatomic substratum of the convulsive
state. Arch. NeuroL Psychiatry, 23: 869-875.
Turner, D.A. and Wyler, A.R. (1981) Temporal lobectomy for
epilepsy: mesial temporal herniation as an operative and prog-
nostic finding. Epilepsia, 22: 623-629.
Veith, G. (1960) On the pathogenesis of perinatal brain lesions.
Geburtsh. Frauenheilk., 20: 905-909.
Vogt, C. and Vogt, O. (1922) Erkrankungen der Groszhirnrinde
im Lichte der topistik Pathoklise, und Pathoarchitektonik. J.
PsychoL Neurol. (Leipzig), 28: 1-171.
Wrogemann, K. and Pena, S.D.J. (1976) Mitochondrial calcium
overload: a general mechanism for cell-necrosis in muscle
diseases. Lancet, 1: 672-674.
T. Sutula and A. Pitkanen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 2

Are seizures harmful: what can we learn

from animal models?

Andrew J. Cole *, Sookyong Koh and Yi Zheng

Epilepsy Research Laboratory, Massachusetts General Hospital and Department of Neurology, Harvard Medical School,
Boston, MA 02114, USA

Abstract: Epilepsy is a brain disease that requires distributed neuronal networks for its expression. Several characteristics
of epilepsy, including its natural history, the latency between an initial insult and the first manifestation of seizures, the
complex interaction of seizures with development as a function of developmental stage, the modulating effect of systemic
physiological responses, and the fact that seizures are ultimately defined by a combination of electrical and behavioral
criteria all suggest that epilepsy should ideally be studied in an intact whole animal preparation. Such preparations
offer the ability to study acute and chronic changes in brain structure and function after single or repeated seizures.
Animal models have major limitations, however, including strain specificity, difficulty in isolating potentially confounding
variables, a relative lack of accessible higher cortical functions, such as language and abstract processing, and shorter
lifespans that may be insufficient to allow the complete expression of seizure-related injury. Information we have learned
from animal studies includes a broad understanding of the chemical, molecular and anatomic consequences of seizures,
including their temporal and spatial relationships to each other, and information on the consequences of seizures as a
function of development. Recent studies have cast light on potential mechanisms of resistance to seizure-induced injury
in the developing brain. In the future, we can anticipate that animal models will continue to be useful, especially when
whole-animal preparations are used to generate material for detailed in vitro examination.

Introduction such as a h i p p o c a m p a l or cortical slice. Furthermore,

Epilepsy is a brain disease, and epileptic seizures
result from abnormal paroxysmal activity o f popu-
lations o f neurons. The careful reader will note that
by definition epilepsy and epileptic seizures cannot
be conceptualized as disorders o f single neurons per
se. It is perhaps less clear whether the disease state
and its primary s y m p t o m can be successfully reca-
pitulated in an isolated array of neurons, either a
plate o f cultured cells or an ex vivo preparation,
* Correspondence to: A.J. Cole, MGH Epilepsy Service,
VBK 830, Massachusetts General Hospital, Fruit Street,
Boston, MA 02114, USA. Tel.: -t-1-617-726-3311; Fax:
+1-617-726-9250;
E-maih cole.andrew @mgh.harvard.edu
epilepsy, a disorder manifest by recurrent unpro-
voked seizures, is by definition a chronic disease,
or at least a disease that manifests itself over a pe-
riod o f time, not simply at an instant. Reductionist
models typically are acute, in the case of ex vivo
preparations, or developmentally disturbed, in the
case o f cultured cells. Moreover, epilepsy occurs in
the context of ongoing physiological processes such
as perfusion, oxygenation, glucose metabolism, acid-
base regulation, thermoregulation, endocrine modu-
lation and the like, some of which m a y have critical
interactions with the disease state itself. W h i l e the
confounding influences of normal physiological re-
sponses m a y make the interpretation of whole animal
experiments difficult, their absence m a y represent an
important and under-recognized limitation of reduc-
tionist approaches. For these reasons, it seems that
14

TABLE 1
The spectrum of animal models
Electrical stimulation Maximal electroconvulsiveseizures (MECS)
Perforant-path stimulation (PPS)
Kindling
Chemoconvulsants Systemic Kainate
Pilocarpine
Picrotoxin
Bicuculline
Penicillin
Intracerebral Kainate
Pilocarpine
Picrotoxin
Bicuculline
Tetanus toxin
Pertussis toxin
Topical Alumina cream
Penicillin
Physical models Hyperthermia
Freeze lesions
Photic stimulation (Papiopapio)
Auditory stimulation (Swiss DBA2 mice)
Genetic models Spontaneous Genetically epilepsy-prone rat strain (GEPRS)
Strasbourg rats (Absence)
Epileptic beagles
Mutant Stargazer
Lurcher
Totterer
Mocha
Transgenic
Knockout
Spontaneous seizure models Post-kindling
Post-kainate
Post-pilocarpine

the most effective way to model epilepsy should be
to utilize whole animal preparations. And indeed a
considerable body of epilepsy research work has uti-
lized animal models, leading to many fundamental
insights. In this chapter, we will review some of the
important uses of animal models, discuss their limi-
tations, and consider the role of animal models going
forward. In particular, we will focus on the issue of
whether a single or initial seizure is harmful, and
how it might relate to the development of epilepsy.
The spectrum of animal models
A wide variety of animal models of epilepsy and
epileptic seizures exist. The major models are listed
in Table 1. The tremendous diversity of available
animal models offers both opportunity and chal-
lenge. Many of the models are acute, and many
are, in fact, models of status epilepticus which may
have important differences from isolated seizures.
Genetic models often have phenotypes that are com-
plex, with seizures as only one manifestation of
a more pervasive structural, functional or devel-
opmental problem. Strain differences in responses
to epileptogenic or convulsant stimuli make com-
parisons between animals from different laborato-
ries difficult, but may offer opportunity to identify
pro- or anti-epileptic genes using differential screen-
ing approaches (Schauwecker and Steward, 1997;
Sandberg et al., 2000; Schauwecker, 2000). Chemo-

TABLE 2
Advantages and limitationsof animal models
Advantages
• Allowassessment of seizure causes and consequences in an
intact preparation
• Survivaltime can be adjusted to examine temporal evolution
of post-ictal changes
• Developmentalstage can be selected, and events at one point
in developmentcan be studied with respect to effects
manifested at a later stage
• Repeated events can studied (e.g. kindling)
• Effects of physiologicalmilieu are integrated
Limitations
• Manyoffer snapshot picture of ictal/post-ictal events
• Manyresult in status epilepticus, which may not adequately
model typical epilepsy
• Straindifferences in seizures and responses highlight the
difficulties in generalizingfindings in a specific model
• Effects of physiologicalmilieu are integrated
convulsants may have systemic effects that are ei-
ther completely independent from seizures, or even
more problematic, result in seizures only as a sec-
ondary consequence to injury or functional distur-
bance. Finally, some of the important correlates of
seizures and epilepsy, such as memory loss, behav-
ioral changes, and secondary psychiatric disturbance
are at best difficult to measure in epileptic animals.
By contrast, all animal models share the property of
having anatomically intact central nervous systems
with functional connections and measurable efferent
responses. A n i m a l s can be developmentally moni-
tored, and prolonged survival is possible to allow
examination of delayed effects of specific stimuli or
treatment. Most recently, the ability to manipulate
the genetic endowment of model animals has opened
the door to allowing examination of complex inter-
actions between genes and behavior, between nature
and nurture. The advantages and disadvantages of
animal models are listed in Table 2.
In the remainder of this chapter, we will identify
specific situations where animal models should be
particularly useful, and offer examples of insights
that have come from animal models that might not
have been available elsewhere. Several situations in
which animal models have an obvious utility can be
defined and are listed in Table 3.
15
TABLE 3
Situations in which whole-animalmodels are required
• To examine transductionof an input function into an output
function without requiring knowledge of the mechanism
• To examine systems level physiology where distant or
unknown connectionsmay have a role
• To study anatomic patterns of responses
• To study the relationship of anatomic findings,e.g. injury,
plasticity to specific molecular markers
• To study developmentallyregulated anatomic, biochemical
and functional events
• To study the effects of chronic or recurrent seizures
• To study the effects of specific genetic manipulationson
phenotype
• To examine the influenceof physiologicalmilieu on seizures
and their consequences
• To generate biological material for examinationafter seizures
• To confirm findingsfrom reductionist systems in the
scaled-up whole animal situation
Insights from animal models
Seizures trigger a cascade of biochemical, anatomic
and functional changes in the central nervous system
It has long been recognized that critical aspects of
brain development are activity-dependent. For ex-
ample, the pioneering experiments of Hubel and
Weisel established the critical role of visual input in
the post-natal organization of the visual system, in-
cluding the establishment of cortical columns, prun-
ing of redundant connections, and establishment of
the critical property of surround inhibition (Hubel
and Wiesel, 1970; Hubel et al., 1977). Later stud-
ies have demonstrated that cortical plasticity, both
functional and anatomic, occurs in response to al-
tered afferent activity, e.g. amputation or fusion of
digits in primates (Merzenich et al., 1984; Allard
et al., 1991). Perhaps surprisingly, our appreciation
that brief seizures trigger long-term changes in CNS
properties is relatively recent. Fig. 1A summarizes,
in a schematic form, some of the events that occur af-
ter seizures. A critical point is that each of these ob-
servations came from animal studies. As an example,
consider the observation that brief seizures induced
by pentylenetetrazole or maximal electroconvulsive
treatment results in rapid and transient expression of
a large class of immediate early genes, many encod-
ing transcription factors. While cell culture studies of
16

Time Course of Biochemical, Anatomic and

Functional Changes After Seizures
(a) S u s c e iflbilit to
recur 'ent se z u r e s
(week to m, ,nths)
O - - - - - ' 4 ) N e u "ogene ds
(da~ s- wee ts)
Be] laviot~ J Def'N its
(61 tours- montl ~)
A dm leuro~ al Cell Loss
hour - 14 q lays)

0=== ='=0 Glial Activa ion

(6 hol lrs - 5 lays)

P r o t i inexp] ession e.g.

0" A
v S o n ~ tostafi ~, NPI
(2 ho ]rs - 3 l a y s )
. K i n a ~e Acti ration
- (5 mi nutes I o 2A h,,urs)

-4
E arly G me Ac tivafio
(.J: m t n - 6 horn s)
; a + + I m Infl ax
0"
rnse~, min~t .~s) I
I
10-3 10-2 lO-I 1 10 1~ 10 ~ 10 4 1 0 I~ 10 9 1010

1 min 1 hour 1 day 1 week

Time (seconds)

Time Course of Biochemical, Anatomic and

Functional Changes After Seizures
S u s c e )tibilit tto
(b)
recur *nt se zures
(week ; to m~ ~uths)
O - - - - - - 4 i Neu rogem iis
( d a s - we, ~s)
Be tavior IDefie Is
(6 ours, montt s)
A ~eurot al Cel Loss
v v
6 horn s - 141 ays)

0-----4 Glial~ ictival Ion

(6 ho, irs - 5 ~lays)
FCOR
2 Som~ t,ostati n, NP~
(2 ho Jrs, 3 Ja3~)
~atil)|l
ECT
ltlJles o 24 h ~ c s l
}lR ~{lkatio
6 hm/ s}
(a++ |,m hfft p~.
It"
I - { n~, t- - . i , l q ~ s!i I
10 a 10 -2 10 "~ 1 10 10 10 3 I0 a tO~ 10 9 1010

1 min 1 hour I day I week

Time (seconds)
Fig. 1. (A) Diagrammatic representation of some of the biochemical, anatomic and functional changes seen after seizures in a variety of
electrical and chemoconvulsant animal models. (B) Diagrammatic representation of changes seen in ECT models (indicated in green).
Note that many of the lasting changes have not been reported after single or repeated ECT.
 17

(a) Parallel Model ]

Seizures
[ I
Sprouting Injury Gliosis Neurogenesis Functional
Change

Series Model
(b)
Seizures

Iv wy

G] psis

Spro ating

Neure enesis

Functional Change
Fig. 2. Theoreticalrepresentationof the relationship between various documentedchanges occurring after seizures. (A) Parallel model
indicates that specific consequences of seizures may occur independently of each other. (B) Series model represents the alternative
hypothesisthat later latencychanges depend on earlier events for their expression.

activity-dependent gene expression could have sug-
gested this phenomenon, only whole animal studies
allowed us to appreciate the extraordinary anatomic
specificity of this response (Morgan et al., 1987;
Saffen et al., 1988; Cole et al., 1989). Similarly,
observation of a variety of events including kinase
activation (Murray et al., 1998, 1999; Anderson et
al., 2000), neuropeptide regulation (Gall et al., 1990;
Baraban et al., 1993; Vezzani et al., 1999; Madsen et
al., 2000), cell loss (Margerison and Corsellis, 1966;
Corsellis and Meldrum, 1976; Schwob et al., 1980;
Gloor, 1991; Sloviter, 1994), mossy fiber sprouting
(Sutula et al., 1988; Cavazos et al., 1991; Wuarin
and Dudek, 1996; Patrylo et al., 1999), enhanced
neurogenesis (Parent and Lowenstein, 1994), altered
receptor expression, chronic behavioral deficits, and
altered susceptibility to recurrent seizures are all the
result of animal studies. With the exception of the
latter phenomenon (see next section), it remains un-
clear whether any or all of these effects of a single
seizure contribute to the development of epilepsy.
Moreover, it is unclear whether whatever contribu-
tion they may have is organized in series or in
parallel (Fig. 2). Obviously this issue has critical
therapeutic implications.
Early life seizures increase susceptibility to later life
seizures and neuronal injury
An important observation from animal studies is that
seizures early in life result in a long-term suscep-
tibility to recurrent seizures with resultant neuronal
injury and behavioral deficits later in life. This find-
ing has been established in multiple laboratories
using a variety of animal models including repeated
kainate administration (Koh et al., 1999), early life
hyperthermic seizures (Dube et al., 2000), and early-
life fluroythyl-induced status (Holmes et al., 1998;
18
Schmid et al., 1999). Each of these models shares
the property that anatomic injury is difficult or im-
possible to detect after the initial insult, suggesting
that the resulting susceptibility is the consequence of
a functional change in network properties.
These studies raise several important questions:
(1) What is the transduction process that results in
enhanced seizure-susceptibility later in life?
(2) Why are juvenile animals resistant to seizure-
induced injury?
(3) Is there a critical point in development before
or after which seizures no longer have this
long-term effect?
Early-life seizures alter synaptic connectivity in
developing brain
One hypothesis, unproven, is that early life seizures
may stabilize immature synaptic connections nor-
mally destined for removal, thereby resulting in an
intrinsically hyperexcitable brain in adulthood. Ev-
idence for this concept comes from Grigonis and
Murphy (1994) who showed that topical applica-
tion of penicillin to immature rabbit visual cortex
resulted in persistence of the immature pattern of
callosal projections without the pruning that occurs
in normal development. By contrast, Swann and col-
leagues have found that early seizures resulted in
a reduction in dendritic spine density, suggesting
an alternative substrate for lasting functional change
(Jiang et al., 1998). Similar findings have been re-
ported in human surgical tissue (Multani et al., 1994)
and in chronic animal seizure models (Willmore et
al., 1980) as well.
Resistance to neuronal injury in the juvenile brain
Many studies have established that in the rodent,
seizures prior to P21 result in little, if any, de-
tectable injury. In the adult brain, we have observed
that treatment with nerve growth factor attenuates
hippocampal injury after kainate-induced seizures
(Weiss et al., 1995). Ambient levels of NGF are
maximal during development, peaking at P14-15.
Because we have no data on this point, this question will not be
discussed.
We therefore hypothesized that high ambient levels
of NGF may prevent seizure-induced neuronal in-
jury in the immature brain. To test this hypothesis,
we selectively lesioned cholinergic neurons bearing
the low-affinity neurotrophin receptor, p75ntfr using a
selective immunotoxin, 192-IgG-saporin. In prelimi-
nary experiments, rats treated with 192-IgG-saporin
on P7 that showed complete loss of basal fore-
brain cholinergic neurons and marked depletion of
acetylcholinesterase stained terminals in hippocam-
pus also demonstrated severe selective cell loss in
CA3 after subsequent treatment with kainate on P16.
By contrast, animals treated with saline on P7 and
animals in which the saporin treatment was un-
successful in depleting cholinergic neurons had no
kainate-induced hippocampal injury (Fig. 3). While
these experiments are consistent with our hypothesis,
b e c a u s e p75ntfr binds several neurotrophins including
BDNF, NT-3 and NT-4/5 it remains unclear whether
high levels of NGF are critical to neuronal survival
in this experimental paradigm. Moreover, in light of
the fact that seizures induce NGF expression, and the
findings of Grigonis and Murphy described above,
we must consider the possibility that enhanced neu-
ronal survival may have negative consequences with
respect to later seizure susceptibility.
Are seizures neuroprotective ?
The preceding discussion emphasizes the commonly
held belief that seizures are harmful. Seizure-induced
phenomena, such as neuronal loss, synaptic remod-
eling and aberrant neuronal proliferation, especially
in the context of decreased performance on behav-
ioral testing and enhanced susceptibility to recurrent
seizures would seem to support this notion. Long
clinical experience and recent experimental data,
however, have challenged this axiom. For exam-
ple, for many years psychiatrists have been treating
patients with refractory depression with electrocon-
vulsive seizures, often with gratifying results. There
is little to suggest that ECT, as typically applied
causes significant anatomic injury or behavioral dys-
function, although patients who receive hundreds of
treatments may provide anecdotal exceptions. Sug-
gestions that ECT causes progressive brain atrophy
and hippocampal changes have not been supported
by careful clinical studies (Sheline et al., 1999; Ende
 19

DNAF

CV

Saline - Kainate Saporin - Kainate

Fig. 3. Neuronal injury after kainate-induced seizures in P15 rats. DNAF indicates DNA fragmentation, a marker of neuronal injury. CV
indicates Cresyl violet Nissl staining showing neuronal integrity. Saline-Kainate indicates animals pretreated with intraventricular saline
on P7, prior to kainate on P15. Saporin-Kainate indicates animal treated with 192-IgG-Saporinintraventricularlyon P7 prior to kainate
on PI5. Note injury and cell loss in CA3 after saporin treatment.

et al., 2000) which have concluded that depression it-
self and its pharmacological treatment are confound-
ing variables with a more powerful effect on struc-
ture and function. By contrast, animal studies during
development have pointed out injurious effects of
ECT (Wasterlain and Plum, 1973; Jorgensen et al.,
1980) and in experimental systems electroconvulsive
seizures have been shown to induce abnormal gene
expression (Morgan et al., 1987; Saffen et al., 1988;
Cole et al., 1990, 1997), kinase activation (Baraban
et al., 1993), protein synthesis (Cole et al., 1990; Gall
et al., 1991; Bhat et al., 1993), and neurotransmit-
ter receptor expression (Bergstrom and Kellar, 1979;
Kellar et al., 1981; Lerer, 1984; Green et al., 1986)
(See Fig. 1B). These observations suggest that many
of the early events occurring after seizures, while
perhaps necessary, are not sufficient to mediate later
emergence of neuronal injury, synaptic reorganiza-
tion, and network dysfunction. They also emphasize
the possibility that many of the events occurring af-
ter seizures are arranged in parallel, rather than in
series (see Fig. 2A,B). Whether seizures are harmful,
neutral or beneficial may depend on seizure type,
e.g. brief electrically induced generalized attacks oc-
curring in controlled clinical circumstances versus
spontaneous seizures of variable duration occurring
in an uncontrolled environment, or host characteris-
tics, such as the presence of underlying neurological
(as opposed to psychiatric) dysfunction or disease. In
any case, these observations emphasize the need for
cautious and unbiased interpretation of the observa-
tions gathered from experimental systems.
Recent experimental data have also challenged
the notion that seizures are harmful. For example,
Greenberg and colleagues (Sasahira et al., 1995)
found that repeated bicuculline seizures separated by
1, 3, 5 or 7 days conferred a time-dependent pro-
tective effect against hippocampal injury induced by
subsequent seizures in the CA3c sector of the hip-
pocampus. They coined the term 'epileptic tolerance'
20
to describe this phenomenon, and suggested that en-
hanced expression of heat-shock proteins caused by
the initial seizure might be responsible for subse-
quent protection against recurrent seizure-induced
injury. Their study suggested, however, that the pro-
tection was brief and of uncertain clinical relevance.
Mclntyre and colleagues (Kelly and Mclntyre, 1994)
have shown that kindling stimulation protects against
kainate seizure-induced injury for up to 28 days, and
Penner and colleagues have confirmed this result in
a rapid kindling paradigm (Penner et al., 2001). Sim-
ilarly, Gale and colleagues have reported in abstract
form that repeated electroconvulsive seizures protect
against kainate-seizure induced injury in experimen-
tal animals. ECT has been shown to cause declining
seizure severity with repeated administration (Cole
et al., 1990), perhaps the behavioral analogue of
the relative refractory period described in synaptic
physiology. It will therefore be important to review
Gale's work critically to determine the duration of
protection conferred.
Transgenic and knockout experiments
The ability to determine the genetic endowment of
experimental animals has offered an important al-
ternative to classical pharmacology for hypothesis
testing. Rather than relying on specific agonists
or antagonists, one can now directly block either
the synthesis or activity of specific molecules and
then examine the resultant phenotype. These stud-
ies may be confounded by at least two practical
issues. First, animals born with altered genomes may
utilize compensatory mechanisms to overcome the
induced deficits, or they may develop abnormally in
a manner that renders hypothesis testing impossible
or irrelevant. The extreme example, of course, is the
embryonic-lethal transgene or knockout. More subtle
is the situation where alternative isoforms of specific
gene products serve to partially or completely com-
pensate for the genetic alteration. To some extent,
the development of inducible expression systems
for transgenes and conditional knockouts may par-
tially overcome these limitations. Second, strain dif-
ferences in genetic background may, in fact, have
more influence on phenotype than the targeted ge-
netic alteration itself. A graphic example of this
phenomenon came from studies of p53 knockout
animals. Several groups of investigators found that
p53 knockout animals were protected against kainate
seizure-induced neuronal injury (Morrison et al.,
1996). Another group, however, using p53 knock-
out animals from a different source, were unable
to reproduce that result (Schauwecker and Steward,
1997). It subsequently became apparent that the dif-
ference in the two studies was the result of strain
differences in the genetic backgrounds of mice used
to develop the knockout lines.
Animal models in the new millennium
As we move into the new millennium, a new trend
in animal models is emerging that promises to of-
fer powerful insights into the cause and effect of
seizures. These models share the property that in
vivo and in vitro techniques are combined to allow
experiments that could not be conducted in either
environment exclusively. While these strategies are
perhaps best thought of as evolutionary, rather than
revolutionary, they deserve special mention none the
less. Three experimental paradigms provide illustra-
tions of these approaches.
Use of biological material from genetically
manipulated animals for in vitro study
Perhaps one of the most valuable uses of genetic ma-
nipulation results from the ability to harvest biolog-
ical material from manipulated animals for in vitro
studies. For example, recent studies have demon-
strated that conditional knockout of the neuronal
MAP kinase kinase (MEK) gene in hippocampus
alters the characteristics of long-term potentiation as
studied in hippocampal slices (Atkins et al., 1998;
Selcher et al., 1999; Schafe et al., 2000) (Kelle-
her, personal communication). Similar approaches
are now routinely undertaken to examine the effect
of genetic manipulation on in vitro physiology us-
ing slice preparations and patch clamp techniques,
and on neuronal viability and biochemical responses
using primary neuronal cell culture techniques.
Receptor alterations in epileptic animals
Another example of the combination of in vitro
and in vivo techniques comes from the work of

Coulter and colleagues. These investigators have
developed spontaneously epileptic animals using
the pilocarpine model. After documenting recurrent
seizures, they have prepared hippocampal slices and
documented physiological abnormalities, especially
in the properties of G A B A receptors (Gibbs et al.,
1997). They have then gone on to use RT-PCR tech-
niques on single cells from these slices to document
changes in the specific G A B A receptor subunits ex-
pressed in epileptic animals as compared to controls
(Brooks-Kayal et al., 1998). Interestingly, an exten-
sion of this study to examine G A B A receptor subunit
expression in animals after the initial seizure, but be-
fore the development of spontaneous seizures could
provide insight into the fundamental question before
this meeting, whether a single seizure is harmful.
Microarray analysis o f epileptic animals
A third example of the use of in vivo and in vitro
techniques in combination illustrates the idea that
this approach is really an evolutionary extension of
older analytical methods where in situ techniques
were used to characterize molecular responses to
seizures. Microarray analysis of cDNAs generated
from epileptic material offers an open-ended method
for documenting altered gene expression that re-
quires little de facto knowledge of the targets to be
examined. In its earliest incarnations, 2-D get elec-
trophoresis of proteins and differential screening of
cDNA libraries led to the identification of previously
unknown molecular responses to abnormal activity.
For example, the finding that Homer (Brakeman
et al., 1997), GRIP (Dong et al., 1997) and ARC
(Lyford et al., 1995) were regulated after seizures
came from a differential screening strategy. Homer
and GRIP are PDZ-domain containing proteins that
interact with metabotropic- and AMPA-type gluta-
mate receptors, respectively. ARC, by contrast, is
expressed mainly in dendrites where it may mediate
synaptic plasticity. Each of these proteins has the
potential to mediate changes in synaptic efficiency
that are long-lasting. More recently, this approach
has been extended by the use of microarray analysis
in which thousands of known and unknown tran-
scripts can be quantitatively assessed in response to
seizures and compared to controls to look for both
up- and down-regulation of activity-dependent tran-
21
scripts (Sandberg et al., 2000). Dingledine has used
this approach to examine differences between early
and late transcriptional responses, whereas Lowen-
stein and colleagues have concentrated on examining
transcripts that are regulated both during develop-
ment and after seizures. Applications of this technol-
ogy, which starts with the whole animal and quickly
moves to the in vitro environment will be limited
only by the arrays of targets available and the imagi-
nation of investigators.
References
Allard, T., Clark, S.A., Jenkins, W.M. and Merzenich, M.M.
(1991) Reorganization of somatosensory area 3b representa-
tions in adult owl monkeys after digital syndactyly. J. Neuro-
physiol., 66(3): 1048-1058.
Anderson, A.E., Adams, J.E, Varga, A.W., Selcher, J.C., Feng,
J., Trzaskos, J.M. and Sweatt, J.D. (2000) Essential role for
ERK MAPK activation and K+ channel phosphorylation in the
kainate model of epilepsy. Soc. Neurosci. Abstr., 26:1836.
Atkins, C.M., Selcher, J.C., Petraitis, J.J., Trzaskos, J.M. and
Sweatt, J.D. (1998) The MAPK cascade is required for mam-
malian associative learning. Nat. Neurosci., 1(7): 602-609.
Baraban, J.M., Fiore, R., Sanghera, J.S., Paddon, H.B. and
Pelech, S. (1993) Identification of p42 mitogen-activated pro-
tein kinase as a tyrosine kinase substrate activated by maximal
electroconvulsive shock in hippocampus. J. Neurochem., 60:
330-336.
Bergstrom, D.A. and Kellar, K.J. (1979) Effect of electrocon-
vulsive shock on monoaminergic receptor binding sites in rat
brain. Nature, 278: 464-466.
Bhat, R.V., Tansk, F.A., Baraban, J.M., Mains, R.E. and Eipper,
B.A. (1993) Rapid increases in peptide processing enzyme
expression in hippocampal neurons. J. Neurochem., 61(4):
1315-1322.
Brakeman, ER., Lanahan, A.A., O'Brien, R., Roche, K., Barnes,
C.A., Huganir, R.L. and Worley, EE (1997) Homer: a pro-
tein that selectively binds metabotropic glutamate receptors.
Nature, 386(6622): 284-288.
Brooks-Kayal, A.R., Shumate, M.D., Jin, H., Rikhter, T.Y.
and Coulter, D.A. (1998) Selective changes in single cell
GABA(A) receptor subunit expression and function in tempo-
ral lobe epilepsy. Nat. Med., 4(10): 1166-1172.
Cavazos, J.E., Golarai, G. and Sutula, T.E (1991) Mossy fiber
synaptic reorganization induced by kindling: time course
of development, progression, and permanence. J. Neurosci.,
11(9): 2795-2803.
Cole, A.J., Saffen, D.W., Baraban, J.M. and Worley, EE (1989)
Rapid increase of an immediate early gene messenger RNA in
hippocampal neurons by synaptic NMDA receptor activation.
Nature, 340: 474-476.
Cole, A.J., Abu Shakra, S., Saffen, D.W., Baraban, J.M. and
Worley, P.E (1990) Rapid rise in transcription factor mRNAs
22
in rat brain after electroshock-induced seizures. J. Neurochem.,
55: 1920-1927.
Cole, A.J., Koh, S., Liu, Z. and Holmes, G.L. (1997) DNA frag-
mentation in developing brain after kainate-induced seizures.
Epilepsia, 38(Suppl. 8): 40.
Corsellis, J.A.N. and Meldrum, B.S. (1976) Epilepsy. In: W.
Blackwood and J.A.N. Corsellis (Eds.), Greenfield's Neu-
ropathology, 3 edn. Edward Arnold, London, pp. 771-795.
Dong, H., O'Brien, R.J., Fung, E.T., Lanahan, A.A., Worley,
P.F. and Huganir, R.L. (1997) GRIP: a synaptic PDZ domain-
containing protein that interacts with AMPA receptors. Nature,
386(6622): 279-284.
Dube, C., Chen, K., Eghbal-Ahmadi, M., Brunson, K., Soltesz,
I. and Baram, T.Z. (2000) Prolonged febrile seizures in the
immature rat model enhance hippocampal excitability long
term. Ann. Neurol., 47(3): 336-344.
Ende, G., Braus, D.E, Walter, S., Weber-Fahr, W. and Henn,
EA. (2000) The hippocampus in patients treated with electro-
convulsive therapy: a proton magnetic resonance spectroscopic
imaging study. Arch. Gen. Psychiatry, 57( 10): 937-943.
Gall, C., Lauterborn, J., Isackson, E and White, J. (1990)
Seizures, neuropeptide regulation, and mRNA expression in
the hippocampus. Prog. Brain Res., 83: 371-390.
Gall, C., Lauterbom, J., Bundman, M., Murray, K. and Isackson,
EJ. (1991) Seizures and the regulation of neurotrophic factor
and neuropeptide gene expression in brain [Review]. Epilepsy
Res. Suppl., 4: 225-245.
Gibbs, J.W., Shumate, M.D. and Coulter, D.A. (1997) Differen-
tial epilepsy-associated alterations in postsynaptic GABA(A)
receptor function in dentate granule and CA1 neurons. J.
Neurophysiol., 77(4): 1924-1938.
Gloor, E (1991) Mesial temporal sclerosis: historical background
and an overview from a modem perspective. In: H. Luders
(Ed.), Epilepsy Surgery. Raven Press, New York, pp. 689-703.
Green, A.R., Heal, D.J. and Goodwin, G.M. (1986) The ef-
fects of electroconvulsive therapy and antidepressant drugs on
monoamine receptors in rodent brain-similarities and differ-
ences. Ciba Found. Symp., 123: 246-267.
Grigonis, A.M. and Murphy, E.H. (1994) The effects of epileptic
cortical activity on the development of callosal projections.
Dev. Brain Res., 77(2): 251-255.
Holmes, G.L., Gairsa, J.L., Chevassus-Au-Louis, N. and Ben
Ari, Y. (1998) Consequences of neonatal seizures in the rat:
morphological and behavioral effects. Ann. Neurol., 44(6):
845-857.
Hubel, D.H. and Wiesel, T.N. (1970) The period of susceptibility
to the physiological effects of unilateral eye closure in kittens.
J. Physiol., 206: 419-436.
Hubel, D.H., Wiesel, T.N. and LeVay, S. (1977) Plasticity of
ocular dominance columns in monkey striate cortex. Philos.
Trans. R. Soc. Lond. B Biol. Sci., 278(961): 377-409.
Jiang, M., Lee, C.L., Smith, K.L. and Swann, J.W. (1998) Spine
loss and other persistent alterations of hippocampal pyramidal
cell dendrites in a model of early-onset epilepsy. J. Neurosci.,
18(20): 8356-8368.
Jorgensen, O.S., Dwyer, B. and Wasterlain, C.G. (1980) Synaptic
proteins after electroconvulsive seizures in immature rats. J.
Neurochem., 35(5): 1235-1237.
Kellar, K.J., Cascio, C.S., Butler, J.A. and Kurtze, R.N. (1981)
Differential effects of electroconvulsive shock and antidepres-
sant drugs on serotonin-2 receptors in rat brain. Eur. J. Phar-
macol., 69: 515-518.
Kelly, M.E. and McIntyre, D.C. (1994) Hippocampal kindling
protects several structures from the neuronal damage result-
ing from kainic acid-induced status epilepticus. Brain Res.,
634(2): 245-256.
Kob, S., Storey, T.W., Santos, T.C., Mian, A.Y. and Cole, A.J.
(1999) Early-life seizures in rats increase susceptibility to
seizure-induced brain injury in adulthood [In Process Cita-
tion]. Neurology, 53(5): 915-921.
Lerer, B. (1984) Electroconvulsive shock and neurotransmitter
receptors: implications for mechanism of action and adverse
effects of electroconvulsive therapy. Biol. Psychiatry, 19(3):
361-383.
Lyford, G.L., Yamagata, K., Kaufmann, W.E., Barnes, C.A.,
Sanders, L.K., Copeland, N.G., Gilbert, D.J., Jenkins, N.A.,
Lanahan, A.A. and Worley, EE (1995) Arc, a growth factor
and activity-regulated gene, encodes a novel cytoskeleton-
associated protein that is enriched in neuronal dendrites. Neu-
ron, 14(2): 433-445.
Madsen, T.M., Greisen, M.H., Nielsen, S.M., Bolwig, T.G. and
Mikkelsen, J.D. (2000) Electroconvulsive stimuli enhance both
neuropeptide Y receptor Y1 and Y2 messenger RNA expres-
sion and levels of binding in the rat hippocampus. Neuro-
science, 98(1): 33-39.
Margerison, J.H. and Corsellis, J.A.N. (1966) Epilepsy and the
temporal lobes: a clinical encephalographic and neuropatho-
logical study of the brain in epilepsy, with particular reference
to the temporal lobes. Brain, 89: 499-530.
Merzenich, M.M., Nelson, R.J., Stryker, M.E, Cynader, M.S.,
Schoppmann, A. and Zook, J.M. (1984) Somatosensory corti-
cal map changes following digit amputation in adult monkeys.
J. Comp. Neurol., 224(4): 591-605.
Morgan, J.I., Cohen, D.R., Hempstead, J.L. and Curran, T.
(1987) Mapping patterns of c-los expression in the central
nervous system after seizure. Science, 237(4811): 192-197.
Morrison, R.S., Wenzel, H.J., Kinoshita, Y., Robbins, C.A.,
Donehower, L.A. and Schwartzkroin, EA. (1996) Loss of
the p53 tumor suppressor gene protects neurons from kainate-
induced cell death. J. Neurosci., 16(4): 1337-1345.
Multani, R, Myers, R.H., Blume, H.W., Schomer, D.L. and
Sotrel, A. (1994) Neocortical dendritic pathology in human
partial epilepsy: a quantitative Golgi study. Epilepsia, 35(4):
728-736.
Murray, B., Alessandrini, A., Cole, A.J., Yee, A.G. and Furshpan,
E.J. (1998) Inhibition of the p44/42 MAP kinase pathway pro-
tects hippocampal neurons in a cell-culture model of seizure
activity. Proc. Natl. Acad. Sci. USA, 95(20): 11975-11980.
Murray, B., Beer, T. and Cole, A.J. (1999) Pre- and post-
synaptic activation of p44/42 MAP kinase in hippocampus
after kainate-induced seizures. Epilepsia, 40:2 I.
Parent, J.M. and Lowenstein, D.H. (1994) Treatment of refrac-

tory generalized status epilepticus with continuous infusion of
midazolam. Neurology, 44(10): 1837-1840.
Patrylo, P.R., Schweitzer, J.S. and Dudek, EE. (1999) Abnormal
responses to perforant path stimulation in the dentate gyms of
slices from rats with kainate-induced epilepsy and mossy fiber
reorganization. Epilepsy Res., 36(1): 31-42.
Penner, M.R., Pinaud, R. and Robertson, H.A. (2001) Rapid
kindling of the hippocampus protects against neural damage
resulting from status epilepticus. NeuroReport, 12(3): 453-
457.
Saffen, D.W., Cole, A.J., Worley, P.E, Christy, B.A., Ryder,
K. and Baraban, J.M. (1988) Convulsant-induced increase in
transcription factor messenger RNAs in rat brain. Proc. Natl.
Acad. Sci. USA, 85: 7795-7799.
Sandberg, R., Yasuda, R., Pankratz, D.G., Carter, T.A., Del Rio,
J.A., Wodicka, L., Mayford, M., Lockhart, D.J. and Barlow, C.
(2000) Regional and strain-specific gene expression mapping
in the adult mouse brain. Proc. Natl. Acad. Sci. USA, 97(20):
11038-11043.
Sasahira, M., Lowry, T., Simon, R.P. and Greenberg, D.A. (1995)
Epileptic tolerance: Prior seizures protect against seizure-
induced neuronal injury. Neurosci. Lett., 185: 95-98.
Schafe, G.E., Atkins, C.M., Swank, M.W., Bauer, E.P., Sweatt,
J.D. and LeDoux, J.E. (2000) Activation of ERK/MAP kinase
in the amygdala is required for memory consolidation of
pavlovian fear conditioning. J. Neurosci., 20(21): 8177-8187.
Schauwecker, P.E. (2000) Seizure-induced neuronal death is as-
sociated with induction of c-Jun N-terminal kinase and is
dependent on genetic background. Brain Res., 884(1-2): 116-
128.
Schauwecker, P.E. and Steward, O. (1997) Genetic determinants
of susceptibility to excitotoxic cell death: implications for
gene targeting approaches. Proc. Natl. Acad. Sci. USA, 94(8):
4103-4108.
Schmid, R., Tandon, P., Stafstrom, C.E. and Holmes, G.L. (1999)
Effects of neonatal seizures on subsequent seizure-induced
brain injury. Neurology, 53(8): 1754-1761.
23
Schwob, J.E., Fuller, T., Price, J.L. and Olney, J.W. (1980)
Widespread patterns of neuronal damage following systemic
or intracerebral injections of kainic acid: a histological study.
Neuroscience, 5: 991=1014.
Selcher, J.C., Atkins, C.M., Trzaskos, J.M., Paylor, R. and
Sweatt, J.D. (1999) A necessity for MAP kinase activation
in mammalian spatial learning. Learn. Memory, 6(5): 478-
490.
Sheline, Y.I., Sanghavi, M., Mintun, M.A. and Gado, M.H.
(1999) Depression duration but not age predicts hippocampal
volume loss in medically healthy women with recurrent major
depression. J. Neurosci., 19(12): 5034-5043.
Sloviter, R.S. (1994) On the relationship between neuropathology
and pathophysiology in the epileptic hippocampus of humans
and experimental animals [Review]. Hippocampus, 4(3): 250-
253.
Sutula, T.E, He, X.X., Cavazos, J. and Scott, G. (1988) Synap-
tic reorganization in the hippocampus induced by abnormal
functional activity. Science, 239(4844): 1147-1150.
Vezzani, A., Sperk, G. and Colmers, W.E (1999) Neuropeptide
Y: emerging evidence for a functional role in seizure modula-
tion. Trends Neurosci., 22(1): 25-30.
Wasterlain, C.G. and Plum, E (1973) Vulnerability of developing
rat brain to electroconvulsive seizures. Arch. Neurol., 29(1):
38-45.
Weiss, S., Cataltepe, O. and Cole, A.J. (1995) NGF reduced
DNA fragmentation in CA1 neurons but not elsewhere after
systemic kainate-induced seizures in the rat. Soc. Neurosci.
Abstr., 21: 985.
Willmore, L.J., Ballinger Jr., W.E., Boggs, W., Sypert, G.W. and
Rubin, J.J. (1980) Dendritic alterations in rat isocortex within
an iron-induced chronic epileptic focus. Neurosurgery, 7(2):
142-146.
Wuarin, J.-E and Dudek, EE. (1996) Electrographic seizures
and new recurrent excitatory circuits in the dentate gyms
of hippocampal slices from kainate-treated epileptic rats. J.
Neurosci., 16(14): 4438-4448.
T. Sutula and A. Pitk~nen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 3

Doubt and certainty in counting

R.W. Guillery 1,, and B.K. August 2,**

1Department of Anatomy and 2 Department of Neurology, School of Medicine, University of Wisconsin, Madison, W1 53706, USA

Abstract: Some of the methods used for counting objects in histological sections are discussed. The method best suited
for any particular counting program depends on many variables, which include the level of accuracy required, the type of
preparation available for study, the size of the objects to be counted, the thickness of the sections that can be used, the
equipment available and the amount of labor that can reasonably be invested. For light and electron microscopy, profile
counts are simple and quick for objects that are small relative to section thickness and whose dimensions are readily
defined. The 'physical disector' is particularly useful where objects to be counted are large relative to sections thickness,
or where their dimensions are unknown or highly variable. For light microscopy, the optical disector is often easier to
use. However, it makes more assumptions than the physical disector; some of these can introduce serious bias in the
counts, and they are explored. Electron microscopy raises some special problems that relate to the depth of focus, the
relatively very thin sections, and the tendency for thin structures that do not span the full thickness of a section to be lost
or unrecognizable in some section planes. The importance of recognizing the assumptions that underlie any method of
counting and its interpretation is stressed.

However, if one remains aware that these methods
yield approximations, one or another of them will
prove useful. The choice of method depends on the
actual conditions and is, moreover, largely a matter
of taste.
E.R. Weibel (1969) writing on
stereological principles.
Introduction
The importance of reliable counting methods in neu-
roscience has increased over the past decade, and
has received significant discussion in a literature that
is surprisingly extensive. (Recent references include:
*Correspondence to: R.W. Guillery, Department of
Anatomy, School of Medicine, University of Wisconsin,
1300 University Avenue, Madison, WI 53706, USA. Tel.:
+1-608-263-4763; Fax: +1-608-262-7036;
E-mail: rguiller @facstaff.wisc.edu
** Responsible for the electron microscopic studies.
Gundersen et al., 1988; Pakkenberg and Gunder-
sen, 1995; Coggeshall and Lekan, 1996; Guillery
and Herrup, 1997; West, 1999; Geuna, 2000; Benes
and Lange, 2001). Counts of nerve cells, glial cells,
vesicles, or synapses in sections prepared for light or
electron microscopy are being undertaken more com-
monly than in the past. They can help to define the
progress of disease, allow comparisons between ex-
perimental and normal conditions, or show changes
that characterize development. If the counting is
based on reliable methods, it can provide crucial
information. If not, it can be seriously misleading.
However, no method of counting can be certified as
free of error.
The investigator who needs to count is best placed
if the need for counts is established before the tissue
is prepared for sectioning. Matching tissue prepara-
tion to the objects to be counted and to the degree
of accuracy required by the counts should be a first
step wherever possible. Often, however, counts need
to be done on tissue that has already been prepared,
perhaps many years ago, or that needs to serve more
26
than one experimental purpose. For such material
one needs to devise the best counting method avail-
able, establish possible sources of error, and decide
whether the likely size of the error of the final
counts will justify the necessary labor and lead to
sufficiently trustworthy conclusions. Although neu-
roscience has been greatly advanced by studies that
included counts from sections, it should be recog-
nized that there are situations where, on the basis
of the material available and the likely size of the
error of a count, it may be prudent not to count.
An erroneous count may be more of a hindrance to
advancing knowledge than no count at all; authors,
reviewers and editors should strive to make the de-
scription of methods relevant to a counting study as
complete and translucent as possible, so that readers
can be helped to evaluate the reliability of a count.
Where two comparable quantitative studies pro-
duce conflicting results, it is often difficult to under-
stand the basis of the difference. For example, Haug
(1986) reports that the number of nerve cells reported
in human cerebral cortex has varied from 0.6 x 109 to
16 x 109, and Pakkenberg and Gundersen (1995) re-
port 20-25 x 109 (see also footnote 2). Although
different methods of counting have been clearly
presented, and sources of errors as well as possi-
ble corrections of errors have been discussed (e.g.
Floderus, 1944; Abercrombie, 1946; Konigsmark,
1970; Pakkenberg and Gundersen, 1989; Clarke,
1992, 1993; Coggeshall and Lekan, 1996; Guillery
and Herrup, 1997; Gundersen et al., 1999; West,
1999; Benes and Lange, 2001), serious differences
concerning methods can be found in the literature,
and discrepancies in the results obtained are still
common. There is an increasingly widely held, but
overly simple faith that only one method of counting,
using the 'disector', often described as 'un-biased'
or 'assumption-free' (see: Coggeshall and Lekan,
1996; Mayhew and Gundersen, 1996; West, 1999),
can produce valid results. Although this is a powerful
and useful method, the view that only counts that use
the disector should be accepted for use in publica-
tions and grant-supported research is too sweeping.
So also is the claim that these methods are free of
assumptions of the type that can, and often do, lead
other methods into systematic errors. For almost any
counting method that has been used, there have been
many publications in which the method of count-
ing is either quite evidently flawed, or is presented
without the detail that is needed to evaluate the sig-
nificance of the final count. In this brief review, we
stress that there is no one 'correct' way to undertake
a count, and we indicate that there are innumerable,
often unforeseen errors that one can make, no mat-
ter which method of counting is used. Any student
interested in the subject can find examples of more
or less egregious errors in the literature (in fact,
encouraging students to find such errors is a good
way to introduce them to the problems of counting).
Since almost all of us who have made counts have
committed errors of omission or commission, we cite
only few examples of the sorts of things that can go
wrong. No matter what method of counting is used,
the range of possible sources of errors is great, far
beyond the scope of this review.
Planning a count
The first step in evaluating a counting method is
to decide what sort of information is being sought.
This is a first step for the investigator who has to
provide a clear statement; it is also an essential first
step for those who give advice on counting and
for those who have to evaluate studies that include
counts. For some studies one simply needs a ball-
park figure to indicate how many cells or axons or
synapses characterize a particular structure or brain.
More commonly, one is looking to make compar-
isons, between nerve cells and glia, nerve ceils and
synapses, between structure A and structure B, or
between different experimental conditions, disease
states, or developmental stages or species. There is,
as we shall see, an important difference between
wanting to know the number of objects within a
particular nucleus or cell layer, and wanting to know
the number of objects per unit volume of a brain
part. Perhaps an important opening statement for the
methods section of a quantitative study should be
one that clearly describes the nature of the counts
to be made, and defines the margins of error that
are considered acceptable. This not only alerts the
reader to the relevant variables of the study, but
will also protect the author from being attacked for
not achieving a level of accuracy greater than that
actually needed in the study. A second step should
perhaps be recognition of possible errors, their likely

size, and a summary of the steps that have been taken
to reduce or eliminate such errors.
Possibly the most important source of error is
the bias introduced by the observer who is making
a comparison between two populations. Unless the
observer is blind to the conditions of the study,
there will be a possibility of a serious bias in the
results. Labeling a counting method as 'unbiased' or
'assumption-free' may at times have led investigators
into a false sense of security about the unbiased
nature of their results. Whenever a count reports
a comparison, the methods section should indicate
whether the observer was blind to the conditions
being compared, and if the methods section does not
include such a statement, then one is well advised to
treat the results as unreliable.
It is tempting to think that some defined for-
mula could be devised for the method to be used
in any quantitative study, but since each tissue, each
preparatory method, and each type of count raises its
own particular array of problems, the development
of such a 'formulaic' approach is to be discouraged.
There is already too great a tendency for investiga-
tors to name their method, cite a general account
of the method, and leave out specific and important
details that, as we shall show, can make a significant
difference to the reliability of a count. In general, any
study that does not look at the possibility of errors
in the counts deserves particularly close scrutiny,
especially if it claims to be free of 'assumptions'.
Defining the 'acceptable' error
Preliminary observations can often give a clue as to
the size of the error that is acceptable. For a doctoral
dissertation one of the authors (R.W.G.) counted the
cells in the mamillary nuclei and found about 80,000
cells in the medial mamillary nucleus of the cat,
and only about 3000 cells in the lateral mamillary
nucleus. The difference tells something significant
about the functions of the two parts of the system,
and the general conclusion about a large difference
between the two nuclei could have been firmly estab-
lished even by counts that had a large error. However,
for comparisons between species, and for ratios of
cells relative to axons, methods that were sensitive to
smaller differences were needed. Comparably, when
electron microscopic images of the visual relay in
27
the thalamus (the lateral geniculate nucleus) first be-
came available, one of the striking features was that
a relatively small proportion of the total synaptic
junctions were established by retinal axons. The pre-
dominance of non-retinal afferents was demonstrable
by counts (Guillery, 1969). These cannot be regarded
as having provided an accurate quantitative survey,
but they did stress what was at the time a surprising
conclusion about the preponderance of non-retinal
afferents. More recent counts have confirmed this
general conclusion, but have provided rather more
accurate figures (Eri~ir et al., 1998).
Counts of ratios between (e.g.) Purkinje cells and
granule cells in the cerebellum can similarly show
that the latter greatly outnumber the former, and a
large error would not alter the conclusion. However,
if a theoretician needed more precise ratios, or if one
wanted to compare the ratios between species, then
the smaller size of the acceptable error must be taken
into consideration when the counts are planned. The
smaller the acceptable error, the more important is
the method, and the greater the necessary investment
in the study.
It has been pointed out that errors differ in their
nature and can differ in the effects that they produce.
For many purposes it is important to distinguish
between errors that are random, and thus affect the
variance of the mean obtained, and errors that are
systematic (or 'biased'), which shift the mean up
or down (West, 1999). The distinction is important
when one is planning a count, but it should be noted
that distinguishing the effects of each type of error
in any particular published count can be extremely
difficult, and often impossible.
The first type of error, provided that an appro-
priate method of sampling has been used, produces
a set of counts that are randomly scattered around
the actual value, and the extent of this scatter, the
variance, can be estimated, and recorded in terms
of standard errors. Up to a point, the more counts
that one has, the smaller this error is likely to be,
although the labor required for accurate counts often
leads to relatively small sample sizes. It should be
stressed that the estimate of the variance will depend
on the distribution of the population of objects being
counted, on the nature of the population of organ-
isms being studied, and on the sampling procedure
used. In some tissues the problem of variation from
28
one section to another or from one part of a sec-
tion to another is relatively small. Gundersen and
Osterby (1981) have made the point that this can be
of 'negligible importance' relative to the 'biological
variation' between individuals. However, the nervous
system is a highly structured (i.e. non-random) tis-
sue, where objects that are to be counted are likely
to be heterogeneously distributed. Here a limited
random sampling procedure of the sort that is often
used can give a false estimate of the size and of the
variability of the population (see Benes and Lange,
2001). Consider a population of cells that is highly
concentrated in small clumps or layers in a tissue.
If 90% of the cells occupy only about 5% of the
volume of the tissue, then there is significant proba-
bility that a sample of 20 counts will not include a
region of the high cell concentration. That is, these
20 counts could provide not only a significant un-
dercount, but would also provide an entirely false
picture of the variability, and so provide a seriously
misleading clue for evaluating the data. Investigators
should have a clear view of how the population of
objects that is to be counted is distributed, should
ensure that their sampling method provides a rep-
resentative sample of all parts of this population,
and should also indicate how the sampling procedure
used relates to the known distribution of the objects
being counted.
The problem of variance applies not only to the
objects being counted but also to the population of
individuals from whom the tissue for counting has
been obtained. A point that may be particularly im-
portant for the subject of this conference concerns
the measure of variance that one can expect to find
in any population of individuals likely to be used.
Whereas one can expect a highly inbred strain of
mouse to produce a relatively low variance for many
counts (Williams et al., 1996), especially when age
and sex are taken into account 1, a human population
is likely to show very much more variation 2. This
will not only produce high standard errors for the
relatively small samples that often have to be used,
Note, however,that where two investigatorsuse different inbred
strains the chances of obtaining discordant results are increased.
2 Pakkenberg and Gundersen (1997) show a range from <15 x
10 9 to >30 x 10 9 for numbers of neocortical neurons in human
brains.
but it may also mean that subjects used for counts
in one laboratory may differ in real terms (general
health, diet, environment etc.) from subjects used
in another. The same is likely to hold for animals
obtained from the wild or for animals that, though
bred for laboratory research, have not been inbred,
such as the cats or monkeys most commonly used
in CNS research. Again, one should be on guard
for small sample sizes, which can provide ballpark
figures, but which may be seriously misleading not
only about the population mean, but also about the
variance. Heavy investments made to obtain highly
accurate individual counts may prove counter pro-
ductive where this leads to records from relatively
few individuals in a highly variable population.
Experimental studies of ageing that involve more
than a few years face a particularly difficult problem
because housing conditions for the experimental sub-
jects change as governments adopt new guidelines,
and as the training received by animal caretakers
changes. For human studies the occurrence of ma-
jor wars, famines, or changing diets may be more
relevant than age in itself.
The second major type of error is a systematic
error that produces undercounts or overcounts. The
most common example occurs where objects of un-
known size are counted in sections. Since many of
the objects are cut and appear in more than one sec-
tion, an uncorrected count will provide an overcount,
and the larger the objects, the greater the overcount.
Where two conditions are being compared, it is pos-
sible to record a significant difference in cell number
where, in reality, there is a difference in cell sizes, or
cell shapes, with no difference in the numbers. That
is, there is a systematic error (or bias) because there
has been a confusion of parameters. Larger objects
produce spuriously higher counts. In this example,
the confusion is between cell size (or shape) and
cell number; in following sections we illustrate other
confusions of parameters that can also lead to com-
parable systematic errors, or biases, and that are less
widely recognized.
In practice, many of the problems and errors that
one encounters in light microscopy and in electron
microscopy are different, and for this reason, we
consider the two separately in what follows.
 29

Light microscopical studies
Profile c o u n t s
T h e m o s t c o m m o n l y d i s c u s s e d s y s t e m a t i c error in
counts that use light m i c r o s c o p i c a l study o f tissue
slices is the one i n t r o d u c e d above, p r o d u c e d by dou-
ble c o u n t i n g o f objects in sections, w h e r e s o m e o f
the objects are cut so that they a p p e a r in two or
m o r e sections (Fig. 1). I f all o f the profiles in the
s a m p l e d parts o f the sections are c o u n t e d (profile
counts), then the severity o f this bias, and the extent
to w h i c h it can be r e c o g n i z e d and c o r r e c t e d d e p e n d s
on h o w m u c h the o b s e r v e r k n o w s about the shape
and the size o f the objects and the thickness o f the
sections. T h e less one k n o w s about the shape and the
size o f the objects b e i n g counted, the stronger the
a r g u m e n t for using an alternative, such as the 'di-
sector' m e t h o d (Pakkenberg and G u n d e r s e n , 1989,
1995; C o g g e s h a l l and Lekan, 1996; West, 1999),
w h i c h is i n d e p e n d e n t o f o b j e c t shape and size. It
has b e e n argued that the d i s e c t o r t e c h n i q u e should
always be used, and that profile counts are intrinsi-
c a l l y unreliable, and thus should be avoided. S i n c e
profile counts are relatively s i m p l e to do and can be
carried out fairly rapidly on m a n y different types o f
section, it is worth l o o k i n g at the d e g r e e to w h i c h
they are unreliable, and defining c o n d i t i o n s u n d e r
w h i c h their use should be e n c o u r a g e d . A point that
is o f p r i m a r y i m p o r t a n c e in e v a l u a t i n g counts is the
tension that a l w a y s exists b e t w e e n , on the one hand,
using a labor-intensive, h i g h l y accurate m e t h o d such
as the p h y s i c a l disector, w h i c h often leads to small
s a m p l e sizes, or, on the o t h e r hand, using a m o r e

Fig. 1. Schema to represent the use of the Abercrombie cor-

rection for a profile count. (A) Twenty-five cells (or nuclei or 2 3 4 5
nucleoli or mitochondria etc.) are distributed through a tissue. I

One of a series of sections is represented by the tissue between • 6 7 9 I0 ,

the two solid lines. This includes some of the cells, cuts some •
12
13 " B
and excludes others. (B) h, the mean dimension of the 25 cells in
the z-axis is equal to H/25. Estimates of h and T are based on
measurements that represent dimensions in the z-plane. If it can • 16 17 I
be shown that on average the dimensions of the cells are equiv- t
alent in all directions, then h can be obtained from sections cut 19 zu 21 22

in any plane, but if this cannot be shown, then h should be mea- 23 24 25

sured in the z-plane itself, either directly, using measurement of
movements of the microscope stage along the z-axis (see section
on measurements along the z-axis), or by cutting sections per- 2 3 4
pendicular to the original section plane, using either equivalent j h =H/25
tissues to those used for counting or, where the method allows
this, re-cutting the same sections perpendicular to the original
section plane. (C) When the section is viewed through the mi- C
•

•
•
b

11
7

12
13 9

]4
10 •

•
1
"I"
/
croscope from above, a profile count will, on average, represent
cells having a unique point (top, bottom or some other, theoret- • t6 17 • /

ical, unique central point) in a thickness of the original tissue

equivalent to T + h. That is, the profile count over-estimates the
•
•
t5
i
18
i
1
cell number by a factor of T + h / T . (D) If, for the measurement
of h and T sections are re-cut perpendicular to the original sec-
tion plane, then, if there is further shrinkage during this second
lh/S
• 6 7 8
process of cutting (which may require re-embedding), then, pro- 13
vided that the shrinkage acts equally on all parts of the section, D •
• 11
12
~" .TIS
for calculating the Abercrombie correction factor, no further cor-
rection is required, since the ratio T / ( T + h) = s T / ( s T + sh),
where s represents the degree of shrinkage. However, the point
about equivalent shrinkage of all parts of the tissue should be
treated as an assumption (see text). It is useful to compare mea-
surements made on the original sections (by calibrated vertical
movements of the microscope stage) with measurements made
directly along the same axis on the re-cut sections.
30
rapid method that allows for larger samples. The
more that is known about the sources of variability
discussed above, the easier it will be to decide on the
most appropriate approach.
Fig. 1 shows that the size of the error in a profile
count depends on the thickness of the sections and on
the mean dimension of the counted objects in a plane
perpendicular to the section (the z-plane). That is, the
smaller the objects being counted and the thicker the
section, the smaller the error. A suitable correction
for this error was published by Abercrombie 55
years ago and can be expressed as N = Nl ( T / T +
h), where N is the actual number of objects that
should be recorded, N1 is the recorded count, T
is the thickness of the sections, and h is the mean
height of the objects in the z-plane (Abercrombie,
1946). As h becomes larger relative to T, the error
becomes larger, and is quite unacceptably large if
h is greater than T. Clarke (1992) has suggested
that profile counts combined with the Abercrombie
corrections should not be used where T exceeds
h by a ratio of 1.5, which is good general rule,
although one is wise to work well on the safe side
of this limit. Where h is small relative to T, the
error will be correspondingly small. That is, given
that one has reliable information about h and T and
h / T is small, profile counts with the Abercrombie
correction, or with an appropriate variant of that
correction (e.g. Floderus, 1944; Konigsmark, 1970)
can produce reliable results. Arguments against the
use of such counts are often based on situations
where the objects to be counted are large relative to
section thickness or of unknown shape (Coggeshall
and Lekan, 1996; West, 1999). Where the objects are
small and of well-defined shape, those arguments do
not apply. Furthermore, since the method is simple
and relatively straight forward, and since it can be
used on material where adjacent sections are not
stained by the same method (which is important if
the physical disector method described below is to
be used) it is a mistake to discourage its proper use.
An example, where a profile count can be useful,
is provided by nucleolar counts (which can also be
used for cell counts in tissues where cells are known
to have one and not more than one nucleolus). In
sections that are 10-30 ~tm in thickness and where
the nucleoli are roughly spherical and 1-3 Ixm in
diameter, as they are in many neural structures, pro-
file counts provide a simple and rapid method. For
the dimensions given above, an uncorrected profile
count will produce an error of about 3% for a pop-
ulation of small nucleoli in 30-1xm sections and of
about 23% for large nucleoli in 10-txm sections, so
that for small nucleoli and 30-1xm sections, even with
no correction, the counts can produce useful results
for many purposes. With larger nucleoli or thinner
sections, the correction becomes important, but once
the correction is made, provided that it is based on
reliable information about the dimensions h and T,
one can expect the estimate to be relatively close to
the actual number in that sample.
It should be noted that there have been several
versions of the Abercrombie correction. Some (e.g.
Floderus, 1944; Konigsmark, 1970) make allowance
for small pieces of the counted structures that are lost
in the cutting (so-called lost caps), or that cannot be
recognized because they are too thin at the surface
of a section. Others (e.g. Coupland, 1968; Hendry,
1976; Hedreen, 1998) address the problem posed by
objects whose size represents a significant fraction of
section thickness, causing measurements of h to be
biased in favor of smaller objects that are completely
included in the sections. These corrections are refine-
ments that can provide a somewhat closer approach
to the 'real' number but, as can be seen from the
above example of nucleolar counts, such corrections
are a case of gilding the lily for small objects in rela-
tively thick sections. Where the ratio of object size to
section thickness is relatively high, these additional
corrections may help, but the correction for the lost
caps can then also be of slightly dubious value, since
often the assessment of just what allowance to make
for lost or unrecognizable 'caps' can be arbitrary.
Nuclear counts in thin sections may give a rather
high h / T ratio, but can still be used in relatively
thick sections provided there is good evidence about
the value of h. Ideally h and T should be measured
in some of the sections of the series that is used for
the counts, and this can be done after some of the
sections have been cut perpendicular to the original
section plane (see Marengo, 1944, and Fig. 1). That
is the measurements should be made in the z-plane.
However, alternate sections, sections from the other
hemisphere or possibly even from other, closely
matched brains can also be used; alternatively, the
measurements can be made on the sections used

for the counts by measuring stage movements of
the microscope in the z-direction, beating in mind,
however, the problems involved in making such mea-
surements, which are considered in a separate section
below.
It may be of some interest for those who have
done or plan to do profile counts to note that the
Abercrombie correction is wrongly presented in two
recent articles that argue strongly against profile
counts in general and in support of the disector meth-
ods in particular (Coggeshall and Lekan, 1996; West,
1999). The correction factors given there would not
lead one to recognize the importance of the ratio of
h to T for profile counts, and could lead to serious
error if used to correct a profile count. For anyone
planning a profile count, the best strategy is to com-
pute the correction factor on the basis of a figure
such as Fig. 1C, which shows clearly that a profile
count is actually counting objects representative of
numbers in a volume equivalent to a section having
a thickness of h + T. Alternatively reference can be
made to Abercrombie's original paper, which also in-
cludes some interesting further thoughts on counting
and measuring the objects to be counted.
One of the suggestions made in that study is that
the correction can be avoided if one cuts adjacent
sections at different thickness (TI and T2, where
TI > T2). The difference between the profile counts
(Nl minus N2) made in the two sets of sections
will then give the correct number for the number of
objects in a (notional) section having thickness T1
minus T2. Where celloidin or frozen sections are cut
on a sliding microtome, this method can be quite
practical, provided that actual section thicknesses are
measured. 3
Shrinkage of the tissue, either before sectioning,
or on the slide after sectioning, can be considerable.
The issue may become important if one is comparing
two tissues that do not undergo the same amount of
shrinkage (Uylings et al., 1986; Haug, 1987), and
if one is recording cell densities rather than total
3 For paraffin sections, two knives mounted precisely parallel to
each other, one above the other and one slightly closer to the
block face than the other can also providethe needed two series,
but collecting two paraffin ribbons concurrently takes quite some
skill, even if one managesto arrange for the knives to be properly
mounted, which is, of course, critical.
31
numbers. This would lead to a different confusion of
parameters, where a greater amount of tissue shrink-
age becomes interpreted as a higher cell density.
The issue can also be important if one measures
volume before shrinkage and cell packing densities
after shrinkage.
The use of the 'disector'
This method of counting has been fully described in
several publications (Gundersen et al., 1988, 1999;
Coggeshall and Lekan, 1996; West, 1999, 2002,
this volume) and was first brought to the attention
of contemporary investigators by a paper published
almost two decades ago (Sterio, 1984). Benes and
Lange (2001) have pointed out that an earlier use
of the same principle was described in 1895 at the
University of Wisconsin for counting the glomeruli
in the kidney of a cat (Miller and Carlton, 1895). The
method is based on a comparison of two adjacent
sections, recording the number of profiles of objects
seen in one section, the 'sampling section', and then
only counting those objects that do not also appear
on the adjacent 'look-up' section. This is a simple
method for avoiding double counts, and its particular
strength is that it is completely independent of the
size and shape of the objects being counted. That
is, with this method, the two parameters, size and
number, cannot be confused.
If the two sections are physically separate sec-
tions (the 'physical disector') then the process is
difficult because the two sections need to be pre-
cisely matched so that objects on one section can be
matched against objects on the next section. Further-
more, the method often cannot be used on archival
material where complete series may not be available,
either because different stains were used for adjacent
sections, or sections were not mounted as complete
series. For these reasons the 'optical disector' has
considerable appeal, since it uses two or more op-
tical sections within a single histological section to
achieve the same result. In principle, this method
can be used rather like the physical disector, record-
ing number of profiles at one plane of focus, and
then only counting those that are not still present
at another plane. Within a reasonably thick section,
several pairs of optical sections can be used, with
the look-up section of one pair serving as a sample
32
section for another (West, 1999)4. In essence, it is
necessary to ensure that within any volume of tissue
in the single physical section, only one point on any
object to be counted is recorded; a simple choice is
to record the top of any object that first comes into
focus as the section is raised towards the objective
(West, 1999; Geuna, 2000). This then resolves the
method into a simple procedure of recording the
number of such 'tops' within an optically defined
thickness within the thicker histological section. The
volume used for such counts should avoid the edges
of the sections, where there may be unevenness and
where there is likely to be a 'lost caps' problem.
The optical disector has justifiably gained con-
siderably in popularity in recent years. Its use is to
be encouraged since it is relatively simple and so
can produce larger sample sizes than the physical
disector. Furthermore, it can serve where the objects
to be counted are too large or too irregular to be
counted by profile counts. However, it is important
that two issues be clearly appreciated by those using
this method. One is the importance of the basic rules
that govern the production of optical images with
a light microscope, and a second is the problems
of tissue shrinkage associated with the production
of histological sections. Failure to recognize the im-
portance of these can introduce serious bias into a
count.
The most important point about the optical dis-
ector concerns measurements in the z-axis. Whereas
the physical disector avoids many (but not all) of the
problems related to measurements along this axis,
these problems can play a major role in the produc-
tion of systematic errors when the optical disector is
used.
Measurements in the z-axis
We have seen that measurements of section thickness
are critical for profile counts. They can sometimes be
ignored where a physical disector is used to sample
4 If this method is used then it is important to ensure that
the distance between the two optical sections is smaller than
the smallest object to be counted, since, of course, such small
objects would be missed as they fell between two chosen optical
sections. The problem does not arise if one simply counts tops as
the section is raised from one focal plane to the other.
from a known proportion of sections through a well
defined volume of tissue (Gundersen et al., 1988).
That is, if the sections are all of essentially the
same thickness, and if each section then represents
a known fraction of the total tissue dimension in the
z-plane, then a count in a sample of each section
will represent a proportion of the total tissue volume
that can be defined without recording section thick-
ness. However, often, for comparisons of densities of
objects in a tissue, which are likely to be important
where boundaries are difficult to define (see below),
section thicknesses need to be defined. For counts
that use the optical disector, it is important to de-
fine the thickness of the optical section from which
any one count is obtained, and this is crucial and
can readily lead to undercounts or overcounts if the
measure is wrongly determined.
In a recent review of quantitative methods Geuna
(2000), discussing the optical disector, argues that
the top of an object: "is a point (and thus adimen-
sional), it has no size, shape or orientation (therefore
no assumptions are needed for these parameters) and
can be sampled in only one disector volume (i.e. it
cannot be split into two disectors)".
This represents a serious misunderstanding of op-
tical sections and one that, to judge from published
accounts, is shared by several other users of the op-
tical disector. Although the top of the object is a di-
mensionless point, its microscopic image is not. The
image has three dimensions, and these dimensions
depend upon the optical conditions of the study.
The depth of the field when using widefield op-
tics 5 and actual measurements made along the z-axis
depend on the numerical aperture of the lens, and
on the optical properties of the specimen. With good
optical conditions (see below) and a good oil im-
mersion lens having a high numerical aperture (1.35
or 1.4), one can expect the accuracy to be of the
order of 0.5 txm, or even less6. This assumes that
The term refers to light microscopic methods that are distinct
from confocal microscopy and other methods using a restricted
beam of light.
6 Under ideal conditions, it can be as small as 0.3 txm (Williams
and Rakic, 1988), but conditions, as argued below, are rarely
ideal. It is best to check empirically. Lange and Edstrrm (1954)
discussed problems of measurements in z-axis in detail and
recorded a 10% error for measurements of 5 ltm along the

a suitably thin cover glass has been used and that
the refractive index of the mounting medium and the
tissue is very close to that of the glass and of the
immersion oil. However, these ideal conditions are
rarely, if ever, met, and often the details provided
are not sufficient for judging the extent to which
they have been met. Mounting media that have been
used in the preparation of histological sections vary
greatly in their refractive index. Lillie (1965) shows
a range from 1.413 to 1.8225 7, but it is rare, in pub-
lications that use measurements along the z-axis, to
find any information about refractive index, either of
the mounting medium, or, where this is relevant, of
the embedding compound used. Concerns about the
refractive index of the mounting medium are particu-
larly important where sections have not been cleared
and are viewed in an aqueous medium. Each change
of refractive index encountered by the light on its
way through the specimen, the mounting medium
and the cover glass to the objective lens will produce
a shift from the ideal condition and a consequent
change o f the distance along the z-axis over which
the object appears to be in focus. The effect on the
apparent size of an object in the z-axis produced
by changes in refractive index can be surprisingly
large (amounting to about 65% for objects viewed
without immersion oil; see Glaser, 1982; West and
Slomianka, 1998).
The refractive index of the tissue itself could play
a significant role in the formation of the image, but
is usually not considered since one assumes that de-
hydration and clearing replace water and lipids from
z-axis. West et al. (1996) using a high numerical aperture, oil
immersion lens give an estimate of 'depth of focus' as 1-2 Ixm,
which is probably the sort of figure one can generally expect.
Uylings et al. (1986), using x63 and xl00 lenses (NA not
given) report inter-individual variation with a range of 3 txm
for measuring a section that was 5 Itm in thickness. We have
used a Nikon 'microcator' (Gundersen et al., 1988) to record
vertical movements of the microscope stage and have measured
the thickness of number 1 cover glasses that had ink marks on
both surfaces, and were mounted in Eukitt mounting medium
(RI = 1.51: Calibrated Instruments Inc., Hawthorne, NY 10502).
With a ×40 lens (NA = 1.0) we recorded measurements ranging
from 146 to 159 txm (mean = 153.0, SE = 0.51, n = 40) for
one cover glass. With a x 100 lens (NA 1.25) the corresponding
values for the same cover glass were 147-158 tim (mean =
152.7, SE = 0.54, n = 20).
7 Immersion oil has a refractive index close to 1.51.
33
the tissue so that it takes on the refractive index of the
mounting medium. However, if an unstained section
of the tissue can be imaged by phase contrast or in-
terference contrast optics (either of these providing a
suitable test) then the tissue itself is acting to refract
the light passing through it, and this is likely to be the
case for any tissue of interest to neuroscientists. That
is, some parts of the section, most probably proteins
that have not been replaced by the dehydration and
clearing procedures, are producing variations in the
refractive index of the cleared tissue. The question
for measures along the z-axis, is whether the overall
effect of these variations in the refractive index affect
the measurements. Preliminary observations of lines
drawn on a microscope slide and observed through a
60-1xm tissue section, suggest that the sections do not
seriously affect measures along the z-axis, except in
so far as the resolution of the image is poorer when
viewed through the section. That is, the refractive
properties of the CNS tissues we have used (cerebral
cortex, cerebellar cortex) produced some slight loss
in the accuracy of the measures, but not a systematic
shift in the mean of the measures that were recorded.
Where measures along the z-axis are critical for a
particular set of observations, it would be useful to
have commercially available slides that are marked
with fine lines. These could serve two purposes if
appropriately designed. If the lines were spaced a
known distance apart along the z-axis ( 5 - 1 0 Ixm
apart between layers of glass, or of plastic having the
same refractive index as the glass) they could serve
to calibrate the equipment used for measurements
along this axis. Furthermore, sample sections could
be mounted over such lines so that any changes in
resolution and focal depth produced by the presence
of the section could be recorded and reported as a
part of the study 8. A simple method of calibration
that may be more practical is to use c o m m e r c i a l l y
available microspheres, and check that mean and
standard errors for measures in the x - and y-axes
match the measures in the z-axis.
A minor, but interesting, variable relevant to mea-
surements in the z-axis is represented by the optics
s However, measurements of fine lines present a best case sce-
nario. As noted below, the nature of the object being observed is
relevant to the accuracy with which its position and dimensions
in the z-axis can be defined.
34
of the observer's eye (see e.g. Haug, 1956; Uylings
et al., 1986). They are best eliminated by using an
image on a screen or a photographic image. Ideally,
perhaps, if one is not using a screen or a photograph,
one should always use very old observers whose
lenses have hardened (it should be regarded as un-
ethical to paralyze the accommodative mechanisms
of young observers).
Mechanical problems are also relevant to mea-
surements in the z-axis. The accuracy of the fine
markings on the focal adjustments of microscopes
varies greatly, and some instruments may give rather
inaccurate measures. Devices for recording the ac-
tual vertical movements of the microscope stage
('microcators': Gundersen et al., 1988) have been
described and these provide more reliable measures
of stage movements, although reports that use such
devices would be well served by brief mention of
their calibration before use. 9
Accurately defining the focal plane in which the
top of an object lies, depends not only on the op-
tics, but also on the nature of the object. Theoretical
considerations generally apply to very small objects
having high contrast, i.e., a point source. In practice,
we do not have many point sources in our sections,
and generally that is not what we count. For very
small, well-defined objects that have a high con-
trast, finding exactly where the top is in focus is
relatively straight forward, whereas a larger opaque
object, a pale one, or a slightly granular one may
prove much more difficult. If one is studying a Nissl-
stained section, then defining the top of the cell can
be extremely difficult, since one is assessing where
the very small Nissl granules, scattered immediately
below the surface of the cell, first come into focus.
Defining the top of the nucleus may prove easier,
because the nuclear membrane is generally (but not
invariably) more clearly defined, and since it has
a higher curvature, the 'top' is nearer to Geuna's
idealized point. If the control and the experimen-
9 We are uncertain about the degree to which the variance of
the measures reported in footnote 5 was due to the mechanism
used, to the optics of the preparation, to the observer's visual
system, or to slight variations in the cover glass thickness.
Although the means and standard errors we have recorded are
relatively consistent, the range of these observations is somewhat
disconcerting.
tal samples differ in the staining properties or the
dispersal of the structures (such as the Nissl gran-
ules near the cell surface) that define the 'top' of
the counted objects, then this could well influence
judgments about best focus.
In summary, measurements along the z-axis are
subject to systematic errors that depend on the op-
tics of the preparation and the mechanics of the
recording equipment. Some errors, like the changes
in refractive index, can lead to serious under counts.
Others, like the uncertainties of defining the precise
focal plane of an object, will increase the size of
the random errors that characterize a result. Where
relatively small distances along the z-axis are being
recorded (e.g. 10 txm or less between the optical
slices), the margin of error introduced by the optical
and mechanical problems may well represent a sig-
nificant percentage of the total z-dimension. There
are some good reasons for having optical disectors
closely spaced, but the likely errors summarized
above suggest that it may be better to have a fairly
wide spacing. Where comparisons are being made
that depend on judgment calls as to whether an ob-
ject is or is not in focus, it is absolutely essential
that the observer be blind to the conditions under
investigation, and that this be clearly stated in the
description of the methods.
The z-axis also presents difficulties for quantita-
tive methods because of the shrinkage that occurs
along this axis x0. Any tissue when it is dehydrated
or hydrated during histological processing is likely
to change in volume, and different methods of prepa-
ration introduce different amounts of change. The
amount of the volume change in any part of a section
depends on the nature of the tissue, on the nature
of the treatment, and on forces that may be act-
ing on the tissue to counteract those produced by
the shrinkage itself. When a tissue block or a free-
floating section is processed, one generally assumes
that all parts of the tissue shrink equally, although
anyone who has handled individual sections of cere-
bral or cerebellar cortex after they have been exposed
to significant shrinkage, will know that the gray and
10Linear shrinkages to 70-80% are commonly found. Since this
has to be cubed to calculate the volume shrinkage one is dealing
with very significant volume changes.

the white matter do not shrink equally. In spite of
this, measurements along the x- and the y-axes, be-
fore and after processing are generally considered
to give a reasonable estimate of shrinkage, where
this measure is needed. When frozen sections or vi-
bratome sections are used, if these are fixed to the
slide, then, provided that the sections adhere firmly
to the slide, there can be no further shrinkage of the
attached section surface in the x- and y-axes, and
much of the shrinkage must occur along the z-axis.
Consequently, the amount of this shrinkage can be
relatively large. Furthermore, since one surface of
the section is firmly adherent to the slide but the
other is free, there is every reason to expect that the
amount of the shrinkage will not be uniform along
the z-axis. We know of no observations that have
investigated this point, and would expect it to vary
depending on the tissue, the method of adhesion, and
the type of treatment. Where the optical disector is
used, therefore, two caveats should be considered.
One is that two optical slices taken one above the
other from the same area of a single histological
section and measured as equal in their dimensions
along the z-axis may not represent equal thicknesses
of the original unshrunk section, and the second, a
consequence of the first, is that the precise position
along the z-axis, of a single optical slice, may make
a difference to a count if the tissue has not undergone
even shrinkage along this axis.
Some of the issues addressed above apply to all
sections, no matter how they are viewed, but the
problem of defining the focal plane is different when
the confocal microscope is used. Here the refractive
indices of tissue, mounting medium and specimen,
and the optical properties of the lens are still im-
portant, as is tissue shrinkage, but one can expect to
have a narrower extent of the z-plane in focus than
with widefield methods (see footnote 4). Given that
setting up optimal conditions for confocal micros-
copy is not simple and that many investigators rely
on technical support that a reviewer or referee can-
not evaluate, some calibration or empirical evidence
regarding the depth of focus of a confocal image
should be provided where images that are relatively
closely spaced are used.
35
Other problems
Although the problem of double counting cut objects
with profile counts has received the most attention,
there are many other sources of error, several of them
being a confusion of parameters comparable to the
confusion of cell size and cell number. Where the
number of objects within a cell group (e.g. a nuclear
group or a lamina) needs to be determined, defining
the outline of the particular cell group accurately
is critical. Many such outlines are very hard to de-
fine in terms of objective criteria, and may depend
upon features that seem obvious to an experienced
microscopist, but that are not easily rendered into a
clear written summary. There are several important
outcomes: one is that two observers working inde-
pendently in different laboratories and at different
times may well be using different criteria to identify
boundaries. Another is that the features that serve
to identify boundaries may well be affected by the
variable under study, the disease state, the age, or the
experimental condition. Architectonic studies often
rely on subtle changes from one region to another
in cell or background staining, in cell size, or cell
distribution, and if these are features that differ in
the two conditions being compared, then an objec-
tive quantitative comparison may prove very difficult
to establish. Here the staining properties of cells
or background represent parameters that influence
judgments about borders, and so can lead to erro-
neous conclusions about size of a cell group or the
number of the objects that they contain. Where com-
parisons between two disease states or experimental
conditions are being studied, the criteria used for es-
tablishing borders should be clearly defined and the
methods section should indicate that the observers
who drew the borders were blind to the disease state
or experimental condition. The issue is raised not
because we have a suggestion for entirely avoiding
the problems, but because there is a tendency in
some published accounts to treat a so-called 'unbi-
ased' method as guarantee for accuracy; it is not,
and especially in comparative counts, it is important
to identify likely sources of error no matter what
particular counting method is being used.
Sometimes one can change strategy and count
objects that show a particular property rather than
cells that are included in a nuclear group or lamina.
36
 37

For instance, one may choose to count cells that are
retrogradely labeled following a particular delivery
of axonally transported marker, or to count cells hav-
ing particular staining properties (GABA or G A D
reactive, ACh containing, or immunoreactive to one
of any number of epitopes). The obvious caveat here
is to make sure that the distinction between a change
in actual cell number and a change in the affinity of
the particular marker or stain (or the concentrations
used) is clearly recognized. Again, there is a pos-
sibility of confusing two parameters, here, staining
properties and cell numbers. For example, the differ-
ence between saying that there is a loss of cells in
the nucleus of Meynert, and saying that there is a
change in the staining properties of the cells in the
nucleus of Meynert is important unless one is willing
to assert boldly and clearly (as some are) that a cell
does not belong to the nucleus of Meynert unless
it has particular staining properties, and then one
leaves changes in total number of cells in that region
of the brain deliberately unresolved. The important
point is to be clear about what the results may mean
in terms of cell number or cell staining.
A further point about many methods that stain
particular components of a cell is that they are of-
ten not all-or-none methods. With these methods,
the strength of the reaction and, therefore, the iden-
tifiability of a positively stained cell, that is, the
final decision about the threshold between a stained
and an unstained cell, depends on the vagaries of
the method and the judgement of the observer. For
example, immunohistochemical methods often stain
the surface of a section well, but stain the inner
parts of a section weakly or not at all. If the bor-
der between these two regions is sharp, then one
can choose to study the well-stained part and ignore
the rest. However, the change in staining intensity
is more likely to be along a gradient, and decisions
about the parts of the section that are suitable for
counts will generally then be rather arbitrary. The
extent to which the reaction product can be seen in
the depth of a section may depend on the amount of
the epitope available, on properties of the matrix that
surrounds the positive cells, or on the concentrations
of antibody used, and these, rather than the number
of cells reported, may be the variable that differs be-
tween two populations being studied. This provides
yet another example of a confusion of parameters.
Electron microscopical studies
Counting objects in electron microscopic materials
presents a number of problems not encountered in
light microscopy and is, on the whole, more difficult.
If one starts with tissue preparation, then problems
of tissue shrinkage are generally comparable to prob-
lems encountered with light microscopical methods,
with one important exception. Cutting thin sections
can readily lead to a compaction of the tissue per-
pendicular to the knife edge. That is, measurements
along this axis of a section may not be equivalent
to measurements along the corresponding part of
the block face or to measurements taken parallel to
the knife edge. The point is readily checked, and
it seems reasonable to assume that where compact-
ing has occurred it is even across the whole block
face. Measurements of section thickness, where they
are needed, can be based on interference colors, or
(better) on views of folds in the section, where the
thickness of the section can be measured directly
(Small, 1968). It is generally assumed that section
thickness is even throughout any one section, since
unevenesses are readily spotted on the basis of in-
terference colors. Since sections are extremely thin
(down to about 50 nm) variations in section thickness
can be a significant fraction of the thickness itself,
and the evenness of the sections should be reported.
Occasionally, comparisons need to be made be-

Fig. 2. Six micrographs taken at six different tilt angles from the same region of the hippocampus of a rat. The axis of tilt is indicated by
the short black line at the upper left of figure A and the angle of tilt is shown in the upper right of each micrograph. The junction labeled
I is a symmetrical junction with a visible cleft in A at +47 °. At the other angles some of the vesicles that lie close to the presynaptic
membrane of this junction are more clearly shown, but otherwise there is little to identify this as a synaptic junction in B-E Junction 2
is clearly shown in D, E and F, from 0° to -27 °, but at the other angles, particularly in A, at +47 °, it is poorly defined as a synaptic
junction. Junction 3 is recognizable at all angles in this figure because the axis of tilt was roughly perpendicular to the plane of the
junction.
38

tween measurements or counts in adjacent thin and
semithin sections made by electron and light micros-
copy, respectively. The points discussed above about
the refractive index of the embedding resin may then
become important. If this differs from the refractive
index of glass and immersion oil, then some cor-
rections for measurements along the z-axis will be
required for the light microscopical observations.
Depth of focus in an electron micrograph exceeds
section thickness, so that all parts of the image are
in focus at the same time. This limits the ways
in which electron micrographs can be used. Profile
counts based on electron micrographs are generally
not advisable, since most structures to be counted are
large in relation to section thickness, which is usually
less than 100 nm. However, useful sections can be
slightly thicker than this and, since synaptic vesicles
are roughly 2 0 - 4 0 nm in diameter, they are an ex-
ception. Not only are their dimensions small relative
to section thickness, but also one can reasonably treat
them as spherical or ovoid objects that are generally
not oriented relative to section plane, or that can be
measured in more than one section plane if there
is reason to suspect some orientation of 'flattened'
vesicles. The extent to which a section through a
part of a vesicle may be invisible in an electron
micrograph will depend on the size and the nature
of the vesicle, but arriving at a determination of this
particular 'lost caps' problem may prove elusive. In
practice, counts of vesicles, unless the vesicles are
relatively large and sparsely packed, could not be
based on serial reconstructions or use the physical
disector, since the small, closely packed vesicles,
will all be in focus in any one micrograph, so that
matching from one section to the next is not feasible
for most synapses. Probably profile counts with ap-
propriate corrections are the best that one can expect
to do, and where two conditions are being compared
on the basis of vesicle packing or number, a good
record of vesicle sizes should also be provided.
Counts of larger objects, such as mitochondria,
synaptic terminals or synaptic junctions 11, are best
carried out with the physical disector method. Profile
counts would need to include unacceptably large
corrections based on the size of the objects and
the thickness of the sections. In principle, object
size can be estimated (see Anker and Cragg, 1974;
Colonnier and Beaulieu, 1985), but such estimates
represent approximations and, more importantly, are
labor-intensive so that there is a danger that the final
number will be based on relatively small samples
and thus represent rather rough estimates (which, in
some instances, may, of course, be sufficient for the
purposes of the study).
Two problems concerning counts of synaptic
junctions deserve some attention. One is the ques-
tion of defining exactly what is to be classified as
a synaptic junction. If one insists that the synaptic
cleft must be visible, the pre- and postsynaptic thick-
enings clearly distinguishable, and a small crowd of
vesicles associated with the presynaptic thickening,
then one will count relatively few synapses. Most
investigators accept obliquely cut synapses, where
the membrane thickenings are recognizable, but not
necessarily distinct (see Figs. 2 and 3), but when
this is done, it is not easy to define the point at
which an apparent thickening ceases to be classifi-
able as a synapse. Similarly, the rigidity with which
the juxtasynaptic presence of more than one vesicle
is used as a criterion can vary. This is fine, provided
that exactly the same criteria are used throughout
any one study, but becomes more difficult where two
independent studies need to be compared. Unless the
criteria are rather strictly outlined in the methods
section, it is unlikely that two laboratories will be
using exactly the same criteria. Furthermore, where
two conditions are being compared by one observer,
it is essential that a 'blind' observer make the counts.
J1The distinction between synaptic junctions and synaptic termi-
nals is important since one terminal will often establish several
junctional specializations.

Fig. 3. Four micrographs taken at four different tilt angles from the same region of a section from the hippocampus of a rat. Conventions
as in Fig. 2. The junction labeled 1 shows a clear synaptic cleft in A at -30 °, but is only poorly defined in D at +50 °. In contrast,
junction 2 has a well-defined cleft at all angles, except in A at -30 °. Junction 3, which is a symmetricaljunction, shows a well defined
cleft at -30 °, but only the presynaptic dense projections are recognizable at +30 ° and +50 °. The region labeled 4 probably represents a
junction roughly en face in A and B, with some sign of a thickening identifiable in D.
39
40
Fig. 4. When a synaptic junction is viewed en face it is difficult to recognize it as a junction, particularly if not all of it is included in a
single section. The three structures indicated by arrows in this figure may represent such en face views, partially (3) or completely (1
and 2) included in the section. However, interpreting them as synaptic junctions is necessarily tentative, and for the purpose of synaptic
counts they would almost certainly not be counted.
The second problem, which is closely related to
the first, is presented in Figs. 2 - 4 , which are elec-
tron microscopic images of sections that have been
tilted through a total of 9 0 - 1 0 0 °. Zero degrees in the
figures represents the usual position of the grid per-
pendicular to the beam. It is evident that the appear-
ance of a synaptic junction changes with a change
in the angle at which it is viewed. Most tellingly,
the appearance can be changed from one that quite
obviously represents a synaptic junction to one that
might not readily be accepted as a synaptic junction,
being only a blur or smudge that represents a synap-
tic thickening viewed en face or partially en face. It
is important to notice that although the quality of the
image deteriorates with increasing tilt (because the
beam is passing through more tissue), some synaptic
junctions are recognizable at maximum tilt, but are
absent or dubious in the untilted section.
In any single electron micrograph one can iden-
tify structures such as those illustrated in Fig. 4 that
can be interpreted as en face images of synaptic
junctions, some probably representing most or all
of a junction, whereas others represent a part of a
cut, en face junction. Unless these junctions are long
and curve into the adjacent section, they will not be
recognizable as synaptic junctions even where serial
sections are available. With thicker sections, junc-
tions viewed en face disappear completely (Scott and
Guillery, 1974), so that information about section
thickness may be important for an interpretation of
synaptic counts that are based on electron micro-
scopic images. Even so, however, we know of no
way in which one can estimate the proportion of
synaptic junctions that are unrecognizable in any one
section. Since the maximum tilt possible is generally
about 90 ° , circa 45 ° in either direction, and with
greater tilt the image becomes unusable, one cannot
examine even a small piece of tissue at all possible
tilt angles. Furthermore, for our studies, we only
had one tilt axis (indicated in the figure) available,
and could not rotate the stage in order to study a
single junction with several different tilt axes. The
conclusion that a significant proportion of synapses
cannot be seen in electron micrographs is probably
not surprising to many electron microscopists. The
problem for synaptic counts is two-fold. One is that
we have no estimate of what that proportion is. The
other, intuitively obvious, and illustrated in Figs. 2
and 3, is that the angle over which any one synapse
remains recognizable will vary. Asymmetrical junc-
tions with a thick postsynaptic thickening can take
more tilt than symmetrical junctions before they are
lost to view, and curved junctions, depending on how
the curvature relates to axis of tilt, will often remain
identifiable over greater angles than junctions that
are fiat. Small junctions are more likely to be lost
than large junctions, particularly if serial sections are
used, because few large junctions are completely flat.
The conclusions that arise from these considera-
tions are rather disconcerting, because they suggest

that in any study of synaptic junctions, no matter
whether they are profile counts or use the physical
disector, only a certain proportion of all synapses can
be identified, and, so far, we know of no methods
that would define what that proportion is. However,
this still allows useful estimates of synaptic numbers
in a tissue, by providing orders of magnitude and
ratios, and these are often all that is needed. Whether
one can use such counts for making comparisons
between two ages or two clinical or experimental
conditions, will depend on the extent to which one
can establish that variables affecting the visibility of
synaptic junctions are unchanged; that is, that there
is not a change in the curvature of some or all of
the junctions, and that the junctions do not change in
terms of the relative density of the synaptic thicken-
ings.
In view of the problems considered above, stain-
ing methods that may be selective for synaptic junc-
tions are likely to prove useful for more accurate
counts. A method earlier proposed by Bloom and
Aghajanian (1968), using ethanolic phosphotungstic
acid, reveals synaptic thickenings quite strikingly
in electron micrographs, and may still be a useful
tool, but it is likely that other methods employ-
ing post-embedding immunohistochemical staining
of specific components of the juxta-synaptic special-
izations could prove more useful. The use of the
physical disector on such preparations may provide a
means of recording numbers of synaptic junctions in
a relatively accurate way. Of course, given a method
for revealing all synaptic junctions in an electron
microscopic section, it should then be possible to
estimate the proportion of synaptic junctions that
are not seen in conventional electron micrographs,
although one should expect this proportion to vary
somewhat, from one part of the brain to another,
from one synaptic type to another, and also to de-
pend on section thickness.
Conclusions
The major conclusion for investigators planning
counts is that there is no one best method. The
method has to be suited to the nature of the material
and to the nature of the problem. It may also need to
be suited to the equipment available. There is often
significant tension between highly accurate, often
41
labor-intensive counts, which are likely to produce
small samples, on the one hand, and, on the other
hand, more rapid, possibly less accurate counts, that
can, however, produce relatively large samples. The
more that is known about the variability of the pop-
ulations, and this includes the populations of the
objects in terms of their sizes, shapes and distri-
butions, as well as the populations of organisms,
people, cats, mice etc. being studied, the clearer will
be the choice as to methods and necessary sample
sizes. No counting method is entirely free of as-
sumptions in all of its applications. Given the danger
that the term 'assumption-free', when applied to a
quantitative method, will lead to a false sense of
security about the reliability of the results and their
interpretation, it may be best for the term to he
avoided altogether and replaced by a thoughtful and
complete account of the tissues that have been used,
and the methods employed to avoid a biased result.
Acknowledgements
We thank Dr. J.B. Pawley for helpful discussions of
some of the optical problems, Dr. A.O.W. Stretton
for helpful comments on an earlier draft, and Dr. A.
Messing for the loan of a microcator. Supported by
grants EY 11494 and EY 12936.
References
Abercrombie, M. (1946) Estimation of nuclear population from
microtome sections. Anat. Rec., 94: 239-247.
Anker, R.L. and Cragg, B.G. (1974) Estimation of the number
of synapses in a volume of nervous tissue from counts in thin
sections by electron microscopy.J. NeurocytoL, 3: 725-735.
Benes, EM. and Lange, N. (2001) Two dimensional versus
three dimensional cell counting: a practical perspective. Trends
Neurosci., 24:11-17.
Bloom, EE. and Aghajanian, G.K. (1968) Fine structural and
cytochemical analysis of the staining of synaptic junctions
with phosphotungstic acid. J. Ultrastruct. Res., 22: 361-375.
Clarke, P.G.H. (1992) How inaccurate is the Abercrombie cor-
rection factor for cell counts?. Trends Neurosci., 15:211-212.
Clarke, P.G.H. (1993) An unbiased correction factor for cell
counts in histological sections. J. Neurosci. Methods, 49:133-
140.
Coggeshall, R.E. and Lekan, H.A. (1996) Methods for determin-
ing numbers of cells and synapses: a case for more uniform
standards of review. J. Comp. Neurol., 364: 3-16.
Colonnier, M. and Beaulieu, C. (1985) An empirical assessment
of stereological formulae applied to the counting of synaptic
42
discs in the cerebral cortex. J. Comp. Neurol., 231: 175-179.
Coupland, R.E. (1968) Determining sizes and distribution of
sizes of spherical bodies such as chromaffin granules in tissue
sections. Nature, 217: 384-388.
Eri~ir, A., Van Horn, S.C., Bickford, M.E. and Sherman, S.M.
(1998) Distribution of synapses in the lateral geniculate nu-
cleus of the cat. Differences between laminae A and A1 and
between relay cells and interneurons. J. Comp. Neurol., 390:
247-255.
Floderus, S. (1944) Untersuchungen fiber den Bau der mensch-
lichen Hypophyse mit besonderer BeriJcksichtung der quanti-
tativen mikromorphologischen Verh~iltnisse. Acta Pathol. Mi-
crobiol. Scand. Suppl., 53: 1-266.
Geuna, S. (2000) Appreciating the difference between design-
based and model-based sampling strategies in quantitative
morphology of the nervous system. J. Comp. Neurol., 427:
333-339.
Glaser, E.M. (1982) Snell's law: the bane of computer micro-
scopists. J. Neurosci. Methods, 5: 201-202.
Guillery, R.W. (1969) A quantitative study of synaptic intercon-
nections in the laminae of the dorsal lateral geniculate nucleus
of the cat. Z. Zellforsch., 96: 1-38.
Guillery, R.W. and Herrup, K. (1997) Quantification without
pontification: choosing a method for counting objects in sec-
tioned tissues. J. Comp. NeuroL, 386: 2-7.
Gundersen, H.J.G. and Osterby, R. (1981) Optimizing sampling
efficiency of stereological studies in biology: or 'do more less
well!'. J. Microsc., 121: 65-73.
Gundersen, H.J.G., Bagger, P., Bendtsen, T.E, Evans, S.M., Ko-
rbo, L., Marcussen, N., Moiler, A., Nielsen, K., Nyengaard,
J.R. and Pakkenberg, B. (1988) The new stereological tools:
disector, fractionator, nucleator and point sampled intercepts
and their use in pathological research and diagnosis. APM1S,
96: 857-881.
Gundersen, H.J.G., Jensen, E.B., Kieu, K. and Nielsen, J. (1999)
The efficiency of systematic sampling in stereology - - recon-
sidered. J. Microscop., 193:199-211.
Haug, H. (1956) Remarks on the determination and significance
of the gray cell coefficient. J. Comp. Neurol., 104: 473-492.
Haug, H. (1986) History of neuromorphometry. J. Neurosci.
Methods, 18: 1-17.
Haug, H. (1987) Brain sizes, surfaces and neuronal sizes of
the cortex cerebri: a stereological investigation of man and
his variability and a comparison with some mammals. Am. J.
Anat., 180: 126-142.
Hedreen, J.C. (1998) What was wrong with the Abercrombie and
empirical cell counting methods? A review. Anat. Rec., 250:
373-380.
Hendry, I.A. (1976) A method to correct adequately for the
change in neuronal size when estimating neuronal numbers af-
ter nerve growth factor treatment. J. Neurocytol., 5: 337-349.
Konigsmark, B.W. (1970) Methods for the counting of neurons.
In: W.J.H. Nauta and S.O.E. Ebbesson (Eds.), Contemporary
Research Methods in Neuroanatomy. Springer, Heidelberg, pp.
315-338.
Lange, P.W. and Edstr6m, A. (1954) Determination of thickness
of microscopic objects. Lab. Invest., 3:116-131.
Lillie, R.D. (1965) Histopathologic Technic and Practical
Histochemistry. 3rd edn., McGraw Hill, New York, NY.
Marengo, N.P. (1944) Paraffin section thickness - - a direct
method of measurement. Stain Technol., 19: 1-10.
Mayhew, T.M. and Gundersen, H.J.G. (1996) "If you assume
you can make an ass out of u and me": a decade of the
disector for stereological counting of particles in 3D space. J.
Anat., 188: 1-15.
Miller, W.S. and Carlton, E.P. (1895) The relation of the cortex
of the cat's kidney to the volume of the kidney and an
estimation of the number of glomeruli. Trans. Wisc. Acad.
Sci., 10: 525-538.
Pakkenberg, B. and Gundersen, H.J.G. (1989) New stereological
method for obtaining unbiased and efficient estimates of
total cell number in human brain areas. Exemplified by the
mediodorsal nucleus in schizophrenics. APMIS, 97: 677-681.
Pakkenberg, B. and Gundersen, H.J.G. (1995) Solutions to old
problems in the quantitation of the central nervous system. J.
Neurol. Sci., 129(Suppl 95): 65-67.
Pakkenberg, B. and Gundersen, H.J.G. (1997) Neocortical
neuron number in humans. Effect of sex and ages. J. Comp.
NeuroL, 384: 312-320.
Small, J.V. (1968) Measurements of section thickness. Proc. 4th
Eur. Cong. Electron Microsc., 1: 609.
Sterio, D.C. (1984) The unbiased estimation of number and sizes
of arbitrary particles using the disector. J. Microscop., 134:
127-136.
Scott, G.L. and Guillery, R.W. (1974) Studies with the high volt-
age electron microscope of normal, degenerating and Golgi
impregnated neural processes. J. Neurocytol., 3: 567-590.
Uylings, H.B., van Eden, C.G. and Hofman, M.A. (1986)
Morphometry of size/volume variables and comparison of
their bivariate relations in the nervous system under different
conditions. J. Neurosci. Methods, 18: 19-37.
Weibel, E.R. (1969) Stereological principles for morphometry in
electron microscopic cytology. Int. Rev. Cytol., 26: 235-302.
West, M.J. (1999) Stereological methods for estimating the total
number of neurons and synapses: issues of precision and bias.
Trends Neurosci., 22:51-61.
West, M.J. (2002) Design based stereological methods for
counting neurons. In: T. Sutula and A. Pitk~inen (Eds.), Do
Seizures Damage the Brain. Progress in Brain Research, Vol.
135. Elsevier, Amsterdam, pp. 43-51.
West, M.J. and Slomianka, L. (1998) Total numbers of neurons
in the layers of the human entorhinal cortex. Corrigendum.
Hippocampus, 8: 426.
West, M.J., Ostergaard, K., Andreassen, O.A. and Finsen, B.
(1996) Estimation of the number of somatostatin neurons in
the striatum: an in situ hybridization study using the optical
fractionator method. J. Comp. Neurol., 370:11-22.
Williams, R.W. and Rakic, P. (1988) Three dimensional count-
ing: An accurate and direct method to estimate numbers of
cells in sectioned material. J. Comp. Neurol., 278: 344-352.
Williams, R.W., Strom, R.C., Rice, D.S. and Goldowitz, D.
(1996) Genetic and environmental control of variation in reti-
nal ganglion cell number in mice. J. Neurosci., 16: 7193-7205.
T. Sutula and A. Pitkanen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Published by Elsevier Science B.V.

CHAPTER 4

Design-based stereological methods for counting neurons

M a r k J. W e s t *

Department of Neurobiology, University of Aarhus, 8000 Arhus C, Denmark

Abstract: Recently developed stereological methods for counting neurons have a number of advantages over previously
available stereological methods. These methods are most aptly referred to as 'design-based' because, in contrast to their
predecessors, the probes and the sampling schemes that define the newer methods are 'designed', that is, defined a priori,
in such a manner that one need not take into consideration the size, shape, orientation, and distribution of the objects to
be counted. The elimination of the need for information about the geometry of the objects to be counted results in more
robust data regarding estimates of total neuron number and neuronal loss because potential sources of systematic errors in
the calculations are eliminated. In this article I will describe the salient features of the newer, design-based, methods and
why they represent improvements over previously available methods.

Introduction assumption-based counting techniques and those of

A recent search of the electronic database main-
tained by the National Library of Medicine indicates
that of the approximately 9000 articles dealing with
the morphology of epilepsy, only 16 deal with mor-
phometry or quantitative anatomy and only 3 papers
in the last three years involve counting neurons. In
view of the fact that neurons are the fundamental
functional units of the nervous system and that neu-
ron loss can be viewed as a robust measure of the
cumulative damage to a region of the central nervous
system, the question arises as to why this is so. It
is the author's opinion that this state of affairs is
the consequence of the confusion that has been gen-
erated by the manner and style of the first articles
that described the new stereology and the some-
what uninformed debate that is presently going on
in the literature between the advocates of the classic
* Correspondence to: M.J. West, Department of Neuro-
biology/Anatomy, University of Aarhus, 8000 Arhus C,
Denmark. Tel.: +45-8942-3011; Fax: +45-8942-3060;
E-maih mjw@ana.au.dk
newer design-based counting techniques. Here I will
attempt to eliminate some of this confusion by de-
scribing the differences between the two approaches
and explaining some of the unique features of the
newer methods that lead to better data.
Assumption-based stereology
Previously available stereological methods for count-
ing, in large part, were based on modeled relation-
ships between the number of objects embedded in
a structure and the number of times two dimen-
sional, sectional probes intercept objects of known
size, shape, and orientation. At a theoretical level,
model-based approaches are valid and have made
valuable contributions to the field of stochastic geo-
metry, the mother of stereology. In practice, how-
ever, these model-based approaches are more aptly
referred to as 'assumption-based' methods because
one often assumed, rather than determined or esti-
mated, the size, shape, orientation, and distribution
of the modeled objects. This was primarily because
it was difficult and time consuming to actually de-
termine the degree to which the 'model' parameters
44

Fig. 1. Low-power light micrographs of a silver-stained horizontal section through the brain of a mouse. The micrographs are taken from
different parts of the CA3 pyramidal cell layer on the same section. Note that the profiles of the nuclei of the pyramidal cells appear
to have different sizes and shapes, which reflect the different shape and orientation of the nuclei in different parts of the layer. Intra-
and inter-sectional differences in the size, shape, and orientation of the nuclei within the same structure make it difficult to determine or
estimate the height, H, of objects and thereby make estimates with Eq. 1 that do not have a systematic error.

were accurate representations of the true values of
the parameters in real structures. For example, it
was often assumed that neurons or neuronal nuclei
(a frequently used counting unit) were spheres. In
many parts of the nervous system, particularly cor-
tical structures, this is the exception rather than the
rule (Fig. 1).
The principle that underlies the most fundamental
model-based approach for estimating the number of
objects in a unit volume of tissue, Nv, is based on the
relationship between the number of object profiles
per unit area of the sections, QA, the mean height
of the objects measured orthogonal to the sectioning
plane, H, and the thickness of the sections, h (Cruz-
Orive, 1997):
Nv = Q A / ( H q-h)
H + h is the average number of times that a profile
of an object can be identified in a section series.
This is the basis of the methods described by Aber-
crombie (1946) and Konigsmark (1970). Note that
this method requires either (1) a determination of H
(the mean object height) from serial constructions,
if H > h, or (2) a determination of H along the
focal axis of a thick section, if H < h. In prac-
tice, an assumption about H has most often been
used (hence the name 'assumption-based' meth-
ods) because of the difficulties encountered when
attempting to make determinations of this parameter
(Cruz-Orive and Weibel, 1990). In Fig. 2, the mean
height, H , of the objects orthogonal to the plane
of sectioning, is approximately four section thick-
nesses (actually 3.94) and there are 326 sectional
profiles. According to the formula presented above,
Nv = Q A / ( H + h) = 326/5 (which is approximately
66). In this case the volume of the region containing
the objects of interest, V(REF), would be the same as
the volume sampled, i.e. the sum of the areas of all
of the sections multiplied by the thickness of the sec-
tions, and the estimate of the total number of neurons
is estN = Nv • V ( R E F ) , that is, 66 = 6 6 . 1 . Note, that
with this approach, the accuracy of the determination
is dependent upon the accuracy of the geometrical
description of the objects, more specifically H. If an
(1)
assumption about the H of the object is not accurate,
the resulting determination of N will systematically
deviate from the true number and, in a statistical
sense, be biased. An error in measurement or false
assumption about object H, comparable to one sec-
tion thickness will in this case result in a 20% bias,
that is estN will be 326/4 or 82 rather than 66. If one
is determined to avoid making assumptions and actu-
ally make determinations of H , this should be done
in each individual, in order to avoid assumptions.
 45

A.

B.
[] oR, Borrn m ,,,[], oPn ,nn, B S=mqnB,,,n, B
96 SECTIONS

C.

LOOKUP

D.

Fig. 2. Assumption-based and disector counting. (A) Representation of a green structure that contains 66 objects of different size, shape
and orientation and that are unevenly distributed throughout the structure. The structure has been serially sectioned into 96 sections
and is viewed orthogonal to the plane of sectioning. The number of objects can be determined by (1) counting the total number of
sectional profiles that appear in the sections, 326, and dividing this number by the mean number of sectional profiles per object, 5, gives
approximately 66 objects (indirect or assumption-based counting), or (2) counting the first profiles of the objects as they are encountered,
that is the leading edges shown in yellow, as one proceeds sequentially through the series (design-based or disector counting). (B) A
histogram in which the number of leading edges, small yellow squares, is plotted as a function of the position in the series where the first
profile of an object appears when proceeding from left to right. Note that the distribution of objects is not even along the sectioning axis.
(C) A disector composed of two sections, the red and blue sections shown in (A) after being rotated 90 degrees. The objects that have
sectional profiles within these sections are shown in their entirety. Using the leading edge counting rule, three objects are counted in the
red section. (D) An expanded view of the disector seen in (C) which shows the spatial positions of the sectional profiles. The red section
is referred to as the 'sample section' and the blue as the 'lookup section'. There are sectional profiles of objects (yellow) in the sample
section that do not have sectional profiles in the 'lookup' section. (With permission of Elsevier, from West, 1999.)
46

Design-based stereology profile o f the object is apparent in the second section,

The new stereological methods are not dependent
upon the need for assumptions about the size, shape,
and orientation o f the objects being counted. This
is because of the use of a 3-D counting probe,
the disector (Sterio, 1984), rather than a 2-D probe
(i.e. the section) used in the previously available
methods. Unlike the assumption-based approach de-
scribed above, in which the numerical density, Nv,
is derived from a model relationship between the
number of object profiles counted on 2-D probes
(i.e. sections), disector counting involves the direct
counting of objects in a known volume of tissue.
In its simplest form, a disector is c o m p o s e d of two
sections: a ' s a m p l e section' and a 'lookup section'
(Fig. 2C). The volume being probed by the disector
is the product o f the area o f the ' s a m p l e section'
and the distance between the two sections. The two
requirements for proper use o f the disector probe
are: (1) any object placed within the region o f in-
terest must be able to be identified on at least one
o f the sections that pass through the region, and (2)
sectional profiles of the same object must be able to
be identified.
The disector counting rule is then: an object is
considered to be in a disector probe when a sectional
the ' s a m p l e section', and not in the first, the 'lookup
section', as one proceeds through the section series.
In essence, what one is doing is directly counting the
number o f leading edges 'tops' present in the volume
defined by the disector. Regardless of the direction
o f sectioning and the size, shape, and orientation of
the objects, there will be only one leading edge for
each object. In order to identify sectional profiles
that belong to the same object, as in the case of
branching objects, it may, however, be necessary to
have access to additional sections that are between
and adjacent to the disector pair.
Although this method o f counting has been dis-
covered and rediscovered over the centuries (Bendt-
sen and Nyengaard, 1989), a relatively recent de-
velopment has made disector counting feasible in
histological tissue in which the numbers of objects
reaches thousands and millions. This is the unbiased
areal counting frame o f Gundersen (1977) (Fig. 3),
which enables one to perform unbiased sub-sampling
of sections that have large numbers of sectional pro-
files of objects of interest. Accordingly, one samples,
at random, an area of the test section with an unbi-
ased areal counting frame. The profiles o f the objects
that lie partially or entirely within the frame and
do not intercept the forbidden line (i.e. a hyper-plane

A° B°

Fig. 3. Subsampling sections. (A) A physical disector consisting of two separate sections. The small blue square in the sample section
(red) represents an unbiased 2-D counting frame that can be used to sample a limited area of the section. Profiles of objects that are
either entirely within the frame or partially within the frame, but do not touch the green 'forbidden' line are sampled. (Not shown is the
infinite extension of the forbidden line in both directions.) When disector counting rules are used, only one object is counted (yellow
profile in upper left of frame. The volume of the disector is defined by the area of the counting frame and the thickness of the sample
section. (B) A diagrammatic representation of an optical disector. In this case, the counting grid is superimposed on an image of a thin
focal plane that is moved a known distance through a thick section. An object is counted if its leading edge comes into focus within
the counting frame, as the latter is moved through the section. The volume of the disector is defined by the area of the counting frame
and the extent of the movement of the frame through the thick section. In this example, only one object is counted. (With permission of
Elsevier, from West, 1999.)

that divides the sampling field), are defined as the ob-
jects that are to be 'tested'. One then applies disector
counting rules to the profiles sampled by the frame
and the corresponding part of the 'lookup section'.
If the sectional profile of an object, 'sampled' by the
areal counting frame placed on the 'sample section',
does not have a profile in the 'lookup section', it is
defined as an object that should be counted in the
volume defined by the disector. In this case, the latter
is the product of the area of the counting frame and
the distance between the corresponding surfaces of
the two sections.
A short time after the first descriptions of how
disector counting rules could be applied to unbiased
sub-samples of large sections, it became apparent
that the sections used to define a disector need not
be physically separate sections (Gundersen, 1986;
Gundersen et al., 1988b). By adjusting the optics
of the light microscope so that the depth of focus
was minimized (i.e. opening the diaphragm of the
sub-stage condenser lens), it was possible to apply
disector counting rules to optical sections positioned
within thick sections. It was also possible to increase
the volume of the sample by increasing the number
of consecutive optical sections, so that a virtual
'stack' of optical sections then defined the probe.
This probe was subsequently referred to as an optical
disector (West and Gundersen, 1990) and the original
disector referred to as a physical disector in order
to distinguish between the two. The volume of an
optical disector probe is then, the product of the
area of the unbiased areal counting frame and the
distance between the corresponding surfaces of the
upper and lower optical sections in the stack. Optical
disector counting is performed by superimposing an
unbiased areal counting frame on an image of an
optical section and 'moving' the counting frame a
known distance, through the thickness of the section,
with the focus control of the microscope (Fig. 4). An
object is considered to be in an optical disector if its
top comes into focus within the unbiased counting
frame, as one focuses through the section. Objects
in focus at the uppermost focal level of the optical
disector are not counted because this represents the
'look up section' of the first disector pair in the stack.
They are counted at the bottom level, since this is the
'sample section' of the last disector in the stack.
The optical disector probe has a number of advan-
47
tages over the physical disector probe when used at
the light microscopic level. First and foremost, one's
ability to find the corresponding parts of the sections
that have to be compared, when applying the count-
ing rules, is greatly simplified in that one only has to
focus up and down to find the corresponding areas of
the 'sample' and 'lookup' sections. This is a major
problem when using physically separate sections that
contain large numbers of profiles of the objects of
interest. When using the optical disector probe it is
also considerably easier to look at other 'sections'
when attempting to determine whether or not profiles
of objects at one level belong to the same object. Un-
fortunately, the optical disector concept cannot be
used at the electron microscopic (EM) level (e.g. to
count synapses). This is because the depth of focus
of an electron image is very large (in the order of
meters) and cannot be positioned or moved as a
section within of an EM section.
Disector counting is not enough
In order to obtain a truly unbiased estimate of to-
tal object number, it is not enough to just count
the objects with disector probes, it is also impor-
tant that the sections used in the analysis and the
positions on those sections to be sampled with dis-
ectors be chosen in a statistically unbiased manner.
In order to make this point clear, one should recall
that there are two, basic, 'design-based' methods for
making unbiased estimates of total object number,
N, using optical disector probes (West, 1993). One
is the 'two step' method which involves (a) making
estimates of the numerical density of objects, Nv,
from multiple samples made with optical disector
probes, and (b) making estimates of the volume of
the tissue in which they are found, V(REF), which can
be readily and efficiently obtained by point count-
ing (Gundersen et al., 1988a). According to the first
method, Nv. V(REF)= N. This method was unfor-
tunately referred to earlier in the literature as the
optical disector. To avoid confusion with the opti-
cal disector probe, it is now recommended that it
be referred to as either the 'two step' method or the
' N V • V(REF)' method. The other of the two methods is
the 'optical fractionator' method (West et al., 1991),
with which one counts, also with optical disector
probes, the number of objects, ~ Q - , in a known
48
 49

fraction, f , of the volume of the structure of interest
(Fig. 5). In this case, ~ Q - x ( I / f ) = N. The proper
implementation of optical disector probes with both
of these methods involves unbiased sampling at two
additional levels of the sampling scheme.
To make an unbiased estimate of total cell number
(i.e. an estimate obtained with a method that on
average gives the true number) with either method,
there must be a random selection of (1) the sections
used in the analysis and (2) the positions on those
sections that are sampled with the optical disectors
(Fig. 5). If this is not done at both levels, there are
constraints with regard to the conclusions that can
be drawn from the resulting estimate. For example
if one uses a 'standardized' section (Hyman et al.,
1998) or a set of sections taken from one end of the
region of interest to make counts, the estimate can
only be considered to be representative of the entire
region when, and only when (1) the Nv estimated
in that section is the same as the ratio of the total
number of neurons to the reference volume, i.e.
NCroT~/V(REF),and (2) the reference volumes, V~REF),
are the same in all individuals. The same will be the
case if one only samples on one edge or side of the
sectional profiles of the region of interest. Without a
priori knowledge about NCroTI/V(REV),this approach
would also fall into the category of 'assumption-
based' methods because the validity of the resulting
data is dependent upon the validity of the assumption
about Nv stated above and the assumption that the
reference volumes are the same in all individuals in
the study. In the biological world, assumptions of
this type are generally weak and must be addressed
openly in the discussion of any data of this type.
The potential biases inherent in the assumption-
based sampling scheme described above can be elim-
inated by designing the selection and sampling of
sections in such a manner that one does not have
to make assumptions about the distribution of the
objects of interest. As already alluded to above, the
assumption about Nv being the same as the ratio
N(TOT)/V(REF)can be eliminated if the sections and
the positions within the sections sampled by disec-
tors are randomly sampled (Miles and Davy, 1976).
That is, one uses a method of selecting (1) the sec-
tions from all of the sections that pass through the
region of interest, and (2) the positions within the
sections so that all parts of the region of interest
(i.e. along all three spatial axes) have equal proba-
bilities of being sampled. The random selection and
sampling procedures can be either independent ran-
dom or systematic random. Systematic random is
preferred because in general it is more efficient and
more readily applied to histological preparations be-
cause they are cut along one axis (Cruz-Orive, 1993;
Gundersen et al., 1999). Fig. 5 depicts the applica-
tion of such a sampling scheme. An example of a
scheme for the unbiased sampling of structures that
can only be identified at the electron microscopic
level (e.g. synapses) can be found in Geinisman et
al. (1996).
Summary
Data from design-based stereological methods for
estimating total neuron number are free from poten-
tial biases related to inaccuracies in the geometrical
description of the objects being counted. This is

Fig. 4. An optical disector. A stack of optical sections through the granule cell layer, of the dentate gyrus of the human hippocampus,
used to make an estimate of the numerical density Nv of granule cells with the optical disector technique. An unbiased counting frame
of known area (0.02 m m x 0.02 mm) is superimposed on an optical section obtained with a high numerical aperture oil immersion
objective. Each optical section (A-L) is separated by 0.002 ram. Starting with the first lookup section, (A), the nuclei sampled by the
frame are counted as one proceeds to focus through a known distance of the section thickness. (In this example nuclei, rather than cell
bodies are counted because it is easier and because there is only one nucleus per granule cell.) The profiles of nuclei within the frame
or in contact with the thin lines of the frame are considered to be inside the counting frame. Those touching the thick forbidden line
are defined as being outside the frame. The two nuclei in focus at the top level of the optical disector, level (A) (black arrows are not
counted because they do not come into focus and one proceeds to focus through the section. That is, the top of the disector is also a
forbidden line. This point is emphasized by omitting the counting frame from this level. In this optical disector, four nuclei are counted
(white arrow heads). Other nuclei that come into focus within the field, but are not sampled by the optical disector, are shown in black.
Note that the bottom level of the optical disector is (K). Profiles at this level are sampled, unlike those at level (A). Level (L) has only
been included to resolve ambiguities that may arise with branched objects (seldom the case with convex structures such as nuclei) and is
not used for counting. (With permission of Wiley-Liss, from West and Gundersen, 1990.)
50

/ a(frame)

l//Ill L-. ',,l kkXl

a
I It 1 / /
a(step)
I I ./I / I //,~ ,q P P f~l,~l I'Ll t \

P ~ II 1// I t /
I / / ~1 ' '\ ~, r ~Y'' ' l ' l
/11 I"£N \ t 7 ~d~ I I 11 \
' IIIII)kk \
lilly tll

/ I111
- 111 I I I I

Fig. 5. A diagrammatic representation of the optical fractionator sampling scheme for estimating total number of neurons expressing
somato-statin mRNA in the striatum of the rat. (a) A systematic random sample of 10-13 sections that span the entire length of the
striatum are selected for analysis. The sections are selected at equal intervals, i.e. every nth section after a random start within the first
interval, to ensure that all parts of the striatum have equal probabilities of being in the sample. The selected sections therefore constitute
a known fraction of the sections in the series, the section sampling fraction (ssf). (b) The labeled neurons are counted under a known
fraction of the section area, the area sampling fraction (asf). This fraction corresponds to the ratio of the area of the disector counting
frame, a(frame) (shown here as small black rectangles), to the area associated with each step movement of the slide, a(step) (shown
here as large white rectangles); asf = a(step)/a(frame). (c) The neurons are counted in optical disectors positioned in the central part of
the section thickness. The height of the optical disector, h, constitutes a known fraction of the section thickness, t. The ratio h/t is the
thickness sampling fraction (tsf). The area of the counting frame, a(frame), is shaded. After systematically sampling at all levels, one has
directly counted the number of neurons Y~ Q - in a known fraction of the region of interest without having to make assumptions about
the size, shape and orientation of the objects. The sum of the number of neurons in the disectors, Y~.Q - , times the product of the inverse
of the fractions, constitutes an unbiased estimate of the total number of labeled neurons in the striatum, estN = ~ Q - • l/ssf. 1/asf. t/h
Note that the volume of the structure and the numerical density are never estimated. (With permission of Wiley-Liss, from West et al.,
1996.)

b e c a u s e 3 - D p r o b e s a r e u s e d to d i r e c t l y c o u n t t h e n u m b e r is n o t a f f e c t e d b y t h e g e o m e t r y o f t h e o b -
n u m b e r o f o b j e c t ' t o p s ' in a k n o w n v o l u m e o f t i s s u e . jects. Equally important, the probes are distributed
The tops are zero-dimensional and therefore their in a r a n d o m manner throughout the three dimen-
sions of the region of interest, so that all neurons
in the region of interest have an equal probability
of being sampled, and assumptions about the distri-
bution of the objects (which also have the potential
for leading to biases) need not be made. An ap-
preciation of the differences between the recently
developed 'design-based' methods and previously
available 'assumption-based' methods can help the
investigator of structural dynamics to understand
why the newer 'designed-based' stereological meth-
ods provide more robust and useful data. The practi-
cal aspects of the application of these methods have
been described by West (1993).
References
Abercrombie, M. (1946) Estimation of nuclear population from
microtome sections. Anat. Rec., 94: 239-247.
Bendtsen, T.E and Nyengaard, J.R. (1989) Unbiased estimation
of particle number using sections - - an historical perspec-
tive with special reference to the stereology of glomeruli. J.
Microsc., 153: 93-102.
Cruz-Orive, L.M. (1993) Systematic sampling in stereology. Bull.
Int. Stat. Inst., 55: 451-468.
Cruz-Orive, L.M. (1997) Stereology of single objects. J. Mi-
crosc., 186: 93-107.
Cruz-Orive, L.M. and Weibel, E.R. (1990) Recent stereological
methods for cell biology: a brief survey. Am, J. Physiol., 258
(Lung Cell. Mol. Physiol., 2): LI48-L156.
Geinisman, Y., Gundersen, H.J.G. and West, M.J. (1996) Unbi-
ased stereological estimation of the total number of synapses
in a brain region. J. Neurocytol., 25: 805-819.
Gundersen, H.J.G. (1977) Notes on the estimation of the numer-
ical density of arbitrary particles: the edge effect. J. Microsc.,
1 I1: 219-233.
Gundersen, H.J.G. (1986) Stereology of arbitrary particles. A
review of unbiased number and size estimators and the presen-
tation of some new ones, in memory of William R. Thompsen.
J. Microsc., 143: 3-45.
Gundersen, H.J.G., et al. (1988a) Some new, simple, and efficient
stereological methods and their use in pathological research
and diagnosis. APMIS, 96: 379-394.
Gundersen, H.J.G., et al. (1988b) The new stereological tools:
disector, fractionator, nucleator, and point sampled intercepts
and their use in pathological research and diagnosis. APMIS,
96: 857-881.
Gundersen, H.J.G., Jensen, E.B., Kieu, K. and Nielsen, J. (1999)
The efficiency of systematic sampling in stereology - recon-
sidered. J. Microsc., 193: 199-211.
Hyman, B.T., Gomez-Isla, T. and Irizarry, M.C. (1998) Stere-
ology: a practical primer for neuropathology. J. NeuropathoL
Exp. Neurol., 57: 305-310.
Konigsmark, B.W. (1970) Methods for the counting of neurons.
In: W.H.J. Nauta and S.O.E. Ebbesson (Eds.), Contemporary
Research Methods in Neuroanatomy. Springer, New York, NY,
pp. 315-340.
Miles, R.E. and Davy, EJ. (1976) Precise and general condi-
tions for the validity of a comprehensive set of stereological
fundamental formulae. J. Microsc., 107:211-226.
Sterio, D.C. (1984) The unbiased estimation of number and size
of arbitrary particles using the disector. J. Microsc., 134: 127-
136.
West, M.J. (1993) New stereological methods for counting neu-
rons. Neurobiol. Aging, 14: 275-285.
West, M.J. (1999) Stereological methods for estimating the total
number of neurons and synapses: issues of precision and bias.
Trends" Neurosci., 22:51-61.
West, M.J. and Gundersen, H.J.G. (1990) Unbiased stereological
estimation of the number of neurons in the human hippocam-
pus. J. Comp. Neurol., 296: 1-22.
West, M.J., Slomianka, L. and Gundersen, H.J.G. (1991) Unbi-
ased stereological estimation of the total number of neurons
in the subdivisions of the rat hippocampus using the optical
fractionator. Anat. Rec., 231: 482-497.
West, M.J., Ostergaard, K., Andreassen, O. and Finsen, B. (1996)
Estimation of the number of somatostatin neurons in the
striatum: an in situ study using the optical fractionator. J.
Comp. Neurol., 370:11-22.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 5

The course of cellular alterations associated with

the development of spontaneous seizures
after status epilepticus

F. Edward Dudek 1,,, Jennifer L. Hellier 2, Philip A. Williams 1 Damien J. Ferraro 1 and
Kevin J. Staley 2

1 Department of Anatomy and Neurobiology, Colorado State University, Fort Collins, CO 80523, USA
2 Department of Neurology, University of Colorado Health Science Center, Denver, CO 80262, USA

Abstract: Chronic epilepsy, as a consequence of status epilepticus, has been studied in animal models in order to analyze
the cellular mechanisms responsible for the subsequent occurrence of spontaneous seizures. Status epilepticus, induced by
either kainic acid or pilocarpine or by prolonged electrical stimulation, causes a characteristic pattern of neuronal death
in the hippocampus, which is followed - - after an apparent latent period - - by the development of chronic, recurrent,
spontaneous seizures. The question most relevant to this conference is the degree to which the subsequent chronic seizures
contribute further to epileptogenesis and brain damage. This article addresses the temporal and anatomical parameters
that must be understood in order to address this question. (1) How does one evaluate experimentally whether the chronic
epileptic seizures that follow status epilepticus contribute to epileptogenesis and lead to brain damage? To answer this
question, we must first know the time course of the development of the chronic epileptic seizures, and whether the interval
between subsequent individual chronic seizures is a relevant factor. (2) What anatomical parameters are most relevant to
the progression of epilepsy? For instance, how does loss of inhibitory intemeurons potentially influence seizure generation
and the progressive development of epileptogenesis? Does axon sprouting and formation of new synaptic connections
represent a form of seizure-induced brain damage? These specific issues bear directly on the general question of whether
seizures damage the brain during the chronic epilepsy that follows status epilepticus.

Introduction 1997). Experimental status epilepticus (SE) is known

Considerable research at the molecular and cellu-
lar levels has been conducted on the mechanisms of
epileptogenesis, but most of this work has focused on
hypothetical changes thought to be important for the
development of spontaneous seizures (e.g., Dudek et
al., 1994; McNamara, 1994, 1999; Dudek and Spitz,
* Correspondence to: EE. Dudek, Department of Anatomy
and Neurobiology, Colorado State University, Fort
Collins, CO 80523, USA. Tel.: +1-970-491-2942; Fax:
+1-970-491-2623; E-mail: ed.dudek@colostate.edu
to induce death o f susceptible neurons, and to lead
to the development of chronic epilepsy (e.g., Ben-
Aft, 1985 and Nadler, 1991 for kainic acid-induced
SE). However, relatively little is known about how
the subsequent seizures associated with the chronic
epileptic state, which follows SE after an apparent
latent period, further affect the brain. The present
article will focus primarily on recent work from our
group concerning progressive changes in the dentate
gyrus after kainate-induced SE. We will consider
the SE-induced loss of hilar neurons, and the issue
of whether the chronic seizures contribute to fur-
ther neurodegeneration in the hippocampus. Data on
54
the time course of mossy fiber sprouting and the
formation of local excitatory circuits will be consid-
ered in relation to the evolution of epilepsy in the
kainate-treated rat. The dentate gyrus, aside from its
importance for hippocampal function, is considered
a model for studying changes that could occur in the
other parts of the temporal lobe. Neuronal loss in the
hilus and this form of synaptic reorganization in the
dentate gyrus have been well documented in human
tissue from patients undergoing surgical treatment
for intractable epilepsy (e.g., de Lanerolle et al.,
1989; Sutula et al., 1989; Houser et al., 1990; Babb
et al., 1991). Several technical and conceptual issues
relevant to whether chronic seizures contribute to
epileptogenesis and damage the brain, at least after
experimental SE, will be discussed.
Induction of status epilepticus (SE)
Several experimental treatments have been used to
induce SE, and they can generally be divided into
two types: injection of chemotoxins and electrical
stimulation. Kainic acid (i.e., kainate; Ben-Ari, 1985;
Nadler, 1991) and pilocarpine (Turski et al., 1983)
are the two primary chemotoxins that have been
used to induce SE. The electrical stimulation proto-
cols involve prolonged, repetitive stimulation of the
perforant path, hippocampus, or other limbic struc-
tures (e.g., Lothman et al., 1990). In both types of
models, repetitive seizures are induced for hours,
and they likely cause widespread brain damage. Al-
though these models (and their variants) probably
have some significant differences, they have many
similarities. In the hippocampus, SE causes loss of
neurons in the hilus and in the CA3 and CA1 ar-
eas, but other regions of the hippocampus and brain
are also clearly affected. Many physiological (e.g.,
receptors) and structural (e.g., dendrites and axons)
alterations, which probably occur with different time
courses, follow the SE-induced death of susceptible
neurons. Seizures are thought to occur after a latent
period of days, weeks or months (e.g., see Hellier et
al., 1998, 1999, for kainate-treated rat).
The time course of chronic seizures after SE
Several studies have reported that chronic SE-
induced motor seizures begin to occur after a latent
period, although only a few studies have provided
quantitative data (see Stafstrom et al., 1992 and Hel-
lier et al., 1998). We have analyzed this question with
direct observation (approximately 6 h/week) and 24
h video monitoring of motor seizures (Racine, 1972).
With 6 h/week monitoring, the latent period ap-
peared to be an average of 2-3 months, and there was
considerable variability across animals (Hellier et al.,
1998). This approach has the limitation that one is
monitoring the animals only about 5% of the time.
As expected, a different but complementary picture
was obtained with 24 h video monitoring (Hellier et
al., 1999). In this study, 81% of 26 kainate-treated
rats did not have any motor seizures in the first week
after kainate treatment (Fig. 1). With this treatment
protocol, virtually all kainate-treated rats develop
epilepsy (Hellier et al., 1998), and most of these
particular rats were later observed to have had one or
more motor seizures with 6 h/week monitoring. Of
the 19% (i.e., five rats) of the kainate-treated rats that
had one or more seizures during the first week after
treatment, two of the five rats had one or two motor
seizures that occurred only 1 or 2 days after the SE.
Two rats had no seizures until day 7, and then had
either one or two seizures. One rat, however, had
several motor seizures over a 3-day period, 5 - 7 days
after the treatment. Our interpretation is that the two
rats that had motor seizures within the first 2 days
after SE, but no motor seizures for the next several
days, had not become epileptic; instead, they had
seizures that were an extension of the SE. Based on
the criterion that epilepsy is defined as the condi-
tion of having had two or more unprovoked seizures,
only two of the twenty-six animals became epileptic
within the first week after treatment, and their motor
seizures began on days 5 and 7 after kainate-induced
SE. Thus, the latent period for motor seizures in
most kainate-treated rats, using this protocol, is at
least 1 week. These data are similar to the results of
Stafstrom et al. (1992).
Another issue relevant to the concept of pro-
gressive changes in epileptogenesis relates to the
question of whether seizure frequency increases with
time after SE. It is generally believed that many peo-
ple with temporal lobe epilepsy, although not all of
them, have a progressive worsening of their condi-
tion. We, therefore, asked whether the frequency of
motor seizures increases with time after SE (Hellier
 55

100
A

8O
"o

(1)
60

40
o
"E
(13

Q. 20

0
//
No seizures > 1 seizure
u)
..~
o

'-9 B
O .--

E 0 "J
z 6
Days after kainate treatment
o

.Q
E oJ i B ----
Z , I I I
0 1 2 3 4 5 6 7

Days alter kainate treatment

Fig. 1. Analysis of motor seizures during the first week after kainate-induced status epilepticus. (A) With continuous 24 h video
monitoring during the first week after kainate treatment, 81% of the rats had no spontaneous motor seizures, but the other 19% were
observed to have > 1 motor seizure. (B and C) Number of spontaneous motor seizures per day as a function of time after kainate
treatment. Of the five rats that had motor seizures during the first week after treatment, two experienced seizures within the first 27 h,
but had no subsequent seizures during the remainder of the first week. The other three rats had their first motor seizure at 5-7 days after
kainate treatment. (Reproduced from Hellier et al., 1999 with permission.)
56

0@ ~ 0.8
"O
o 0.8 A B
1~20 O

t-" ~0.6-
(/)
0.6 09 N~36
N~12 P
23
N
1~35
0.4 N~47
.~1',4 0.4-
(,9

C
~ 0.2 ~ 0.2- Plus sign represents
N-~47 D" animals used for analysis
N~471~47 ~4z in Figure 3D.
~ 0.0 I I I I I I ~ 0.0
I I I I I I I
23
N 1 2 3 4 5 6 7 23
N 0 1 2 3 4 5 6 7
(D
Months after kainate treatment (/3
Months after onset of seizures
0.8 to 0.6
C D
0.5
~0.6 t--
C
"~ o.4
N
~ 0.4 -N 0.3
N~23
N 8'0.2 t tAsterisk represents
~ O.2
C
03
significant difference
(P<0.05) from the first
,,$.-
month after onset of
0.0 ,~ o.o
seizures.
I I I I I I I I I I I
0 25 50 75 100 ._N
03
0 1 2 3 4 5 6 7 8
6O
Duration of epileptic period (%) Months after onset of seizures
Fig. 2. Seizure frequency as a function of time after kainate treatment. These data are based on a population of 47 kainate-treated rats
that had at least one seizure every 30 days after their initial seizure, and that were euthanized >4 months after kainate treatment. (A)
Graph of seizure frequency for all 47 rats. At later periods, fewer kainate-treated rats were available for the analysis, because they were
either used for experiments or died. (B) In this graph, seizure frequency is assessed as a function of time after the onset of seizures to
compensate for the different latent periods. (C) Seizure frequency as a percent of the duration of the total epileptic period. The epileptic
period was defined as the number of weeks between the onset of chronic seizures and death of the animal. These data compensate for
the effect of preferentially using animals with a high seizure frequency for electrophysiological experiments and for the observation that
those animals that had a high seizure frequency were more susceptible to death. (D) Analysis of seizure frequency as a function of time
for seven rats that were analyzed for 4-8 months. The seizure frequency at 4-8 months was significantly higher compared to 1 month
(note asterisks). (Reproduced with permission from Hellier et al., 1998.)

et al., 1998). Fig. 2 shows the results of an analysis over the next several months. On average, seizure
of motor seizure frequency as a function of time frequency reaches an apparent maximum at approxi-
after SE. The data indicate that initially the seizures mately one seizure every 2 h (0.5 seizures/h). These
occur at a low rate, and then increase in frequency data, and those of Stafstrom et al. (1992), support the

hypothesis that the epileptic state worsens for most
animals. Furthermore, the motor seizures can occur
nearly every hour, at least under some conditions in
some animals, although this requires several months
to develop. The data in Fig. 1, and described above,
emphasize the difficulty assessing the actual latent
period. Our experience suggests that analyses based
on seizure frequency are more practical than assess-
ments of the latent period, and are potentially a more
accurate approach to assessing the progressive nature
of the epileptogenesis in SE-based models.
SE causes neuronal death presumably because
repetitive seizures occur at a high rate, and several
seizures precede each subsequent seizure by a rel-
atively short time period (i.e., minutes). Does the
amount of time between seizures (i.e., the inter-
seizure interval) during chronic epilepsy contribute
to the likelihood that a seizure will cause neuronal
damage? The initial chronic motor seizures that oc-
cur shortly after SE are usually quite infrequent in
experimental animals, but after several weeks and
months, motor seizures can be observed every hour
or two. When chronic seizures occur nearly every
hour, are they more likely to be deleterious? With
intervals as short as an hour, it seems likely that
brain recovery systems are inadequate, so that an
additive effect of successive chronic seizures may be
present in a manner reminiscent to what occurs dur-
ing SE. A continuum between infrequent seizures,
clusters of seizures over several hours with short
inter-seizure intervals, and actual SE could hypo-
thetically exist. This possibility emphasizes the need
for quantitative analysis of seizure frequency as a
variable when considering this question, since the
frequency of spontaneous seizures during chronic
epilepsy may occasionally come relatively close to
the seizure frequency that occurs during SE (i.e., one
per hour versus several per hour). Because seizure
frequency increases for at least several months after
kainate-induced SE, this may be a highly vulnerable
time period in the post-SE models of temporal lobe
epilepsy.
Anatomical changes after SE: neuronal death
The issue of how one measures neuronal death is a
fundamental and long-standing problem for the field
of epilepsy research. We have chosen to analyze
57
this issue using neuron counting with stereological
methods (e.g., West and Gundersen, 1990; West et
al., 1991). In our initial analysis of kainate-treated
rats (Buckmaster and Dudek, 1997), we assessed
neuronal loss in the hilus of the dentate gyms along
the septal-temporal axis using cresyl violet and im-
munocytochemically stained tissue. We found that
about 52% of the hilar neurons in rats with kainate-
induced epilepsy (i.e., several months after treat-
ment) were lost compared to saline-treated controls,
and that neuronal loss occurred predominantly at the
temporal end of the hippocampus. In a subsequent
study (Hellier et al., 1999), we analyzed the num-
ber of neurons with similar although not identical
methods at 1 week after kainate treatment (Fig. 3).
The estimated loss of hilar neurons 1 week after
kainate treatment was about 35% relative to the con-
trois, also with a preferential loss at the temporal
end of the hippocampus. If chronic seizures did kill
neurons, one would expect more neuronal loss in
the chronically epileptic rats than in rats evaluated
1 week after SE. The apparent loss of hilar neu-
rons was greater (i.e., 52% compared to 35%) in the
rats with kainate-induced epilepsy compared to rats
1 week after treatment (i.e., before most rats have
chronic motor seizures). For the group studied many
weeks after SE, chronic seizures had been occurring
for a considerable period of time, and presumably
at a high frequency for many of them. Although
we did find fewer neurons in the hilus of the rats
with kainate-induced epilepsy compared to kainate-
injected rats 1 week after treatment, this is a post
hoc comparison and an actual quantitative analysis
would be inappropriate. First, different investigators
conducted the studies, and differences in neuronal
counting could have been a source of variance. Sec-
ond, the animals were prepared at different times,
and thus were not appropriately matched. Therefore,
although similar stereological analyses were used in
these two studies (i.e., Buckmaster and Dudek, 1997
versus Hellier et al., 1999), and the animal model
was virtually identical, it is not possible to make firm
conclusions from a direct comparison of these two
data sets. Furthermore, even if a difference in the
two experimental groups were found, it would not be
possible to conclude that the chronic seizures caused
the loss of neurons. In the long term, it would also
seem necessary to use an experimental design that
58

U)
t-

2
400 A versus after SE and chronic seizures). Furthermore,
the neurons that are lost after SE would be expected
c- 300 -~--~a[in~e, / ~ to be those most susceptible to chronic seizures.
These two general issues represent major potential
O
problems in regard to using SE-based models of
200 experimental epilepsy to determine whether chronic
E
"m seizures damage the brain. Experiments that aim to
c- 100 mark damaged neurons destined to die (e.g., TUN-
t--
6} NEL stain) necessarily assume that these neurons
0 will die, and when applied to the SE-based models,
septal middle temporal still have the limitations and caveats summarized
Portion of the septotemporal axis above.

Anatomical changes after SE: mossy fiber

3.0 B sprouting
o
O
2.5 -,-saline
0~
-o-kainate
E 2.0
E ter SE and during kindling (e.g., Mathern et al.,
iv. 1.5
¢-
m 1.0
0.5 0 O--------------~
0.0
septal middle temporal
Portion of the septotemporal axis
Fig. 3. Distribution of hilar neurons and Timm stain in the in-
ner molecular layer as a function of position along the septal-
temporal axis for saline- and kainate-treated rats. (A) The saline-
treated rats had more neurons at the temporal end (100% sep-
totemporal distance), compared to the septal end (0%). All three
regions of the hippocampus had fewer neurons in kainate-treated
rats. (B) The difference in Timm score for kainate- and saline-
treated rats was small but significant along the full extent of the
hippocampus. (Reproduced with permission from Hellier et al.,
1999.)
first blocks the chronic seizures after SE for an ap-
propriate period, and then assesses neuronal damage
relative to a group with unblocked chronic seizures.
Additional technical and conceptual problems ex-
ist in this type of experiment, and these issues should
be considered in future work. The number and pro-
portion of neurons damaged or killed after SE can
be large and variable. In this type of experiment,
this variability will be an important source of error
in a quantitative comparison of the two experimen-
tal groups (i.e., after SE but before chronic seizures
Several laboratories have reported that Timm stain
in the inner molecular layer increases with time af-
1992, 1993; Cavazos et al., 1994). We have ana-
lyzed both the histological and electrophysiological
changes that occur in the dentate gyrus as a func-
tion of time after SE (Wuarin and Dudek, 2001).
A semi-quantitative analysis of mossy fiber sprout-
ing (i.e., scores ranging from 0 to 3) was based
on the intensity and area of Timm stain in the in-
ner molecular layer (see Tauck and Nadler, 1985).
We found that mossy fiber sprouting clearly began
to occur within the first week or two after kainate
treatment. It had progressed substantially by 2-4
weeks, and had become extremely robust 10-51
weeks after treatment (Fig. 4), when virtually all
of the animals were displaying spontaneous motor
seizures. Using whole-cell recording from dentate
granule cells in hippocampal slices from kainate-
treated rats, we found that the frequency and am-
plitude of spontaneous EPSCs increased in parallel
with the Timm stain in the inner molecular layer.
Furthermore, with flash photolysis of caged gluta-
mate to stimulate relatively small regions of the
dentate granule-cell layer, we found that hippocam-
pal slices from kainate-treated rats with mossy fiber
sprouting showed EPSCs to focal stimulation of
granule cells (Fig. 5; see also Molnar and Nadler,
1999). The number of granule cells that received
excitatory input from nearby granule cells increased
progressively as a function of time after kainate-
induced SE (Fig. 6). Only 1 of 52 controls showed
 59

Controls KA-treated
n=441 n = 395 n = 519 n = 678 n = 783 n = 832
7 rats 7 rats 8 rats 1K r=f¢ 1~ r~f~ 14 r~fe
100 10

80 ~mm staining
rading scale
i rauck and Nadler,
09 • Neurosci., 5, 1985)
i
60.
t-
i = 3
09 0 = 2
~ = 1
09 40. C--] = 0
a.

20. !
i

!
0" ! i ! I
1-2 2-4 17-72 1-2 2-4 10-51

Time after treatment (weeks)

Fig. 4. Analysis of Timm staining score as a function of time after kainate treatment. Hippocampal sections from kainate-treated rats
used in electrophysiological experiments (see below) were analyzed with the Timm stain after saline or kainate treatment. The Timm
score was significantly greater in kainate-treated rats and showed a progressive increase as a function of time after kainate treatment•
All assessments were done with blind procedures, and the number of sections and rats is shown above each bar. (Reproduced with
permission from Wuarin and Dudek, 2001 .)

a similar response (Fig. 6). These data indicate that
excitatory connections from granule cells to other
granule cells increase in density as a function of time
after SE. Previous studies from our group and others
(e.g., Cronin et al., 1992; Wuarin and Dudek, 1996,
2001; Patrylo and Dudek, 1998; Hardison et al.,
2000; Lynch and Sutula, 2000) showed that epilepti-
form bursts could be evoked in the isolated dentate
gyms after robust mossy fiber sprouting had oc-
curred, months after kainate- or pilocarpine-induced
SE, if inhibition was depressed and/or extracellular
potassium was elevated slightly. Similar observations
have been made in slices of human hippocampus
with mossy fiber sprouting from patients with in-
tractable epilepsy (Franck et al., 1995). Activation of
a small population of granule cells (using focal pho-
tolysis of caged glutamate) evoked network bursts
when slices were treated with bicuculline and high
extracellular potassium, but only in preparations with
robust sprouting several months after kainate treat-
ment (Fig. 7). Burst discharges were not evoked
at earlier time periods with less Timm stain in the
inner molecular layer. These data indicate that a pro-
gressive increase in local excitatory circuits occurs
in the dentate gyrus after SE. As the density of
axon sprouting increases with more time after SE,
the dentate gyms progressively becomes more capa-
ble of generating epileptiform bursts when granule
cells are activated after inhibition is depressed and
potassium is elevated.
These data and others indicate that SE and the
consequent neuronal death are followed by a pro-
gressive increase in seizure frequency after an ap-
parent latent period. In the dentate gyms, which
serves as an experimental model, an increase in neu-
ronal death in the hilus may occur as a function
of the chronic seizures, but data from our group
are not definitive on this point. A profound in-
60

A 3

B lO

C 15

Fig. 5. Photoactivationof caged glutamate in the dentate granule-cell layer evoked repetitive EPSCs in granule cells from kainate-treated
rats with mossy fiber sprouting. Whole-cell recording at resting membrane potential from a granule cell in the outer blade from a rat 39
weeks after kainate treatment. Repetitive photostimulations(0.05 Hz) were given at one site in the granule-cell layer, 600 txm from the
recorded cell. The numbers in each trace indicate the stimulation number, and the traces are continuous in A-C. The top trace in each
panel shows baseline activity.The arrows indicate the stimulus artifact from the flash. The bottom trace in C is an expansion of the time
period marked by the dashed lines. (Reproduced with permissionfrom Wuarin and Dudek, 2001.)

crease in mossy fiber axons in the inner molecular
layer is, however, observed during the months af-
ter SE. Several laboratories have provided evidence
that this increase in mossy fiber sprouting is also
associated with the development of local excitatory
circuits (e.g., Cronin et al., 1992; Wuarin and Dudek,
1996, 2001; Molnar and Nadler, 1999; Lynch and
Sutula, 2000), and possibly also an increase in lo-
cal inhibitory circuits (Cronin et al., 1992; Sloviter,
1992; Buhl et al., 1996). Ultrastructural observations
support these electrophysiological data (Kotti et al.,
1997; Zhang and Houser, 1999; Wenzel et al., 2000).
Local inhibitory circuits are known to mask the ef-
fects of local excitatory circuits (Miles and Wong,
1987; Christian and Dudek, 1988), and when inhi-
bition is intact, the responses of the granule cells
 61

100

90 • KA-treatedrats
¢q 80 [] Saline-injected controls
ID 66%
O (n = 32)
70

t-
t~
60
t_

O
50
O~
40
¢-
Q~
30
Q}
13-
20
10%
(n = 29)
10
0% 0%
(n = 18) (n = 17)
0
1-2 2-4 10-51 (kainate)
17-72 (saline)
Time after treatment (weeks)
Fig. 6. Plot of the percentage of granule cells responding to photoactivation of caged glutamate with an increase in EPSCs as a function
of time after treatment for saline- and kainate-injected rats. For each group, the number of tested cells is indicated above the bar.
(Reproduced with permission from Wuarin and Dudek, 200l.)

are either similar to those in the normal dentate
gyrus or slightly hyperexcitable (e.g., see Patrylo et
al., 1999). Thus, the granule-cell network establishes
new forms of connectivity after the loss of approxi-
mately half of the neurons in the hilus, but inhibitory
circuits tend to mask the new excitatory interconnec-
tions. Although we cannot determine from our data
whether neuronal loss occurred over time, the pro-
gressive nature of the axon sprouting and synaptic
reorganization is well established.
Anatomical changes after SE: loss of inhibitory
interneurons
When considering neuronal damage, it is obvious
that one has to give particular consideration to the
loss of inhibitory interneurons versus principal neu-
rons. Loss of GABAergic interneurons themselves
is likely to cause hyperexcitability and seizures in
many cortical areas. Several studies have been con-
ducted on dentate granule cells using hippocampal
slices in vitro, which have had the excitatory in-
puts from the entorhinal cortex removed. In these
studies, blockade of GABAA-receptor-mediated in-
hibition and/or elevation of extracellular potassium
in control animals has minimal effect or may lead to
mild hyperexcitability in response to perforant-path
stimulation (Wuarin and Dudek, 1996, 2001; Patrylo
et al., 1999; Hardison et al., 2000; Lynch and Sutula,
2000). These experimental conditions, however, do
not lead to network bursts from hilar stimulation or
focal activation of granule cells with caged gluta-
mate in slices from control animals. On the other
hand, as summarized above, after robust mossy fiber
sprouting has occurred following experimental SE,
pronounced burst discharges have been evoked when
GABAA-receptor-mediated inhibition was depressed
and/or the concentration of extracellular potassium
was raised. Therefore, loss of inhibitory interneurons
could have a much more profound effect on the func-
62

50 mV

500 ms

~.__ ~___. ~_.., ..

®
t
Fig. 7. Photoactivation of caged glutamate in the granule-cell layer in the presence of 30 IxM bicuculline and 6 mM extracellular
potassium. Photoactivation of caged glutamate in the granule-cell layer evoked epileptiform bursts of action potentials at numerous
locations throughout the dentate gyrus when the flash was localized to the granule-cell layer (but not the hilus). The patch pipette
indicates the position of the recorded cell in the outer blade of the dentate gyms. Each number shows the location of the photostimulation
in the diagram and the correspondingbursts of action potentials. The recording was conducted in current-clampconfigurationat resting
potential (-71 mV), and the rat had been treated 33 weeks previously with kainate. The arrowheads indicate the stimulus artifact from
the flash. (Reproduced with permission from Wuarin and Dudek, 2001.)

tion of the granule-cell network when new recurrent
excitatory circuits are present than when they are
not. Several studies have provided evidence for neu-
rodegeneration, axon sprouting and formation of new
recurrent excitatory circuits in the CA1 area of the
hippocampus after treatments that induce SE (Nadler
et al., 1980; Meier and Dudek, 1996; Perez et al.,
1996; Esclapez et al., 1999; Smith and Dudek, 2001).
Thus, the formation of new recurrent excitatory cir-
cuits could be a widespread p h e n o m e n o n that occurs
in many cortical areas under a variety of epilepto-
genic conditions. Frequent seizures (i.e., during SE
or even during chronic epilepsy) could damage or
kill some interneurons, and thus not only increase
overall excitability, but also u n m a s k new recurrent
excitatory circuits. These two mechanisms would
be expected to have a combined effect to increase
seizure susceptibility, and would lead to a progres-

sive worsening of the epilepsy. Gorter et al. (2001)
found that rats with a progressive, post-SE increase
in the frequency of spontaneous seizures had both
extensive loss of parvalbumin- and somatostatin-
immunoreactive neurons and also robust T i m m stain
in the inner molecular layer compared to rats without
a progressive increase in the frequency of spon-
taneous chronic seizures, which had less of these
histopathological markers. The c o m b i n e d loss of
inhibitory interneurons and the formation of new
recurrent excitatory circuits would potentially have
a positive-feedback effect to promote epileptogene-
sis.
Conclusions
Several technical and conceptual issues are relevant
to evaluating whether the chronic seizures that de-
velop after SE damage the brain. Because SE itself
causes significant and variable neuronal death, an
evaluation of subsequent injury attributable only to
the chronic seizures is problematic. Neuronal counts,
even with an appropriate experimental design, will
be a difficult but important approach for assess-
ing whether the post-SE chronic seizures damage
the brain. If neuronal injury does result from the
chronic seizures, presumably it will become more
of a problem as seizure frequency increases weeks
and months after SE. Although it has not been clear
in our studies whether there is a gradual seizure-
dependent decline (i.e., independent of prior SE) in
the number of neurons, progressive and profound
synaptic reorganization occurs in animals and hu-
mans for months after SE. This synaptic reorgani-
zation signifies, at least partially, the formation of
new recurrent excitatory circuits, which are masked
in some areas (e.g., the dentate gyms) by strong
inhibitory circuits. Loss of inhibitory interneurons,
either during or after the injury, would tend to
unmask abnormal recurrent excitatory circuits and
other potential epileptogenic mechanisms (e.g., up-
regulated N M D A receptors). Progressive loss of in-
hibitory interneurons would be expected to augment
the electrophysiological effects of new excitatory lo-
cal circuits. These abnormal circuits would presum-
ably contribute to cognitive deficits that can occur
in animal models (Stafstrom et al., 1993) and some
people with epilepsy. These issues and concerns are
63
likely to be important to an analysis of whether
seizures lead to brain damage.
References
Babb, T.L., Kupfer, W.R., Pretorius, J.K., Crandall, RH. and
Levesque, M.E (1991) Synaptic reorganization by mossy
fibers in human epileptic fascia dentate. Neuroscience, 42:
351-363.
Ben-Aft, Y. (1985) Limbic seizures and brain damage produced
by kainic acid: Mechanisms and relevance to human temporal
lobe epilepsy. Neuroscience, 14: 375-403.
Buckmaster, ES. and Dudek, EE. (1997) Neuron loss, granule
cell reorganization, and functional changes in the dentate gyrus
of epileptic kainate-treated rats. J. Comp. Neurol., 385: 385-
404.
Buhl, E.H., Otis, T.S. and Mody, I. (1996) Zinc-induced collapse
of augmented inhibition by GABA in a temporal lobe epilepsy
model. Science, 271: 369-373.
Cavazos, J.E., Das, I. and Sutula, T.E (1994) Neuronal loss
induced in limbic pathways by kindling: evidence for induc-
tion of hippocampal sclerosis by repeated brief seizures. J.
Neurosci., 14: 3106-3121.
Christian, E.E and Dudek, EE. (1988) Characteristics of local
excitatory circuits studied with glutamate microapplication in
the CA3 area of rat hippocampal slices. J. Neurophysiol., 59:
90-109.
Cronin, J., Obenaus, A., Houser, C.R. and Dudek, EE. (1992)
Electrophysiology of dentate granule cells after kainate-
induced synaptic reorganization of the mossy fibers. Brain
Res., 573: 305-310.
De Lanerolle, N.C., Kim, J.H., Robbins, R.J. and Spencer, D.D.
(1989) Hippocampal interneuron loss and plasticity in human
temporal lobe epilepsy. Brain Res., 495: 387-395.
Dudek, EE. and Spitz, M. (1997) Hypothetical mechanisms for
the cellular and neurophysiologic basis of secondary epilep-
togenesis: proposed role of synaptic reorganization. J. Clin.
Neurophys., 14: 90-101.
Dudek, EE., Obenaus, A., Sehweitzer, J.S. and Wuarin, J.-E
(1994) Functional significance of hippocampal plasticity in
epileptic brain: electrophysiological changes of the dentate
granule cells associated with mossy fiber sprouting. Hip-
pocampus, 4: 259-265.
Esclapez, M., Hirsch, J.C., Ben-Ari, Y. and Bernard, C. (1999)
Newly formed excitatory pathways provide a substrate for
hyperexcitability in experimental temporal lobe epilepsy. J.
Comp. Neurol., 408: 449-460.
Franck, J.E., Pokorny, J., Kunkel, D.D. and Schwartzkroin, EA.
(1995) Physiologic and morphologic characteristics of granule
cell circuitry in human epileptic hippocampus. Epilepsia, 36:
543-558.
Gorter, J.A., van Vliet, E.A., Aronica, E. and Lopes da Silva,
F.H. (2001) Progression of spontaneous seizures after sta-
tus epilepticus is associated with mossy fibre sprouting and
extensive bilateral loss of hilar parvalbumin and somatostatin-
immunoreactive neurons. Eur. J. Neurosci., 13: 657-669.
64
Hardison, J.L., Okazaki, M.M. and Nadler, J.V. (2000) Modest
increase in extracellular potassium unmasks effect of recurrent
mossy fiber growth. J. Neurophysiol., 84: 2380-2389.
Hellier, J.L., Patrylo, P.R., Buckmaster, P.S. and Dudek, EE.
(1998) Recurrent spontaneous motor seizures after repeated
low-dose systemic treatment with kainate: assessment of a rat
model of temporal lobe epilepsy. Epilepsy Res., 31: 73-84.
Hellier, J.L., Patrylo, P.R., Dou, P., Nett, M., Rose, G.M. and
Dudek, EE. (1999) Assessment of inhibition and epileptiform
activity in the septal dentate gyrus of freely behaving rats
during the first week after kainate treatment. J NeuroscL, 19:
10053-10064.
Houser, C.R., Miyashiro, J.E., Swartz, B.E., Walsh, G.O., Rich,
J.R. and Delgado-Escueta, A.V. (1990) Altered patterns of
dynorphin immunoreactivity suggest mossy fiber reorganiza-
tion in human hippocampal epilepsy. J. Neurosci., 10: 267-
282.
Kotti, T., Riekkinen Sr., P.J. and Miettinen, R. (1997) Characteri-
zation of target cells for aberrant mossy fiber collaterals in the
dentate gyrus of epileptic rat. Exp. NeuroL, 146: 323-330.
Lothman, E.W., Bertram, E.H., Kapur, J. and Stringer, J.L.
(1990) Recurrent spontaneous hippocampal seizures in the
rat as a chronic sequela to limbic status epilepticus. Epilepsy
Res., 6: 110-118.
Lynch, M. and Sutula, T. (2000) Recurrent excitatory connectiv-
ity in the dentate gyrus of kindled and kainic acid-treated rats.
J. Neurophysiol., 83: 693-704.
Mathern, G.W., Kupfer, W.R., Pretorius, J.K., Babb, T.L. and
Levesque, M.E (1992) Onset and patterns of hippocampal
sprouting in the rat kainate seizure model: evidence for pro-
gressive cell loss and neo-innervation in regio inferior and
superior. Dendron, 1: 69-84.
Mathern, G.W., Cifuentes, E, Leite, J.P., Pretorius, J.K. and
Babb, T.L. (1993) Hippocampal EEG excitability and chronic
spontaneous seizures are associated with aberrant synaptic
reorganization in the rat intrahippocampal kainate model. Elec.
Clin. Neurophysiol., 87: 326-339.
McNamara, J.O. (1994) Cellular and molecular basis of epilepsy.
J. Neurosci., 14: 3413-3425.
McNamara, J.O. (1999) Emerging insights into the genesis of
epilepsy. Nature, 24: 15-22.
Meier, C.L. and Dudek, EE. (1996) Spontaneous and
stimulation-induced synchronized bursts after discharges in
the isolated CA1 of kainate-treated rats. J. Neurophysiol., 76:
2231-2239.
Miles, R. and Wong, R.K. (1987) Inhibitory control of local
excitatory circuits in the guinea-pig hippocampus. J. Physiol.,
388: 611-629.
Molnar, P. and Nadler, J.V. (1999) Mossy fiber-granule cell
synapses in the normal and epileptic rat dentate gyrus studied
with minimal laser stimulation. J. NeurophysioL, 82: 1883-
1894.
Nadler, J.V. (1991) Kainic acid as a tool for the study of temporal
lobe epilepsy. Life Sci., 29:2031-2042.
Nadler, J.V., Perry, B.W. and Cotman, C.W. (1980) Selective
reinnervation of hippocampal area CA1 and the fascia den-
tata after destruction of CA3-CA4 afferents with kainic acid.
Brain Res., 182: 1-9.
Perez, Y., Morin, E, Beaulieu, C. and Lacaille, J.-C. (1996)
Axonal sprouting of CA1 pyramidal cells in hyperexcitable
hippocampal slices of kainate-treated rats. Eur. J. Neurosci., 8:
736-748.
Patrylo, P.R., Schweitzer, J.S. and Dudek, EE. (1999) Abnormal
responses to perforant path stimulation in the dentate gyrus of
slices from rats with kainate-induced epilepsy and mossy fiber
reorganization. Epilepsy Res., 36:3631-3642.
Patrylo, P.R. and Dudek, F.E. (1998) Physiological unmasking of
new glutamatergic pathways in the dentate gyrus of hippocam-
pal slices from kainate-induced epileptic rats. J. Neurophysiol.,
79: 418-429.
Racine, R.J. (1972) Modification of seizure activity by electri-
cal stimulation, II. Motor seizures. Electroencephalogr. Clin.
Neurophysiol., 32: 281-294.
Sloviter, R.S. (1992) Possible functional consequences of synap-
tic reorganization in the dentate gyrus of kainate-treated rats.
Neurosci. Lett., 137: 91-96.
Smith, B.N. and Dudek, EE. (2001) Short- and long-term
changes in CA1 network excitability after kainate treatment
in rats. J. Neurophysiol., 85: 1-9.
Stafstrom, C.E., Thompson, J.L and Holmes, G.L. (1992) Kainic
acid seizures in the developing brain: status epilepticus and
spontaneous recurrent seizures. Dev. Brain Res., 65: 227-236.
Stafstrom, C.E., Chronopoulos, A., Thurber, S., Thompson, J.L.
and Holmes, G.L. (1993) Age-dependent cognitive and behav-
ioral deficits after kainic acid seizures. Epilepsia, 34: 420-
432.
Sutula, T., Cascino, G., Cavazos, J., Parada, I. and Ramirez, L.
(1989) Mossy fiber synaptic reorganization in the epileptic
human temporal lobe. Ann. Neurol., 26: 321-330.
Tauck, D.L. and Nadler, J.V. (1985) Evidence of functional
mossy fiber sprouting in hippocampal formation of kainic
acid-treated rats. J. Neurosci., 5: 1016-1022.
Turski, W.A., Cavalheiro, E.A., Schwarz, M., Czuczwar, S.J.,
Kleinrok, Z. and Turski, L. (1983) Limbic seizures produced
by pilocarpine in rats: behavioural, electroencephalographic
and neuropathological study. Behav. Brain Res., 9: 315-335.
Wenzel, H.J., Woolley, C.S., Robbins, C.A. and Schwartzkroin,
P.A. (2000) Kainic acid-induced mossy fiber sprouting and
synapse formation in the dentate gyrus of rats. Hippocampus,
10: 244-260.
West, M.J. and Gundersen, H.J. (1990) Unbiased stereological
estimation of the number of neurons in the human hippocam-
pus. J. Comp. NeuroL, 296: 1-22.
West, M.J., Slomianka, L. and Gundersen, H.J.G. (1991) Unbi-
ased stereological estimation of the total number of neurons
in the subdivisions of the rat hippocampus using the optical
fractionator. Anat. Rec., 231: 482-497.
Wuarin, J.-E and Dudek, EE. (1996) Electrographic seizures
and new recurrent excitatory circuits in the dentate gyrus
of hippocampal slices from kainate-treated epileptic rats. J.
Neurosci., 16: 4438-4448.
Wuarin, J.-P. and Dudek, F.E. (2001) Excitatory synaptic input
 65

to granule cells increases with time after kainate treatment. J. of dynorphin in the dentate gyrus in human temporal lobe
NeurophysioL, 85: 1067-1077. epilepsy: a study of reorganized mossy fiber synapses. J.
Zhang, N. and Houser, C.R. (1999) Ultrastructural localization Comp. Neurol., 405: 472-490.
T. Sutulaand A. Pitk~inen(Eds.)
Progress in Brain Research, Vol. 135
© 2002 ElsevierScienceB.V.All rightsreserved

CHAPTER 6

Progression of neuronal damage after status epilepticus and

during spontaneous seizures in a rat model of temporal
lobe epilepsy

Asia Pitk~inen 1,3,,, Jari Nissinen 1, Jaak Nairism~igi 2, Katarzyna Lukasiuk 1,

Olli H.J. Gr6hn 2, Riitta Miettinen 3,4 and Risto Kauppinen 2

I Epilepsy Research Laboratory and e NMR Research Group, A.L Virtanen Institute for Molecular Sciences, University of Kuopio,
PO. Box 1627, F1N-70 211 Kuopio, Finland
3Department of Neurology, Kuopio University Hospital, P.O. Box 1777, FIN-70 211 Kuopio, Finland
4 Department of Neurology and Neurosciences, University of Kuopio, P.O. Box 1627, FIN- 70 211 Kuopio, Finland

Abstract: The present study was designed to address the question of whether recurrent spontaneous seizures cause
progressive neuronal damage in the brain. Epileptogenesis was triggered by status epilepticus (SE) induced by electrically
stimulating the amygdala in rat. Spontaneous seizures were continuously monitored by video-EEG for up to 6 months.
The progression of damage in individual rats was assessed with serial magnetic resonance imaging (MRI) by quantifying
the markers of neuronal damage (T2, T10, and Dav) in the amygdala and hippocampus. The data indicate that SE induces
structural alterations in the amygdala and the septal hippocampus that progressively increased for approximately 3 weeks
after SE. T2, T~p, and Dav did not normalize during the 50 days of follow-up after SE, suggesting ongoing neuronal death
due to spontaneous seizures. Consistent with these observations, Fluoro-Jade B-stained preparations revealed damaged
neurons in the hippocampus of spontaneously seizing animals that were sacrificed up to 62 days after SE. The presence of
Fluoro-Jade B-positive neurons did not, however, correlate with the number of spontaneous seizures, but rather with the
time interval from SE to perfusion. Further, there were no Fluoro-Jade B-positive neurons in frequently seizing rats that
were perfused for histology 6 months after SE. Also, the number of lifetime seizures did not correlate with the severity of
neuronal loss in the hilus of the dentate gyms assessed by stereologic cell counting. The methodology used in the present
experiments did not demonstrate a clear association between the number or occurrence of spontaneous seizures and the
severity of hilar cell death. The ongoing hippocampal damage in these epileptic animals detected even 2 month after SE
was associated with epileptogenic insult, that is, SE rather than spontaneous seizures.

Introduction labeling (TUNEL), or immunohistochemical tech-

Analysis of histologic preparations stained using
Nissl, silver, terminal deoxytransferase nick end-
* Correspondence to: A. Pitk~inen, Epilepsy Research Lab-
oratory, A.I. Virtanen Institute, University of Kuopio, P.O.
Box 1627 (street address: Neulaniementie 2), FIN-70 211
Kuopio, Finland. Tel.: +358-17-16-3296; Fax: -+-358-17-
16-3025; E-mail: asla.pitkanen@uku.fi
niques indicates that even a few electrically induced
kindled seizures can cause a loss of subpopulations
of neurons in the amygdala (Callahan et al., 1991;
Pretel et al., 1997; Tuunanen et al., 1997; Tuuna-
nen and Pitk~inen, 2000) and hippocampus (Cavazos
et al., 1994; Bengzon et al., 1997; Pretel et al.,
1997; Dalby et al., 1998; Zhang et al., 1998). In
the hippocampus, the severity of neuronal damage
correlates with the number of afterdischarges, that is,
68
evoked seizures in a kindling model (Cavazos et al.,
1994), and its distribution depends on the stimulation
site (Kotloski et al., 2002). Finally, the severity of
damage correlates with the impairment in cognitive
performance (Sutula et al., 1995).
Several lines of evidence suggest that brief
seizures can also cause damage in the human epilep-
tic brain. The neurochemical basis for this damage is
explained by the study of During and Spencer (1993)
who demonstrated a potentially neurotoxic 8-fold in-
crease in the extracellular levels of glutamate in the
hippocampus after secondarily generalized sponta-
neous seizures. Several studies indicate an increase
in the cerebrospinal fluid (CSF) level of neuron-
specific enolase (y-enolase), a marker of irreversible
neuronal damage, after brief seizures (Jacobi and
Reiber, 1988; Rabinowicz et al., 1994, 1996; Greffe
et al., 1996; Tumani et al., 1999). Further evidence
comes from a classic histologic study of Mourizen-
Dam (1982) who reported that hippocampal neu-
ronal loss correlates with the number of generalized
seizures and the duration of epilepsy. More recent
histopathologic analysis of patients undergoing hip-
pocampal resection due to drug-refractory temporal
lobe epilepsy (TLE) favors the idea that both the
initial insult as well as recurrent seizures contribute
to the damage (Mathern et al., 1995). The study by
Henshall et al. (2000a) suggests that programmed
cell death contributes to ongoing neuronal damage
in the brain of patients with epilepsy. In addition to
neuronal damage, an 11-fold increase in microglia in
the CA1 subfield and a 3-fold increase in the CA3
subfield of the hippocampus in patients with TLE
undergoing surgery due to drug-refractory seizures
support the idea of continuing neuronal injury due to
ongoing seizure activity (Beach et al., 1995).
Whether recurrent seizures cause progressive neu-
ronal loss has also recently been addressed in cross-
sectional as well as follow-up magnetic resonance
imaging (MRI) studies. Our cross-sectional MRI vol-
umetry studies of patients with TLE indicated that
only 5% of patients with newly diagnosed epilepsy
(< 1 year of TLE) had a unilateral hippocampal
volume reduction of at least 2 standard deviations
(SDs) of the control mean (Salmenper~i et al., 2001).
In chronic patients who experienced more than two
seizures per year for more than 20 years, however,
there was a volume reduction of at least 2 SDs in the
hippocampus in 50% of patients (Salmenper~i et al.,
2001). The severity of the hippocampal damage cor-
related with the lifetime number of seizures (K~ilvi~ii-
nen et al., 1998; Salmenper~i et al., 2001). Consistent
with our observations, Van Paesschen et al. (1997)
concluded that the degree of hippocampal volume
loss might be associated with the number of general-
ized seizures. The cross-sectional MR spectroscopy
study by Tasch et al. (1999) demonstrated that the N-
acetyl aspartate (NAA)/creatine (Cr) ratio correlated
negatively with the duration of epilepsy, and they
concluded that generalized seizures might cause pro-
gressive neuronal dysfunction or loss. The follow-up
study by Van Paesschen et al. (1998) demonstrated
that two patients exhibited a hippocampal volume
loss over a 1-year follow-up. O'Brien et al. (1999)
described a case study in which a 28-year-old man
with refractory TLE had progressive hippocampal at-
rophy of 12% over a period of 4 years. Another case
study by Jackson et al. (1999) demonstrated a 47%
hippocampal volume decrease over 8 months in a 23-
year-old male with three tonic-clonic seizures. More
recently, there have been several other case stud-
ies demonstrating progressive hippocampal damage
in patients with epilepsy (see Sutula and Pitk~inen,
2001).
Taken together, data accumulating from histologic
analyses of brains from kindled rats support the idea
that brief seizures can cause neuronal loss. Imaging
studies indicate that spontaneous brief seizures last-
ing less than 2 min can also cause progressive dam-
age in humans, at least in some individuals. In kin-
dling, however, the seizures are induced electrically
and the data from humans are based on volumetric
measurement, which is an indirect indicator of cel-
lular death. Also, no direct evidence is available on
spontaneous seizure models in animals. Therefore,
it has remained under dispute whether spontaneous
seizures can cause neuronal loss. In retrospective
human studies it has also been difficult to differenti-
ate the contribution of the underlying epileptogenic
insult versus recurrent seizures to overall damage.
The present study was designed to address the
question of whether recurrent spontaneous seizures
cause progressive neuronal damage in the brain using
MRI and histologic techniques. We used an exper-
imental model of TLE in which epileptogenesis is
triggered by electrically induced status epilepticus

(SE). In this model, a subpopulation of rats develops
epilepsy with frequent spontaneous seizures (mean
seizure frequency up to 31 seizures per day; Nissinen
et al., 2000). Spontaneous seizures were monitored
using a continuous video-EEG recording system.
According to our hypothesis, the lifetime number
of spontaneous seizures should correlate with the
severity of neuronal loss. Further, rats with frequent
seizures should have signs of ongoing brain damage.
Materials and methods
Animals
Male Sprague-Dawley rats (275-325 g) were used
in the present study. After implantation of electrodes,
rats were housed in individual cages at a temperature
of 19-21°C, with humidity maintained at 50 to 60%
and lights on from 0700 to 1900. Standard food
pellets and water were freely available. All animal
procedures were conducted in accordance with the
guidelines set by the European Community Council
Directives 86/609/EEC.
To mimic the process of human TLE, three
rat groups were included in the study: 'newly di-
agnosed', 'recently diagnosed', and 'chronic' rats
with epilepsy. In 'the newly diagnosed group', self-
sustained SE was induced by electrically stimulating
the lateral nucleus of the amygdala in 16 adult male
Sprague-Dawley rats. The animals were allowed
to recover from SE spontaneously. Nonstimulated
electrode-implanted rats (n = 16) served as controls.
Rats were monitored with video-EEG continuously
24 h/day via cortical electrode until they developed
a second spontaneous seizure and 11 days thereafter,
before being perfused for histology.
In 'the recently diagnosed group', self-sustained
SE was induced in 30 rats. To investigate the effect
of the duration of SE on neuronal damage, SE was
stopped with diazepam (15 m g / k g and 10 mg/kg 8 h
later, intraperitoneally) after the rats experienced 5 or
fewer high-amplitude and high-frequency discharges
( H A F D s 1; n = 7), after 6 to 50 HAFDs (n = 15), or
I A conspicuous feature of EEG activity during SE is the
occurrence of high-amplitude and high-frequency discharges
(HAFDs), which are typically associated with behavioral
69
after more than 50 HAFDs (n = 8). Rats were mon-
itored with video-EEG (every other day, 24 h/day)
for 60 days, and thereafter, perfused for histology. In
addition, there were 14 electrode-implanted unstim-
ulated controls.
In 'the chronic group', self-sustained SE was in-
duced in 16 rats. The rats were monitored with video-
EEG for 6 months (24 h/day, every other day). In
addition, there were 8 electrode-implanted controls.
Implantation of electrodes
The animals were anesthetized with intraperitoneal
injection of sodium pentobarbital (60 mg/kg) and
chloral hydrate (100 mg/kg) and placed in a stereo-
taxic frame. A pair of stimulation electrodes (0.5
m m vertical tip separation) was implanted into the
lateral nucleus of the left amygdala (3.6 m m poste-
rior, 5.0 m m lateral, and 6.5 m m ventral to bregma).
One stainless-steel screw was inserted as a corti-
cal electrode into the skull above the right frontal
cortex (3 mm anterior to bregma, 2 m m lateral to
midline). Two stainless-steel screws were inserted
as indifferent and ground electrodes into the skull
bilaterally over the cerebellum. The electrodes were
fixed with dental acrylate. The rats were allowed to
recover from the surgical operation for 14 days until
electrical stimulation was started.
Induction of self-sustained SE
Afterdischarge threshold was assessed by stimulating
the amygdala with a 1-s train of 60 Hz, 50 to 400
IxA (peak to peak), 1-ms bipolar square-wave pulses.
Only those rats in which afterdischarges could be
induced at a current level of 400 txA or lower were
included in the study.
To induce SE, the amygdala was stimulated with
2 trains/s of 1-ms, 60-Hz bipolar pulses (each train
lasting 100 ms) at 400 lxA current (peak to peak).
After 20 rain of continuous stimulation, the stimula-
tion was interrupted, and the behavioral and electro-
graphic seizure activity of the animal was observed
seizures. HAFDs are defined as a high-amplitude (>2 x base-
line) and high-frequency (>8 Hz) discharge in the amygdala or
in the cortex (or both) that lasts for at least 5 s.
70
for 60 s. If the behavior of the animal revealed the
presence of epileptic activity (head nodding/or limb
clonus), the observation period was extended up to
10 min. If the animal did not meet the criterion
of clonic SE (continuous epileptiform spiking and
recurrent clonic seizures), stimulation was resumed
and the behavior of the animal was checked again
after 5 min. Once the criterion of SE was achieved,
no further stimulation was given.
Electrophysiologic characterization of SE and
spontaneous seizures
To electrophysiologically characterize the duration
and severity of SE, seizure activity was recorded by
a digital video-EEG system as described previously
in detail (Nissinen et al., 2000). The severity of
SE was assessed by counting the number of HAFD
during SE. The duration of SE was defined as an
interval between the first and last HAFD.
The occurrence of spontaneous seizures was de-
termined based on the analysis of EEG data. If
an electrographic seizure was observed, the severity
of the behavioral seizure was scored based on the
video. Criterion for an epileptic seizure was a high-
frequency (>5 Hz), high-amplitude (>2 x baseline)
discharge either in the amygdala or in the cortex (or
both) that lasted for at least 5 s.
Characterization of behavioral seizures
During the stimulation and follow-up periods, the
behavior of the rats was recorded using a video
camera that was time-locked with the digital EEG.
Behavioral motor seizure activity was classified ac-
cording to a slightly modified Racine scale (Racine,
1972). Score 0: electrographic seizure without any
detectable motor manifestation. Score 1: mouth and
face clonus, head nodding. Score 2: clonic jerks
of one forelimb. Score 3: bilateral forelimb clonus.
Score 4: forelimb clonus and rearing. Score 5: fore-
limb clonus with rearing and falling.
Histologic analysis of brain tissue
Fixation
Rats were deeply anesthetized and perfused intra-
cardially according to the fixation protocol for Timm
staining (Sloviter, 1982). The brains were postfixed
in the fixative for 4 h and then cryoprotected in a
solution containing 20% glycerol in 0.02 M potas-
sium phosphate buffer, pH 7.4 for 24 h. The brains
were then blocked, frozen in dry ice, and stored at
- 7 0 ° C until cut. They were sectioned in the coronal
plane in a one-in-five series at a thickness of 30
Ixm (newly diagnosed, recently diagnosed groups) or
50 txm (chronic group) with a sliding microtome.
The sections were stored in a cryoprotectant tissue-
collecting solution (TCS; 30% ethylene glycol, 25%
glycerol in 0.05 M sodium phosphate buffer) at
- 2 0 ° C until processing.
Assessment of neuronal damage in thionin staining
One series of sections was stained with thionin to
characterize the cytoarchitectonic boundaries of var-
ious brain regions and to locate the electrode tips.
These sections were also used to assess the severity
of neuronal damage by counting cells. The hip-
pocampus was partitioned into different regions ac-
cording to the nomenclature described by Amaral
and Witter (1995).
Stereologic estimation of total neuronal numbers
in the hilus. Stereologic analyses were conducted
blindly with respect to the treatment status of the
animal. The optical fractionator method was im-
plemented using Stereo Investigator software in a
Neuro Lucida morphometry system (MicroBright-
Field, Germany) with guidelines described by West
et al. (1991). A color video camera (Hitachi HV-
C20, Japan), interfaced with an Olympus BX50
microscope, was used to view sections on a high-
resolution monitor, and neuroanatomic borders of
the hilus were digitized under low-power magnifica-
tion. Subsequent cell counting was confined within
these borders. The sections were inspected according
to a systematic random sampling scheme such that
counts were derived from a known and representa-
tive fraction of the hilus. Specifically, the motorized
stage of the microscope system was under computer
control, and the hilar fields in every histologic sec-
tion were surveyed at evenly spaced x-y intervals
of 180 x 180 txm for the hilus. For each x-y step,
cell counts were derived from a known fraction of

the total area using an unbiased counting frame that
was 36 x 36 txm. Counting was performed through-
out the section, avoiding the neurons that were in
focus at the surface of the section. Neuronal nu-
clei were counted only as they first came into focus
within each optical dissector. Glia, identified by size
and cytologic characteristics, were excluded from
the counts. Finally, the total neuron number was esti-
mated by multiplying the sum of the neurons counted
by the reciprocal of the fraction of the hippocampus
that was sampled (i.e., a multiple of the fraction of
the histologic sections examined, the fraction of the
x-y step interval covered by the counting frame, and
the fraction of the total section thickness examined).
Assessment of neuronal density in the septal and tem-
poral hilus. Because the severity of hilar cell damage
varies along the septotemporal axis of the hippocam-
pus, the density of hilar cells was estimated from the
septal and temporal ends of the hippocampus sepa-
rately. At the septal end, the neuronal density was
assessed from three sections that were systematically
sampled at 450-txm (newly diagnosed and recently
diagnosed animals) or 200-~tm intervals (chronic
animals) starting at the level at which the suprapyra-
midal and infrapyramidal blades of the granule cell
layer form a continuous band of cells. At the tempo-
ral end, the neuronal density was assessed from two
adjacent sections (150 txm apart) at the level where
the granule cell layer forms an oval shape.
Using Stereo Investigator software in the Neuro
Lucida morphometry system described above, hilar
fields in every histologic section were surveyed at
evenly spaced x-y intervals (70 x 70 ~tm septally,
150 × 150 Ixm temporally). For each x-y step, cell
counts were derived from a known fraction of the
total area using a counting frame that was 25 × 25
Ixm septally and 30 x 30 Ixm temporally. Because the
area of the hilus in the epilepsy groups did not differ
from that in controls, neuronal density was calcu-
lated by dividing the neuronal number by the area.
The mean density was used for the statistical anal-
ysis. Analyses were conducted blindly with respect
to the treatment status of the animal. To compare the
severity of damage between the groups, the sever-
ity of damage was transformed to damage-%, that
is (density of neurons in experimental animal/mean
density of neurons in the control group) x 100%.
71
Assessment of neuronal damage in Fluoro-Jade B
preparations
An adjacent series of sections (1 in 10) was stained
with Fluoro-Jade B according to the protocol de-
scribed by Schmued et al. (1997). The density of
Fluoro-Jade B-positive neurons was semiquantita-
tively assessed as follows (Fig. 3A). Score 0: no
damage. Score 1: lesions involving less than 20%
of neurons in the region of interest. Score 2: lesions
involving 21 to 50% of neurons. Score 3: lesions
involving 51 to 100% of neurons. The damage score
was based on the analysis of all sections in which the
region of interest was present.
To visualize the distribution of Fluoro-Jade B-
positive cells, fluorescent neurons were plotted us-
ing a fluorescent microscope, Leitz DMRD (Leitz,
Wetzlar, Germany) equipped with a computer-aided
digitizing system (Minnesota Datametrics, St. Paul,
MN). To determine the location of plotted fluores-
cent neurons, cytoarchitectonic borders of the region
of interest were drawn using a camera lucida from
adjacent thionin-stained sections with a stereo mi-
croscope and a drawing tube. Thereafter, cytoarchi-
tectonic outlines were superimposed on computer-
generated plots using Canvas 3.5 (Deneba, Miami,
FL) software on a Macintosh computer.
MRI follow-up of rats during epileptogenesis and
epilepsy
To follow the progression of structural alterations
in individual rats, a separate group of rats (n = 10)
was prepared for MRI analysis. In these animals,
a bipolar stainless-steel stimulating electrode was
implanted into the left amygdala. To detect sponta-
neous seizures, three platinum-iridium wires were
implanted into the skull as described in the section
'Implantation of electrodes'. To improve the qual-
ity of MRI, the stimulating electrode was removed
2 days after the induction of SE. To monitor the
spontaneous seizures, video-EEG was recorded via
a cortical platinum electrode for 4 days before each
imaging session. Three rats with electrode implanta-
tions without stimulation served as controls.
MRI of the amygdala and the septal hippocampus
was performed using a scanner operating at 4.7 T
(a bird-cage-type volume-coil, coronal 1 mm slice
72
- 2.8 mm from bregma, matrix 128 • 256, FOV 35
mm) at 2, 9, 21 and 50 days after SE. Diffusion
(Dav, TR = 1.5 s, TE -----55 ms, b-values 0, 470, 856
s/mm 2) and T2 (TE = 20 to 60 ms, TR = 1.5 s, 4 av-
erages) images were sequentially acquired. Tip was
quantified at the same time points (variable length
(10-90 ms) adiabatic spin-lock pulses followed by a
fast spin echo imaging sequence, TR = 2.5 s, echo
spacing 10 ms, 16 echoes/excitation, 4 averages).
Regions analyzed included the amygdala (stimula-
tion site, primary focus for spontaneous seizures)
and the septal hippocampus (remote area connected
polysynaptically with the primary stimulation site).
Photomicrography
Photomicrographs were taken with a Leica DM RB
microscope equipped with a CoolSnap digital cam-
era system (RS Photometrics, Sweden).
Statistical analysis
Data were analyzed using SPSS for Windows (ver-
sion 9.0) or Statview 4.5 for Macintosh. MRI data
were analyzed using Student's t-test. The severity of
neuronal damage in different temporal lobe struc-
tures in the different treatment groups was compared
using the Mann-Whitney U-test. The severity of
neuronal damage between the stimulated and con-
tralateral sides was compared using the Wilcoxon
signed rank test. Correlations between hilar cell
damage and seizure frequency were analyzed us-
ing Spearman's rank correlation. A p-value of less
than 0.05 was considered significant.
Results
Severity of neuronal damage in the hilus at different
stages of the epileptic process
According to our hypothesis, the neuronal numbers
would be lowest in rats with chronic epilepsy. There-
fore, we first estimated the total neuronal numbers
in the hilus of the chronic group by stereologic cell
counting. The number of neurons in the ipsilateral
hilus did not differ between the controls (n = 8)
and epileptic (n = 13) animals (44,650 q- 3923 vs
40,3544-9992; Fig. 1A). There was also no de-
crease in the number of hilar neurons contralat-
erally in epileptic animals compared to controls
(44,600 4- 6021 vs 37,369 4- 9337). Neuron counts
did not differ between the ipsilateral and contralat-
eral sides.
The severity of hilar damage varies along the sep-
totemporal axis of the hippocampus, being more se-
vere temporally than septally (Nissinen et al., 2000).
During the course of these studies it has become ap-
parent that even substantial damage involving a small
segment of the septotemporal extent of the hilus
might lead to a relatively small decline in the total
neuronal numbers. Therefore, we assessed the asso-
ciation between hilar cell loss and lifetime seizure
number in the septal and temporal ends separately.
In the ipsilateral septal hilus, the density of neurons
in newly diagnosed, recently diagnosed, and chronic
animals was reduced by 23 4- 17%, 25 4- 14%, and
12 + 9%, respectively, compared to that in controls
(all, p < 0.001; Fig. 2A). In the contralateral septal
hilus, the density of neurons in the newly diagnosed,
recently diagnosed, and chronic animals was reduced
by 20q- 17% (p < 0.001), 15-t- 13% (p < 0.001), and
144- 12% (p < 0.01), respectively, compared to that
in controls (p > 0.05, p < 0.05, p > 0.05 compared
to ipsilateral side).
In the ipsilateral temporal hilus, the neuronal
density in newly diagnosed rats was reduced by
38 + 16% and in recently diagnosed rats by 30-4-17%
compared to that in controls (both, p < 0.001). In
the contralateral temporal hilus, the neuronal den-
sity in newly diagnosed animals was 36 4- 24% and
in recently diagnosed rats 31 5:23% lower than in
controls (both p < 0.001; Fig. 3A). The severity of
damage did not differ between the ipsilateral and
contralateral sides.
Association of lifetime seizure number with neuronal
numbers and densities
If recurrent spontaneous seizures cause further dam-
age to the hilar cells, we hypothesized that there
would be a correlation between the severity of hi-
lar damage and lifetime seizure number. In chroni-
cally epileptic animals, the total number of lifetime
seizures did not correlate with the total number of
neurons in the ipsilateral (Fig. 1B) or contralateral
hilus (both, p > 0.05). When the association be-
 73

B 60000

A6OOOO 50000
40000
30000
50000 .....................
i .....................
I ........................ 20000
Chronic epilepsy
10000 R.S.
40000 ..............................................................................
O9 • | 0
Z 2000 4000 6000
O II
rr" 30000 ................................................................................ LIFETIME Sz NUMBER
LU
Z
20000 ................................................................................ C 60000
.................................................
. ............. .....
50000
40000
1 0 0 0 0 ........ 44 650 ].......................................
30000
[ 40~ ] 20000
Chronic epilepsy
0 ' ' 10000
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

n.s.
Control Chronic
Epilepsy 0 50 100 150 200
DURATION OF EPILEPSY (d)
Fig. 1. (A) Total neuronal number in the ipsilateral hilus was not decreased in chronically epileptic animals compared to that in controls
(6 months after SE). (B) The number of hilar neurons did not correlate with the lifetime seizure number in chronically epileptic animals.
Note that some animals with a very high seizure number have normal hilar cell counts (arrows). (C) The number of hilar neurons did
not correlate with the duration of epilepsy in chronically epileptic animals. Note that some animals with the longest duration of epilepsy
have normal hilar cell counts (arrows). Abbreviations: d = days; n.s. = statistically nonsignificant; Sz = seizure.

tween lifetime seizure number and damage to hilar Association of seizure frequency with neuronal
cells at the septal and temporal ends was assessed numbers and densities
by combining the data from the different animal
groups, the lifetime seizure number did not correlate Exposure of neurons to the toxic effects of glutamate
with neuronal density in the hilus ipsilaterally, but presumably depends on the seizure frequency, and
did correlate contralaterally (r = 0.335, p < 0.05, therefore, the association of seizure frequency with
n = 37) at the septal end (data available from newly neuronal loss was assessed. There was no correlation
diagnosed, recently diagnosed, and chronic animals) between seizure frequency and total neuronal num-
(Fig. 2B). At the temporal end (data available from bers in the hilus. Ipsilaterally seizure frequency cor-
newly diagnosed and recently diagnosed animals), related with the severity of damage in the temporal
however, there was a correlation both ipsilaterally hilus (r = 0.498, p < 0.05, n = 23) and contralater-
(r = 0.447, p < 0.05, n = 24; Fig. 3B) and contralat- ally, both septally (r = 0.365, p < 0.05, n = 36) and
erally (r = 0.605, p < 0.01, n = 24). It should be temporally (r = 0.612, p < 0.01, n = 23). Analysis
noted, however, that some animals with a very low of data from individual animals, however, indicates
lifetime seizure number had damage as severe as the that some rats with a very low seizure frequency had
animals with a large number of seizures (Fig. 3B). substantial ( > 3 0 % ) hilar cell damage. In contrast,
some animals with a mean daily seizure frequency of
more than 15 had the same magnitude of damage as
rats with very low seizure frequency.
74

B
/x.

100
......................l ....................: ...................z ........................
._J
~
z
0rr
100

60
40
.iiit!i.ii.i...i_iiii..i.ii.i..
....., .................................................................. I
.............................. • .0. ~ 2o ............................................................................
1J ~n.s.
" L~'""t""l;~
o~ 8O
I .............
i ...................
i ....................... z 0
W 500 1500 2500 3500 4500 5500 6500
_J
o~ 60 LIFETIME Sz NUMBER
z
O
rr
w 40 0
z o~ 100 h o t ..............o , , .............• .....................t ~ . . . . . . . . . . . . .

-28% 8o
20
6o
co
z 40
' ' ' ~ 20 ,;:;: ::; ; ;: :i; t ,anmaSns
Chronic Recent New D
w 0
z 0 50 100 150 200
DURATION OF EPILEPSY (d)
Fig. 2. (A) Density of neurons in the ipsilateral septal hilus (expressed as a percentage of neurons remaining compared to controls;
100%) was decreased both in the newly diagnosed, recently diagnosed, and chronically epileptic animals (all, p < 0.001). (B) The
density of neurons in the ipsilateral septal hilus did not correlate with the lifetime seizure number when data from all animal groups were
combined. Note that some animals with a very high seizure number have normal hilar cell counts (arrows). (C) The density of neurons
in the ipsilateral septal hilus did not correlate with the duration of epilepsy when data from all animal groups were combined. Note that
some animals with the longest duration of epilepsy have normal hilar cell counts (arrows). Abbreviations: d = days; n.s. = statistically
nonsignificant; Sz = seizure.

Association of duration of epilepsy with neuronal Association of duration of SE with neuronal

numbers and densities numbers and density

Longer duration of epilepsy was assumed to asso- SE is a brain damaging insult, the duration of which
ciate with more severe damage caused by both the is associated with the severity of neuronal damage
progression of degenerative processes initiated by (Meldrum and Brierley, 1973). We retrospectively
SE and recurrent seizures. In the chronic group, there assessed the association of the duration of SE with
was no correlation between the duration of epilepsy cell counts. Interestingly, the duration of SE did
and the neuronal numbers in the hilus (Fig. 1C). not correlate with the decrease in the total neuronal
Also, the duration of epilepsy did not correlate with numbers in the hilus (chronic group). Also, there
neuronal density in the ipsilateral or contralateral was no association between the duration of SE or the
septal or temporal hilus (ipsilateral septal in Fig. 2C number of HAFDs and the density of neurons in the
and ipsilateral temporal in Fig. 3C). septal or temporal hilus (all animals; Fig. 4).
 75

~°100
A
~ 60
100
4o
o 2o .............................................................................
1 All animals
80 I p=0.033
UJ
z 0
t- 40 90 140
I.I_
UJ |
- 60 LIFETIME SZ NUMBER
................................................................t ................................
co • |
z
O
g 4o C
IJ.I o~
z ~_ 100
80
20 ._1
~z 60 .... tt- ...................................
• ' ' ° , ............................
0 40
...............°.~. ..................................................
All animals
D 20
0 Recent New uJ i n.s.
z 0 .........................................................................
0 20 40 60
DURATION OF EPILEPSY (d)
Fig. 3. (A) Density of hilar neurons (expressed as a percentage of neurons remaining compared to controls; 100%) was decreased at
the temporal end of the dentate gyrus both in the newly diagnosed and recently diagnosed (both p < 0.001) epileptic animals. (B)
The density of neurons in the ipsilateral temporal hilus correlated with the lifetime seizure number when data from newly and recently
diagnosed animal groups were combined. Note, however, that many of the animals with only very few seizures (arrows) had hilar cell
loss as severe as the rats with frequent seizures. (C) The density of neurons in the ipsilateral temporal hilus did not correlate with the
duration of epilepsy when data from newly and recently diagnosed animal groups were combined (Spearman's rank correlation). Note
that many of the animals with a very short duration of epilepsy (arrows) had as severe damage as the rats with the longest duration of
epilepsy. Abbreviations: d = days; n.s. = statistically nonsignificant; Sz = seizure.

MRI of brain during SE-induced epileptogenesis and the changes in T2 even though the abnormalities
epilepsy were more pronounced and Tl0 remained elevated
even at day 50 (Fig. 5). At 2 days, D,v in the
Histologic analysis provides insight into only one ipsilateral amygdala did not differ from controls,
time point, which compromises the analysis of the whereas it was increased in the ipsilateral hippocam-
temporal course of damage in individual animals. pus (127%). At later time points, Day was elevated
Therefore, we used modem imaging techniques to in both the amygdala and the hippocampus. MRI
follow the progression of damage after SE (Fig. 5). parameters during the first 23 days did not predict
At 2 days, T2 was prolonged in the ipsilateral amyg- the severity of epilepsy at later time points.
dala (by 162%, p < 0.01) and in the hippocampus
(127%) compared to electrode-implanted controls (is Assessment of Fluoro-Jade B staining at different
100%). At 9, 23 and 50 days, T2 remained elevated stages of epilepsy
but tended to decrease in the ipsilateral amygdala
(to 117% at 50 days) as well as in the ipsilateral Fluoro-Jade B stains irreversibly damaged neurons
hippocampus (to 114%). Changes in T10 paralleled (electron microscopic observations by Miettinen and
76

SEPTAL HILUS

100 ....~,~...._•...• ................................................. ,ip..~ .............. 100 ............, . . . . . . . . . . . . . . . . . . . . . . . O.._l.Z.l.._.o__i ..............................

- _ ~ O •
u4, 80
. ,......:'.... - ...................................... . . . . . . . . . . . .

m 80 ......... ~ . O . 0 __I~I ................................... .O. ................................

~ • o ............... • . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

............... a • .................. ~ ............................ • ......................................

~z 6o ~ 60
O 0
or 40 rr 40
D
Iii 20 i iiiiiiiiiiiiiiiiiiiiiiiiiiiii'iiiiiiiiiiiiiiiiiiiiii "nsan,n a,s LU 20 [ p=0.037
z Z
0 0
0 500 1000 1500 0 50 100 150 200
DURATION OF SE (min) HAFDs

TEMPORAL HILUS

o~ C I
100 ..o----..-- ~ 1 0 0 l.............l ........................l
ii
UJ
80 ~
.......................................................................................................

i-".......................................................................
............................. .tu 80
l ..............................................................................

i i - - - ~ ..............o ............................................................
...........................
G0
O
Z 60 r ~ ................go ..........................................................................
_ _
COZ 60
0
",,"
•
fr
D 40 I-- ........................................o ........................I All animals rr 40 iiiiiiiiiiii iiii iiii iiii i°iiiill iiii iiiiiiiii
D t All animals
L.U UJ
Z
......................................................................
[n.s. z n.s.
0-- 0
0 500 1000 1500 0 50 100 150 200
DURATION OF SE (min) HAFDs
Fig. 4. Association of the severity of SE with neuronal damage in the ipsilateral septal (A and B) and temporal (C and D) hilus.
(A) The severity of cell loss (expressed as a percentage of neurons remaining compared to controls; 100%) did not correlate with the
duration of SE (data pooled from all three rat groups). Note that some of the rats with the longest SE (arrows) had normal hilar cell
densities. (B) The severity of cell loss correlated with the number of high-amplitude and high-frequency discharges during SE. The
association, however, suggested that animals with a higher number of seizures during SE had a higher density of hilar cells. At the
temporal end, there was no association between hilar cell loss and duration of status epilepticus (C) or the number of high-amplitude
and high-frequency discharges during SE (D). Abbreviations: HAFD = high-amplitude and -frequency discharge; rain = minutes; n.s. =
statistically nonsignificant; SE = status epilepticus.

Pitk~inen, unpublished). In the present study, Fluoro- lated negatively with the time from SE to perfusion
Jade B-positive neurons were assessed in the newly in the CA3 (r = -0.488, p < 0.05), the perirhinal
diagnosed and chronic groups (Fig. 6). None of cortex (r = - 0 . 2 8 4 , p < 0.05), and the thalamus
the newly diagnosed rats had positive neurons in (r = -0.286, p < 0.05). There were no Fluoro-Jade
the hilus, whereas 10/14 had Fluoro-Jade B-positive B-positive cells in any of the animals in the chronic
neurons in the CA3, 9/14 in the CA1, 14/14 in the group.
amygdala, 3/14 in the piriform cortex, and 11/14 When the data from newly diagnosed and chronic
in the thalamus. Also, one of the two rats that groups were pooled, there was no correlation be-
was stimulated but did not develop epilepsy had a tween the lifetime seizure number and hippocampal
few Fluoro-Jade B-positive neurons in the amyg- total damage score (Fig. 7A). Time to perfusion,
dala and thalamus, and the other rat had a few in however, correlated with the total hippocampal dam-
just the amygdala. In the newly diagnosed group, age score (p < 0.001; Fig. 7B). Approximately 60
the density of Fluoro-Jade B-positive neurons corre- days after SE, there were no positive neurons in any
 77

AMYGDALA HIPPOCAMPUS
A B
180 ........................................................................ seizures 180 ........................................................................ Lseizures
160 •-.L ................................................................................................................................... 160
140
120
...... 3.x ................................. ~..I--.-.~...**.-.ii....=....... . 140
120 i i!!!!!!
80 80
60 ...............................................................................................• - I. T 2
60
40
20
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . l_._ Day 40
20 ..................................................................................................
iiiiiii ii iiiiiiiiii ii iiiiiiiiii ii iiiiiiii ii "O'T2~ T1
°Dav
............................................................................ 1- I - Tip
0 I I I t I 1 I I I I I 0 I I I I I I I I I I I

0 10 20 30 40 50 60 0 10 20 30 40 50 60
FOLLOW-UP (d) FOLLOW-UP (d)
Fig. 5. Long-term magnetic resonance imaging follow-up of rats after SE. (A) In the ipsilateral amygdala, T2 and Tip were increased
2 days after SE (p < 0.01), returned to normal levels during the next 2 weeks, and thereafter tended to increase again. The diffusion
coefficient, Day, became progressively more abnormal during the first 3 weeks. Importantly, all parameters were above the control level
even 50 days after SE. (B) Unlike in the amygdala, there were no rapid increases in the T2 and Tip values in the ipsilateral septal
hippocampus after SE. Instead, all parameters (T2, Tip, Day) increased progressively during the first 3 weeks after SE and remained
above the control level even at 50 days. Values are expressed as a percentage of that in controls animals (control value is defined as
100%). Abbreviations: d = days; Day = 1/3 of the trace of the diffusion tensor; TLp = longitudinal relaxation time in the rotating frame;
T2 = transverse relaxation time.

of the rats despite a high frequency of daily seizures models triggered by other etiologies, such as head
( > 1 0 seizures/day) in some chronically epileptic trauma or stroke, compromises the extrapolation of
animals (Fig. 7B). data obtained in SE models to sequelae of other
etiologies.
Discussion In the present study, SE was induced by electrical
stimulation of the amygdala, which is also the site
Methodologic considerations of origin for most of the spontaneous seizures occur-
ring later in life (Nissinen et al., 2000). The amyg-
When comparing data obtained from animal stud- dala provides substantial inputs to the CA1 and CA3
ies to those obtained from human studies, a critical subfields of the temporal half of the hippocampus
question arises. What does the animal model model? (Pikkarainen et al., 1999). Projections to the septal
In the present experiments, epileptogenesis was in- hippocampus are meager, and there are no monosy-
duced by electrically stimulating the amygdala in naptic projections to the hilus (Pikkarainen et al.,
adult male rats. This results in the development of 1999). With these caveats in mind, we assumed that
self-sustained SE and the appearance of spontaneous the polysynaptically connected hippocampus would
seizures of temporal lobe origin after a latency pe- provide a good candidate region to study seizure-
riod of approximately 1 month. In some animals induced neuronal death that would not be contam-
seizures might occur tens of times per day (Nissinen inated by monosynaptic neuronal death associated
et al., 2000). We propose that our model models with the SE-triggering stimulation itself.
TLE in humans that has an adult onset with acute In the present study, neuronal loss was assessed
nonsymptomatic SE as an etiology. It is important by estimating the total neuronal numbers in the hilus
to realize, however, that the lack of data on the de- and measuring neuronal density in the septal and
velopment of brain damage in spontaneous seizure temporal hilus. These approaches have a limited sen-
78

~--; ~:x8 ~t~ ,~

~..~ ~ o

..~ ~ ~ ~ " ~-~ ~

o~-~

.~'~ t.~ ~ ~ =
0 oo~

~ - ~ ~.~
02 O~

c~ 0 "~ :~

"0 ." -= ~ " II

~.~ ~ ~:
~ ' ~ ~ -~

a.~ o ~ I ~
e . ~ ~

o ~ . ~ o'd

•~ 5 ,

• .0 ~ 0 . ~
.~ ~-~ ~ ~ ~ ~
o ~
 79

A 8 B 8
uJ 7 ......... • ........................ Newly diagnosed and .........• ............................. Newly ,,~,
~ ' ~ ; ua " n o s e '~ a n d
n- 6 ..............a ....................... chronic animals
n- .............w ....................... chronic animals
O 5 o 5- ..............a ......................... p<0.001
u~ 4
..............~ t ....................... n.s.
o 4

m 3 .........Q ...............................................................................................................

2 "?,

" 1
.............. a .................................................. ~ . . . ~ ¢ . . . . ~ ' . ................... ~ ...... ,, 1
.............Q l ...................................... -Q....Q---.-Q .................... Q ........... 0
0

0 2000 4000 6000 0 50 100 150 200

LIFETIME SEIZURE NUMBER TIME TO PERFUSION (d)
Fig. 7. (A) Number of Fluoro-Jade B-positive cells in the hippocampus was not associated with the lifetime seizure number (the
correlation was also not significant if calculated separately for partial or secondarily generalized seizures in the newly diagnosed group;
data not shown). Note that several animals with a very high lifetime seizure number (and high daily seizure frequency; arrows) had
no Fluoro-Jade B-positive cells in the hippocampus. (B) Number of Fluoro-Jade B-positive cells correlated inversely with the time to
perfusion. Note that there were no positive cells in animals that were sacrificed 180 days after SE (13 rats, arrow) even though some of
the animals had several spontaneous seizures per day. Abbreviations: d = day; F-J B = Fluoro-Jade B.

sitivity to detect minor loss of a subpopulation of cells in the present study are dying neurons, not just
vulnerable neurons (Tuunanen et al., 1997; Tuuna- cells undergoing temporary dysfunction.
nen and Pitk~inen, 2000). Further, there is substantial
interanimal variability in the severity of damage Time course of progression of amygdaloid and
caused by SE. Seizure and SE-induced neurogene- hippocampal damage after SE
sis is another factor confounding the assessment of
neuronal damage by retrospective cell counting (Par- The MRI follow-up of rats after SE provided evi-
ent et al., 1997). In fact, the reconstitutive effect of dence that structural alterations continue to progres-
neurogenesis on hilar cell counts might be the most sively increase for approximately 3 weeks after SE.
remarkable in frequently seizing animals (Scott et At the stimulation site in the amygdala, the T2 and
al., 1998, 2000; Madsen et al., 2000; Nagawa et al., T] 0 elevations were most prominent 2 days after
2000). SE, declining towards normal values within the next
Another tool used to assess ongoing neuronal week, and again becoming more abnormal during
damage was Fluoro-Jade B staining, which has the third week after SE. In the polysynaptically con-
been reported to label irreversibly damaged neurons nected septal hippocampus, there was no such peak
(Schmued et al., 1997). This assumption is based elevation at 2 days. Rather, there was a more lin-
on the demonstration of Fluoro-Jade B-positive cells ear increase in MRI parameters analyzed during the
in sections adjacent to those showing acid-fuchsine first 3 weeks following SE. Interestingly, both at the
(Schmued et al., 1997) or silver-positive (Kubov~i et stimulation site and in the septal hippocampus, MRI
al., 2001) neurons in the same brain areas. There parameters tended to remain elevated even 50 days
are, however, no previous studies that assessed the after SE.
ultrastructure of Fluoro-Jade B-positive cells. We re- A critical question remains as to whether the ab-
cently investigated Fluoro-Jade B-positive neurons normalities in MRI at later follow-up points when
in rats that experienced kainate-induced SE using the animal is seizing spontaneously indicate ongoing
electron microscopy. The preliminary data show that neuronal loss. The present data indicate a dynamic
all Fluoro-Jade B neurons in the hippocampus or the pattern of both T2 and T10 in the ipsilateral amyg-
thalamus have an ultrastructure of irreversible dam- dala after electrical stimulation and consequent SE.
age (Pitk~inen and Miettinen, unpublished). There- Substantial recovery of the relaxation times in the
fore, we conclude that all Fluoro-Jade B-positive amygdala is reconciled as reinstated water home-
80
ostasis following seizures (see Ebisu et al., 1996).
Prolonged T2 is a well-documented indicator of irre-
versible brain damage, and thus, the time-dependent
increase in T2, particularly when accompanied by
an increased T10, is considered a sign of irreversible
neural damage. The T10 contrast serves as a sensi-
tive MRI indicator of irreversible neuronal damage
during reperfusion following acute cerebral ischemia
in the rat (Grrhn et al., 1999). The present data
add a new dimension to this picture, demonstrating
that T~ 0 may recover following prolonged seizures.
Finally, diffusion is a well-established MRI index
of acute ischemia (Moseley et al., 1990), epileptic
seizure (Zhong et al., 1993), and brain infarction
(Welch et al., 1986, 1995). Acute ischemia and
seizure cause reduced diffusion, whereas infarcted
tissue has elevated water diffusivity. The present data
indicate elevated diffusivity in the amygdala after 4
weeks or so; diffusion increased much earlier in the
hippocampus, suggesting a differential time course
of neural cell damage in the brain structures. Taken
together, the MRI data obtained suggest that during
the first 3 weeks after SE, there is a progressive
increase in structural damage in the amygdala and
the hippocampus. At later time points, milder ab-
normalities in T2, T10, and Dav are associated with
ongoing neuronal cell death, which is consistent with
the presence of Fluoro-Jade B-positive neurons in
the amygdala and hippocampus 50 days after SE.
Contribution of spontaneous seizures to hilar cell
damage
There was no correlation between the number of
lifetime seizures and the severity of neuronal loss in
the hilus of the dentate gyrus. The longest follow-up
of spontaneously seizing rats was 6 months, during
which four animals had more that 2700 sponta-
neous seizures (Nissinen et al., 2000). Therefore, it
is unlikely that infrequency of spontaneous seizures
compromised our ability to detect seizure-induced
damage. As shown previously, most of the behav-
ioral seizures in frequently seizing animals are par-
tial and are shorter than the secondarily generalized
seizures (44 vs 61 s, Nissinen et al., 2000). Further,
the proportion of partial seizures of all seizures in-
creases during the course of the disease (Nissinen
et al., 2000). It remains to be studied whether the
shorter duration of spontaneous seizures compared
to that of induced seizures in the kindling model
explains the difference in the severity of seizure-
induced damage. We had a few chronically seizing
animals with secondarily generalized seizures but
even in these animals we could not find any Fluoro-
Jade B-positive ceils in the hilus or brain areas at 6
months after SE. Also, when the correlation analysis
was performed separately between the severity of
damage assessed by cell counting versus partial or
secondarily generalized seizures, no association was
found.
The timing of sacrifice could have affected our
ability to detect neuronal damage with Fluoro-Jade
B, particularly in rarely seizing animals. We had,
however, several animals with frequent seizures each
day. Therefore, we consider it unlikely that we
missed damaged neurons because of the time in-
terval between the seizure and sacrifice.
A more extensive analysis of neuronal cell counts
in brain areas other than the hilus, including regions
monosynaptically linked with the primary seizure
focus, might have provided a more thorough view
to seizure-induced neuronal damage. The lack of
Fluoro-Jade B-positive neurons in regions receiving
monosynaptic inputs from the lateral nucleus of the
amygdala (e.g., other amygdaloid nuclei, layer III of
the entorhinal cortex, perirhinal cortex; see Pitk~inen,
2000) in chronically epileptic animals with several
seizures per day argues against ongoing damage
caused by seizures in these regions.
Contribution of SE to hilar cell damage
Previous studies demonstrated that hilar cells are
among the most vulnerable cell types to become
damaged by SE (Fujikawa, 1996). This raises a
question as to whether there are any hilar cells left
after SE to be exposed to the damaging effects
of spontaneous seizures later in life in our model.
As we show in the present experiments, only 23%
(3/13) of the chronic animals had a 20% reduc-
tion in the total neuronal numbers in the ipsilateral
hilus. When the neuronal density was estimated in
the ipsilateral septal and temporal hilus separately,
46% (17/37) of rats had >20% damage in the septal
and 79% (19/24) in the temporal hilus. Therefore,
most of our epileptic animals had a substantial num-
82
account in spontaneous seizure models currently in
use and remains a challenge for researchers attempt-
ing to model the human condition.
References
Amaral, D.G. and Witter, M.E (1995) Hippocampal formation.
In: G. Paxinos (Ed.), The Rat Nervous System. Academic
Press, San Diego, CA, pp. 443-493.
Amaral, D.G. and Insausti, R. (1990) The human hippocampal
formation. In: G. Paxinos (Ed.), The Human Nervous System.
Academic Press, San Diego, CA, pp. 711-755.
Beach, T.G., Woodhurst, W.B,, MacDonald, D.B. and Jones,
M.W. (1995) Reactive microglia in hippocampal sclerosis as-
sociated with human temporal lobe epilepsy. Neurosci. Lett.,
191 : 27-30.
Bengzon, J., Kokaia, Z., Elm@, E., Nanobashvili, A., Kokaia,
M. and Lindvall, O. (1997) Apoptosis and proliferation of
denatate gyrus neurons after single and intermittent limbic
seizures. Proc. Natl. Acad. Sci. USA, 94: 10432-10437.
Callahan, P.M., Paris, J.M., Cunningham, K.A. and Shinnick-
Gallagher, E (1991) Decrease of GABA-immunoreactive neu-
rons in the amygdala after electrical kindling in the rat. Brain
Res., 555: 335-339.
Cavazos, J.E., Das, I. and Sutula, T.E (1994) Neuronal loss
induced in limbic pathways by kindling: evidence for induc-
tion of hippocampal sclerosis by repeated brief seizures. J.
Neurosci., 14: 3106-3121.
Dalby, N.O., West, M. and Finsen, B. (1998) Hilar somatostatin-
mRNA containing neurons are preserved after perforant path
kindling in the rat. Neurosci. Lett., 255: 45-48.
During, M.J. and Spencer, D.D. (1993) Extracellular hippocam-
pal glutamate and spontaneous seizure in the conscious human
brain. Lancet, 341: 1607-1610.
Ebisu, T., Rooney, W.D., Graham, S.H., Mancuso, A., Weiner,
M.W. and Maudsley, A.A. (1996) MR spectroscopic imaging
and diffusion-weighted MRI for early detection of kainate-
induced status epilepticus in the rat. Magn. Reson. Med.,
36(6): 821-828.
Fujikawa, D.G. (1996) The temporal evolution of neuronal dam-
age from pilocarpine-induced status epilepticus. Brain Res.,
725(l): 11-22.
Fujikawa, D.G., Shinmei, S.S. and Cai, B. (1999) Lithium-
pilocarpine-induced seizures produces necrotic neurons with
internucleosomal DNA fragmentation in adult rats. Eur. J.
Neurosci., 1 l: 1605-1614.
Fujikawa, D.G., Shinmei, S.S. and Cai, B. (2000) Kainic acid-
induced seizures produce necrotic, not apoptotic, neurons with
internucleosomal cleavage: implications for programmed cell
death mechanisms. Neuroscience, 98( 1): 41-53.
Greffe, J., Lemoine, E, Lacroix, C., Brunon, A.-M., Terra, J.-L.,
Dalery, J., Bernier, E., Soares-Boucaud, I., Rochet, T., Leduc,
T.A., Balvay, G. and Mathieu, E (1996) Increased serum
levels of neuron-specific enolase in epileptic patients and after
electroconvulsive therapy - - a preliminary report. Clin. Chim.
Acta, 244: 199-208.
Gr6hn, O.H.J., Lukkarinen, J.A., Silvennoinen, M.J., Pitkanen,
A., van Zijl, P.C.M. and Kauppinen, R. (1999) Assignment
of reversible and irreversible ischaemic cerebral damage in a
rat using quantitative Tlo, T2 and the trace of the diffusion
tensor magnetic resonance imaging. Magn. Reson. Med., 42:
268-276.
Henshall, D.C., Clark, R.S., Adelson, ED., Chen, M., Watkins,
S.C. and Simon, R.E (2000a) Alterations in bcl-2 and cas-
pase gene family protein expression in human temporal lobe
epilepsy. Neurology, 55(2): 250-257.
Henshall, D.C., Chen, J. and Simon, R.E (2000b) Involvement
of caspase-3-1ike protease in the mechanism of cell death fol-
lowing focally evoked limbic seizures. J. Neurochem., 74(3):
1215-1223.
Jackson, G.D., Chambers, B.R. and Berkovic, S.E (1999) Hip-
pocampal sclerosis: development in adult life. Dev. Neurosci.,
21(3-5): 207-214.
Jacobi, C. and Reiber, H. (1988) Clinical relevance of increased
neuron-specific enolase concentration in cerebrospinal fluid.
Clin. Chim. Acta, 177: 49-54.
K~ilvi~iinen, R., Salmenper~i, T., Partanen, K., Vainio, E, Riekki-
nen, E and Pitkanen, A. (1998) Recurrent seizures may cause
hippocampal damage in temporal lobe epilepsy. Neurology,
50: 1377-1382.
Kotloski, R., Lynch, M. and Sutula, T.E (2002) Repeated brief
seizures induce progressive hippocampal neuron loss and
memory deficits. Prog. Brain Res., in press.
Kubov~, H., Druga, R., Lukasiuk, K., Suchomelov~i, L., Haugvi-
coyly, R. and Pitk~inen, A. (2001) Status epilepticus causes
necrotic damage in the mediodorsal nucleus of the thalamus in
immature rats. J. Neurosci., 21(10): 3593-3599.
Lukasiuk, K. and Pitk~inen, A. (1998) Distribution of early neu-
ronal damage after status epilepticus in chronic model of TLE
induced by amygdala stimulation. Epilepsia, 39(Suppl. 6): 9.
Madsen, T.M., Treschow, A., Bengzon, J., Bolwig, T.G., Lind-
vail, O. and Tingstr6m, A. (2000) Increased neurogenesis in
a model of electroconvulsive therapy. Biol. Psychiatry, 47:
1043-1049.
Mathern, G.W., Pretorius, J.K. and Babb, T.L. (1995) Influence
of the type of initial precipitating injury and at what age it
occurs on course and outcome in patients with temporal lobe
seizures. J. Neurosurg., 82(2): 220-227.
Meldrum, B.S. and Brierley, J.B. (1973) Prolonged epileptic
seizures in primates. Ischemic cell change and its relation to
ictal physiological events. Arch. Neurol., 28: 10-17.
Moseley, M.E., Cohen, Y., Mintorovitch, J., Chileuitt, L.,
Shimizu, H., Kucharczyk, J., Wendland, M.F. and Weinstein,
ER. (1990) Early detection of regional cerebral ischemia in
cats: comparison of diffusion- and T2-weighted MRI and
spectroscopy. Magn. Reson. Med., 14(2): 330-346.
Mourizen-Dam, A. (1982) Hippocampal neuron loss in epilepsy
and after experimental seizures. Acta Neurol. Scand., 66: 601-
642.
Nagawa, E., Aimi, Y., Yasuhara, O., Tooyama, I., Shimada,
M., McGeer, EL. and Kimura, H. (2000) Enhancement of
progenitor cell division in the dentate gyrus triggered by initial

ber of hilar cells remaining after SE, particularly
septally. Another possibility is that the time-course
of hilar cell death after SE is faster than that of
hippocampal pyramidal cells. Supporting this idea,
there were no Fluoro-Jade B-positive neurons in the
hilus of animals that had a substantial number of hi-
lar cells remaining in thionin preparations, whereas
there were numerous Fluoro-Jade B-positive cells in
other hippocampal subfields in the same section.
When we assessed the neuronal numbers or den-
sities retrospectively several months after SE, there
was no clear association between the duration or
severity (number of HAFDs) of SE and the sever-
ity of neuronal damage. We previously demonstrated
that duration of SE is associated with the presence of
damage. In the present model, SE has to continue for
approximately 40 min to induce damage (Lukasiuk
and Pitkanen, 1998). If SE is allowed to continue
uncontrolled for several hours, the association be-
tween the duration of SE and the severity of damage,
however, disappears.
Previous studies using silver and TUNEL tech-
niques as well as markers of programmed cell death,
demonstrated that SE-induced neuronal loss might
continue for several days (Fujikawa et al., 1999,
2000; Henshall et al., 2000b; Tuunanen and Pitka-
nen, 2000). Fluoro-Jade B staining can be detected in
the amygdala, hippocampus, endopiriform nucleus,
perirhinal cortex, and thalamus approximately 60
days after SE. The number of Fluoro-Jade B-positive
cells did not, however, correlate with the number of
spontaneous seizures, but correlated with the time
interval from SE to perfusion. Further, there were no
Fluoro-Jade B-positive neurons present in frequently
seizing rats that had been perfused for histology 6
months after SE. These observations raise the ques-
tion as to whether the damage even at about 2 months
after SE was more related to SE rather than to the
occurrence of spontaneous seizures. Therefore, the
methodology used in the present experiments did not
demonstrate a clear association between the number
or occurrence of spontaneous seizures and the sever-
ity of hilar cell death. The hippocampal damage in
our epileptic animals seemed to associate with pro-
gressive neuronal loss triggered by the underlying
epileptogenic insult, that is, SE rather than with the
spontaneous seizures.
81
Conclusions
The present data did not provide evidence to support
the idea that spontaneous seizures cause neuronal
damage. Rather, the loss of neurons in the present
model was associated with the epileptogenic insult,
that is, SE. One explanation is that more sensi-
tive methods are needed to detect the few neurons
damaged by brief spontaneous seizures. As shown
by Bengzon et al. (1997), a single afterdischarge
in a kindling model might cause positive TUNEL
labeling of only one or two cells per 20-p~m-thick
section. Consequently, the total number of neurons
killed by a single kindled seizure is estimated to be
only a few hundred. In humans, the total number
of neurons in the granule cell layer, hilus, and CA
subfields of the hippocampus has been estimated to
be 35.7 million (West and Gundersen, 1990). We re-
cently demonstrated that in patients with cryptogenic
TLE with no known underlying brain damaging eti-
ology, the number of spontaneous seizures needed
to cause a 50% decrease in the total volume of the
hippocampus is approximately 6500 (K~ilviainen et
al., 1998). If the hippocampal volume loss in MRI
is assumed to derive to the same magnitude from
the cellular and noncellular compartments, it is esti-
mated that each spontaneous seizure would damage
approximately 2746 neurons (17.85 million/6500).
Considering that the total rostrocaudal length of the
hippocampus is 4 cm (Amaral and Insausti, 1990)
giving 800 50-1xm-thick sections, there would be
approximately three damaged neurons (2746/800)
visible in each section after seizures. These numbers
correlate well with the data from a kindling model
(Bengzon et al., 1997). Further studies using sen-
sitive markers of different cell death pathways are
needed to assess the presence of damage induced by
spontaneous seizures.
In humans, progressive seizure-induced neuronal
damage is observed in a subpopulation of patients
(Van Paesschen et al., 1998; see Sutula and Pitk~i-
nen, 2001). Analysis of the clinical history of these
individuals indicates that factors like genotype, gen-
der, head trauma, environment, or medication might
have contributed to the sensitivity of an individual to
seizure-induced neuronal damage (Sutula and Pitk~-
nen, 2001). A possibility of multifactorial risk of
seizure-induced neuronal damage is not taken into

limbic seizures in rat models of epilepsy. Epilepsia, 41(1):
10-18.
Nissinen, J., Halonen, T., Koivisto, E. and Pitkanen, A. (2000)
A new model of chronic temporal lobe epilepsy induced by
electrical stimulation of the amygdala in rat. Epilepsy Res., 38:
177-205.
O'Brien, T.J., So, E.L., Meyer, F.B., Parisi, J.E. and Jack, C.
(1999) Progressive hippocampal atrophy in chronic intractable
temporal lobe epilepsy. Ann. Neurol., 45: 526-529.
Parent, J.M., Yu, T.W., Leibowitz, R.T., Geschwind, D.H.,
Sloviter, R.S. and Lowenstein, D.H. (1997) Dentate granule
cell neurogenesis is increased by seizures and contributes to
aberrant network reorganization in the adult rat hippocampus.
J. Neurosci., 17(10): 3727-3738.
Pikkarainen, M., ROnkk6, S., Savander, V., Insausti, R. and
Pitk~inen, A. (1999) Projections from the lateral, basal and
accessory basal nuclei of the amygdala to the hippocampal
formation in rat. J. Comp. Neurol., 403: 229-260.
Pitk~inen, A. (2000) Connectivity of the rat amygdaloid complex.
In: J.E Aggleton (Ed.), The Amygdala: a Functional Analysis.
Oxford University Press, Oxford, pp. 31-115.
Pretel, S., Applegate, C.D. and Piekut, D. (1997) Apoptotic and
necrotic cell death following kindling induced seizures. Acta
Histochem., 99: 71-79.
Rabinowicz, A.L., Correale, J.D., Couldwell, W.T. and DeGior-
gio, C.M. (1994) CSF neuron-specific enolase after metho-
hexital activation during electrocorticography. Neurology, 44:
1167-1169.
Rabinowicz, A.L., Correale, J., Boutros, R.B., Couldwell, W.T.,
Henderson, C.W. and DeGiorgio, C.M. (1996) Neuron-specific
enolase is increased after single seizures during inpatient
video/EEG monitoring. Epilepsia, 37(2): 122-125.
Racine, R.J. (1972) Modulation of seizure activity by electri-
cal stimulation, II. Motor seizures. Electroencephalogr. Clin.
Neurophysiol., 32: 281-294.
Salmenperfi, T., K~ilvi~iinen, R., Partanen, K. and Pitkanen,
A. (2001) Hippocampal and amygdaloid damage in par-
tial epilepsy: A cross-sectional MRI study of 241 patients.
Epilepsy Res., 46: 69-82.
Schmued, L.C., Albertson, C. and Slikker Jr., W. (1997) Fluoro-
Jade: a novel fluorochrome for the sensitive and reliable his-
tochemical localization of neuronal degeneration. Brain Res.,
751(1): 37-46.
Scott, B.W., Wang, S., Burnham iU, W.M., De Boni, U. and
Wojtowicz, J.M. (1998) Kindling-induced neurogenesis in the
dentate gyms of the rat. Neurosei. Lett., 248(2): 73-76.
Scott, B.W., Wojtowicz, J.M. and Burnham, W.M. (2000) Neuro-
genesis in the dentate gyms of the rat following elctroconvul-
sive shock seizures. Exp. NeuroL, 165: 231-236.
Sloviter, R.S. (1982) A simplified Timm stain procedure compat-
ible with formaldehyde fixation and routine paraffin embed-
ding of rat brain. Brain Res. Bull., 8: 771-774.
Sutula, T., Lauersdorf, S., Lynch, M., Jurgella, C. and Woodard,
83
A. (1995) Deficits in radial arm maze performance in kindled
rats: evidence for long-lasting memory dysfunction induced by
repeated brief seizures. J. Neurosci., 15(12): 8295-8301.
Sutula, T.P. and Pitk~inen, A. (2001) More evidence for seizure-
induced neuron loss: Is hippocampal sclerosis a cause and an
effect of epilepsy?. Neurology, 57: 169-170.
Tasch, E., Cendes, F., Li, L.M., Dubeau, F., Andermann, E and
Arnold, D.L. (1999) Neuroimaging evidence of progressive
neuronal loss and dysfunction in temporal lobe epilepsy. Ann.
Neurol., 45: 568-576.
Tumani, H., Otto, M., Gefeller, O., Wiltfang, J., Herrendorf,
G., Mogge, S. and Steinhoff, B.J. (1999) Kinetics of serum
neuron-specific enolase and prolactin in patients after single
epileptic seizures. Epilepsia, 40(6): 713-718.
Tuunanen, J. and Pitk~inen, A. (2000) Do seizures cause neuronal
damage in rat amygdala kindling?. Epilepsy Res., 39: 171-
176.
Tuunanen, J., Halonen, T. and Pitkanen, A. (1997) Decrease in
somatostatin-immunoreactive neurons in the rat amygdaloid
complex in a kindling model of temporal lobe epilepsy.
Epilepsy Res., 26: 315-327.
Van Paesschen, W., Revesz, T., Duncan, J.S., King, M.D. and
Connelly, A. (1997) Quantitative neuropathology and quan-
titative magnetic resonance imaging of the hippocampus in
temporal lobe epilepsy. Ann. Neurol., 42(5): 756-766.
Van Paesschen, W., Duncan, J.S., Stevens, J.M. and Connelly, A.
(1998) Longitudinal quantitative hippocampal magnetic reso-
nance imaging study of adults with newly diagnosed partial
seizures: one-year follow-up results. Epilepsia, 39(6): 633-
639.
Welch, K.M., Levine, S.R. and Ewing, J.R. (1986) Viewing
stroke pathophysiology: an analysis of contemporary methods.
Stroke, 17(6): 1071-1077.
Welch, K.M., Windham, J., Knight, R.A., Nagesh, V., Hugg,
J.W., Jacobs, M., Peck, D., Booker, P., Dereski, M.O. and
Levine, S.R. (1995) A model to predict the histopathology
of human stroke using diffusion and T2-weighted magnetic
resonance imaging. Stroke, 26(11): 1983-1989.
West, M.J. and Gundersen, H.J.G. (1990) Unbiased stereological
estimation of the number of neurons in the human hippocam-
pus. J. Comp. NeuroL, 296: 1-22.
West, M.J., Slomianka, L. and Gundersen, H.J.G. (1991) Unbi-
ased stereological estimation of the total number of neurons in
the subdivisions of the rat hippocampus using optical fraction-
ator. Anat. Ree., 231 : 482-497.
Zhang, L.-X., Smith, M.A., Li, X.L., Weiss, S.R.B. and Post,
R.M. (1998) Apoptosis of hippocampal neurons after amyg-
dala kindled seizures. Brain Res. MoL Brain Res., 55: 198-
208.
Zhong, J., Petroff, O.A., Pilchard, J.W. and Gore, J.C. (1993)
Changes in water diffusion and relaxation properties of rat
cerebrum during status epilepticus. Magn. Reson. Med., 30(2):
241-246.
T. Sutulaand A. Pitk~inen(Eds.)
Progress in Brain Research, Vol. 135
© 2002 ElsevierScienceB.V.All rightsreserved
CHAPTER 7
Does convulsive status epilepticus (SE) result in cerebral
damage or affect the course of epilepsy the
epidemiological and clinical evidence?
Simon Shorvon *
Institute of Neurology, University College London, Queen Square, London WCIN 3BG, UK
Introduction
The fact that convulsive status epilepticus (SE) can
result in brain damage in experimental models has
been irrefutably demonstrated, since the pioneering
work of Meldrum and colleagues in the adolescent
baboon (Meldrum and Brierley, 1973; Meldrum and
Horton, 1973; Meldrum et al., 1973, 1974; Meldrum,
1997). Numerous animal models, in which seizures
produced either by chemical means or by electrical
stimulation have repeatedly shown a distinctive pat-
tern of cerebral damage (see Fountain and Lothman,
1995; Coulter and DeLorenzo, 1999). Considerable
progress has been made in clarifying mechanisms,
as indeed the work presented in this volume itself
testifies. In spite of this, evidence of brain damage in
humans has been more difficult to define or quantify.
In the past, indeed, several authorities have doubted
that damage is prominent or clinically relevant. This
inadequate state of affairs reflects badly upon clini-
cal research. In this paper, I will try to summarise,
in short form, the lines of evidence which do exist
and the reasons for lack of clarity on this subject. I
will concentrate on tonic clonic SE and not on the
* Correspondence to: S. Shorvon, Institute of Neurology,
University College London, Queen Square, London
WC1N 3BG, UK. Tel.: +44-20-7829-8758;
E-mail: s.shorvon@ion.ucl.ac.uk
TABLE 1
Adverse outcomesof human SE
Death
Focal neurological deficits
Intellectual deficit
Epilepsy
other types of SE (e.g. non-convulsive SE, epilepsia
partialis continua, SE in childhood epilepsy syn-
dromes, etc.). The prognosis and outcome of these
conditions is covered elsewhere (Shorvon, 1994).
The experimental animal evidence is much stronger
and provides fascinating insights into the extent and
mechanisms of cerebral damage following SE; this
evidence is reviewed elsewhere in this volume and
will not be covered here.
In Table 1 are the categories of adverse outcome
in SE which have been the subject of study. I will
consider each in turn. In Table 2 are the confounding
TABLE 2
Factors which influence outcome and which render clinical stud-
ies difficult
Definitions of SE (the duration of episode)
Types of SE
The underlying pathology
Patient factors (e.g. age, drug treatment)
Ceiling effects
Insensitivity of clinical measurementtools
86
factors that have made this a subject difficult to study
from the clinical perspective and which complicate
the assessment of results (and these are difficulties
which can be largely avoided in experimental inves-
tigations in animal models).
Factors which complicate the assessment of the
findings from clinical studies
Definitions of SE
There is considerable (and to an extent futile) debate
about what constitutes SE, a debate which resolves
mainly around the length of time continuous or
repeated seizure activity should persist before SE
is considered to be present. Studies with differing
definitions will not be comparable. The traditional
literature, influenced heavily by Gastaut and col-
leagues (Gastaut et al., 1967), defined SE as present
if seizures persist for 60 rain or more. Subsequent
work proposed time periods of 20 or 30 min, and
in recent times much shorter periods have been sug-
gested (5 min being the current record). The radical
shortening to 5 min is based on studies (usually
small) of video-EEG convulsive seizures suggesting
that if a seizure continues for 5 rain or more, it will
become self-sustaining (Lowenstein et al., 1999).
Here is not the place to debate the merits of these
suggestions. Even if this proposition is correct, and
epidemiological evidence from the Richmond study
(DeLorenzo et al., 1999) as well as everyday clinical
experience, suggests that it is not always the case, the
fact remains that the propensity to cerebral damage,
and prognosis and outcome, is heavily dependent on
the duration of the seizure activity.
Animal experimentation has yielded findings
which are consistently clear about the importance of
duration of seizures as a major factor influencing the
degree of cerebral damage. Almost all models have
shown that there is a threshold below which histolog-
ical damage is not seen, and above which the longer
the seizure, the more likely is consequent cerebral
damage. This was first demonstrated by Meldrum
who showed that cortical damage is unlikely in the
photosensitive baboon with seizures of less than 90
rain duration (see Meldrum, 1997). Findings similar
in principle (but varying in detail) have been made
by many subsequent authors. The same is probably
true in human SE, although few studies have actually
explored this. One of the earliest of these was that
of Barois et al. (1985) who reported 90 cases of SE
of under 24 h duration of whom only 4% died, and
29 cases of SE lasting more than 24 h, of whom
24% died and 24% were left with residual deficits or
in a persisting vegetative state. Towne et al. (1994),
in a retrospective survey of 253 adult cases of SE,
showed a 9.8 fold (odds ratio) increase in mortality
amongst those with SE lasting more than 1 h when
compared to those with less long-lasting SE.
There has been a significant reduction in mortality
and morbidity of childhood SE since the recognition
that prolonged seizures are potentially dangerous,
and a much more urgent approach to treatment
has been taken. This follows the landmark work
of Aicardi and colleagues (see below; Aicardi and
Chevrie, 1970). Interestingly, this improvement in
morbidity was interpreted in an editorial 20 years
later suggesting that SE was not as dangerous as
once taught (Freeman, 1989). This fallacy was well
countered by Aicardi and others in the correspon-
dence that followed (Aicardi and Chevrie, 1989),
who emphasised that it was the urgent treatment of
acute seizures (and therefore the reduction in seizure
duration) which was the reason for the improvement
in morbidity, and that delayed treatment of SE was
as dangerous as ever.
A final methodological point worth making is
that, in human studies, the point of onset of SE is of-
ten poorly observed and thus estimates of 'duration'
are surely subject to wild inaccuracy. Quite how this
problem is overcome in epidemiological studies is
not clear, but this simple fact clearly complicates
all human studies purporting to measure outcome
related to seizure-duration.
Types of SE
It has long been thought that convulsive SE carries
far greater risk of brain damage than non-convulsive
SE. Certainly, the mortality rates are much higher
in convulsive SE (see below). There is however
unresolved debate concerning the extent of morbidity
of non-convulsive SE. This is a non-trivial subject,
for the urgency of treatment hinges on this point.
The evidence from animal experimentation is
however not reassuring. In Meldrum's original work,

it was clear that convulsive SE was more damag-
ing than non-convulsive SE, although both caused
damage (Meldrum, 1997). Furthermore the damage
caused by convulsive SE could not be wholly at-
tributed to systemic physiological disturbances (e.g.
hyperthermia, hypoxia, hypoglycaemia, low blood
pressure, etc.) although these worsened damage. The
damage is largely due to electrographic activity, and
the clear demonstration that hippocampal damage
consistently follows prolonged non-convulsive lim-
bic SE in rodents and other species have also high-
lighted the dangers in humans (and this is discussed
further below and extensively elsewhere in this vol-
ume). Many of the older studies of SE, however,
did not differentiate between seizure types, and this
renders comparison difficult.
The underlying pathology
Status epilepticus is much more likely to occur in
patients with symptomatic epilepsy than in idio-
pathic epilepsy. The underlying pathology has often
a propensity to cause cerebral damage itself, and the
disentanglement of this effect from that of the SE
is a problem which has plagued all clinical studies
of outcome. This is particularly true of de novo SE
in patients who have no previous history of epilepsy
(40-70% of all cases) and in whom the SE is due
to an acute brain insult. The common causes are
trauma, encephalitis, stroke, tumour etc. Morbidity
in such cases is often more likely to be due to the
underlying pathology than the SE, although both
may play a part. An interesting observation on this
point was made in the study of Goulon et al. (1985).
They noted that the prognosis of the underlying con-
dition worsened if SE occurred; thus, the mortality
of bacterial meningitis admissions to the ITUs was
33% of 87 cases without SE, compared to 82% of
the 11 cases complicated by SE. Similarly, the re-
cent Richmond epidemiological project examined 37
deaths, and most were in patients with acute symp-
tomatic epilepsy (see below). The mortality rate of
stroke in the same hospital is less than 4%, but
when the stroke is complicated by SE, the death
rate is 35-50% (DeLorenzo et al., 1995). Of course
even in these studies, it is likely that the pathologies
(e.g. stroke, meningitis) which resulted in SE were
more profound than those that did not. Causality in
87
such uncontrolled situations is really not possible to
prove.
Patient factors (e.g. age, therapy)
Children have been recognised for many years to
be more prone to SE than adults, yet the propen-
sity for cerebral damage may be less (Fountain and
Lothman, 1995). This implies that the mechanisms
of epileptogenesis are not the same as the mecha-
nisms of seizure-induced cerebral damage, but this
is a little explored point. The relative resistance of
immature brain to seizure-induced damage has been
repeatedly shown in animal work, although there are
very few clinical data. It is also possible that some
of the drugs used to treat SE (for instance the bar-
biturates, general anaesthesia) have neuro-protectant
potential, although again clinical evidence is slight.
Ceiling effects
It seems very likely that if cerebral damage is in-
duced by seizures (or SE) it is subject to a ceiling
effect. Routine clinical experience shows that whilst
cortical gliosis and a degree of hippocampal atrophy
are common in chronic epilepsy, it is seldom very
severe, and does not strongly correlate with num-
ber of seizures or SE episodes. This is discussed
further elsewhere in this volume. Even in patients
with very chronic and severe epilepsy, the degree
of atrophy can be mild. It is possible that the ma-
jority of damage is caused by the initial episodes
and that subsequent episodes have less propensity
to result in damage. This might explain the appar-
ent lack of obvious evidence of clinical deterioration
in non-convulsive complex partial SE which is the
SE type, par excellence, which is regularly repeated
(Cockerell et al., 1994).
Insensitivity of clinical measurement tools
A great advantage of animal experimentation is the
ability directly to study tissue in a controlled fash-
ion by histological methods. In human SE, reliance
has to be put on methods which are fundamentally
insensitive to the sorts of small changes induced by
seizures. Serial MRI and psychometric testing, for
instance, are better suited to detecting large structural
88
change. Even massive changes in gene expression,
or in receptor regulation, or in synaptic reorgani-
sation - - the sorts of changes which are likely to
be seizure-induced and result in cerebral damage - -
are not easily detected by these methods. Strenuous
efforts, however, have produced some results, and
these are discussed elsewhere in this volume.
Mortality of SE
The fact that SE can result in death was recog-
nised from the very first documentation of epilepsy
(Sakikku), and has been frequently emphasised ever
since (see Shorvon, 1994). Even in the pre-treatment
era, however, the condition was by no means always
fatal and only between 5 and 50% of patients with
convulsive SE died in the acute attack in the series
before the early part of the twentieth century (and
the introduction of effective treatment).
Mortality in adult SE
In the first important study of outcome in adult SE
(Oxbury and Whitty, 1971), 6 (11%) of the 54 pa-
tients with known cerebral pathology died in SE,
and a further 5 (9%) died within the next 6 months.
Only 1 of the 32 cases without known pathology
died. Aminoff and Simon (1980) reported death in
16 (16%) of 98 adult patients admitted to hospital
with SE, but in only 2 was death directly attributed
to SE, and in the rest it was due to the underlying
cause or to medical or therapeutic complications. In
a study of 282 consecutive admissions in SE to two
intensive care units (Goulon et al., 1985), 100 (35%)
died, but in only 2 was the death attributable to SE.
The recent epidemiological study from Richmond,
Virginia, of 137 adult and 29 paediatric cases of SE
showed an overall mortality of 22%. The mortality
of the elderly patients was highest (38%) compared
with that in young adult age groups (14%). The
great majority of these deaths were due to the un-
derlying causes, although 26% of the adult deaths
occurred in either idiopathic (3%) or remote symp-
tomatic epilepsy (22%) (DeLorenzo et al., 1995).
Towne et al. (1994) published univariate and mul-
tivariate analyses of mortality amongst 253 adults
with SE identified retrospectively from the hospital
computerised database of discharge details (a source
which has inherent inaccuracies). Those with SE of
less than one hour duration had lower mortality rates
than those with SE duration of over one hour. Anoxic
aetiologies and advancing age (which are interrelated
factors) were associated with higher rates.
Mortality in childhood SE
Aicardi and Chevrie (1970) reported an 11% mor-
tality rate amongst 239 infants and children, with
death both during the acute stage of convulsive SE
and in the months later. Most of the cases (85%)
were under the age of five years, and the authors
reported that the duration of convulsions was criti-
cal and that prolonged convulsions were particularly
devastating in young babies. In later studies, lower
mortality rates were reported (e.g. 3.6%) which re-
flects the success of more urgent therapy. Phillips
and Shanahan (1989), in a study deliberately de-
signed to see whether prognosis had improved in
the two decades since the Aicardi study, reported a
6% mortality rate in 218 episodes of childhood SE
admitted to a paediatric intensive care unit over a 5-
year period. In 1 l of the 13 deaths, there were acute
cerebral insults, and there was only 1 death amongst
the 99 episodes of idiopathic SE. In the most re-
cent study (from Richmond), the mortality amongst
children was only 2.5% (1 case) and none in idio-
pathic or remote symptomatic cases (DeLorenzo et
al., 1995).
Mortality in non-convulsive SE
There have been few studies of mortality in non-
convulsive SE. It is possible that some cases were
included in the earlier studies cited above, although
usually seizure type was not documented and in
these early studies only convulsive SE was included
in definitions. One study reported death in three of
ten cases of complex partial SE admitted to intensive
care, and in two of these cases the cause of the acute
SE was not known. However, the great majority of
patients with non-convulsive SE are not admitted to
intensive care facilities, and the extent of mortality in
the generality of case is unknown - - although rou-
tine clinical experience suggests that this common
event is very rarely fatal.

Clinical studies of neurological morbidity
resulting from SE
Adults
In the study of Oxbury and Whitty (1971), five of
86 cases of SE were 'undoubtedly deteriorated' after
the episode, and in two (2%) no cause other than
the epilepsy itself could be found for the neurolog-
ical impairment. Rowan and Scott (1970) recorded
a 26% rate 'neurological sequelae' but did not pro-
vide any further details. Six of the 90 cases reported
by Aminoff and Simon (1980) had intellectual im-
pairment following the SE. The main difficulty in
assessing this problem is that of differentiating the
effects of seizures from that of the underlying cause.
Nevertheless, it is common clinical experience that
memory and personality change is common after
a prolonged bout of convulsive SE, although these
deficits often improve over months.
There is one prospective psychometric study of
patients before and after SE (albeit without SE being
the major focus of the study; Dodrill and Wilen-
ski, 1990). In this investigation, 143 adult epileptic
patients were tested 5 years apart. SE occurred in
the intervening period in 9 cases, and there was a
bigger (but not significantly so) deterioration in the
WAIS amongst these 9 cases when compared to the
other 144. However, the patients who experienced
SE had markedly lower scores than the controls even
at the first evaluation (Dodrill and Wilenski, 1990).
Because of small numbers and other confounding
factors, the statistical value of this study is limited.
Dodrill and Wilenski also reviewed 14 other studies
and case reports and concluded that SE had only a
slight adverse effect on cognitive abilities amongst
survivors, and that in many individuals there were
no adverse effects. My own reading of these lim-
ited data, however, is not so reassuring. The correct
tests have seldom been done, and there are very few
prospective data. There are, furthermore, no detailed
serial data in the aftermath of SE. In adults, at least,
it can be probably concluded that serious morbidity
is relatively uncommon (although everyday clinical
practice shows that effects do occur), yet there can
be no doubt from individual cases that permanent
cognitive sequelae can result from a severe episode
of convulsive SE. Acute intellectual disturbances
89
often improve over the months following SE, and
the timing of testing is important. Conversely, serial
imaging evidence suggests that consecutive atrophy
may progress in the months after an episode of SE.
Children
In children, the risk of morbidity from SE may dif-
fer from that in adults. The younger the child, the
more likely are both motor or cognitive deficits. In
the series of studies of Aicardi and Chevrie (Aicardi
and Chevrie, 1970) of the 239 cases of SE between
the ages of 1 month and 15 years, 47 (20%) subse-
quently developed motor deficits and 55 (23%) men-
tal impairment which could be directly attributable
to the SE (and not the underlying aetiology). The
motor problems were hemiplegia in 28 (12%) of the
type conforming to the HH syndrome, and diple-
gia, extrapyramidal and cerebellar signs. The motor
and mental sequelae often co-existed and overall 82
(34%) children were affected. In these studies, 118
children were seen in the acute phase of SE and
followed prospectively. Of these, 47 (40%) were left
with neurological and 51 (43%) mental sequelae (a
total of 53 (45%) of cases). In a similar study from
Japan, deficits occurred in 40 (51%) of 79 chil-
dren, of whom 25 (32%) were of the HH type, and
37% mental deficits. A 28% morbidity was found
amongst 52 children by Yager et al. (1988), and a
9.1% morbidity amongst 186 survivors from SE by
Maytal et al. (1989). The experimental data in rodent
models suggest that juvenile animals are less liable
to damage following SE than adult animals (Coulter
and DeLorenzo, 1999), but this issue is, in clinical
practice, unresolved.
The HH and HHE syndromes (initials referring
to the permanent hemiplegia or hemiparesis) and
chronic epilepsy (in about three quarters), which can
follow a prolonged asymmetrical or unilateral febrile
convulsion in a child under 4 years of age (usually
under 2 years) (Aicardi and Chevrie, 1969). Many of
these children have some neurological dysfunction
before the SE, and the SE may be of greater sever-
ity than usual reflecting this. There is severe venous
congestion and thrombosis, and massive cerebral
oedema pathologically, although angiography is usu-
ally normal. The damage is probably due to a mix-
ture of vascular and excitotoxic mechanisms. This
90
used to be a common sequel to febrile SE (Gastaut
et al., 1967; Aicardi and Chevrie, 1969, 1970, 1983),
but with the more rapid and effective early therapy,
HH and HHE are now rare occurrences in developed
countries, although they are still frequent and pre-
ventable in the developing world. This improvement
is very likely to be the consequence of more rapid
and urgent control of convulsive and febrile SE.
Histological and MRI studies of hippocampal and
cortical damage following SE
Hippocampal atrophy and gliosis have been long
recognised to be an association with human SE, both
chronically and in the acute phase. There are defini-
tive pathological studies in the older literature on
this point. These findings are very similar to those
in experimental animal models, and these are dis-
cussed elsewhere in this volume. Corsellis and Bru-
ton (1983), for instance, found almost complete loss
of neurones in the Sommer sector of the hippocam-
pus in 20 patients dying during or soon after an
episode of SE. This acute lesion was recognised as
the precursor of Ammon's Horn Sclerosis. They also
noted damage in the cerebral cortex, the cerebellum
and thalamus. Indeed, widespread gliosis (Chaslin's
gliosis) and neuronal loss in the cortex was ini-
tially regarded as more significant than that in the
hippocampus. Acute neuronal necrosis was found
especially in the middle cortical layers, stretching
over wide areas of the cortical mantle in some cases,
and only patchily distributed in others (Corsellis and
Bruton, 1983). In survivors of the acute lesion, grad-
ual atrophy of the cerebellum was noted, in both
the Purkinje cells and the granular layer, and also
widespread shrinkage, gliosis and neuronal loss in
neocortex and basal ganglions. In 55 patients with
severe chronic epilepsy, Margerison and Corsellis
(1966) found significant damage in the hippocampus
in 65%, in the cerebellum in 45%, in the amygdala
in 27%, in the thalamus in 25% and in the cortex
in 22%. It was concluded that hippocampal sclerosis
was due to ischaemic brain damage in early seizures
or SE. The relative vulnerability of the prosubicu-
lum, CA1 and CA3 regions to damage in human
SE has been confirmed by quantitative measures of
neuronal densities (DeGiorgio et al., 1992; Chapter
21 in this volume). Although all the studies reported
above were of convulsive SE, there is also a single
paper describing three patients without pre-existing
epilepsy who died 11-27 days after the onset of
non-convulsive SE lasting 1-3 days (Fujikawa et al.,
1991). In all three cases there were changes similar
to those outlined above, with neuronal loss in CA1,
CA3 and hilar cells, and also in amygdala, thalamus,
cerebellum and cerebral cortex.
There are also a small number of serial MRI
studies which show evidence of progressive atrophy
following SE. These are reviewed elsewhere in this
volume and will be discussed only briefly here. In
the study of Wieshmann et al. (1997) for instance, a
patient with an episode of SE which lasted 2 weeks
was studied. She was scanned during the episode,
2 months later and then 56 months later. Within
2 months of the SE episode, bilateral hippocampal
atrophy was demonstrated and this had progressed
further at the time of the scan 56 months later. Lim-
ited psychometric analysis over this period (using the
Warrington recognition test for words and faces) also
showed evidence of cognitive decline at 2 months
which had also progressed further at 58 months.
Meierkord et al. (1997) and Chee and Lo (1997)
also reported three cases scanned during and after
episodes of prolonged SE and showed atrophy and
signal change. VanLandingham et al. (1998) showed
changes in hippocampal volume after prolonged or
focal febrile SE. These confirm the findings from
the pre-MRI days of air-encephalographic studies
which showed ventricular enlargement following SE
(Aicardi and Baraton, 1971), and from CT studies
(Labate et al., 1991).
Epilepsy resulting from SE
A fundamental question which has been very inad-
equately researched is whether human SE increases
the propensity for further epilepsy. The animal ex-
perimentation is clear, but there are at present no
modem direct clinical studies of this phenomenon
and data are sparse. The situation is complicated by
the fact that no study has successfully disentangled
the effects of the SE from that of the underlying
aetiology. Four areas can be cited which are relevant
to this aspect.
First is of course the analogy with animal exper-
imentation. In many animal models, experimentally
92
the NCPP (Nelson and Ellenberg, 1981), permanent
hemiplegia occurred after the febrile seizure in only
0.4%, and no child developed the H H E syndrome.
The risk of subsequent epilepsy after a febrile con-
vulsion has varied from 2 to 11%. The NCPP found
a four fold increase in risk of epilepsy in children
who had a febrile convulsion compared to those who
had not (although the overall risk was small). In the
CHES cohort (16004 neonatal survivors, 98.5% of
all children born in the U K in one w e e k in April,
1970), 14676 were studied at 10 years and of these
who were neurologically normal before their first
febrile seizure (382 cases), only 2.4% (9 cases) de-
veloped epilepsy. 32 patients were recorded to have
had a prolonged febrile convulsion and 2 (6%) devel-
oped subsequent epilepsy (Verity, 1998). None o f the
other studies differentiated febrile SE from shorter
febrile seizures, and the risks of epilepsy are no
doubt greater after prolonged febrile seizures. It thus
seems clear that epilepsy can develop after febrile
SE, although the majority of children who experi-
ence febrile SE will not develop subsequent epilepsy
or cerebral damage. The subject o f the relationship
between febrile seizures and epilepsy is discussed
elsewhere in this volume.
Future studies of the potential of SE to cause
epilepsy are needed. These are important clinically to
assess the place of neuroprotection. F r o m the clinical
perspective, studies o f epilepsy after SE are compli-
cated by the confounding effects of the aetiology, the
type of SE, and ceiling effects. Investigations of de
novo SE in patients without previous epilepsy are
useful only if the cause of the SE is known itself
not to result independently in subsequent epilepsy
(and this excludes cases due, for instance, to cere-
bral infection, trauma, stroke or tumour). Ideally, a
case control methodology should be utilised, with SE
cases matched to other epilepsy patients without a
history of SE. The results should be stratified by age,
and by the duration of the SE. These are formidable
design problems and because of the difficulties these
pose, there are no published studies to date which
have satisfactorily explored this question.
References
Aicardi, J. and Baraton, J. (1971) A pneumoencephalographic
demonstration of brain atrophy following status epilepticus.
Dev. Med. Child Neurol., 13: 660-667.
Aicardi, J. and Chevrie, J.-J. (1969) Acute hemiplegia in infancy
and childhood. Dev. Med. Child Neurol., 11: 162-173.
Aicardi, J. and Chevrie, J.-J. (1970) Convulsive status epilepticus
in infants and children. Epilepsia, 11: 187-197.
Aicardi, J. and Chevrie, J.-J. (1989) Status epilepticus. Pedi-
atrics, 84: 939-940.
Aicardi, J. and Chevrie, J.-J. (1983) Consequences of status
epilepticus in infants and children. In: A.V. Delgado Escueta,
C.G. Wasterlain, D.M. Treiman and R.J. Porter (Eds.), Status
Epilepticus. Mechanisms of Brain Damage and Treatment.
Advances in Neurology 34, Raven Press, New York, NY, pp.
115-128.
Aminoff, M. and Simon, R.P. (1980) Status epilepticus: causes,
clinical features and consequences in 98 patients. Am. J. Med.,
69: 657-666.
Annergers, J.F., Hauser, W.A., Shirts, S.B. and Kurtland, L.T.
(1987) Factors prognostic of unprovoked seizures after febrile
convultions. New England J. Med., 316: 493~-98.
Barois, A., Estournet, B., Baron, S. and Levy-Alcover, M. (1985)
Prognostic h long terme des 6tats de mal convulsifs prolongrs.
A propos de vingt-neuf observations d'6tats de mal convulsifs
de plus du vingt-quatre heures. Ann. Pediatr., 32: 621-626.
Berg, A.T., Shinnar, S., Hauser, W.A., Alemany, M., Shaprio,
E.D., Salomon, M.E. and Crain, E.F. (1992) A prospective
study of recurrent febrile studies. New England J. Med., 327:
1122-1127.
Chee, M.W.L. and Lo, N.K. (1997) Asymmetric hippocampal
atrophy and extra-hippocampal epilepsy following refractory
status epilepticus in an adult. J. Neurol. Sci., 147: 203-204.
Corsellis, J.A.N. and Bruton, C.J. (1983) Neuropathology of sta-
tus epilepticus in humans. In: A.V. Delgado Escueta, C.G.
Wasterlain, D.M. Treiman and R.J. Porter (Eds.), Status
Epilepticus. Mechanisms of Brain Damage and Treatment.
Advances in Neurology 34, Raven Press, New York, NY, pp.
129-139.
Cockerell, O.C., Walker, C.M., Sander, J.W.A.S. and Shorvon,
S.D. (1994) Complex partial status epilepticus: a recurrent
problem. J. Neurol., Psychiatry Neurosurg., 57: 835-837.
Coulter, D.A. and DeLorenzo, R.J. (1999) Basic mechanisms
of status epilepticus. In: A.V. Delgado, W.A. Wilson, R.W.
Olsen and R.J. Porter (Eds.), Jaspers Basic Mechanisms of
the Epilepsies. Lippencott Williams and Wilkins, Philadelphia,
PA, pp. 725-733.
DeGiorgio, C.M., Tomiyasu, U., Cott, P.S. and Treiman, D.M.
(1992) Hippocampal pyramidal cell loss in human status
epilepticus. Epilepsia, 33: 23-37.
DeLorenzo, R.J., Garnett, L.K., Towne, A.R., Waterhouse, E.J.,
Boggs, J.G., Morton, L., Afzal Choudhry, M., Barnes, T. and
Ko, D. (1999) Comparison of status epilepticus with prolonged
seizure episodes lasting from 10 to 29 minutes. Epilepsia, 40:
164-169.
DeLorenzo, R.J., Pellock, J.M., Towne, A.R. and Boggs, J.G.
(1995) Epidemiology of status epilepticus. Z Clin. Neurophys-
iol., 12: 316-325.
Dodrill, C.B. and Wilenski, A.J. (1990) Intellectual impairment
 91

TABLE 3
The course of epilepsy after an episode of convulsive status in 5 patients with pre-existing epilepsy
Patient Sex/age Seizure type prior to SE Aetiology of epilepsy Approx Course in subsequent 12 months
duration
of status
1. F/32 CPS, SGTCS, > 1/month Post-tranmatic 36 h 7 months seizure free, then epilepsy returned at
previous frequency
2. M/34 CPS,SGTCS, > 1/month Hippocampalsclerosis 24 h No change
3. M/27 CPS, SPS, SGTCS, 1/3 month Hippocampal sclerosis 24 h Szs unchanged in form but more frequent
(> 1/month)
4 M/38 CPS, SPS, SGTCS Post-operative dysplasia 12 h No change
5. F/22 SGTCS Not known 6h New seizure type developed (motor partial Szs),
frequency unchanged
Course of epilepsy in 5 patients with chronic epilepsy, followed for at least 12 months after an episode of convulsive status. The duration
of status is given approximately (to nearest 6 h). Seizure frequencies are categorised into: < 1/month; l-3/month; <3/month). Patients 1
and 4 had at least one documented previous episode of status).
Key: M = male; F = female; CPS = complex partial seizures; SPS = simple partial seizures; SGTCS = secondarily generalised tonic
clonic seizures; Szs = seizures.

induced SE results in a continuing propensity to Syndrome in 16 (11%), and partial epilepsy in 35

seizures. This is attributed usually to the status-
induced hippocampal damage, and this resembles
human hippocampal sclerosis. A good (but by no
means the only) example is that of the self-sustaining
limbic status epilepticus model of Lothman (see
Fountain and Lothman, 1995). The induced SE usu-
ally lasts several hours and the animals gradually
return to normal. The episode results in chronic cell
loss in CA1 and in the middle layers of entorhinal
cortex. About one month later, the animals begin
to have spontaneous seizures, of a complex partial
type, and this chronic epilepsy' persists for at least
12 months (the longest reported period yet of follow
up; Fountain and Lothman, 1995). Epilepsy is a se-
quel of chemically and electrically induced SE in a
wide range of models, and of course also of kindling
(Coulter and DeLorenzo, 1999).
Second, SE is sometime the first manifestation of
epilepsy - - and it could be hypothesised that, at least
in some cases, the status-induced damage is the cause
of the subsequent epilepsy. In various series, between
40 and 70% of all cases of SE occur in people without
a previous history of epilepsy, and in 12% of all cases
of epilepsy the seizures started with SE.
Third, an episode of SE can also change seizure
type. In the 239 children reported by Aicardi and
Chevrie (1970) for instance, the following seizure
types developed de novo: infantile spasms in 10
(7%) cases, further SE in 15 (10%), Lennox Gastaut
(15%). Tonic clonic seizures occurred after the SE
in five fewer patients than before. I have reviewed
the subsequent course of epilepsy in five patients
with chronic epilepsy who sustained an episode of
SE from m y own practice (Table 3). In two, the SE
made no difference to the seizure pattern. In one, a
new seizure type emerged (partial motor seizures),
in one there was a period of freedom from seizures
for 7 months before the epilepsy returned at ap-
proximately its previous frequency, and in one the
epilepsy was significantly worsened after the SE.
Such observations of course are uncontrolled and
furthermore, treatment changes were made in all
except one case, yet they do provide anecdotal evi-
dence that SE can alter, in various ways, the course
of epilepsy. Epilepsy is more likely if the episode of
SE resulted in overt cerebral damage. About three
quarters of those children with post-status hemiple-
gia, for instance, will also develop seizures (Gastaut
et al., 1967; Aicardi and Chevrie, 1969, 1970, 1983).
Finally, there is the evidence that epilepsy can
result from febrile SE. Although the case series
from hospital practice provide rather ominous evi-
dence of the potential for febrile seizures to cause
SE, the epidemiological studies are more reassur-
ing. There were no deaths from febrile seizures or
SE recorded amongst the 2740 children in the three
largest prospective studies (Nelson and Ellenberg,
1981; Annergers et al., 1987; Berg et al., 1992). In

as an outcome of status epilepticus. Neurology, 40(Suppl. 2):
23-27.
Freeman, J.M. (1989) Status epilepticus: it's not what we've
thought or taught. Pediatrics, 83: 444-445.
Fountain, N.B. and Lothman, E.W. (1995) Pathophysiology of
status epilepticus. J. Clin. Neurophysiol., 12: 326-342.
Fujiwara, T., Watanabe, M., Matsuda, K., Senbongi, M., Yagi,
K. and Seino, M. (1991) Complex partial status epilepticus
provoked by ingestion of alcohol. Epilepsia, 32: 650-656.
Gastaut, H., Roger, J. and Lob, H. (1967) Les dtats de mal
gpileptiques. Masson, Paris.
Goulon, M., Levy-Alcover, M.A. and Nouailhat, F. (1985) Etat
de mal 6pileptique de l'adulte, 6tude 6pid6miologique et clin-
ique en r6animation. Rev. EEG Neurophysiol., 14: 277-285.
Labate, C., Magaudda, A., Fava, C., Meduri, M. and Di Perri, R.
(1991) Hemispheric brain atrophy following unilateral status
epilepticus. Boll. Lega Ital. Contro L'Epilepsia, 74: 103-104.
Lowenstein, D.H., Bleck, T. and MacDonald, R. (1999) It's time
to revise the definition of status epilepticus. Epilepsia, 40:
120-122.
Margerison, J.H. and Corsellis, J.A.N. (1966) Epilepsy and the
temporal lobes: a clinical, electroencephalographic and neu-
ropathological study of the brain with particular reference to
the temporal lobes. Brain, 89: 499-530.
Maytal, J., Shinnar, S., Moshe, S.L. and Alvarez, L.A. (1989)
Low morbidity and mortality of status epilepticus in children.
Pediatrics, 83: 323-331.
Meierkord, H., Wieshmann, U., Niehaus, L. and Lehmann, R.
(1997) Structural consequences of status epilepticus demon-
strated with serial magnetic resonance imaging. Acta Neurol.
Scand., 96: 127-132.
Meldrum, B.S. (1997) First Alfred Meyer Memorial Lecture.
Epileptic brain damage: a consequence and a cause of seizures.
Neuropathol. Appl. Neurobiol., 23: 185-202.
Meldrum, B.S. and Brierley, J.B. (1973) Prolonged epileptic
seizures in primates: ischaemic cell change and its relation to
ictal physiological events. Arch. Neurol., 28: 10-17.
93
Meldrum, B.S. and Horton, R.W. (1973) Physiology of status
epilepticus in primates. Arch. Neurol., 28: 1-9.
Meldrum, B.S., Vigouroux, R.A. and Brierley, J.B. (1973) Sys-
temic factors and epileptic brain damage. Arch. Neurol., 29:
82-87.
Meldrum, B.S., Horton, R.W. and Brierley, J.B. (1974) Epilep-
tic brain damage in adolescent baboons following seizures
induced by alloglycine. Brain, 99: 523-542.
Nelson, K.B. and Ellenberg, J.H. (Eds.) (1981) Febrile Seizures.
Raven Press, New York.
Phillips, S.A. and Shanahan, R.J. (1989) Etiology and mortality
of status epilepticus in children: a recent update. Arch. Neurol.,
46: 74-76.
Oxbury, J.M. and Whitty, C.W.M. (1971) Causes and conse-
quences of status epileptieus in adults: a study of 86 cases.
Brain, 94: 733-744.
Rowan, A.J. and Scott, D.F. (1970) Major status epilepticus: a
series of 42 patients. Acta Neurol. Scand., 46: 573-584.
Shorvon, S.D. (1994) Status Epilepticus: Its Clinical Features
and Treatment in Children and Adults. Cambridge University
Press, Cambridge.
Towne, A.R., Pellock, J.M., Ko, D. and DeLorenzo, R.J. (1994)
Determinants of mortality in status epilepticus. Epilepsia, 35:
22-34.
VanLandingham, K.E., Heinz, E.R., Cavazos, J.E. and Lewis,
D.V. (1998) MRI evidence of hippocampal injury after pro-
longed febrile convulsions. Ann. Neurol., 43: 413-426.
Verity, C.M. (1998) Do seizures damage the brain? The epidemi-
ological evidence. Arch. Dis. Child., 78: 78-84.
Yager, J.Y., Cheang, M. and Seshia, S.S. (1988) Status epilepti-
cus in children. Can. J. Neurol. Sci., 15: 402-405.
Wieshmann, U.C., Woermann, F.G., Lemieux, L., Free, S.L.,
Bartlett, P.A., Smith, S.J.M., Duncan, J.S., Stevens, J.M. and
Shorvon, S.D. (1997) Development of hippocampal atrophy: a
serial magnetic resonance imaging study in a patient who de-
veloped epilepsy after generalised status epilepticus. Epilepsia,
38: 1238-1241.
T. Sutula and A. Pitk~en (Eds.)
Progressin BrainResearch,Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 8

Repeated brief seizures induce progressive hippocampal

neuron loss and memory deficits

Robert Kotloski 1, Michael Lynch 1, Suzanne Lauersdorf I and Thomas Sutula 1,2,*

1Department of Neurology and2Department of Anatomy, University of Wisconsin, Madison, W153792, USA

Abstract: The long-term effects of repeated brief seizures on spatial memory and hippocampal neuronal populations were
assessed in kindled rats. Rats that experienced a range of 3 afterdischarges to 134 secondary generalized tonic-clonic
(Class V) seizures evoked by stimulation of the olfactory bulb were evaluated in a radial arm maze task that is a measure
of spatial memory and is disrupted by hippocampal damage. After completion of the memory task and a minimum of "-~3
months after the last evoked seizure, stereological methods were used to assess neuronal populations at septal and temporal
locations of the hippocampus and dentate gyms. Repeated brief seizures induced a long-lasting deficit in spatial memory
performance that was detected after a cumulative total of "-~6partial and 30 secondary generalized seizures. The memory
deficit progressively increased as a function of the number of seizures, and was not observed in age-matched, electrode-
implanted, unstimulated, but otherwise similarly handled paired controls. Neuronal loss was detected in the temporal hilus
of the dentate gyms, CA1, and CA3 of the hippocampus after 69 or more secondary generalized tonic-clonic seizures,
and was associated with the progressive memory dysfunction. Repeated brief seizures induced progressive, permanent
functional and structural abnormalities in the hippocampus, which included spatial memory deficits accompanied by
gradually evolving neuronal loss in a pattern resembling human hippocampal sclerosis. These experimental results support
the view that hippocampal sclerosis and associated memory dysfunction are induced by repeated seizures, and imply that
seizure control could prevent adverse long-term consequences of seizures on hippocampal dependent functions.

Introduction not merely the result of hypoxia or metabolic distur-

The question of whether seizures cause brain dam-
age has provoked controversy for more than a cen-
tury. While there has been continuing debate about
whether brief seizures induce neural damage, both
experimental and clinical studies have firmly es-
tablished that intense or continuous seizures during
status epilepticus induce widespread neural damage
prominently involving the hippocampus. The dam-
age is a direct consequence of the seizures and is
* Correspondence to: T.E Sutula, Department of Neu-
rology H6/570, University of Wisconsin, Madison, WI
53792, USA. Tel.: +1-608-263-5448; Fax: -t-1-608-263-
0412; E-mail: sutula@neurology.wisc.edu
bances (Meldrum et al., 1973).
Prompt, effective treatment of status epilepticus in
rodent models not only suppresses the acute seizures,
but also reduces or prevents long-term consequences,
such as seizure-induced damage in specifically vul-
nerable neurons in the hippocampal dentate gyms,
associated mossy fiber sprouting, behavioral abnor-
malities, and increased susceptibility to evoked kin-
died seizures (Ylinen et al., 1991; Sutula et al.,
1992). These beneficial long-term effects of treat-
ment in status epilepticus have important clinical im-
plications for resolving the controversy about neural
damage induced by recurring brief seizures. If neural
damage is also a consequence of the brief recurring
seizures that are the defining feature of epilepsy,
prompt effective treatment that achieves complete
96
control and suppression of sporadic seizures would
be expected to forestall cognitive impairment and
development of intractable epilepsy.
The most commonly encountered pattern of dam-
age in human epilepsy is neuronal loss and gliosis in
the hippocampus prominently involving CA1, CA3,
and the hilus of the dentate gyms, which has been
referred to as hippocampal sclerosis, Ammon's Horn
sclerosis, or mesial temporal sclerosis (Gloor, 1991).
Autopsy studies and pathological examination of
the surgically resected human temporal lobe have
demonstrated that the damage may variably involve
other regions of the hippocampus (Mouritzen Dam,
1980; Margerison and Corsellis, 1966), including
CA2 and the granule cell layer of the dentate gyms,
which are regarded as relatively resistant to hypoxic
and excitotoxic damage (Sloviter, 1989).
Volumetric MRI methods have established a cor-
relation between atrophy of the hippocampus and the
histological lesion of hippocampal sclerosis (Cas-
cino et al., 1991), and have confirmed that the
damage may involve not only the hippocampus,
but other limbic areas such as the entorhinal cor-
tex, lateral temporal cortex, and regions beyond the
hippocampal formation (DeCarli et al., 1998; Lee
et al., 1998; Bernasconi et al., 1999). MRI studies
have also helped to define the relationship between
seizure onset, duration of epilepsy, and the develop-
ment of hippocampal damage. Hippocampal volume
loss may be a consequence of an initial precipitating
injury such as prolonged febrile seizures or febrile
status epilepticus in children (Sagar and Oxbury,
1987; Vanlandingham et al., 1998), and in adults the
extent of hippocampal volume loss is correlated with
duration of epilepsy (DeCarli et al., 1998; Lee et
al., 1998; Theodore et al., 1999) and in some stud-
ies, with estimates of cumulative seizure frequency
(Kalviainen et al., 1998; Salmenpera et al., 1998;
see also Theodore and Gaillard, 2002, this volume;
Holmes et al., 2002, this volume). While volumet-
ric MRI studies have demonstrated that hippocampal
atrophy or sclerosis is progressive in patients with
intractable epilepsy, the roles of initial precipitating
injury and/or repeated seizures in the induction of
hippocampal sclerosis remain controversial.
The question of whether hippocampal damage is
a consequence of an initial injury or might also be
caused by cumulative seizure-induce brain damage
can be directly addressed in experimental animal
models of chronic epilepsy. Although it had gen-
erally been believed that brief sporadic seizures do
not induce neuronal damage, recent work from mul-
tiple laboratories has provided increasingly strong
evidence that repeated brief seizures induce neu-
ronal death. The possibility that repeated seizures
might induce neuronal damage followed the obser-
vation that kindling induced progressive sprouting
of the mossy fiber pathway in the dentate gyms,
which suggested that the sprouting might be a re-
active consequence to progressive seizure-induced
deafferentation or neuronal loss (Sutula et al., 1988;
Cavazos et al., 1991). Stereological methods initially
demonstrated that there was a reduction in neuronal
density in the hilus of the dentate gyrus which in-
creased as a function of the number of seizures, and
was consistent with neuronal loss (Cavazos and Su-
tula, 1990). Subsequent studies reported that brief
repeated seizures evoked by kindling progressively
reduced neuronal density in a variety of hippocam-
pal and extra-hippocampal areas. The reduction in
density was initially most apparent in the hilus of the
dentate gyms, but also gradually developed in CA1,
CA3, and the entorhinal cortex, and thus cumula-
tively resembled the pattern of the neuronal loss in
hippocampal sclerosis (Cavazos et al., 1994). In this
study, there was non-significant trend to a seizure-
induced increase in overall hippocampal volume,
and there has been controversy about whether the
seizure-induced reduction in neuronal density in the
hilus was caused by an increase in the volume or by
neuronal loss (Bertram and Lothman, 1993; Adams
et al., 1997). Dramatic increases in volume of the
dentate gyrus have been reported in a chronic mouse
model of epilepsy induced by kainic acid (Bouilleret
et al., 2000).
More recent studies using so-called unbiased
stereological methods have confirmed the observa-
tion of seizure-induced neuronal loss in the hilus
after seizures (Dalby et al., 1998), and multiple lab-
oratories have reported that repeated brief seizures
evoked by kindling induce apoptotic neuronal death
in both hippocampal and extrahippocampal regions
(Bengzon et al., 1997; Pretel et al., 1997; Zhang
et al., 1998), which supports the interpretation that
seizures induce neuronal death and cumulatively re-
sult in a pattern of neuronal loss resembling hip-

pocampal sclerosis as well as more widespread dam-
age which is often encountered in human temporal
lobe epilepsy. As a further complication for assess-
ment of seizure-induced neuronal loss, it is now
apparent that seizures evoked by pilocarpine and
kindling also induce neurogenesis in the rat den-
tate gyms (Parent et al., 1997, 1998) which could
restore neuronal number and possibly contribute to
the seizure-induced increase in volume of this region
reported in rodent models.
To further address the controversial questions
about seizure-induced neuronal loss, stereological
and morphometric analysis was performed in a group
of rats that experienced seizures evoked by kindling
stimulation of the olfactory bulb. This group of kin-
dled rats was previously examined in a radial arm
maze task and demonstrated progressive seizure-
induced memory dysfunction as a function of the
number of evoked seizures (Sutula et al., 1995).
Stereological analysis in these kindled rats with char-
acterized seizure-induced memory deficits provided
an opportunity to determine if a relationship existed
between the number of seizures, development of spa-
tial memory dysfunction, and alterations in specific
hippocampal neuronal populations. The results re-
vealed an increase in volume of the dentate gyms
that may partially account for reduced neuronal den-
sity in the hilus, but as changes in volume were
not observed in CA1 and CA3, the seizure-induced
reductions in these regions were most likely caused
by neuronal loss. Evidence for neuronal loss in CA1
and CA3 was observed only after ~ 3 0 evoked Class
V seizures, which corresponded to the onset of per-
formance deficits in the radial arm maze that requires
integrity of the hippocampus.
Methods
Surgical and kindling procedures
Adult male Sprague-Dawley rats (250-350 g) were
anesthetized with a combination of ketamine 80
m g / k g i.m. and xylazine 10 mg/kg i.m., and were
stereotaxically implanted with an insulated stainless
steel bipolar electrode for stimulation and record-
ing. The electrode was implanted in the olfactory
bulb (9 mm anterior, 1.2 m m lateral, 1.8 mm ven-
tral to bregma). After a recovery period of 2 weeks,
97
age-matched pairs of electrode implanted rats were
randomly assigned to a group that received kindling
stimulation, or to a paired control group that was
similarly handled, but did not receive electrical stim-
ulation.
The unrestrained awake animals in the kindling
group received twice daily kindling stimulation (5
days per week) with a 1-s train of 62 Hz biphasic
constant current 1.0 ms square-wave pulses, accord-
ing to standard procedures (Cavazos et al., 1994).
The evoked behavioral seizures were classified ac-
cording to standard criteria (Sutula and Steward,
1986). Rats received stimulation until 3 afterdis-
charges (ADs), or 3, 30, 69-75, or >83 Class
V seizures were evoked. A group of paired age-
matched control rats were handled and placed in the
recording cage twice daily according to the same
protocol, but did not receive stimulation. Each con-
trol rat was handled twice daily until its paired kin-
dled rat experienced the assigned number of Class V
seizures.
Behavioral testing
A complete description of the behavioral assessment
of these rats has been published previously (Sutula
et al., 1995). After completion of the last kindling
stimulation, the kindled rats were treated with a 1-
month rest interval. During this interval, the kindled
rats were placed into the recording cage and handled
twice daily in the same manner as the control rats,
but did not receive electrical stimulation. Control
rats continued to undergo twice daily handling and
placement in the recording cage. After completion
of the 1-month rest interval, behavioral testing in an
8-arm radial maze was performed 5 days per week,
according to previously described procedures. For
the duration of the study, the same 4 arms of the
8-arm radial maze were baited with a raisin, which
was hidden from view in a recess at the end of the
arm. Each rat was placed in the center area of the
maze, and was observed for the sequence of arm
entries and consumption of the raisins. Criterion per-
formance was defined as consumption of the raisin
in all 4 baited arms during no more than 5 entries.
The sequence of entries into baited and unbaited
arms of the radial maze was recorded during daily
behavioral trials. According to terminology in previ-
98
ous studies, entry into an unbaited arm was scored
as a reference error. Reentry into a baited arm was
scored as a working error. Reentry into an unbaited
arm was scored as a reference and a working error.
Completion of the behavioral task was defined as
achievement of criterion performance on each of 5
consecutive daily trials. After achievement of cri-
terion performance on 5 consecutive days, the rats
continued daily behavioral trials for an additional
week, and were then evaluated for recall or memory
of the correct baited arms by an additional testing
procedure. In this additional testing procedure, all
arms of the radial maze were unbaited. Each rat was
then placed in the center of the maze, and the ratio of
entries into previously baited and unbaited arms, and
time spent in previously baited arms was recorded
during a 10-min period of observation.
Histological procedures
After completion of behavioral testing, each rat was
deeply anesthetized and perfused transcardially with
an aqueous solution of 10% (v/v) formalin in 0.9%
(w/v) NaC1. The brains were removed, postfixed for
at least 10 days in same solution, dehydrated for 35
days in graded concentrations of alcohols, and were
then embedded in graded concentrations of low vis-
cosity nitrocellulose (celloidin) for 50 days, which
provides superior preservation of the neuronal archi-
tecture. Horizontal 20-1xm sections were cut using
a sliding microtome from the surface of neocor-
tex throughout the most ventral hippocampus. All
sections were retained and stored in 70% ethanol.
Every fifth section was stained with cresyl violet,
but additional sections were also stained to insure
that equivalent areas were available for quantitative
assessment in each specimen.
Stereological analysis
Locations for neuron counting
Neuronal counts were obtained in the dentate gyms
and hippocampus in horizontal sections at two stan-
darized locations along the septotemporal (dorsoven-
tral) axis of the hippocampal formation, as in pre-
vious studies (Cavazos and Sutula, 1990; Cavazos
et al., 1994). The location of the regions, which are
illustrated in Figs. 1-3 of Cavazos et al. (1994), were
identified by the following criteria: (1) In a hori-
zontal section about 800 txm ventral from the most
dorsal hippocampus, neuronal density was measured
in the hilus of the dentate gyms, CA3a, CA3c, CA2,
CAla, and CAlc. At this septotemporal level, the
polymorphic neurons in the hilus of the dentate
gyms are enclosed in an oval ring formed by granule
cells in the stratum granulosum. (2) In a horizontal
section about 2800 Ixm ventral from the most dor-
sal hippocampus that included the motor nuclei of
cranial nerves Ili and IV, neuronal density was mea-
sured in the hilus of the dentate gyms, CA3a, CA3c,
CA2, CAla, and CAlc. The investigator performing
the counts was unaware of the identity of the sec-
tions, and the order of examination of the sections
was randomized.
Counting methods
Counts of nuclei were obtained ipsilateral and con-
tralateral to the stimulating electrode at the stan-
dardized locations by an optical disector method.
All nuclei (objects) that came into focus within the
area of an eyepiece reticule (25 m m 2) while moving
the microscope headstage through the thickness of
the section were manually counted. In each reticule
field, nuclei overlapping the lower and left edges of
the reticule were counted, but nuclei that overlapped
the upper and right edges were not counted. In each
location, the number of neurons and their relative
position were recorded using a camera lucida, and
were summed to obtain the nuclear count per reticule
field through the thickness of the section. In previous
experiments, the nuclear counting procedure in this
study had an inter-observer variability of less than
10%; the intra-observer variability was 3% (Cavazos
and Sutula, 1990; Cavazos et al., 1994). Previous
studies have revealed that these methods are quite
sensitive for assessment of neuronal loss, which typ-
ically exceeds 15-20% before a lesion is reliably
detected by visual inspection (Konigsmark, 1969;
Cavazos and Sutula, 1990; Cavazos et al., 1994).
Mean neuronal density (Ni) for each counted re-
gion was calculated from the average nuclear count
per reticule field (ni) obtained from the standard-
ized septal and temporal sections according to the
Floderus formula: Ni = n i x t / ( t + d - 2b), where

Ni is the corrected neuronal density, ni is the aver-
age nuclear count per reticule field, t is the section
thickness, d is the average nuclear diameter at each
of the counted regions, and b is a constant which
represents the limit of optical resolution for each
objective (Konigsmark, 1969; Cavazos and Sutula,
1990; Cavazos et al., 1994). For counts obtained
with a 20× objective (n.a. 0.75), b = 0.36 I~m. The
thickness (t) of each section was also determined
by measuring the distance between upper and lower
focal planes of the section with the stage micrometer
using the 100 × oil immersion objective. The average
nuclear diameter (d) for neurons in the hilus of the
dentate gyms and hippocampal pyramidal neurons
ranged from "--6.5 to 11 Ixm. The ratio of section
thickness (t)/nuclear diameter (d) was always above
1.5 (range: 1.81-3.07), which supports the stereo-
logical assumptions of this method (Clarke, 1992).
Volume measurements
As systematic changes in tissue volume could al-
ter the neuronal density, estimates of the volume of
the hippocampal region (hippocampus proper, i.e.,
CA1, CA2, CA3, and dentate gyms were obtained
from ipsilateral and contralateral hemispheres using
a stereological approximation method. The volume
of the combined hippocampus proper and dentate
gyms in the temporal region (Vtot~) was measured
through six consecutive sections, including the sec-
tion chosen for counting, using an image analy-
sis system. (Vtotal) was measured using the formula
Vtotal : ~ n = l - 6 (An -q-An+l)t/2 where An is the area
of the combined hippocampus proper and dentate
gyms in the n-th section, An+l is the combined area
of the next section, and t is the thickness of the
consecutive sections. For calculation of the volume
of the dentate gyms (VoG), An was measured by out-
lining the circumference of the dentate gyms from
crest to crest along the hippocampal fissure, and
connecting the tips with straight lines that excluded
pyramidal neurons in CA3c. The hippocampal vol-
ume (VH) was calculated by subtraction according
to the following formula: VH = Vtotal- VDG. For
each rat, the volume corrected mean neuronal den-
sities (Nvcor) of the hilus of the dentate gyms and
hippocampal subfields of the septal and temporal
locations were calculated according to the formula
99
Nvcor = Ni x Vx/Vc, where Vx is the estimated vol-
ume (Vto~, VH, or VoG) of the given rat, and Vc is
the corresponding estimated mean volume of control
rats.
Statistical methods
All measures were expressed as mean :t: SEM. The
differences in nuclear counts per reticule field (ni),
mean neuronal densities (NiL and volume-corrected
neuronal densities (Nvcor) as a function of the num-
ber of evoked seizures were statistically analyzed
using an ANOVA and were considered significant
when P < 0.05. Individual comparisons were evalu-
ated for significance using the Bonferroni correction.
Results
Effects of brief repeated seizures on spatial memory
performance
Spatial memory was assessed by radial arm maze
testing in 32 pairs of kindled rats and age-matched
control rat, which have been reported in detail previ-
ously (Sutula et al., 1995). Kindled rats experienced
a range of three evoked ADs to 134 Class V seizures.
The age-matched control rat of each pair was im-
planted with an olfactory bulb electrode and was
handled similarly, but received no stimulation. Kin-
dled rats studied at 1 month after the last of 30-
134 evoked Class V seizures acquired competence
in radial arm maze performance at a rate that was
indistinguishable from controls, but demonstrated a
deficit in the ability to repeat the task on consecutive
days. At 1 month after the last evoked seizure, these
performance deficits are unlikely to be affected by
acute consequences of recent seizures. The spatial
memory deficit was detected in rats with greater than
30 evoked Class V seizures, but was not observed
in kindled rats that experienced three ADs or three
Class V seizures. The severity of the deficit, as as-
sessed by the number of reference errors in the radial
arm maze, increased as a function of the number
of evoked seizures (Sutula et al., 1995; see also
Fig. 3A).
100

TABLE 1
Septal hippocampus

Control 3ADs 3 Class V 30 Class V 69-75 Class V >83 Class V ANOVA

Hilus
n 32 6 6 4 8 8
Counts 20.44-0.5 214- 1.2 18.84- 1 16.3-t- 1 17.55:0.9 16.3-t-0.8 F = 9.84,
P < 0.0001
Ni 290144-1115 299924-3204 226514-4237 201764-3586 265804-2355 233624-1435
Nv~,~ 28657 4- 1049 29659 4- 2053 24016 -I- 3791 22431 4- 2813 28254 4- 2658 26045 4-1115 F = 1.28,
P = 0.2816
CA3a
n 32 6 6 4 8 8
Counts 9.24-0.2 8.54-0.7 8.24-0.3 9.14-0.3 9.34-0.5 9.14-0.5
IV/ 1917724-4850 1743864- 15943 173414 4- 10832 1939704-5104 1914414- 10718 185449 4- 10993
Nvcor 189941 4-4679 1701564- 11627 1687804- 12165 1991944-10481 192838 4- 12935 184731 4-15178

CA3c
n 32 6 6 4 8 8
Counts 194-0.4 21.84-0.9 20.14-0.8 18.74-1.4 18.84-0.9 18.94-0.9
N~ 2764864-7170 3109104-14617 2892274-12651 2768734-24785 2666054-9252 2708874-15773
Nvoot 2737794-6677 3056284- 12719 2868134- 16032 2817044-18366 271343-4-13898 2647124- 15133

CA2
n 32 6 6 4 8 8
Counts 10.14-0.2 10.54-0.7 9.34-0.5 114-0.6 10.74-0.7 11.44-0.7
Ni 2106514-6480 2212264- 15589 192011 4- 14098 2383534- 11171 2284864-11937 2372734-16302
Nvcor 2087554-5803 2172964-17598 1889684-13904 2432704-12228 2261154-15601 2341524-20469

CAla
n 32 6 6 4 8 8
Counts 25.3 4- 0.6 25.2 4- 0.8 24.1 4-1.3 24.2 4-1.1 25.3 4-1.0 30.1 4-1.3
Ni 567022 4-16816 559413 4-20576 568237 4-37920 5591024- 31839 552675 4-15886 568728 4-18478
Nvoo~ 5596274-13672 5505704-21184 5643334-37919 5737914-32925 5687264-28412 5588494-36905

CAlc
n 32 6 6 4 8 8
Counts 224-0.6 21.94- 1.0 23.84-1.9 25.94-1.2 23.24- 1.3 23.64-1.0
Ni 5010644-17716 5083064-27552 5951194-81945 6262164-33420 5244584-34426 5414824-28548
NV~T 5066254-15319 5013564-27279 5791504-62356 6415154-40157 5384434-31166 5347624-40319

n, number of rats; Ni, neuronal density; Nvoo,, volume corrected neuronal density.

Effects of brief repeated seizures on hippocampal
neuronal density
Spatial memory performance in the radial ann maze
may be disrupted by hippocampal damage, so it
was of interest to determine if the radial arm maze
performance deficits, which increased as a function
of the number of evoked seizures, were accompanied
by hippocampal neuron loss. Neuronal densities in
the hilus of the dentate gyms and the CA3, CA2, and
CA1 subfields were measured at septal and temporal
levels of the hippocampal formation at 7 days after
completing the maze task in the 32 pairs of kindled
and age-matched control rats.
There were decreases in hippocampal neuronal
counts and volume-corrected neuronal densities
(Nvcor) that developed as a function of the number
of evoked seizures (see Tables 1 and 2, and Fig. 1),
which confirmed previous reports of seizure-induced
neuronal loss in other groups of kindled rats (Cava-
zos and Sutula, 1990; Cavazos et al., 1994). De-
creases in NVcor in kindled rats were observed primar-
ily in the temporal regions of the hippocampus, and
included the hilus of the dentate gyms, CA3c, CAla,
 101

TABLE 2
Temporal hippocampus

Control 3ADs 3 Class V 30 Class V 69-75 Class V >83 Class V ANOVA

Hilus
n 32 6 6 4 8 8
Counts 37.74-0.7 36.64-1.5 39.1.1.5 38.3-1-1.7 33.34-1.0 31.9,1,1.3 F = 12.6,
P < 0.0001
Ni 505384-1423 50466±1601 49917-1-1941 49866.1.754 43384±1135 426054-2578
Nv cot 498984- 1 2 6 7 49574-4-1 5 2 0 5 4 0 8 3"1"2890 53849"1"3 0 7 5 43537 ± 2772 4 7 7 9 54- 2435 F = 4.05,
P = 0.02
CA3a
n 32 6 6 4 8 8
Counts 14.3+0.3 12.9.1.0.5 14.4,1,0.6 13.54-0.6 12.94-0.5 13.64-0.6 F = 2.95,
P = 0.0559
Ni 182988,1,4516 172740+7297 1797134-8159 171357+4161 1634724-7365 1761664-7932
Nvcor 180102.1.4147 170475-4-7059 177141,1,7374 1754544-8655 1534234- 13310 173121+7902 F = 2.36,
P = 0.099
CA3c
n 32 6 6 4 8 8
Counts 16.64-0.3 15.74-0.8 17.1.0.7 15.34-0.9 15.6.1.0.5 14.94-0.6 F = 3.13,
P = 0.0473
Ni 2328724-5782 228144-4-10525 231114,1,7961 2117444-14748 2171404-8918 210943+9087
Nvcor 229018-1-5044 2246154-10197 226723,1,8766 216833-t-15869 201944±15621 2074524-9322 F=3.48,
P = 0.034
CA2
n 32 6 6 4 8 8
Counts 12.54-0.3 12.5.1.0.4 13.8+0.8 11.84-0.8 12.74-0.8 12.5±0.4
Ni 170532.1.3786 177990-4-5541 182069±12669 159715±11239 170670±12971 1723414-3217
Nvcor 168304,1,3815 175407-t-6527 178145~z8814 1631804-13134 162891,1,16649 1701244-7947
CAIa
n 32 6 6 4 8 8
Counts 18.44-0.4 20.6,1, 1.2 19.84-1.2 18.3,1,0.7 15.64-1.0 17.5±0.8 F = 6.78,
P = 0.0016
Ni 282203 4-6963 3250634-22476 290200±22315 2736864-17519 246387,1,22464 267287± 12049
Nvcor 281290±6151 321216± 19712 283751± 18777 278240± 12326 222561±23423 2666334- 17771 F = 5.75,
P = 0.0042
CAIc
n 32 6 6 4 8 8
Counts 30.14-0.5 30.3 + 1.1 34.1 ±2.1 30.4± 1.2 29.44- 1.4 27.7± 1.2 F = 3.84,
P = 0.024
Ni 501065,1,10578 5228644-25112 538912-t-34614 491926±11960 475056zk24866 459254±17399
Nvcor 497861± 10274 514945±23052 532884±32063 503206q-23873 4539604-43607 449099± 18912 F = 4.51,
P = 0.013
Abbreviations as in Table 1.

and C A l c , where the seizure-induced decreases were n o c h a n g e in the total v o l u m e o f t h e h i p p o c a m p u s

r e s p e c t i v e l y , 9 2 % , 9 0 % , 87%, a n d 9 1 % o f c o n t r o l s .
Effects of brief repeated seizures on volume of the
hippocampus and dentate gyrus
R e d u c t i o n in n e u r o n a l d e n s i t y m a y b e c a u s e d b y
n e u r o n a l loss or an i n c r e a s e in v o l u m e . T h e r e w a s
i n c l u d i n g the C A 1 , C A 2 , C A 3 subfields a n d the d e n -
tate gyrus, ( F = 0.302, P = 0.74), but t h e r e w a s an
i n c r e a s e in the v o l u m e o f the d e n t a t e g y r u s in kin-
d l e d rats c o m p a r e d to c o n t r o l s ( F = 3.19, P < 0.045,
Fig. 2). T h e v o l u m e i n c r e a s e in the d e n t a t e g y r u s
w a s -'~7% in t h e k i n d l e d rats w h i c h e x p e r i e n c e d > 6 9
C l a s s V g e n e r a l i z e d t o n i c - c l o n i c s e i z u r e s (t = 2.35,
102

~0 hilus (temporal) ~ 1=* CA3¢ (temporal)

o

~ N

+~ -r -o

m
conlrol :; AOt -:;¢ CI V O - 1:;4C~ V comr~ =~o,-sea v u- +s4av
Number of seizures Number of seizures

E " ~ " CAIa (temporal) E "+] CA1 ¢ (temporal)

~ ~"'1

(onbol $ ADZ-$$O V ~ - !114(:1V ¢onfrol $ ADI -lie CI I/ G) - t$4CI V ¢ordlrol $ AO! - $ $ CI II ¢9 - 1 5 4 0 V

Number of seizures Nmnber of seizures Number of seizures
Fig. 1. Repeated brief seizures evoked by kindling of the olfactory bulb in rats decreased volume corrected neuronal density in temporal
regions of the hippocampus. Volume corrected neuronal density in the hilus of the dentate gyms, CA3c, CAla, and CAlc decreased after
69 secondary generalized tonic-clonic (Class V) seizures. As neuronal loss was observed in the hilus of the dentate gyms, CA3c, CAla,
and CAlc, but not in CA2, the distribution of neuronal loss resembled the pattern of hippocampal sclerosis. The results demonstrated
that hippocampal sclerosis was induced by brief repeated seizures. Asterisks indicate statistical significance: hilus, P = 0.02; CA3c,
P =0.034; CAla, P =0.0042; CAlc, P =0.013.

onolJ Total volume 1=01/ Dentate gyrus volume ~+ Hinnhr.=zmt~lJ¢ u~hJm~

i,,,1 I " |,,,

+,, ++ +,,
I~ le IS
¢on~'ol 3ADz-$OCIV ~ - 1 ~ 4 C I V ¢onkol I~AOz-$0CIV | ) - I ~ I 4 C I V ¢on~'ol 3ADI-$eCIV I;[~-154CIV
Number of seizures Number of seizures Number of seizures
Fig. 2. Alterations in volume of subregions of the hippocampal formation induced by repeated brief seizures. There was an increase in
the volume of the dentate gyrns that achieved statistical significance after 69 Class V seizures (asterisk indicates P = 0.045, ANOVA;
P < 0.05, Bonferoni correction). There was a trend toward reduction in volume of the hippocampus proper that did not achieve statistical
significance.

P < 0.05, Bonferroni correction). This increase in On the basis of this morphometric analysis of
volume in the dentate gyrus was accompanied by a volume, the reduction in Nvco, in the hippocampus
non-significant trend to decrease in volume of the proper is most likely caused by neuronal loss. The in-
hippocampus proper, i.e., CA1, CA2, CA3, (~3%, crease in volume of the dentate gyrus after repeated
F = 0.716, P = 0.49). seizures may contribute to the seizure-induced de-
 103

A B
¢o
¢J
O 110q ,

. - 140 1
.|i :t
"t
120 7O
lOO ~@ so
so •~ 5o
o
O) 6O Is
~ 30
e- 40,
o ~ 2e
.o
, O• •
~ o i , o
; ;e ,;o ,;a ,;o ,;o 2;o control 3ADs- 3 0 C I V 69- 134CIV

Number of afterdischarges Number of seizures

Fig. 3. (A) Seizure-induceddeficits in radial arm maze performance as a function of the number of afterdischarges or evoked seizures.
There was a strong correlationbetween the number of reference errors and the cumulativenumber of seizures (r = 0.69, P = 0.00001).
Reference errors were defined as entry into unbaited arms of the radial arm maze (see Methods for additional details). Dark circles
indicate rats from groups with no detectable cumulative neuronal loss. Open circles are rats from groups with significantneuronal loss.
Rats with greater than 90 evoked afterdischarges had neuronal loss and also made more reference errors during radial arm maze testing.
(B) Reference errors in electrode-implanted,age-matched control rats, in rats that experienced 30 or fewer Class V seizures, and rats
with greater than 69 Class V seizures that had neuronal loss. There was a significantincrease in reference errors in rats with neuronal
loss that developed after 69 Class V seizures (P < 0.0001, Mann- Whitney Rank Sum Test).

crease in neuronal density in this region, but as there
was a significant decrease in neuronal density of the
dentate gyrus after correction for the increase in vol-
ume (Nvco,), neuronal loss probably also occurred in
the dentate gyrus at the temporal level.
in the subgroup of kindled rats that experienced
more than 69 Class V seizures and demonstrated
significant neuronal loss (Fig. 3A,B).
Discussion

Relationship of seizure-induced spatial memory Stereological and morphometric analysis in kindled

deficits and neuronal loss
As reported previously, the number of reference er-
rors, defined as entry into unbaited arms of the radial
maze, increased as a function of the number of
evoked ADs in kindled rats (r = 0.69, P = 0.00001,
Fig. 3A). The maze performance of rats that expe-
rienced 3 ADs or 3 Class V seizures did not differ
from their paired controls, but a difference in ability
to repeat criterion performance on consecutive days
was observed in kindled rats after ~ 4 0 evoked ADs,
or ~ 3 0 or more Class V seizures. There were no
significant differences in reference errors in rats that
experienced 30 or fewer Class V seizures compared
to controls, but more reference errors were observed
rats with characterized deficits in spatial memory
function demonstrated that repeated brief seizures
induced subfield specific hippocampal neuronal loss
in a pattern resembling hippocampal sclerosis. The
results not only confirmed previous studies, but also
provided additional new evidence that relatively sub-
tle seizure-induced neuronal loss in specific subpop-
ulations of hippocampal neurons is associated with
long-term, probably permanent deficits in spatial
memory.
Technical issues in the assessment of neuronal loss
There are substantial theoretical and technical ques-
tions that must be addressed in analysis of neuron
104
number in the central nervous system. The so-called
unbiased methods offer some potential advantages,
particularly when variations in size and shape of the
objects of interest may influence accuracy of counts,
or when sampling bias in a structure with cellular
heterogeneity might result in inaccurate estimates of
cell number in the overall structure (West, 1999; see
also West, 2002, this volume). While the so-called
unbiased methods have a number of potential advan-
tages, there has been a range of viewpoints about
their application and relative merits compared to
older conventional counting methods (Guillery and
Hermp, 1997; see also Guillery and August, 2002,
this volume).
Several methodological aspects of this study were
informative regarding the sources of error in esti-
mating neuronal density using counting techniques,
and also provided some insight into the sources of
variability among studies applying these techniques
for assessment seizure-induced alterations in the hip-
pocampus. Inspection of Tables 1 and 2 revealed that
the major source of variability arose in the calcu-
lation of volume in the region of interest. In com-
parison to our previous studies, the measurements
for the calculation of estimated volume employed
greater sampling which would be expected to im-
prove accuracy, and confirmed previously published
reports of an increase in the volume of the dentate
gyms in some rodent models of epilepsy (Adams et
al., 1997; Bouilleret et al., 2000). These results sug-
gested that the seizure-induced reduction in neuronal
density in this region may not be caused by neuronal
loss, but the significant reduction in neuronal density
after volume correction (Nvcor) in this study never-
theless implied that neuronal loss also occurred in
the dentate gyms. Importantly, there was no increase
in volume of the hippocampus proper, but rather
a non-significant trend to a decrease in volume,
which supports the interpretation that neuronal loss
occurred in the hippocampus. With the significant
increase in volume of the dentate gyrus accompanied
by a trend to smaller volume of the hippocampus
proper, there was no overall change in the combined
volume of the dentate gyrus and hippocampus, as
reported previously (Cavazos et al., 1994). The un-
biased methods, which offer some methodological
advantages, have also provided evidence supporting
seizure-induced neuronal loss (Dalby et al., 1998).
Conventional stereological methods employed in this
and previous studies of kindled rats and unbiased
methods thus support the viewpoint that repeated
brief seizures induce hippocampal neuronal loss.
Spatial features of hippocampal neuronal loss
induced by brief repeated seizures: relationship to
hippocampal sclerosis and site of seizure initiation
This analysis and previous studies of the effects of
kindled seizures on hippocampal neuronal popula-
tions using stereological counting techniques (Cava-
zos et al., 1994) have demonstrated that repeated
brief seizures evoked by kindling induced a con-
sistent pattern of neuronal loss resembling human
hippocampal sclerosis. Kindled rats that experienced
seizures evoked exclusively by stimulation of the
olfactory bulb demonstrated neuronal loss in the
temporal regions of CA3c, CAla, CAlc, and the
hilus of the dentate gyms, with sparing of CA2, a
subfield which is known to be resistant to hypoxia
and is also relatively preserved in human hippocam-
pal sclerosis (Mouritzen Dam, 1980; Babb et al.,
1984; Sloviter, 1989; Gloor, 1991). This distinctive
subfield specific pattern was also observed in kin-
dled rats that received perforant path or amygdala
stimulation (Cavazos et al., 1994).
The cumulative damage in hippocampal subfields
in kindled rats that received olfactory bulb stimu-
lation was apparent in the temporal hippocampus,
which contrasts with the more widespread neuronal
loss involving both septal and temporal regions in
kindled rats that experienced seizures evoked by per-
forant path or amygdala stimulation (Cavazos et al.,
1994). These observations suggest that the distribu-
tion of seizure-induced neuronal loss is dependent
on the site of seizure initiation and pathways that are
activated by the epileptogenic process. Compared to
our previous studies using the same counting tech-
niques, the amount of damage in rats experiencing
repeated seizures evoked by olfactory bulb stimu-
lation was less than in rats kindled by stimulation
of the perforant path. The differences in seizure-
induced damage in the studies may be caused by
variability in the technical aspects of the analysis,
but the use of the same techniques in both stud-
ies, the consistency of the pattern of loss in specific
hippocampal subfields in both studies, and the differ-

ences in the septal and temporal distribution of the
neuron loss suggest that the seizure-induced dam-
age was pathway-specific and cannot be explained
merely by variability or technical factors. These ob-
servations are of interest in view of the reported dif-
ferences in damage in human temporal lobe epilepsy
between tumor associated cases and idiopathic cases
(Kim et al., 1990).
While this study assessed neuronal densities only
in the hippocampus, previous analysis in groups
of rats experiencing seizures evoked by perforant
path and amygdala stimulation demonstrated neu-
ronal loss in extrahippocampal regions including the
entorhinal cortex and endopyriform nucleus (Cava-
zos et al., 1994), which is consistent with imaging
and pathological observations in human epileptic
temporal lobe indicating that damage may involve
extra-hippocampal and other limbic areas, such as
the entorhinal cortex, lateral temporal cortex, and
regions beyond the hippoeampal formation (DeCarli
et al., 1998; Kalviainen et al., 1998; Lee et al., 1998;
Bernasconi et al., 1999).
Evidence that repeated brief seizures induce
progressive hippocampal neuronal loss
Neuronal loss was detected in this study only after
>69 Class V seizures evoked by olfactory bulb stim-
ulation. In contrast, neuronal loss was initially de-
tected after 30 repeated seizures evoked by perforant
path or amygdala stimulation, and progressively in-
creased after additional seizures (Cavazos and Su-
tula, 1990; Cavazos et al., 1994). An important ques-
tion is whether this neuronal loss, which occurs in
a pattern that appears to be pathway-specific, begins
only after a series of repeated seizures, or is a con-
sequence of each seizure. Studies using the TUNEL
method, which detects of DNA fragmentation and
is a marker for apoptosis, have demonstrated that
even a single or a few brief seizures induce apoptotic
death in neurons of the dentate gyrus and hippocam-
pus (Bengzon et al., 1997; Pretel et al., 1997; Zhang
et al., 1998). These observations directly support
the observation of cumulative seizure-induced neu-
ronal loss in the dentate gyms and hippocampus
as detected by stereological methods. Furthermore,
multiple studies in experimental models suggest that
cumulative, gradually progressive neuronal loss is
105
likely to be a consequence of the repeated brief
seizures (for a summary, see Table 3).
While the direct observation of seizure-induced
apoptosis after single or a few seizures suggests
that each seizure produces neuronal damage, the
stereological methods employed in this and previous
studies detected cumulative neuronal loss only after
multiple seizures. This may reflect the limited sensi-
tivity of the counting methods, which are clearly
subject to substantial variability due to a range
of potential errors, particularly calculation of vol-
ume changes, which may influence neuronal density.
Seizure-induced neurogenesis may also be a factor
that contributes to the cumulative effect of seizures
on hippocampal neuronal populations (Bengzon et
al., 1997; Parent et al., 1997; Parent et al., 1998;
see also Parent and Lowenstein, 2002, this volume).
With direct evidence of apoptotic neuronal death
after a few seizures and the evidence of evolving
loss in multiple stereological studies, it seems most
likely that individual seizures progressively induce
neuronal loss that cumulatively results in a pattern
of damage resembling hippocampal sclerosis. The
distribution of this loss may depend on the path-
ways activated by the site of seizure initiation, and
raise that possibility that specific functional abnor-
malities may result from cumulative seizure-induced
neuronal loss.
It is of interest that repeated seizures appear to
have different effects on hippocampal neurons and
circuits after a previous episode of status epilepticus.
After neuronal damage, induced by status epilepti-
cus, spontaneous recurrent seizures have not consis-
tently induced additional neuronal loss (see Dudek
et al., 2002, this volume and Pitk~inen et al., 2002,
this volume). The reasons for differences between
these studies of repeated brief seizures and recur-
rent spontaneous seizures after status epilepticus are
uncertain, but several possibilities deserve consider-
ation. First, the secondary generalized tonic-clonic
seizures evoked by kindling are typically several
minutes in duration, which is longer than the re-
curring seizures that follow some models of status
epilepticus (see Pitk~inen et al., 2002, this volume).
Second, the initial prolonged seizures may have dam-
aged the most vulnerable neuronal subpopulations,
leaving surviving neurons that are relatively resistant
to additional seizure-induced loss. Third, vulnerabil-
106

TABLE 3
Experimental studies assessing neuronal loss after repeated brief seizures

Model Site of seizure Numberof seizures Method of Sampled locations and Reference
induction assessment results (bold indicates
loss or damage)
Kindling perforant path 3-30 secondary stereological neuronal loss in hilus of Cavazos and
generalized tonic--clonic the dentate gyrus Sutula (1990)
seizures
Kindling (rapid) amygdala ~1500 seizures stereological decreased neuronal Bertram and
density and increased Lothman (1993)
volume of dentate gyrus
Kindling perforant path 3-150 secondary stereological neuronal loss in hilus of Cavazos et al.
amygdala generalized
tonic-clonic the dentate gyrus, CA1, (1994)
olfactory bulb seizures CA3, entorllinal cortex
Kindling amygdala 3 secondary generalized grid counting decreased neuronal Adams et al.
tonic-clonic seizures density and increased (1997)
volume of dentate gyrus
Kindling (rapid) hippocampus 1 afterdischarge and 2-3 TUNEL staining for increase in apoptotie Bengzon et al.
secondary generalized apoptosis cells in the hilus of (1997)
tonic-clonic seizures dentate gyrus after 1
AD (~214%) and 2-3
generalized seizures
(~415%)
Kindling entorhinal 5-85 secondary TUNEL staining for apoptosis in hilus, CA1, Pretel et ai.
cortex generalized tonic-clonic apoptosis; silver granule cells, (1997)
seizures degeneration staining subiculum, neocortex
Kindling amygdala 1-20 partial and TUNEL staining, 30-80% increase in Zhang et al.
secondary generalized Bax/Bcl ratio apoptotic cells after 1 (1998)
tonic--clonicseizures or 20 seizures
Kindling perforant path 5 secondary generalized unbiased neuronal loss in the Dalby et al.
tonic--clonicseizures stereological hilus of the dentate (1998)
gyrus
Kindling amygdala 5 secondary generalized unbiased no loss in amygdala or Tuunanen and
tonic--clonicseizures stereological hilus of the dentate gyrus Pitk~inen(2000)
Kindling olfactory bulb 3-134 secondary stereological neuronal loss in Kotloski et al.
generalized tonic-clonic temporal hilus, CA1, (2002)
seizures CA3
Spontaneous amygdala as many as 6000 stereological, no effect of repeated Pitk~inenet al.
seizures after spontaneous seizures fluoro-Jade B spontaneous seizures (2002)
status epilepticus immunochemistry, after status epilepticus
MRI

ity to additional damage may be altered by previous
seizures, as suggested by the apparent protective ef-
fects of kindled seizures against damage induced by
status epilepticus in kindled rats (Kelley and Mcln-
tyre, 1994). These experimental studies suggest that
the effects of seizures may vary as a function of the
previous activity and seizures in neural circuitry.
Relationship between repeated brief seizures,
neuronal loss, and memory dysfunction
The possible cognitive effects of seizure-induced
neuronal loss are of potentially major clinical sig-
nificance. In rats that experienced repeated brief
seizures evoked by stimulation of the olfactory bulb,

impairment of spatial memory became apparent after
~30 secondary generalized (Class V) seizures, and
increased in severity as a function of the cumulative
number of seizures. The maze performance of kin-
died rats that experienced 30 or fewer evoked Class
V seizures (or <40-50 ADs in Fig. 3), as assessed
by reference errors or ability to repeat the criterion
task, did not differ from controls without seizures. In
contrast, kindled rats with >69 Class V seizures (or
~80-90 ADs in Fig. 3) that had significant cumula-
tive seizure-induced neuronal loss also demonstrated
spatial memory deficits. The results thus provide ev-
idence of an association between the development
of seizure-induced memory dysfunction and loss of
hippocampal neurons. Although the relationship be-
tween hippocampal damage and memory dysfunc-
tion has been recognized for many years on the basis
of human observations including the patient H.M.
(Scoville and Milner, 1957; Corkin et al., 1997)
and numerous rodent and primate studies (Squire
and Zola, 1997), this study provides quantitative
evidence of an association between the induction
of relatively subtle, subfield specific seizure-induced
damage in the rodent hippocampus and spatial mem-
ory dysfunction. These observations confirm the im-
portance of the hippocampus in the acquisition of
short-term memories, and have potential clinical sig-
nificance in regard to the consequences of repeated
or uncontrolled seizures.
Implications for human epilepsy
The observations of this combined behavioral and
anatomical study have potentially important impli-
cations for human epilepsy. Human imaging studies
have directly demonstrated that hippocampal atrophy
may follow an initial precipitating injury such a pro-
longed or complex febrile seizures (Vanlandingham
et al., 1998; see also Lewis et al., 2002, this volume),
but the possibility that repeated seizures may be con-
tributing to progressive neuronal loss has also been
suggested by multiple imaging studies demonstrating
that the atrophy increases with the duration of the
epilepsy (Davies et al., 1996; Lee et al., 1998; Tasch
et al., 1999; Theodore et al., 1999; Fuerst et al.,
2001), and in some cases occurs without an initial
precipitating injury (Briellmann et al., 2001). Human
MRI observations are consistent with the possibility
107
that hippocampal sclerosis, in addition to being the
sequelae of an initial injury, may also be an acquired
lesion that is at least partially caused by poorly
controlled seizures (Mathem et al., 1996; Tasch et
al., 1999). This experimental study strongly supports
the view that brief repeated seizures cumulatively
produce hippocampal damage which is accompa-
nied by memory dysfunction, and thus suggests
that hippocampal sclerosis could in part be caused
by poorly treated epilepsy. This possibility, particu-
larly with respect to the associated seizure-induced
memory dysfunction, may be important in regard to
cases of medically intractable or poorly controlled
epilepsy, which is accompanied by memory dysfunc-
tion (Jokeit and Ebner, 1999; see the following in
this volume: Austin and Dunn, 2002; Hermann et al.,
2002; Helmstaedter, 2002; Jokeit and Ebner, 2002;
Sutula and Pitk~inen, 2002; Treiman, 2002).
In considering the implications of these experi-
mental observations for human epilepsy, the follow-
ing additional points deserve emphasis. First, the
majority of patients with temporal lobe epilepsy
experience recurring partial complex rather than sec-
ondary generalized seizures, and the overwhelming
majority of seizures evoked by kindling are partial
with secondary generalization. As these seizures are
likely to produce more significant metabolic stress,
it would be valuable to determine if repeated partial
seizures also induce neuronal loss. This study using
kindled rats could not discriminate whether recurring
partial seizures (Class I-IV) might also be inducing
neuronal loss, but this question could perhaps be ad-
dressed using markers for apoptosis. Second, while
the results using markers for apoptosis and stere-
ological methods both support the viewpoint that
individual seizures are likely to induce neuronal loss,
memory dysfunction was observed only after many
seizures, which might seem to suggest that there is a
threshold for seizure-induced cognitive dysfunction.
In regard to this apparent threshold for induction
of memory dysfunction (>30 secondary generalized
seizures), hippocampal circuits may have a capacity
to maintain normal function after some number of
seizures or other adverse injurious events, but emer-
gent properties of these complex circuits, such as
memory, may become affected only after a signifi-
cant proportion of the components of the circuits are
damaged.
108
Stereological analysis and m e t h o d s for detection
o f apoptosis strongly support the v i e w p o i n t that n e u -
ronal death is n o t o n l y a c o n s e q u e n c e o f status
epilepticus, but also is i n d u c e d b y repeated brief
seizures. T h e association of s e i z u r e - i n d u c e d hip-
p o c a m p a l n e u r o n a l loss with spatial m e m o r y i m -
p a i r m e n t i m p l i e s that the c o n s e q u e n c e s o f n e u r o n a l
loss from repeated brief seizures are n o t b e n i g n . In
e x p e r i m e n t a l m o d e l s o f status epilepticus, p r o m p t
t r e a t m e n t that suppresses seizures reduces or pre-
vents l o n g - t e r m c o n s e q u e n c e s of the seizures, such
as d a m a g e in specifically v u l n e r a b l e n e u r o n s in the
dentate gyms, associated m o s s y fiber sprouting, be-
havioral abnormalities, and i n c r e a s e d susceptibility
to additional seizures (Sutula et al., 1992; Y l i n e n et
al., 1991). These observations suggest that p r o m p t
effective t r e a t m e n t o f repeated brief seizures m a y
prevent n e u r o n a l loss a n d r e o r g a n i z a t i o n o f hip-
p o c a m p a l circuitry that contribute to m e m o r y dys-
f u n c t i o n and p r o m o t e s susceptibility to additional
seizures. T h e adverse c o n s e q u e n c e s o f repeated brief
seizures strongly support the i m p o r t a n c e of u r g e n t
t r e a t m e n t a n d a c h i e v e m e n t o f c o m p l e t e seizure con-
trol as therapeutic goals for this c o m m o n disorder.
References
Adams, B., Sazgar, M., Osehobo, P., Vanderzee, C., Diamond,
J., Fahnestock, M. and Racine, R.J. (1997) Nerve growth
factor accelerates seizure development, enhances mossy fiber
sprouting, and attenuates seizure-induced decreases in neu-
ronal density in the kindling model of epilepsy. J. Neurosci.,
17(14): 5288-5296.
Austin, J.K. and Dunn, D.W. (2002) The neurodevelopmental
impact of childhood onset temporal lobe epilepsy on brain
structure and function and the risk of progressive cognitive
effects. In: T. Sutula and A. Pitk~inen (Eds.), Do Seizures
Damage the Brain. Progress in Brain Research, Vol. 135.
Elsevier, Amsterdam, pp. 419-427.
Babb, T., Pretorius, W., Davenport, C., Lieb, J. and Crandall,
P. (1984) Temporal lobe volumetric cell densities in temporal
lobe epilepsy. Epilepsia, 25: 721-732.
Bengzon, J., Kokaia, Z., Elmer, E., Nanobashvili, A., Kokaia, M.
and Lindvall, O. (1997) Apoptosis and proliferation of dentate
gyms neurons after single and intermittent limbic seizures.
Proc. Natl. Acad. Sci. USA, 94(19): 10432-10437.
Bernasconi, N., Bernasconi, A., Andermann, E, Dubeau, E,
Feindel, W. and Reutens, D.C. (1999) Entorhinal cortex in
temporal lobe epilepsy - - a quantitative MRI study. Neurol-
ogy, 52: 1870.
Bertram, E. and Lothman, E. (1993) Morphometric effects of
intermittent kindled seizures and limbic status epilepticus in
the dentate gyrus of the rat. Brain Res., 603(1): 25-31.
Bouilleret, V., Loup, E, Kiener, T., Marescaux, C. and Fritschy, J.
(2000) Early loss of interneurons and delayed subunit specific
changes in GABAa-receptor expression in a mouse model of
mesial temporal lobe epilepsy. Hippocampus, 10(3): 305-324.
Briellmann, R., Newton, M., Wellard, M. and Jackson, G. (2001)
Hippocampal sclerosis following brief generalized seizures in
adulthood. Neurology, 57: 318-320.
Cascino, G.D., Jack Jr., C.R., Parisi, J.E., Sharbrough, EW.,
Hirschorn, K.A., Meyer, EB., Marsh, W.R. and PC, O.B.
(1991) Magnetic resonance imaging-based volume studies in
temporal lobe epilepsy: pathological correlations. Ann. Neu-
roL, 30(1): 31-36.
Cavazos, J.E. and Sutula, T. (1990) Progressive neuronal loss
induced by kindling: a possible mechanism for mossy fiber
synaptic reorganization and hippocampal sclerosis. Brain Res.,
527: 1-6.
Cavazos, J.E., Golarai, G. and Sutula, T. (1991) Mossy fiber
synaptic reorganization induced by kindling: time course of
development, progression, and permanence. J. Neurosci., 11:
2795-2803.
Cavazos, J.E., Das, I. and Sutula, T. (1994) Neuronal loss in-
duced in limbic pathways by kindling: evidence for induction
of hippocampal sclerosis by repeated brief seizures. J. Neu-
rosci., 14(5): 3106-3121.
Clarke, P.G. (1992) How inaccurate is the Abercrombie correc-
tion factor for cell counts?. Trends Neurosci., 15:211-212.
Corkin, S., Amaral, D.G., Gonzalez, R.G., Johnson, K.A. and
Hyman, B.T. (1997) H.M.'s medial temporal lobe lesion: find-
ings from magnetic resonance imaging. J. Neurosci., 17(10):
3964-3979.
Dalby, N.O., West, M. and Finsen, B. (1998) Hilar somatostatin-
mRNA containing neurons are preserved after perforant path
kindling in the rat. Neurosci. Lett., 255(1): 45-48.
Davies, K.G., Hennann, B.P., Dohan Jr., F.C., Foley, K.T., Bush,
A.J. and Wyler, A.R. (1996) Relationship of hippocampal scle-
rosis to duration and age of onset of epilepsy, and childhood
febrile seizures in temporal lobectomy patients. Epilepsy Res.,
24(2): 119-126.
DeCarli, C., Hatta, J., Fazilat, S., Fazilat, S., Gaillard, W.D. and
Theodore, W.H. (1998) Extratemporal atrophy in patients with
complex partial seizures of left temporal origin. Ann. Neurol.,
43(1): 41-45.
Dudek, F.E., Hellier, J.L., Williams, P.A., Ferraro, D.J. and
Staley, K.J. (2002) The course of cellular alterations associated
with the development of spontaneous seizures after status
epilepticus. In: T. Sutula and A. Pitkiinen (Eds.), Do Seizures
Damage the Brain. Progress in Brain Research, Vol. 135.
Elsevier, Amsterdam, pp. 53-65.
Fuerst, D., Shah, J., Kupsky, W., Johnson, R., Shah, A., Hayman-
Abello, B., Ergh, T., Poore, Q., Canada, A. and Watson, C.
(2001) Is hippocampal sclerosis a progressive disorder? A
volumetric MRI, pathological and neuropsychological study.
Neurology, 57: 184-188.
Gloor, P. (1991) Mesial temporal sclerosis: historical background
and an overview from a modern prospective. In: H. Luders

(Ed.), Epilepsy Surgery. Raven Press, New York, NY, pp.
689-703.
Guillery, R.W. and August, B.K. (2002) Doubt and uncertainty
in counting. In: T. Sutula and A. Pitkanen (Eds.), Do Seizures
Damage the Brain. Progress in Brain Research, Vol. 135.
Elsevier, Amsterdam, pp. 25-42.
Guillery, R.W. and Herrup, K. (1997) Quantification without
pontification: choosing a method for counting objects in sec-
tioned tissues. J. Comp. Neurol., 386(1): 2-7.
Helmstaedter, C. (2002) Effects of chronic epilepsy on declara-
tive memory systems. In: T. Sutula and A. Pitk~inen (Eds.), Do
Seizures Damage the Brain. Progress in Brain Research, Vol.
135. Elsevier, Amsterdam, pp. 439-453.
Hermann, B.P., Seidendberg, M. and Bell, B. (2002) The neu-
rodevelopmental impact of childhood onset temporal lobe
epilepsy on brain structure and function and the risk of pro-
gressive cognitive effects. In: T. Sutula and A. Pitk~inen (Eds.),
Do Seizures Damage the Brain. Progress in Brain Research,
Vol. 135. Elsevier, Amsterdam, pp. 429-438.
Holmes, G.L., Khazipov, R. and Ben-Aft, Y. (2002) Seizure-
induced damage in the developing human: relevance of ex-
perimental models. In: T. Sutula and A. Pitk~inen (Eds.), Do
Seizures Damage the Brain. Progress in Brain Research, Vol.
135. Elsevier, Amsterdam, pp. 321-334.
Jokeit, H. and Ebner, A. (1999) Long term effects of refractory
temporal lobe epilepsy on cognitive abilities: a cross sectional
study. J. Neurol. Neurosurg. Psychiatry, 67(1): 44-50.
Jokeit, H. and Ebner, A. (2002) Effects of chronic epilepsy on
intellectual functions. In: T. Sutula and A. Pitkanen (Eds.), Do
Seizures Damage the Brain. Progress in Brain Research, Vol.
135. Elsevier, Amsterdam, pp. 455-463.
Kalviainen, R., Salmenpera, T., Partanen, K., Vainio, P., Riekki-
nen, P. and Pitkanen, A. (1998) Recurrent seizures may cause
hippocampal damage in temporal lobe epilepsy. Neurology,
50(5): 1377-1382.
Kelley, M.E. and Mclntyre, D.C. (1994) Hippocampal kindling
protects several structures from the neuronal damage resulting
from kainic acid induced status epilepticus. Brain Res., 634(2):
245-256.
Kim, J., Guimaraes, P.O., Shen, M.Y., Masukawa, L.M. and
Spencer, D. (1990) Hippocampal neuronal density in temporal
lobe epilepsy with and without gliomas. Acta Neuropathol.,
80(1): 41-45.
Konigsmark, B. (1969) Methods for the counting of neurons.
In: W. Nauta and S. Ebbesson (Eds.), Contemporary Research
Methods in Neuroanatomy. Springer Verlag, Berlin, pp. 315-
340.
Kotloski, R., Lynch, M., Lauersdorf, S. and Sutula, T. (2002) Re-
peated brief seizures induce progressive hippocampal neuron
loss and memory deficits. In: T. Sutula and A. Pitk~inen (Eds.),
Do Seizures Damage the Brain. Progress in Brain Research,
Vol. 135. Elsevier, Amsterdam, pp. 95-110.
Lee, J.W., Andermann, F., Dubeau, F., Bernasconi, A., Mac-
Donald, D., Evans, A. and Reutens, D.C. (1998) Morphome-
tric analysis of the temporal lobe in temporal lobe epilepsy.
Epilepsia, 39(7): 727-736.
Lewis, D.V., Barboriak, D., MacFall, J.R., Provenzale, J.M.,
109
Mitchell, T.V. and van Landingham, K.E. (2002) Do pro-
longed febrile seizures produce medial temporal sclerosis?
Hypotheses, MRI evidence and unanswered questions. In: T.
Sutula and A. Pitkanen (Eds.), Do Seizures Damage the Brain.
Progress in Brain Research, Vol. 135. Elsevier, Amsterdam,
pp. 263-278.
Margerison, J.H. and Corsellis, J.A. (1966) Epilepsy and the
temporal lobes. A clinical, electroencephalographic and neu-
ropathological study of the brain in epilepsy, with particular
reference to the temporal lobes. Brain, 89(3): 499-530.
Mathern, G.W., Babb, T., Leite, J., Pretorius, J., Kuhlman, P.,
Spradlin, S. and Mendoza, D. (1996) The pathogenic and
progressive features of chronic human hippocampal epilepsy.
Epilepsy Res., 26: 151-161.
Meldrum, B., Vigouroux, R. and Brierley, J. (1973) Systemic
factors and epileptic brain damage: prolonged seizures in para-
lyzed artificially ventilated baboons, Arch. Neurol. Psychiatry,
29: 82-87.
Mouritzen Dam, A. (1980) Epilepsy and neuron loss in the
hippocampus. Epilepsia, 21: 617-629.
Parent, J.M. and Lowenstein, D.H. (2002) Seizure-induced neu-
rogenesis: are more new neurons good for an adult brain?
In: T. Sutula and A. Pitk~inen (Eds.), Do Seizures Damage
the Brain. Progress in Brain Research, Vol. 135. Elsevier,
Amsterdam, pp. 121-132.
Parent, J.M., Yu, T.W., Leibowitz, R.T., Geschwind, D.H.,
Sloviter, R.S. and Lowenstein, D.H. (1997) Dentate granule
cell neurogenesis is increased by seizures and contributes to
aberrant network reorganization in the adult rat hippocampus.
J. Neurosci., 17(10): 3727-3738.
Parent, J.M., Janumpalli, S., McNamara, J.O. and Lowenstein,
D.H. (1998) Increased dentate granule cell neurogenesis fol-
lowing amygdala kindling in the adult rat. Neurosci. Lett.,
247(1): 9-12.
Pitk~nen, A., Nissinen, J., Nairism/igi, J., Lukasiuk, K., Grrhn,
O.H.J., Miettinen, R. and Kauppinen, R. (2002) Progression
of neuronal damage after status epilepticus and during sponta-
neous seizures in a rat model of temporal lobe epilepsy. In: T.
Sutula and A. Pitk~inen (Eds.), Do Seizures Damage the Brain.
Progress in Brain Research, Vol. 135. Elsevier, Amsterdam,
pp. 67-83.
Pretel, S., Applegate, C.D. and Piekut, D. (1997) Apoptotic and
necrotic cell death following kindling induced seizures. Acta
Histochem., 99(1): 71-79.
Sagar, H. and Oxbury, J. (1987) Hippocampal neuronal loss
in temporal lobe epilepsy: correlation with early childhood
convulsions. Ann. Neurol., 22: 334-340.
Salmenpera, T., Kalviainen, R., Partanen, K. and Pitkanen, A.
(1998) Hippocampal damage caused by seizures in temporal
lobe epilepsy. Lancet, 351 (9095): 35.
Scoville, W. and Milner, B. (1957) Loss of recent memory after
bilateral hippocampal lesions. J. Neurol. Neurosurg. Psychia-
try, 20:11-21.
Sloviter, R. (1989) Calcium-binding protein (calbindin-D28) and
parvalbumin immunocytochemistry: localization in the rat hip-
pocampus with specific reference to the selective vulnerability
110
of hippocampal neurons to seizure activity. J. Comp. Neurol.,
280: 183-196.
Squire, L.R. and Zola, S.M. (1997) Amnesia, memory and brain
systems. PhiL Trans. R. Soc. Lond., 352(1362): 1663-1673.
Sutula, T. and Pitk~inen, A. (2002) Summary: Neuropsycholog-
ical consequences of human epilepsy. In: T. Sutula and A.
Pitk~inen (Eds.), Do Seizures Damage the Brain. Progress in
Brain Research, Vol. 135. Elsevier, Amsterdam, pp. 465-467.
Sutula, T. and Steward, O. (1986) Quantitative analysis of synap-
tic potentiation during kinding of the perforant path. J. Neuro-
physioL, 56: 732-745.
Sutula, T., He, X.X., Cavazos, J. and Scott, G. (1988) Synap-
tic reorganization in the hippocampus induced by abnormal
functional activity. Science, 239:1147-1150.
Sutula, T., Cavazos, J.E. and Golarai, G. (1992) Alteration of
long-lasting structural and functional effects of kainic acid
in the hippocampus by brief treatment with phenobarbital. J.
Neurosci., 12(11): 4173-4187.
Sutula, T., Lauersdorf, S., Lynch, M., Jurgella, C. and Woodard,
A. (1995) Deficits in radial arm maze performance in kindled
rats: evidence for long-lasting memory dysfunction induced by
repeated brief seizures. J. Neurosci., 15(12): 8295-8301.
Tasch, E., Cendes, E, Li, L.M., Dubeau, E, Andermann, E and
Arnold, D.L. (1999) Neuroimaging evidence of progressive
neuronal loss and dysfunction in temporal lobe epilepsy. Ann.
Neurol., 45(5): 568-576.
Theodore, W.H. and Gaillard, W.D. (2002) Neuroimaging and
the progression of epilepsy. In: T. Sutula and A. Pitkfinen
(Eds.), Do Seizures Damage the Brain. Progress in Brain
Research, Vol. 135. Elsevier, Amsterdam, pp. 305-313.
Theodore, W.H., Bhatia, S., Hatta, J., Fazilat, S., DeCarli, C.,
Bookheimer, S.Y. and Gaillard, W.D. (1999) Hippocampal
atrophy, epilepsy duration, and febrile seizures in patients with
partial seizures. Neurology, 52(1): 132-136.
Treiman, D.M. (2002) Will brain damage after status epilepticus
be history in 2010? In: T. Sutula and A. Pitk~inen (Eds.), Do
Seizures Damage the Brain. Progress in Brain Research, Vol.
135. Elsevier, Amsterdam, pp. 471-478.
Tuunanen and Pitk~inen, A. (2000) Do seizures cause neuronal
damage in rat amygdala kindling? Epilepsy Res., 39:171-176.
Vanlandingham, K.E., Heinz, E.R., Cavazos, J.E. and Lewis,
D.V. (1998) Magnetic resonance imaging evidence of hip-
pocampal injury after prolonged focal febrile convulsions.
Ann. Neurol., 43(4): 413-426.
West, M.J. (1999) Stereological methods for estimating the total
number of neurons and synapses: issues of precision and bias.
Trends Neurosci., 22(2): 51-56.
West, M.J. (2002) Design based stereological methods for count-
ing neurons. In: T. Sutula and A. Pitk~inen (Eds.), Do Se&ures
Damage the Brain. Progress in Brain Research, Vol. 135.
Elsevier, Amsterdam, pp. 43-51.
Ylinen, A., Miettinen, R., Pitkanen, A., Guyla, A., Freund, T.
and Riekkinen, E (1991) Enhanced GABAergic inhibition
preserves hippocampal structure and function in a model of
epilepsy. Proc. Natl. Acad. Sci. USA, 88: 7650-7653.
Zhang, L.X., Smith, M., Li, X., Weiss, S. and Post, R.M. (1998)
Apoptosis of hippocampal neurons after amygdala kindled
seizures. Mol. Brain Res., 55(2): 198-208.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
O 2002 Elsevier Science B.V. All rights reserved

CHAPTER 9

Neuronal apoptosis after brief and prolonged seizures

Johan Bengzon 1,,, Paul Mohapel 2, Christine T. Ekdahl 2 and Olle Lindvall 2
I Department of Neurosurgery, University Hospital, S-221 85 Lund, Sweden
2 Section of Restorative Neurolog), Wallenberg Neuroscience Center, BMC A-I1, S-221 84 Lund, Sweden

Abstract: Evidence has accumulated that apoptotic cell death contributes to brain damage following experimental seizures.
A substantial number of degenerating neurons within limbic regions display morphological features of apoptosis following
prolonged seizures evoked by systemic or local injections of kainic acid, systemic injections of pilocarpine and sustained
stimulation of the perforant path. Although longer periods of seizures consistently result in brain damage, it has previously
not been clear whether brief single or intermittent seizures lead to cell death. However, recent results indicate that also
single seizures lead to apoptotic neuronal death. A brief, non-convulsive seizure evoked by kindling stimulation was
found to produce apoptotic neurons bilaterally in the rat dentate gyrus. The mechanism triggering and mediating apoptotic
degeneration is at present being studied. Alterations in the expression and activity of cell-death regulatory proteins such as
members of the Bcl-2 family and the cysteinyl aspartate-specific proteinase (caspase) family occur in regions vulnerable
to cell degeneration, suggesting an involvement of these factors in mediating apoptosis following seizures. Findings of
decreased apoptotic cell death following administration of caspase inhibitors prior to and following experimentally induced
status epilepticus, further suggest a role for caspases in seizure-evoked neuronal degeneration. Intermediate forms of
cell death with both necrotic and apoptotic features have been found after seizures and investigation into the detailed
mechanisms of the different forms of cell degeneration is needed before attempts to specific prevention can be made.

Introduction controlled, and active lysis of single cells requir-

The mechanism of epileptic cell damage has for long
been attributed to excitotoxicity-induced necrosis.
However, in recent years, evidence has accumulated
that neurons also die by apoptosis following seizures.
The term apoptosis was introduced by Kerr et
al. (1972). The original definition of apoptosis
was based on morphological criteria including cell
shrinkage, condensation, blebbing of the cytoplasm-
and nuclear membranes, and budding off of cellu-
lar fragments. However, apoptosis is now often used
synonymously with programmed cell death. Pro-
grammed cell death constitutes a cell-autonomous,
* Correspondence to: J. Bengzon, Department of Neu-
rosurgery, University Hospital, S-221 85 Lund, Sweden.
Tel.: +46-46-171580; Fax: +46-46-2220560;
E-mail: johan.bengzon @neurokir.lu.se
ing de novo protein synthesis (Kerr et al., 1972;
Wyllie et al., 1980; Clarke, 1990). During the de-
velopment of the nervous system, neurons that die
through programmed cell death display the mor-
phological criteria of apoptosis. The most widely
used techniques for the study of apoptosis are in
situ terminal deoxynucleotidyltransferase-mediated
dUTP nick-end labeling (TUNEL) of fragmented
DNA, sometimes in combination with a DNA stain,
in tissue sections and agarose gel electrophoresis of
fragmented DNA from homogenized tissue samples.
Necrosis, in contrast, deletes groups or clusters
of cells and is characterized by a random break-
down of cellular constituents due to energy failure.
Swelling and lysis of the cell is often followed by
an inflammatory reaction and injury to the surround-
ing tissue. Importantly, modes of cell degeneration
intermediate between apoptosis and necrosis have
112

TABLE 1
Summary of the literature characterizing the patterns of apoptosis following a variety of animal models of epilepsy and status epilepticus

Method of Reference Method of apoptotic Time after Comments Regions expressing apoptotic
seizure detection insult damage
induction
Kindling, single Bengzon et al., 1997 TUNEL 5h hippocampal GCL and SGZ
stimulation
Kindling, Bengzon et al., 1997 TUNEL and propidium 0.5-4 h hippocampal GCL, SGZ, and
multiple hilus
stimulations
Pretel et al., 1997 TUNEL and biotin 20-72 h qualitative hippocampal GCL, hilus,
assessment only interna/molecular layer, CA1,
and subiculum; deep cortical
layers
Zhang et al., 1998 TUNEL 24 h, 2 weeks diffusely throughout
hippocampus
Bax and Bcl-2 in situ 4-24 h hippocampal GCL
hybr.
Nakagawa et al., TUNEL 18 h none detected
2000
Umeoka et al., 2000 TUNEL 2h hippocampal GCL, SGZ, and
hilus; white matter
Perforant path Sloviter et al., 1996 EM and toluidine blue 12-24 h after 8 h of hippocampal GCL and SGZ
stimulation stim.
Thompson et al., TUNEL 2 h, 24 h in rat pups hippocampal GCL and hilus
1998 (only at 24 h)
Kainic acid, Pollard et al., Silver stain, TUNEL, 18 h, 24 h intra- hippocampal CA3 and CA4;
local 1994a,b EM, DNA amygdaloid amygdala
application electrophoresis injections
Venero et al., 1999 TUNEL 1-10 days intra-septal hippocampal CA1, CA3, and
injections CA4; amygdala; septum;
thalamus
Henshall et al., PANT, TUNEL, 4-96 h intra- hippocampal CA3 and CA4
2000a Caspase-3 immuno, amygdaloid
injections
Kainic acid, Filipkowski et al., DNA electrophoresis 18 h, 72 h hippocampus; entorhinal and
systemic 1994 sensory cortices
application
Sakhi et al., 1994 p53 in situ hybr., 4 h, 8 h, 16 h mice hippocampal CA1 and CA3;
TUNEL amygdala; piriform cortex;
thalamus
Gillardon et al., 1995 TUNEL, Bcl-2 and Bax 24 h, 48 h hippocampus; neocortex
Gillardon et al., 1995 CPP-32 in situ hybr., 6 h, 24 h hippocampal CA3 and CA4
TUNEL
Liu et al., 1996 cyclin D1 immuno. 8-16 h hippocampal pyramidal layers
Sakhi et al., 1996 p53 immuno. 4 h, 30 h hippocampal CA1 and CA3;
piriform cortex; thalamus
Simonian et al., 1996 DNA electrophoresis, 2-12 h cerebellar
TUNEL granular cell
cultures
Tuunanen et al., 1999 DNA electrophoresis, 8 h, 16 h examined only variable between different
TUNEL, Bcl-2 and Bax amygdala amygdaloid nuclei
damage
Faherty et al., 1999 TUNEL, Caspase-3 30 h to 4 days in KA FVB/N hippocampal CA1, CA3, and
immuno. sensitive mice CA4
 113

TABLE l (continued)

Method of Reference Method of apoptotic Time after Comments Regions expressing apoptotic
seizure detection insult damage
induction
Fujikawa et al., 2000 TUNEL, EM, DNA 24 h, 72 h necrotic cells dorsal and ventral hippocampus;
electrophoresis, H and E can exhibit amygdala; entorhinal, piriform,
stain 'apoptotic' and frontal cortices
markers
Kondratyev and Caspase-3 immuno., 24 h amygdala; rhinal cortex;
Gale, 2000 Hoechst and Texas Red: hippocampus
DNA electrophoresis
Pilocarpine Sankar et al., 1998 TUNEL, EM, DNA 24 h immature and hippocampal CA1 and SGZ;
electrophoresis, ethidium mature rats progressively more damage in
bromide hippocampal CA3 and
amygdala with increasing age
Fujikawa et al., 1999 TUNEL, EM, DNA 24 h, 72 h necrotic cells ventral hippocampal CA1, CA2,
electrophoresis, H and E can exhibit and CA3; piriform and
stain 'apoptotic' entorhinal cortices; thalamus
markers
Roux et al., 1999 TUNEL and p75 1 day, 3 days hippocampal CA1 and GCL;
immuno. entorhinal, perirhinal and
piriform cortices; amygdala;
thalamus
Covolan et al., 2000b EM 2.5-48 h cells show both hippocampal GCL and SGZ
apoptotic and
necrotic
features
Ekdahl et al., 2001 TUNEL and Hoechst 2 days, 8 days hippocampal GCL and SGZ,
hilus, CA1, and CA3

Abbreviations: CA1 = CA1 pyramidal layer; CA3 = CA3 pyramidal layer; CA4 = CA4 pyramidal layer within the dentate gyms; EM =
electron microscopy; GCL = granular cell layer of dentate gyms; KA = kainate ac!d; PANT = DNA polymerase 1-mediated biotin-dATP
nick translation; SGZ = subgranular zone of dentate gyms; TUNEL = terminal deoxynucleotidyltransferase-mediated dUTP nick-end
labeling.

been observed after seizures (Covolan et al., 2000b;
Fujikawa, 2000; Fujikawa et al., 2000).
The following section summarizes evidence of
apoptotic cell death following brief and prolonged
seizures induced by kindling, perforant path stimula-
tion, pilocarpine, and kainate and reviews the litera-
ture on the mechanisms of seizure-induced apoptotic
neuronal degeneration.
Apoptosis after brief seizures
Status epilepticus lasting for more than 30 min has
been well documented to cause neuronal damage in
both experimental animals and in humans (Hauser,
1983; Sperk, 1994) (Table 1). Although longer peri-
ods of seizures consistently produce degeneration
of neurons, brief, single or intermittent seizures
have previously not been thought to lead to cell
death. However, work from our own laboratory pro-
vides evidence for cell death following brief single
seizures in rats (Bengzon et al., 1997). Five hours
after a single hippocampal kindling stimulation, pro-
ducing focal epileptiform activity lasting for about
80 s, a marked increase (214 4-32% of control) of
TUNEL-positive pycnotic nuclei was observed bilat-
erally within the dentate gyrus. Most labeled nuclei
were located in the subgranular zone of the dor-
sal and ventral blade of the dentate granule cell
layer. A few TUNEL-positive nuclei were also seen
within the granule cell layer and in the dentate hilus.
Degenerating cells displayed morphological charac-
teristics of apoptosis. In addition to being intensely
labeled using the TUNEL technique, propidium io-
dide DNA staining showed that degenerating nuclei
114

Fig. 1. (A) Nuclei labeled for fragmented DNA (arrows) along the hilar border of the granule cell layer 2 h after 40 hippocampal
kindling stimulations, (B and C) High-powerphotomicrographsof labeled nuclei with morphologicalfeatures characteristic of apoptosis,
such as condensation and lobulation (arrow), following kindling stimulation. Note numerous apoptotic bodies (arrowheads). (D) Confocal
scanning laser image showing nuclear TUNEL (green) and cytoplasmicNeuN immunolabeling(red) demonstrating the neuronal identity
of a degenerating cell 2 h after 40 hippocampalkindling stimulations. (Bars: A = 80 ~m; B and C = 15 Ixm;D = 10 ~tm.) Illustrations
from Bengzon et al. (1997).

were consistently shrunken, irregularly shaped, and
lobulated compared to normal nuclei. After 40 re-
curring stimulations with 5-min intervals, so-called
rapid kindling, markedly higher numbers of apop-
totic cells were observed within the dentate gyrus.
The kindling-induced increase in TUNEL-positive
cells was blocked by the protein synthesis inhibitor
cycloheximide. Some TUNEL-positive degenerated
cells were double-labeled with the neuron-specific
antigen NeuN, indicating a neuronal phenotype of
these apoptotic cells (Fig. 1).
Degeneration of dentate granule neurons follow-
ing brief kindled seizures was confirmed in the study
by Zhang et al. (1998). The number of cells dis-
playing fragmented DNA as assessed by the TUNEL
technique increased by 30% compared to control
after a single epileptic discharge produced by amyg-
dala kindling stimulation. The authors suggested that
the degenerating cells mainly consisted of hippocam-
pal interneurons and that the functional effect might
be a disinhibition within the hippocampus. In support
of these findings, Pretel et al. (1997) demonstrated
that some of the kindling induced TUNEL-labeled
cells in the hippocampus double stained with so-
matostatin, a marker for interneurons. However, fur-
ther experiments are needed to clarify the identity of
the degenerating cells.
The cell loss induced by each seizure in all of
the above studies is mild which may explain why
conventional degeneration staining protocols in the
past have failed to detect this change. Corresponding
studies in humans aimed at detecting subtle cell loss
following seizures are technically impossible to carry
out. However, postmortem analysis of humans with
chronic idiopathic epilepsy suggests that neuronal
damage is cumulative and related to the frequency of
seizures and the duration of the disease (Dam, 1980).
This could imply that a mild cell loss, as seen after
every seizure in the kindling model of epilepsy, over
several years of repeated and frequent seizures could
lead to substantial pathological changes.
Apoptosis following prolonged seizures
Widespread apoptosis has been found in a variety
of animal models of status epilepticus. The first

studies demonstrating apoptotic cell death following
seizures were performed by Pollard et al. (1994a,b).
After experimental status epilepticus induced by
intra-amygdaloid injection of kainate in adult rats,
silver-impregnated damaged neurons were observed
in the amygdala and pyramidal neurons of the hip-
pocampal CA3 region a few hours after injection.
In both areas the degeneration had apoptotic fea-
tures, including nuclear chromatin condensation and
marginalization and positive nuclear labeling with
the TUNEL-staining method. Combined TUNEL la-
beling and silver staining showed that the DNA frag-
mentation occurred in dying neurons. Subsequent
studies using both kainic acid systemically (Tuuna-
hen et al., 1999) and locally (Venero et al., 1999)
have extended these initial findings and confirmed
neuronal degeneration with apoptotic features within
the hippocampal pyramidal regions CA1 and CA3/4
and in the amygdala. Following pilocarpine-induced
status epilepticus, Roux et al. (1999) observed nu-
merous TUNEL-positive cells throughout the piri-
form cortex and entorhinal cortex in addition to the
hippocampus.
Also the immature brain shows vulnerability to
status-epilepticus-induced apoptosis. Sankar et al.
(1998) noted neurons displaying features of apop-
totic death in the CA1 region of the 2-weeks-old
pups, and in the subgranular zone of the dentate
gyrus in the 3-weeks-old animals after lithium-
pilocarpine-induced status epilepticus. Thompson
et al. (1998) observed that intermittent perforant
path stimulation in rat pups produced apoptotic
hippocampal cell loss. After 16 h of stimulation,
TUNEL labeling performed 2 h after the end of stim-
ulation showed an intense band of positively labeled
eosinophilic cells with condensed profiles bilaterally
in the dentate granule cell layer.
Cell-death mechanisms
Programmed cell death in response to various insults
can be triggered through cell membrane receptor
activation, mitochondrial injury, or by direct damage
to the DNA (Graham and Chen, 2001).
Membrane-receptor-activated apoptosis has been
documented following seizures. Activation of the
kainate glutamate receptor 6 (GluR6) leads to sig-
naling via the c-Jun N-terminal kinase (Jnk) family
115
(Savinainen et al., 2001). One particular member of
the Jnk family, Jnk3, may be required for stress-
induced neuronal apoptosis. Yang et al. (1997) re-
ported that disruption of the gene encoding Jnk3
caused mice to be resistant to excitotoxicity caused
by kainic acid. They showed that a disruption of
Jnk3 caused a reduction in seizure activity and pre-
vented hippocampal CA1 and CA3 neuronal apop-
tosis. Further evidence implicating the Jnk family
in seizure-induced apoptosis comes from the find-
ing that systemic kainic-acid-evoked seizures leads
to activation of Jnkl and phosphorylation of c-Jun
(Mielke et al., 1999). Furthermore, the magnitude
and period of induction of Jnk-1 protein following
kainic acid seizures were associated with impending
cell death, while increased phosphorylation of c-Jun
protein was associated with resistance to cell death
(Schauwecker, 2000).
Other receptor candidates involved in triggering
cell degeneration following seizures might include
the p75 neurotrophin receptor (p75NTR) (Roux et al.,
1999). Numerous TUNEL-positive cells throughout
the post-seizure hippocampus, piriform cortex, and
entorhinal cortex after pilocarpine-induced seizures
were found to be double labeled for the p75NTR,
suggesting that seizure-induced neuronal loss within
the CNS might occur through apoptotic signaling cas-
cades involving p75NTR. However, further work is
needed to clarify the involvement of this receptor in
the induction of apoptosis following seizures.
Mitochondrial stress produced by prolonged de-
polarization, oxidative stress, and opening of the mi-
tochondrial permeability transition pore are powerful
triggers for programmed cell death (Reed, 1998).
The Bcl-2 family genes are key determinants in
regulating mitochondrial permeability. The function
of Bcl-2 is to block the mitochondrial releases of
cytochrome c in response to mitochondrial stressor
stimuli. In addition to the anti-apoptotic Bcl-2 gene,
this family consists of more than 20 genes includ-
ing the anti-apoptotic genes Bcl-xL, Bcl-w, and the
pro-apoptotic gene Bax. Following amygdala kin-
dling stimulations, the ratio of Bax/Bcl-2 expression
was found to increase in the hippocampus (Zhang et
al., 1998). Also the levels of Bcl-w protein increase
within the hippocampus following seizures (Hen-
shall et al., 2001). A herpes simplex virus-1 vector
used to deliver the Bcl-2 gene in order to overex-
116
press it within vulnerable parts of the hippocampus
granule cells can counteract the neuronal degenera-
tion and decline in hippocampal function seen after
kainic-acid-induced status epilepticus (McLaughlin
et al., 2000). It has been demonstrated that the tumor
suppressor protein p53, which stimulates production
and/or mitochondrial translocation of Bax, can re-
duce damage to CA1 and CA3 hippocampal neurons
following kainic-acid-induced seizures (Culmsee et
al., 2001).
Cytochrome c release from mitochondria trig-
gers cell death through cysteinyl aspartate-specific
proteinase (caspase) activation. The caspases com-
prise a family of 14 proteases that, in their active
proteolysed state, function as initiators and effec-
tors of programmed cell death. Clear evidence now
points to a role for caspase-dependent neuronal de-
generation following seizures. Faherty et al. (1999)
examined the levels of activated caspase-3 follow-
ing kainic-acid-induced seizures in two mice strains
either sensitive or resistant to kainic-acid-induced
neuronal degeneration. Catalytically active caspase-
3 was detected 30 h following kainic acid treat-
ment in the sensitive strain before the appearance of
pyknosis and TUNEL labeling. This expression of
activated caspase-3 continued up to 4 days follow-
ing injection. Caspase-3 immunoreactivity was never
detected in the resistant strain and there was no ev-
idence of pyknosis or TUNEL staining. In support,
other groups (Henshall et al., 2000a; Kondratyev and
Gale, 2000) have demonstrated increases in active
caspase-3 fragments following kainic-acid-induced
seizures. Together these data suggest that activation
of caspase-3 is a necessary component of kainic-
acid-induced TUNEL cell death. Further evidence
for the involvement of caspase in neuronal death
following seizures was the finding that the caspase-3
inhibitor z-DEVD-fmk, which was injected into the
lateral ventricle prior to and following the epileptic
insult, substantially attenuated apoptotic cell death
both in hippocampus and rhinal cortex (Kondratyev
and Gale, 2000). Subsequently, in recent work in our
laboratory, we gave multiple intracerebroventftcular
infusions of caspase inhibitors during and following
pilocarpine-induced status epilepticus and reduced
the number of TUNEL/Hoechst-positive cells (Ek-
dahl et al., 2001). This treatment also increased
the number of newly formed cells in the subgran-
ular zone of the dentate gyrus at 1 week after the
epileptic insult (see below). Viswanath et al. (2000)
created transgenic mice that neuronally expressed
the baculoviral caspase inhibitor p35 and found an
attenuation in both caspase activity and neurodegen-
eration in response to kainic acid in vitro and in vivo.
In particular, kainic acid administration to p35 mice
resulted in decreased caspase activity and TUNEL
staining in pyramidal CA1 hippocampal neurons.
Necrosis versus apoptosis
Considerable controversy exists conceming the de-
gree of true apoptotic damage with kainic-acid- and
pilocarpine-induced seizures. The nature of dentate
granule cell damage in epilepsy has been reported
as either apoptotic, necrotic or both. Adding to the
problem of identifying the mode of degeneration are
shortcomings in the techniques used. There is evi-
dence that in situ TUNEL labeling may give false-
positive labeling of necrotic cells and the detection
of DNA laddering on agarose gels may not be ex-
clusive to apoptotic cells (e.g. Charriaut-Marlangue
and Ben-Aft, 1995; Fujikawa, 2000; Fujikawa et
al., 2000). Covolan et al. (2000a) analyzed dentate
gyrus granule cell morphology with electron micros-
copy after pilocarpine and reported a variety of cell
death morphologies ranging from apoptosis to necro-
sis. Some cells displayed coalescence of chromatin
against nuclear membranes in the absence of obvious
apoptotic cytoplasmic budding or typical membrane-
bound apoptotic bodies. The authors concluded that
pilocarpine-induced status epilepticus promotes a de-
generative process in the dentate granule cell layer
with both apoptotic and necrotic features. Interme-
diate forms of degeneration of hippocampal neu-
rons were seen also in a series of studies by Fu-
jikawa et al. (1999, 2000) after kainic-acid- and
pilocarpine-evoked seizures. Degenerating neurons
displayed morphologies characteristic of necrosis;
however, with electron microscopy these neurons ap-
peared dark and shrunken with pyknotic nuclei con-
taining small and dispersed TUNEL-negative chro-
matin clumps. Furthermore, many of these 'necrotic'
looking cells exhibited internucleosomal DNA cleav-
age (DNA 'laddering'). In other less severe animal
models of epilepsy, such as kindling or perforant
path stimulation, clear apoptosis is more discern-
118
to controls. Evidence of caspase-1 and caspase-3
activity was determined by detecting increases in
their respective cleavage byproducts. Bcl-2, Bax, and
caspase-3 immunoreactivity were increased predom-
inantly in cells with neuronal morphology, whereas
Bcl-xL immunoreactivity was increased in cells with
glia morphology.
Conclusions and implications
Over the past few years it has become clear that neu-
ronal apoptotic degeneration occurs both as an early
and late consequence of seizures. It is not unusual
that apoptotic degeneration is detected following
prolonged seizures; but what may be more surpris-
ing is that death of hippocampal neurons is detected
following brief and focal non-convulsive seizures.
The discovery that part of the damage to the brain
following seizures is the result of programmed cell
death, suggests alternative new treatment strategies,
such as caspase inhibitors, to prevent cell degener-
ation. However, intermediate forms of degeneration
between necrosis and apoptosis clearly exist. Further
investigations into the precise molecular mechanisms
of these different forms of degeneration and their re-
lationship to regenerative processes, such as reactive
neurogenesis, are needed before the full therapeutic
potential can be harnessed.
Abbreviations
caspase: cysteinyl aspartate-specific proteinase
TUNEL: terminal deoxynucleotidyltransferase-
mediated dUTP nick-end labeling
Acknowledgements
Supported by grants from the Swedish Medical Re-
search Council, the Elsa and Thorsten Segerfalk
Foundation, the Kock Foundation and the Royal
Physiographic Society.
References
Bengzon, J., Kokaia, L., Elmer, E., Nanobashvili, A., Kokaia, M.
and Lindvall, O. (1997) Apoptosis and proliferation of dentate
gyrus neurons after single and intermittent limbic seizures.
Proc. Natl. Acad. Sci. USA, 94: 10432-10437.
Bonfoco, E., Krainc, D., Ankarcrona, M., Nicotera, P. and Lip-
ton, S.A. (1995) Apoptosis and necrosis: two distinct events
induced, respectively, by mild and intense insults with N-
methyl-D-aspartate or nitric oxide/superoxide in cortical cell
cultures. Proc. Natl. Acad. Sci. USA, 92: 7162-7166.
Charriaut-Marlangue, C. and Ben-Ari, Y. (1995) A cautionary
note on the use of the TUNEL stain to determine apoptosis.
Neuroreport, 7: 61-64.
Clarke, P.G. (1990) Developmental cell death: morphological
diversity and multiple mechanisms. Anat. Embryol., 181: 195-
213.
Covolan, L., Ribeiro, L.T., Longo, B.M. and Mello, L.E. (2000a)
Cell damage and neurogenesis in the dentate granule cell
layer of adult rats after pilocarpine or kainate-induced status
epilepticus. Hippocampus, 10: 169-180.
Covolan, L., Smith, R.L. and Mello, L.E.A.M. (2000b) Ultra-
structural identification of dentate granule cell death from
pilocarpine-induced seizures. Epilepsy Res., 41: 9-21.
Culmsee, C., Zhu, X., Yu, Q.S., Chan, S.L., Camandola, S., Guo,
L., Greig, N.H. and Mattson, M.R (2001) A synthetic inhibitor
of p53 protects neurons against death induced by ischemic and
excitotoxic insults, and amyloid beta-peptide. J. Neurochem.,
77: 220-228.
Dam, A.M. (1980) Epilepsy and neuron loss in the hippocampus.
Epilepsia, 21: 617-629.
Ekdahl, C.T., Mohapel, P., Elmdr, E. and Lindvall, O. (2001)
Caspase inhibitors increase short-term survival of progenitor
cell progeny in the adult rat dentate gyrus following status
epilepticus. Fur. J. Neurosci., 14: 937-945.
Faherty, C.L., Xanthoudakis, S. and Smeyne, R.J. (1999)
Caspase-3-dependent neuronal death in the hippocampus fol-
lowing kainic acid treatment. Brain Res. Mol. Brain Res., 70:
159-163.
Filipkowski, R.K., Hetman, M., Kaminska, B. and Kaczmarek, L.
(1994) DNA fragmentation in the rat brain after intraperitoneal
administration of kainate. Neuroreport, 5: 1538-1540.
Fujikawa, D.G. (2000) Confusion between neuronal apoptosis
and activation of programmed cell death mechanisms in acute
necrotic insults. Trends Neurosci., 23:410-411.
Fujikawa, D.G., Shinmei, S.S. and Cai, B. (1999) Lithium-
pilocarpine-induced status epilepticus produces necrotic neu-
rons with internucleosomal DNA fragmentation in adult rats.
Eur. J. Neurosci., 11: 1605-1614.
Fujikawa, D.G., Shinmei, S.S. and Cai, B. (2000) Kainic acid-
induced seizures produce necrotic, not apoptotic, neurons with
internucleosomal DNA cleavage: implications for programmed
cell death mechanisms. Neuroscience, 98: 41-53.
Gage, F.H. (2000) Mammalian neural stem cells. Science, 287:
1433-1438.
Gillardon, E., Wickert, H. and Zimmermann, M. (1995) Up-
regulation of bax and down-regulation of bcl-2 is associated
with kainate-induced apoptosis in mouse brain. Neurosci. Lett.,
192: 85-88.
Graham, S.H. and Chen, J. (2001) Programmed cell death in
cerebral ischemia. J. Cereb. Blood Flow Metab., 21: 99-109.
Hauser, W.A. (1983) Status epilepticus: frequency, etiology, and
neurological sequelae. Ad~: Neurol., 34: 3-14.

able (Sloviter et al., 1996; Bengzon et al., 1997).
Perforant path stimulation for 8 h induces acute de-
generation of dentate granule cells, whereas 24 h
additionally injures hilar and hippocampal pyramidal
neurons (Sloviter et al., 1996). Light and electron
microscopic analyses revealed that the degenerating
hilar and pyramidal neurons exhibited morphological
features of necrosis. In contrast, acutely degenerating
granule neurons exhibited morphological features of
apoptosis, including coalescence of nuclear chro-
matin into multiple nuclear bodies, compaction of
the cytoplasm, cell shrinkage, and budding-off of
apoptotic bodies. The authors concluded that the
nature of the neuronal death induced by excessive
excitation could be determined postsynaptically by
the manner in which different target cells react to
an excitatory insult. Alternatively, it could be that
the nature of the degeneration is determined by the
severity of the insult, as it has been proposed for
ischemia-induced neurodegeneration (Graham and
Chen, 2001). Excitotoxin exposure at a high concen-
tration for a prolonged period of time has been
shown to produce necrosis of neurons in vitro,
whereas brief exposure to the toxin at lower con-
centrations results in apoptosis in the same neuronal
population (Bonfoco et al., 1995). Factors such as
the variation in the duration and intensity of seizure
activity, metabolic disturbances and energy failure
during and after seizures, and specific cell death trig-
gering factors may all contribute to determining the
eventual pathway of degeneration that a particular
cell commits to.
Relationship of apoptosis to dentate gyrus
neurogenesis
The dentate gyrus in rats contains precursor cells
that continue to produce new neurons throughout
adulthood. Proliferation of neuroblasts takes place
in the subgranular zone and the newly formed cells
then migrate into the granule cell layer and de-
velop phenotypic characteristics of granule neurons.
The newly formed cells seem to be well integrated
and extend projections to the hippocampal CA3 re-
gion, but the functional capacity of these neurons
remains unknown. Dentate granule neurogenesis can
be influenced by various stimuli, including aging,
learning, exercise, adrenal steroids, growth factors
117
and various insults, see Gage (2000). Neurogene-
sis is also increased following seizures. Brief, kin-
died seizures give rise to moderate increases in the
number of newly formed cells and more prolonged
or repetitive seizures result in larger increases in
neurogenesis (Bengzon et al., 1997; Parent et al.,
1997). In a recent study from our own laboratory
we investigated the relationship between seizure-
induced apoptosis and neurogenesis in the dentate
gyms of adult rats by blocking caspases. Multiple
intraventricular infusions of caspase inhibitors just
prior to and up to 1 week following pilocarpine-
evoked status epilepticus reduced the number of
TUNEL/Hoechst-positive cells and increased the
number of bromodeoxyuridine-stained proliferated
cells in the dentate subgranular zone at 1 week fol-
lowing the insult (Ekdahl et al., 2001). Our findings
suggest that caspases modulate seizure-induced neu-
rogenesis in the dentate gyms, probably by regulat-
ing apoptosis of newly born neurons, and that this ac-
tion can be suppressed by caspase inhibitors. Along
the same lines, administration of the protein syn-
thesis inhibitor cycloheximide was found to increase
the number of proliferated cells in the hippocampus
following systemic pilocarpine administration (Co-
volan et al., 2000a). The authors speculated that
such increased mitotic rates might be associated with
an anti-apoptotic-mediated protection of a vulnera-
ble precursor cell population that would otherwise
degenerate after pilocarpine-induced status epilepti-
cus. Our work supports this notion and points to
the caspases as this anti-apoptotic mechanism in the
protection of these precursor cells. Taken together,
our own work and the findings of Covolan et al.
(2000a) point to a dynamic balance between apop-
tosis and the generation of new cells in the dentate
gyms following seizures.
Apoptosis in humans
To address the role of cell death regulatory genes
in the neuropathology of human epilepsy, Henshall
et al. (2000b) investigated the expression of Bcl-2,
Bcl-xL, Bax, caspase-1, and caspase-3 proteins in
temporal cortex samples from patients who had un-
dergone temporal lobectomy surgery for intractable
epilepsy. Levels of Bcl-2 and Bcl-xL proteins were
significantly increased in epileptic brains compared

Henshall, D.C., Chen, J. and Simon, R.E (2000a) Involvement
of caspase-3-1ike protease in the mechanism of cell death
following focally evoked limbic seizures. J. Neurochem., 74:
1215-1223.
Henshall, D.C., Clark, R.S., Adelson, ED., Chen, M., Watkins,
S.C. and Simon, R.E (2000b) Alterations in bcl-2 and cas-
pase gene family protein expression in human temporal lobe
epilepsy. Neurology, 55: 250-257.
Henshall, D.C., Skradski, S.L., Lan, J., Ren, T. and Simon, R.P.
(2001) Increased'Bcl-w expression following focally evoked
limbic seizures in the rat. Neurosci. Lett., 305: 153-156.
Kerr, J.F., Wyllie, A.H. and Currie, A.R. (1972) Apoptosis: a
basic biological phenomenon with wide-ranging implications
in tissue kinetics. Br. J. Cancer, 26: 239-257.
Kondratyev, A. and Gale, K. (2000) Intracerebral injection of
caspase-3 inhibitor prevents neuronal apoptosis after kainic
acid-evoked status epilepticus. Brain Res. Mol. Brain Res., 75:
216-224.
Liu, W., Bi, X., Tocco, G., Baudry, M. and Schreiber, S.S.
(1996) Increased expression of cyclin D1 in the adult rat brain
following kainate acid treatment. Neuroreport, 7: 2785-2789.
McLaughlin, L., Roozendaal, B., Dumas, T., Gupta, A., Ajilore,
O., Hsieh, J., Ho, D., Lawrence, M., McGaugh, J.L. and
Sapolsky, R. (2000) Sparing of neuronal function postseizure
with gene therapy. Proc. Natl. Acad. Sci. USA, 97: 12804-
12809.
Mielke, K., Brecht, S., Dorst, A. and Herdegen, T. (1999) Ac-
tivity and expression of JNK1, p38 and ERK kinases, c-Jun
N-terminal phosphorylation, and c-jun promoter binding in
the adult rat brain following kainate-induced seizures. Neuro-
science, 91: 471-483.
Nakagawa, E., Aimi, Y., Yasuhara, O., Tooyama, L., Shimada,
M., McGeer, EL. and Kimura, H. (2000) Enhancement of
progenitor cell division in the dentate gyrus triggered by initial
limbic seizures in the rat models of epilepsy. Epilepsia, 41:
10-18.
Parent, J.M., Yu, T.W., Leibowitz, R.L., Geschwind, D.H.,
Sloviter, R.S, and Lowenstein, D.H. (1997) Dentate granule
cell neurogenesis is increased by seizures and contributes to
aberrant network reorganization in the adult rat hippocampus.
J. Neurosci., 17: 3727-3738.
Pollard, H., Cantagrel, S., Cbarriant-Marlangue, C., Morean, J.
and Ben Ari, Y. (1994a) Apoptosis associated DNA fragmen-
tation in epileptic brain damage. Neuroreport, 5: 1053-1055.
Pollard, H., Charriaut-Marlangue, C., Cantagrel, S., Represa, A.,
Robain, O., Moreau, J. and Ben-Aft, Y. (1994b) Kainate-
induced apoptotic cell death in hippocampal neurons. Neuro-
science, 63: 7-18.
Pretel, S., Applegate, C.D. and Piekut, D. (1997) Apoptotic and
necrotic cell death following kindling induced seizures. Acta
Histochem., 99: 71-79.
Reed, J.C. (1998) Bcl-2 family proteins. Oncogene, 17: 3225-
3236.
Roux, EE, Colicos, M.A., Barker, P.A. and Kennedy, T.E. (1999)
p75 neurotrophin receptor expression is induced in apoptotic
neurons after seizure. J. Neurosci., 19: 6887-6896.
Sakhi, S., Bruce, A., Sun, N., Tocco, G., Baudry, M. and
ll9
Schreiber, S.S. (1994) p53 induction is associated with neu-
ronal damage in the central nervous system. Proc. Natl. Acad
Sci. USA, 91: 7525-7529.
Sakhi, S., Sun, N., Wing, L.L., Mehta, E and Schreiber, S.S.
(1996) Nuclear accumulation of p53 protein following kainic
acid-induced seizures. Neuroreport, 7: 493-496.
Sankar, R., Shin, D.H., Liu, H., Mazarati, A., Pereira de Vas-
concelos, A. and Wasterlain, C.G. (1998) Patterns of status
epilepticus-induced neuronal injury during development and
long-term consequences. J. Neurosci., 18: 8382-8393.
Savinainen, A., Garcia, E.P., Dorow, D., Marshall, J. and Liu,
Y.F. (2001) Kainate receptor activation induces mixed lineage
kinase-mediated cellular signaling cascades via post-synaptic
density protein 95. J. Biol. Chem., 276: 11382-11386.
Schanwecker, EE. (2000) Seizure-induced neuronal death is as-
sociated with induction of c-Jun N-terminal kinase and is
dependent on genetic background. Brain Res., 884:116-128.
Simonian, N.A., Getz, R.L., Leveque, J.C., Konradi, C. and
Coyle, J.T. (1996) Kainic acid induces apoptosis in neurons.
Neuroscience, 75: 1047-1055.
Sloviter, R.S., Dean, E., Sollas, A.L. and Goodman, J.H. (1996)
Apoptosis and necrosis induced in different hippocampal neu-
ron populations by repetitive perforant path stimulation in the
rat. J. Comp. Neurol., 366: 516-533.
Sperk, G. (1994) Kainic acid seizures in the rat. Prog. Neurobiol.,
42: 1-32.
Thompson, K., Holm, A.M., Schousboe, A., Popper, P.,
Micevych, P. and Wasterlain, C. (1998) Hippocampal stim-
ulation produces neuronal death in the immature brain. Neuro-
science, 82: 337-348.
Tuunanen, L., Lukasiuk, K., Halonen, T. and Pitkanen, A. (1999)
Status epilepticus-induced neuronal damage in the rat amyg-
daloid complex: distribution, time-course and mechanisms.
Neuroscience, 94: 473-495.
Umeoka, S., Miyamoto, O., Janjua, N.A., Nagao, S. and Itano,
T. (2000) Appearance and alteration of TUNEL positive cells
through epileptogenesis in amygdaloid kindled rat. Epilepsy
Res., 42: 97-103.
Venero, J.L., Revuelta, M., Machado, A. and Cano, J. (1999)
Delayed apoptotic pyramidal cell death in CA4 and CA1
hippocampal subfields after a single intraseptal injection of
kainate. Neuroscience, 94:1071-1081.
Viswanath, V., Wu, Z., Fonck, C., Wei, Q., Boonplueang, R. and
Andersen, J.K. (2000) Transgenic mice neuronally expressing
baculoviral p35 are resistant to diverse types of induced apop-
tosis, including seizure-associated neurodegeneration. Proc.
Natl. Acad. Sci. USA, 97: 2270-2275.
Wyllie, A.H., Kerr, J.F. and Currie, A.R. (1980) Cell death: the
significance of apoptosis. Int. Rev. Cytol., 68: 251-306.
Yang, D.D., Kuan, C.Y., Whitmarsh, A.L., Rincon, M., Zheng,
T.S., Davis, R.J., Rakic, P. and Flavell, R.A. (1997) Absence of
excitotoxicity-induced apoptosis in the hippocampus of mice
lacking the Jnk3 gene. Nature, 389: 865-870.
Zhang, L.X., Smith, M.A., Li, X.L., Weiss, S.R. and Post, R.M.
(1998) Apoptosis of hippocampal neurons after amygdala kin-
dled seizures. Brain Res. Mol. Brain Res., 55: 198-208.
T. Sutula and A. PitkRnen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAFFER 10

Seizure-induced neurogenesis: are more new neurons good

for an adult brain?

Jack M. Parent 1,* and Daniel H. Lowenstein 2

Department of Neurology, University of Michigan Medical Center, Ann Arbor, M1 48104-1687, USA
2 Harvard Medical School and Department of Neurology, Beth Israel-Deaconess Medical Center, 333 Brookline Avenue,
Boston, MA 02215, USA

Abstract: The idea that neural stem cells may play a role in the pathophysiology or potential treatment of specific epilepsy
syndromes is relatively new. This notion relates directly to advances in the field of stem cell biology over the past decade,
which have confirmed prior theories that both neural stem cells and neurogenesis, the birth of new neurons, persist in
specific regions of the adult mammalian brain. The physiological role of persistent neurogenesis is not known, although
recent work implicates this process in specific learning and memory tasks. Knowledge of the normal neurogenic pathways
in the mature brain has led to recent studies of neurogenesis in rodent models of acute seizures or epileptogenesis. Most of
these studies have examined neurogenesis in the adult rodent dentate gyms, and current evidence indicates that single brief
or prolonged seizures, as well as repeated kindled seizures, increase dentate granule cell (DGC) neurogenesis. The models
studied to date include pilocarpine and kainic acid models of temporal lobe epilepsy, limbic kindling, and intermittent
perforant path stimulation. Recent work also suggests that pilocarpine-induced status epilepticus increases rostral forebrain
subventricular zone (SVZ) neurogenesis and caudal SVZ gliogenesis. Several lines of evidence implicate newly generated
neurons in structural and functional network abnormalities in the epileptic hippocampal formation of adult rodents. These
abnormalities include aberrant mossy fiber reorganization, persistence of immature DGC structure (e.g. basal dendrites),
and the abnormal migration of newborn neurons to ectopic sites in the dentate gyms. Taken together, these findings suggest
a pro-epileptogenic role of seizure- or injury-induced neurogenesis in the epileptic hippocampal formation. However, the
induction of forebrain SVZ neurogenesis and directed migration to injury after seizures and other brain insults underscores
the potential therapeutic use of neural stem cells as a source for neuronal replacement after injury.

Neurogenesis in the adult mammalian brain
Neurogenesis in the mammalian CNS is confined
largely to the embryonic period, after which neu-
ronal precursor cells undergo terminal division and
new neuronal tissue ceases to be generated. Despite
the recognition nearly 90 years ago that mitotically
* Correspondence to: J.M. Parent, University of Michigan
Medical Center, Neuroscience Laboratory Building, 1103
E. Huron St., Ann Arbor, MI 48104-1687, USA. Tel.:
+1-734-936-1988; Fax: -t-1-734-763-7686;
E-mail: parent@umich.edu
active cells persist in the adult rodent brain (Allen,
1912), the widely held belief that the adult CNS
lacks any regenerative potential delayed acceptance
of the notion that new neurons could be generated
in the adult mammalian brain. Based on tritiated
thymidine mitotic labeling studies, however, inves-
tigators first proposed over three decades ago that
neurons continue to be produced in the adult rodent
rostral SVZ-olfactory bulb pathway and hippocam-
pal dentate gyrus (Altman and Das, 1965; Hinds,
1968; Altman, 1969). These findings were confirmed
by electron microscopy a decade later (Kaplan and
Hinds, 1977), and have been identified in every adult
mammalian species examined to date, including hu-
122
Fig. 1. Schematic parasagittal view of the adult rodent brain showing regions of persistent neurogenesis. Dark circles denote neuronal
precursor cells, and white circlesrepresentdifferentiatingneurons. See text for details. DG = dentate gyrus; SVZ = subventricularzone;
RMS = rostral migratorystream; OB = olfactorybulb.
man (for the dentate gyrus) and non-human primates
(Eriksson et al., 1998; Gould et al., 1998, 1999;
Kornack and Rakic, 1999).
Adult mammalian neurogenesis has been studied
most extensively in the rodent dentate gyrus. In the
adult rat, neuronal precursor cells proliferate in clus-
ters in the dentate subgranular zone, located at the
border of the granule cell layer and hilus (Fig. 1)
(Kaplan and Hinds, 1977; Cameron et al., 1993;
Kuhn et al., 1996). Their progeny disperse and mi-
grate into the DGC layer where they differentiate
into mature granule neurons (Cameron et al., 1993;
Kuhn et al., 1996). A smaller number of progeny
probably also differentiate into radial glia-like cells
in the granule cell layer (Cameron et al., 1993).
However, it is not known whether individual precur-
sor cells are multipotentent or lineage restricted in
terms of the daughter cells they can generate. Al-
though the majority of DGCs in the rat are produced
near the end of the first postnatal week, new DGCs
continue to be generated at a lower rate throughout
adulthood and into senescence (Kuhn et al., 1996).
Newly differentiating granule neurons in the mature
hippocampal formation express a number of imma-
ture neuronal markers putatively involved in cell
migration and axon outgrowth, including collapsin
response mediator protein-4 (CRMP-4), the polysia-
lylated form of neural cell adhesion molecule (PSA-
NCAM), and doublecortin (Seki and Arai, 1993; Par-
ent et al., 1997, 1999; Nacher et al., 2001). Newly
generated DGCs in the adult also appear to integrate
normally into existing hippocampal networks. Com-
bined retrograde tracer and mitotic labeling studies
in adult rodent have shown that mossy fibers of
newly born DGCs project to appropriate targets in
hippocampal area CA3 (Stanfield and Trice, 1988;
Markakis and Gage, 1999).
Neuronal precursors also persist and continue to
proliferate in the adult rodent forebrain SVZ (Alt-
man, 1969; Kaplan and Hinds, 1977; Lois and
Alvarez-Buylla, 1994; Lois et al., 1996; Thomas et
al., 1996). However, unlike in the dentate gyrus, SVZ
neuronal progenitors migrate long distances to their
final destinations in the olfactory bulb (Fig. 1) (Lois
and Alvarez-Buylla, 1994; Lois et al., 1996). The im-
mature neurons migrate from the rostral SVZ to the
olfactory bulb using a relatively unique form of tan-
gential, chain migration (Lois and Alvarez-Buylla,
1994; Lois et al., 1996; Doetsch and Alvarez-Buylla,
1996; Wichterle et al., 1997) in a restricted fore-
brain pathway known as the rostral migratory stream
(RMS) (Altman, 1969; Kishi, 1987). As in the den-
tate gyrus, the immature neuronal progeny in the
SVZ and RMS of adult rodents can be identified
by their expression of characteristic markers such
as PSA-NCAM, neuron-specific beta tubulin, dou-
blecortin, and CRMP-4 (Bonfanti and Theodosis,
1994; Doetsch and Alvarez-Buylla, 1996; Thomas et
al., 1996; Perreto et al., 1999; Magavi et al., 2000;
Nacher et al., 2000). Once the neuroblasts reach the

subependymal region of their olfactory bulb target,
they disperse radially and differentiate into granule
and periglomernlar neurons (Luskin, 1993; Lois and
Alvarez-Buylla, 1994; Lois et al., 1996; Thomas et
al., 1996).
Several relatively recent advances have acceler-
ated our understanding of persistent neurogenesis in
the adult mammalian brain. First, the ability to iden-
tify proliferating precursors and track their migration
and differentiation in vivo has markedly improved
with the advent of bromodeoxyuridine (BrdU) and
retroviral labeling techniques. Second, a number of
groups reported in the early 1990s that a popula-
tion of cells in the adult rodent forebrain SVZ and
dentate gyms possess neural stem cell-like proper-
ties, i.e. they can self-renew and generate neurons,
astrocytes and oligodendrocytes in vitro (Reynolds
and Weiss, 1992; Richards et al., 1992; Lois and
Alvarez-Buylla, 1993; Palmer et al., 1997). Prolifer-
ation in vitro requires growth factors, such as epi-
dermal growth factor (EGF), basic fibroblast growth
factor (bFGF), or brain-derived neurotrophic fac-
tor (BDNF) (Reynolds and Weiss, 1992; Lois and
Alvarez-Buylla, 1993; Kirschenbaum and Goldman,
1995; Gritti et al., 1996). Both quiescent and con-
stitutively proliferating populations of rostral SVZ
precursor cells appear to exist in vivo (Morshead
and van der Kooy, 1992; Morshead et al., 1998;
Doetsch et al., 1999), although the identity of the
putative neural stem cell in the adult rodent forebrain
SVZ remains controversial (Johansson et al., 1999;
Doetsch et al., 1999). Remarkably, evidence from
a recent study of neurogenesis in the adult primate
brain indicates that the capacity for neuronal renewal
may not be limited solely to the phylogenetically
older olfactory bulb and dentate gyms brain regions
suggested by rodent neurogenesis studies. Gould and
colleagues have shown that the forebrain SVZ of
the adult monkey is a proliferative region that gen-
erates precursor cells capable of migrating through
the mature white matter to differentiate into neurons
in multiple cortical regions, including neocortical as-
sociation areas (Gould et al., 1999). This finding, if
confirmed, has important implications for the ther-
apeutic use of endogenous neural precursors as a
source for neuronal replacement after injury.
123
Modulation of adult neurogenesis
The physiological role of neurogenesis in the mature
brain is unknown. Recent evidence raises the possi-
bility that DGC neurogenesis in the adult rat is nec-
essary for certain forms of hippocampal-dependent
learning and memory (Shots et al., 2001). Similarly,
studies of altered neurogenesis in the adult rodent
SVZ-olfactory bulb pathway implicate this system
in specific types of olfactory learning (Gheusi et al.,
2000). These data fit well with the current under-
standing of the role of neurogenesis in adult song-
bird learning (Scharff et al., 2000). In addition to its
physiological function, the molecular mechanisms
that regulate adult neurogenesis remain poorly un-
derstood. The rate of DGC neurogenesis during early
postnatal and adult life appears to be influenced, at
least in part, by factors such as aging, environmental
stimulation, exercise, glucocorticoid hormone levels
and glutamatergic input to the DGC layer (reviewed
in Gage et al., 1998). Other neurochemical systems
implicated in modulating adult DGC neurogenesis
include serotonin, dopamine, and opioids (Dawirs
et al., 1998; Brezun and Daszuta, 1999; Eisch et
al., 2000). Growth or neurotrophic factors have also
been shown to influence cell proliferation and/or
neurogenesis in adult rodent germinative zones. In-
creased DGC neurogenesis has been reported after
administration of bFGF or insulin-like growth factor-
1 (IGF-1) (Wagner et al., 1999; Aberg et al., 2000),
while bFGF, EGF and BDNF appear to alter neuro-
genesis and/or gliogenesis in the adult rodent rostral
SVZ-olfactory bulb pathway (Craig et al., 1996;
Kuhn et al., 1997; Zigova et al., 1998; Wagner et al.,
1999).
As mentioned above, the presence of ongoing
neurogenesis in the mature brain raises the possi-
bility that endogenous precursor cells could be used
therapeutically for repair of neuronal loss associated
with brain injuries or degenerative disorders (Lowen-
stein and Parent, 1999). However, the response of en-
dogenous neural stem or precursor cells to cerebral
injury and their potential involvement in neurologi-
cal disease pathophysiology have received relatively
little attention. A number of recent investigations
suggest that various forms of injury accelerate neural
(i.e. both neuronal and glial) precursor proliferation
in the adult rodent dentate gyms and rostral fore-
124
brain SVZ. In addition to studies of seizure-induced
injury described below, increased DGC neurogene-
sis has been found after mechanical, excitotoxic, or
ischemic lesions of adult rodent brain (Gould and
Tanapat, 1997; Liu et al., 1998; Takagi et al., 1999).
Several investigations also describe injury-induced
increases in adult rodent forebrain SVZ precursor
cell proliferation. The types of injury include aspi-
ration or transection lesions of the forebrain (Willis
et al., 1976; Szele and Chesselet, 1996; Weinstein
et al., 1996), inflammatory or chemical demyeli-
nation (Calz~ et al,, 1998; Nait-Oumesmar et al.,
1999), and percussion trauma (Holmin et al., 1997).
Some of this work suggests that SVZ precursors
give rise to astrocytes and oligodendrocytes after
brain injury (Holmin et al., 1997; Nait-Oumesmar
et al., 1999). However, a recent investigation of en-
dogenous forebrain SVZ precursors in an adult rat
Parkinson's disease model has shown increased pro-
liferation, directed migration and neuronal differen-
tiation of SVZ progenitor cells induced by combined
6-hydroxydopamine lesions and transforming growth
factor-ct infusion (Fallon et al., 2000).
Seizure-induced adult neurogenesis and
gliogenesis
Several recent studies have shown that DGC neuro-
genesis in adult rats increases in various rodent mod-
els of limbic epileptogenesis or acute seizures (Beng-
zon et al., 1997; Parent et al., 1997, 1998; Gray and
Sundstrom, 1998; Scott et al., 1998). In the kainate
and pilocarpine models of temporal lobe epilepsy,
chemoconvulsant-induced status epilepticus (SE) in-
creases cell proliferation by approximately 5- to 10-
fold in the adult rat dentate gyrus after a latent period
of at least several days (Parent et al., 1997; Gray and
Sundstrom, 1998). Most of the newly born cells
differentiate into DGCs and disperse into the gran-
ule cell layer. A similar, albeit less dramatic, effect
on DGC neurogenesis also occurs in electrical kin-
dling models of epileptogenesis, including amygdala
(Scott et al., 1998; Parent et al., 1998), hippocampal
(Bengzon et al., 1997) and perforant path (Naka-
gawa et al., 2000) kindling. Acute seizures in adult
rats induced by intermittent perforant path stimula-
tion or brief hippocampal stimulation also accelerate
DGC neurogenesis (Bengzon et al., 1997; Parent et
al., 1997). Remarkably, even single afterdischarges
produced by hippocampal stimulation are capable of
increasing the number of newly differentiated DGCs
two weeks later (Bengzon et al., 1997).
Although these findings raise the possibility that
electrical activation directly stimulates mitotic ac-
tivity, apoptotic cell death in the DGC layer also
occurs after even brief, discrete seizure-like dis-
charges (Sloviter et al., 1996; Bengzon et al., 1997).
Therefore, seizures may act to increas e neurogenesis
indirectly through injury leading to cell turnover in
the dentate gyrns. This idea is supported by findings
of a relationship between cell death and subsequent
cell birth in a number of postnatal neurogenic sys-
tems, including the higher vocal center of adult song-
birds (Scharff et al., 2000) and the rodent olfactory
bulb and dentate gyrus (Gould and McEwen, 1993;
Biebl et al., 2000). The molecular link between
seizure-induced injury and increased proliferation
and/or survival of newly generated DGCs is not
known. Among the candidate molecules upregulated
by seizure activity are growth factors (Riva et al.,
1992; Humpel et al., 1993; Gall et al., 1994; Young
and Dragunow, 1995; Opanashuk et al., 1999), neu-
rotrophins (Ernfors et al., 1991; Isackson et al., 1991;
Dugich-Djordjevic et al., 1992) and extracellular ma-
trix molecules (Ferhat et al., 1996). Specific neuro-
transmitters or neuromodulatory systems mentioned
above that normally influence DGC neurogenesis
may also be altered by seizure activity.
To begin to address potential mechanisms of
seizure-induced DGC neurogenesis, we recently
asked whether constitutively proliferating precursors
are activated by seizures or if, instead, quiescent
progenitors are recruited to proliferate in the dentate
subgranular zone. We labeled the constitutively pro-
liferating cells by systemic BrdU administration one
day prior to inducing SE with pilocarpine, and then
identified the labeled cells immunohistochemically
between 2 and 14 days later (Parent et al., 1999).
Interestingly, after a latent period of 4-7 days we
found that SE accelerated the proliferation of cells
normally dividing prior to any injury. Although these
data do not exclude the involvement of quiescent
precursors, it suggests that the mechanisms involved
in seizure-induced neurogenesis at least in part re-
late to accelerated cell division of mitotically active
neural precursors.

More recently, we have identified a second con-
stitutively proliferating precursor population that ex-
pands after pilocarpine-induced SE. These precur-
sors arise from the caudal SVZ at the level of the
dorsal hippocampus. When they are labeled with
BrdU 1-2 days before SE, the number of BrdU-
immunoreactive cells 10-14 days later is markedly
increased in pilocarpine-treated adult rats compared
to controls. We confirmed this increase in imma-
ture cells by immunostaining for the differentiating
precursor markers PSA-NCAM, doublecortin and
CRMP-4. These studies showed expansion of pre-
cursors with migratory cell morphology in the cau-
dal SVZ, infracallosal region and areas CA1 and
CA3 of the hippocampus after seizure-induced in-
jury. To confirm migration, retroviral reporters were
stereotaxically injected into the caudal SVZ prior
to seizures, and 2-3 weeks later labeled cells were
found in these same regions. Surprisingly, all of
these cells showed a glial morphology (oligodendro-
cytic or astrocytic) and failed to co-express neuronal
markers. In controls, retroviral reporter-labeled cells
appeared only in the caudal SVZ and corpus cal-
losum after caudal SVZ injections. These findings
suggest that pilocarpine-induced SE accelerates the
proliferation of glial-lineage restricted precursors in
the caudal SVZ. Moreover, it is likely that cues aris-
ing from the injured hippocampus redirect the migra-
tion of newly generated glioblasts to sites of damage
after SE. Understanding how newly generated glia
influence network function in the hippocampus may
provide insight into epileptogenic mechanisms. Fur-
thermore, these precursors may be useful as vehicles
to deliver specific gene products to sites of injury for
future antiepileptogenic treatment strategies.
The effect of seizures on the other persistent ger-
minative zone in the adult, the rostral forebrain SVZ,
has been relatively unexplored. Based on previous
findings of injury-induced cell proliferation in the
rostral SVZ and seizure-induced DGC neurogene-
sis in adult rodents, we asked whether prolonged
seizures also increase neurogenesis in the adult rat
rostral SVZ. Using the pilocarpine model of lim-
bic epileptogenesis, we recently found that 2 h of
SE markedly upregulates cell proliferation, as mea-
sured by BrdU labeling and immunostaining for an
endogenous cell cycle marker, in the adult rat fore-
brain SVZ and RMS. Immunostaining for markers of
125
immature neurons revealed that this change in pro-
liferative activity resulted in increased neurogenesis
in these same brain regions. The majority of neurons
newly generated after seizures migrate through the
normal RMS pathway to their appropriate targets in
the olfactory bulb. However, their migration to the
olfactory bulb is accelerated after SE. We labeled
proliferating cells by systemic BrdU administration
or focal injection of retroviral reporters into the ros-
tral SVZ, and found that they reached the olfactory
bulb much more rapidly after pilocarpine treatment
as compared to saline-treated controls. Moreover, a
significant proportion of the neuroblasts arising from
the SVZ after SE appeared to exit the RMS pre-
maturely and migrate into injured forebrain regions.
The results of these experiments are summarized in
Fig. 2.
Potential effects of altered neurogenesis in
epilepsy models
We are only at the earliest stages of understanding
the effects of seizure-induced neurogenesis in the
adult mammalian brain. Again, most of the work
addressing this question has been directed at altered
neurogenesis in the epileptic adult rodent dentate
gyms. Although the occurrence of increased neu-
ronal birth after seizures suggests the potential for
compensatory effects in the setting of injury, our
initial hypothesis was that newly generated DGCs
were responsible for aberrant mossy fiber reorgani-
zation in the epileptic hippocampal formation. In the
pilocarpine model of TLE, aberrant mossy fiber reor-
ganization typically begins during the second week
after SE and peaks after approximately two months
(Cavalheiro et al., 1991; Mello et al., 1993). Thus,
the birth and subsequent differentiation of increased
numbers of developing DGCs induced by prolonged
seizure activity parallels the time course of mossy
fiber remodeling in this model. Importantly, seizure-
induced mossy fiber synaptic reorganization in the
adult rat closely resembles pathological findings in
human TLE (Tauck and Nadler, 1985; Cronin and
Dudek, 1988; Sutula et al., 1989; Houser et al.,
1990; reviewed in Parent and Lowenstein, 1997).
To test our hypothesis, we first used BrdU la-
beling and immunostaining for axonal markers to
determine whether newly born DGCs contribute to
126

IIIIIIIII
v

Normal
. , ., _ , . . . . .s v z
LV ~oo

t~ RMS ,,, ,,,,,

RAizurA

Fig. 2. Model of seizure-induced rostral SVZ neurogenesis in the adult rat. The top panel shows normal adult SVZ-olfactory bulb
neurogenesis. Pilocarpine-induced status epilepticus (bottom panel) induces the following: (1) the SVZ and RMS expand with increased
neuronal precursors; (2) neuroblast migration to the olfactory bulb is accelerated; (3) some neuroblasts exit the RMS prematurely, migrate
ectopically into the forebrain, and differentiate into neurons. Cx = cortex; LV = lateral ventricle; SVZ = subventricular zone; RMS =
rostral migratory stream; OB ----olfactory bulb.

seizure-induced mossy fiber remodeling in adult rats
(Parent et al., 1997). We found that developing ax-
ons from newly born DGCs participated in aber-
rant mossy fiber reorganization in both area CA3
and the dentate inner molecular layer. To further
test our hypothesis, we inhibited DGC neurogenesis
with whole brain X-irradiation and then examined
whether pilocarpine-induced SE still caused mossy
fiber remodeling (Parent et al., 1999). Despite a
nearly complete reduction of newborn DGCs after ir-
radiation, robust aberrant supragranular mossy fiber
remodeling appeared four weeks after pilocarpine
treatment. Taken together, these data are consistent
with the idea that both newly born and mature DGCs
respond to seizure-induced injury with the aber-
rant outgrowth or sprouting of axons to atypical sites
(Fig. 3). The molecular signals responsible for mossy
fiber remodeling after seizures remain unknown.
A second abnormality related to seizure-induced
DGC neurogenesis concerns the ectopic location of
newborn granule neurons in the epileptic hippocam-
pal formation. In human TLE, the granule cell layer
128
ever, unlike mature granule neurons in the DGC
layer, the ectopic hilar granule cells exhibited ab-
normal burst firing in synchrony with CA3 pyra-
midal cells. In addition, many putatively newborn
DGC located in the hilus and hilar aspect of the
DGC layer after seizures exhibit a much higher
percentage of persistent basal dendrites than is nor-
mally seen in DGCs of adult rodents (Spigelman et
al., 1998; Buckmaster and Dudek, 1999; Ribak et
al., 2000). Similar changes also occur in the den-
tate gyms of the p35 (neuronal-specific activator of
cyclin-dependent kinase 5)-deficient mouse, a model
of cerebral dysgenesis and epilepsy (Wenzel et al.,
2001), suggesting that such changes are developmen-
tal abnormalities. Importantly, Ribak and colleagues
have found morphological evidence of substantially
increased net excitatory synapses on the basal den-
drites of hilar ectopic DGCs (Ribak et al., 2000).
These investigators have suggested that this synap-
tic reorganization may be a mechanism for seizure
generation.
Beyond the data supporting a pro-epileptogenic
role of seizure-induced DGC neurogenesis, the find-
ings of ectopic hilar DGCs have implications for
brain repair potential after injury. We have found
newborn hilar and molecular layer granule-like cells
after SE even in animals with significant injury to
the superior blade of the DGC layer (J.M. Parent and
D.H. Lowenstein, unpublished data). Furthermore,
endogenous DGC precursors still appear to differen-
tiate into DGCs (by the criteria of morphology and
antigen expression) even when they migrate to atypi-
cal locations. These findings suggest that brain repair
strategies will need to overcome at least two ob-
stacles to achieve neuronal replacement after injury
using endogenous or transplanted neural precursor
cells. First, competing cues may exist at sites of
injury that could direct migration of neural progeni-
tors to inappropriate locations (e.g. the dentate hilus
instead of injured DGC layer). Second, the local en-
vironment may not maintain the cues necessary to
direct differentiation of neural progenitors into the
appropriate cell types.
In addition to epileptogenesis, seizure-induced
alterations in neurogenesis may have implications
for the memory dysfunction associated with chronic
epilepsy. Although unproven, existing evidence sup-
ports a relationship between adult DGC neurogenesis
and certain forms of hippocampal learning and mem-
ory in the rodent (Shors et al., 2001). Learning and
memory dysfunction has been demonstrated follow-
ing limbic kindling of adult rats (Sutula et al., 1995),
and alterations of DGC networks may participate
in such disturbances given the presumed involve-
ment of the hippocampal formation in mammalian
learning and memory (Jarrard, 1993). The potential
role of altered DGC neurogenesis in cognitive im-
pairments associated with brain irradiation to treat
humans with brain tumors has also been raised re-
cently (Parent et al., 1999; Tada et al., 2000). Perhaps
seizures alter the network integration of newly gen-
erated DGCs (via ectopic location or persistent basal
dendrites), and this leads to dysfunction of circuits
necessary for memory acquisition or retrieval. How
potential seizure-induced changes in forebrain SVZ
neurogenesis, which is putatively involved in olfac-
tory learning in rodents (Gheusi et al., 2000), may
relate to interictal abnormalities in human epilepsy is
even more speculative.
The recent finding of seizure-induced neurogene-
sis in the adult mammalian forebrain SVZ also raises
some other interesting questions. For example, how
does seizure activity or seizure-induced injury stim-
ulate SVZ neurogenesis and alter the normal pattern
of neuroblast migration? Do differentiating neurons
that migrate ectopically into the forebrain survive
and integrate into existing networks? If so, do they
serve to reestablish normal connections after injury,
or do they participate in the formation of abnormal
networks that may predispose to seizure generation?
These issues are important in light of the evidence
that endogenous neuronal precursors in the adult rat
SVZ and dentate gyrus respond similarly to seizures
and other forms of brain injury. Understanding the
molecular regulation of adult mammalian neural pre-
cursors is a necessary step toward achieving the ca-
pacity to modify or direct the proliferation, migration
and differentiation of neural stem cells in the setting
of acute brain injury or neurodegeneration. The abil-
ity to manipulate this response may then offer strate-
gies for brain repair or antiepileptogenic therapies.
References
~berg, M.A.I., ,~berg, N.D., Hedb~icker, H., Oscarsson, J. and
Eriksson, ES. (2000) Peripheral infusion of IGF-1 selectively
 127

G,.,,.j%j
¢

Hilu to CA3

Fig. 3. Model of seizure-induced dentate granule cell neurogenesis in the adult rat. Proliferation of neural precursors (round gray cell
under the GCL) in the subgranular zone accelerates after pilocarpine-induced status. Some precursors differentiate into DGCs in the
granule cell layer (GCL), and both newly generated and mature DGCs contribute to aberrant mossy fiber reorganization in the inner
molecular layer (above the GCL). Other precursors may form glial ceils or undergo seizure-induced chain migration into the hilus to
produce hilar ectopic DGCs.

is often relatively preserved but may show abnor-
malities that include dispersion of the layer and the
presence of ectopic granule-like neurons in the hilus
and inner molecular layer (Houser, 1990). DGC dis-
persion also occurs in the adult rat pilocarpine model
of TLE (Mello et al., 1992). In our initial stud-
ies of seizure-induced neurogenesis (Parent et al.,
1997), we found that newly differentiating neurons
with granule cell morphology appeared in unusual
locations, i.e. the dentate hilus and inner molecular
layer. These cells resemble the 'ectopic' granule-like
neurons identified in surgical specimens from hu-
mans with temporal lobe epilepsy (Houser, 1990).
We also observed a progressive increase in large
BrdU-immunolabeled nuclei in the hilus with in-
creasing time after SE, as well as chains of migrating
neuroblasts extending from the inner DGC layer to
the hilus (Fig. 3). Although the precise origin of
these cells is unknown, their appearance following
pilocarpine treatment, but not in controls, suggests
that they migrate aberrantly from the dentate SGZ to
the hilus after prolonged seizures.
Several groups have subsequently confirmed and
extended the finding of newly generated ectopic hilar
DGCs after kainic acid- or pilocarpine-induced SE
(Scharfman et al., 2000; Dashtipour et al., 2001).
Importantly, Scharfman and colleagues studied the
electrophysiological features of the hilar ectopic
granule-like neurons using intracellular recordings
in hippocampal slices from epileptic adult rats. They
found that these ectopic cells maintained many of the
electrophysiological characteristics of DGCs. How-

induces neurogenesis in the adult rat hippocampus. J. Neu-
rosci., 20: 2896-2903.
Allen, E. (1912) The cessation of mitosis in the central nervous
system of the albino rat. J. Comp. Neurol., 22: 547-568.
Altman, J. (1969) Autoradiographic and histological studies of
postnatal neurogenesis, IV. Cell proliferation and migration
in the anterior forebrain, with special reference to persisting
neurogenesis in the olfactory bulb. J. Comp. Neurol., 137:
433-458.
Altman, J. and Das, G.D. (1965) Autoradiographic and histolog-
ical evidence of postnatal hippocampal neurogenesis in rats. J.
Comp. Neurol., 124: 319-335.
Bengzon, J., Kokaia, Z., Elmer, E., Nanobashvili, A., Kokaia, M.
and Lindvall, O, (1997) Apoptosis and proliferation of dentate
gyrus neurons after single and intermittent limbic seizures.
Proc. Natl. Acad. Sci. USA, 94: 10432-10437.
Biebl, M., Cooper, C.M., Winkler, J. and Kuhn, H.G. (2000)
Analysis of neurogenesis and programmed cell death reveals
a self-renewing capacity in the adult rat brain. Neurosci Lett.,
291: 17-20.
Bonfanti, L. and Theodosis, D.T. (1994) Expression of polysia-
lylated neural cell adhesion molecule by proliferating cells in
the subependymal layer of the adult rat, in its rostral extension
and in the olfactory bulb. Neuroscience, 62: 291-305.
Brezun, J.M. and Daszuta, A. (1999) Depletion in serotonin
decreases neurogenesis in the dentate gyrus and the subven-
tricular zone of adult rats. Neuroscience, 89: 999-1002.
Buckmaster, P.S. and Dudek, EE. (1999) In vivo intracellular
analysis of granule cell axon reorganization in epileptic rats. J.
Neurophysiol., 81: 712-721.
Calz~t, L., et al. (1998) Proliferation and phenotype regulation
in the subventricular zone during experimental allergic en-
cephalomyelitis: in vivo evidence of a role for nerve growth
factor. Proc. Natl. Acad. Sci. USA, 95: 3209-3214.
Cameron, H.A., Woolley, C.S., McEwen, B.S. and Gould, E.
(1993) Differentiation of newly born neurons and glia in the
dentate gyrus of the adult rat. Neuroscience, 56: 337-344.
Cavalheiro, E.A., Leite, J.R, Bortolotto, Z.A., Turski, W.A.,
Ikonomidou, C. and Turski, L. (1991) Long-term effects of
pilocarpine in rats: structural damage of the brain triggers
kindling and spontaneous recurrent seizures. Epilepsia, 32:
778-782.
Craig, C.G., Tropepe, V., Morshead, C.M., Reynolds, B.A.,
Weiss, S. and van der Kooy, D. (1996) In vivo growth factor
expansion of endogenous subependymal neural precursor cell
populations in the adult mouse brain. J. Neurosci., 16: 2649-
2658.
Cronin, J. and Dudek, EE. (1988) Chronic seizures and collateral
sprouting of dentate mossy fibers after kainic acid treatment in
rats. Brain Res., 474: 181-184.
Dashtipour, K., Tran, EH., Okazaki, M.M., Nadler, J.V. and
Ribak, C.E. (2001) Ultrastructural features and synaptic con-
nections of hilar ectopic granule cells in the rat dentate gyms
are different from those of granule cells in the granule cell
layer. Brain Res., 890: 261-271.
Dawirs, R.R., Hildebrandt, K. and Teuchert-Noodt, G. (1998)
Adult treatment with haloperidol increases dentate granule cell
129
proliferation in the gerbil hippocampus. J. Neural Transm.,
105: 317-327.
Doetsch, F. and Alvarez-Buylla, A. (1996) Network of tangential
pathways for neuronal migration in adult mammalian brain.
Proc. Natl. Acad. Sci. USA, 93: 14895-14900.
Doetsch, F., Caillt, I., Lim, D.A., Garcfa-Verdugo, J.M, and
Alvarez-Buylla, A. (1999) Subventricular zone astrocytes are
neural stem cells in the adult mammalian brain. Cell, 97: 703-
716.
Dugich-Djordjevic, M.M., et ak (1992) BDNF mRNA expres-
sion in the developing rat brain following kainic acid-induced
seizure activity. Neuron, 8:1127-1138.
Eisch, A.J., Barrot, M., Schad, C.A., Self, D.W. and Nestler, EJ.
(2000) Opiates inhibit neurogenesis in the adult rat hippocam-
pus. Proc. Natl. Acad. Sci. USA, 97: 7579-7584.
Eriksson, P.S., Perfilieva, E., Bjork-Eriksson, T., Alborn, A.,
Nordborg, C., Peterson, D.A. and Gage, EH. (1998) Neuroge-
nesis in the adult human hippocampus. Nat. Med., 4: 1313-
1317.
Ernfors, P., Bengzon, J., Kokaia, Z., Persson, H. and Lindvall, O.
(1991) Increased levels of messenger RNAs for neurotrophic
factors in the brain during epileptogenesis. Neuron, 7: 165-
176.
Fallon, J., et al. (2000) In vivo induction of massive prolifera-
tion, directed migration, and differentiation of neural cells in
the adult mammalian brain. Proc. Natl. Acad. Sci. USA, 97:
14686-14691.
Ferhat, L., Chevassus-Au-Louis, N., Khrestchatisky, M., Ben-
Ari, Y. and Represa, A. (1996) Seizures induce tenascin-C
mRNA expression in neurons. J. NeurocytoL, 25: 535-546.
Gage, F.H., Kemperman, G., Palmer, T.D., Peterson, D.A. and
Ray, J. (1998) Multipotent progenitor cells in the adult dentate
gyrus. J. Neurobiol., 36: 249-266.
Gall, C.M., Berschauer, R. and Isackson, P.J. (1994) Seizures
increase basic fibroblast growth factor mRNA in adult rat
forebrain neurons and glia. Mol. Brain Res., 21: 190-205.
Gheusi, G., Cremer, H., McLean, H., Chazal, G., Vincent, J. and
Lledo, P. (2000) Importance of newly generated neurons in the
adult olfactory bulb for odor discrimination. Proc. Natl. Acad.
Sci. USA, 97: 1823-1828.
Gould, E. and McEwen, B.S. (1993) Neuronal birth and death.
Curr. Opin. Neurobiol., 3: 676-682.
Gould, E. and Tanapat, P. (1997) Lesion-induced proliferation
of neuronal progenitors in the dentate gyrus of the adult rat.
Neuroseience, 80: 427-436.
Gould, E., Tanapat, P., McEwen, B.S., Fltigge, G. and Fuchs, E.
(1998) Proliferation of granule cell precursors in the dentate
gyms of adult monkeys is diminished by stress. Proc. Natl.
Acad. Sci. USA, 95: 3168-3171.
Gould, E., Reeves, AJ., Graziano, M.S.A. and Gross, C.G.
(1999) Neurogenesis in the neocortex of adult primates. Sci-
ence, 286: 548-552.
Gray, W.P. and Sundstrom, L.E. (1998) Kainic acid increases the
proliferation of granule cell progenitors in the dentate gyrus of
the adult rat. Brain Res., 790: 52-59.
Gritti, A., et al. (1996) Multipotential stem cells from the adult
130
mouse brain proliferate and self-renew in response to basic
fibroblast growth factor. J. Neurosci., 16:1091-1100.
Hinds, J.W. (1968) Autoradiographic study of histogenesis in the
mouse olfactory bulb. J. Comp. Neurol., 134: 287-304.
Holmin, S., Almqvist, P., Lendahl, U. and Mathiesen, T. (1997)
Adult nestin-expressing subependymal cells differentiate to
astrocytes in response to brain injury. Eur. J. Neurosci., 9:
65-75.
Houser, C.R. (1990) Granule cell dispersion in the dentate gyms
of humans with temporal lobe epilepsy. Brain Res., 535: 195-
204.
Houser, C.R., Miyashiro, J.E., Swartz, B.E., Walsh, G.O., Rich,
J.R. and Delgado-Escueta, A.V. (1990) Altered pattens of
dynorphin immunoreactivity suggest mossy fiber reorganiza-
tion in human hippocampal epilepsy. J. Neurosci., 10: 267-
282.
Humpel, C., Lippoldt, A., Chadi, G., Ganten, D., Olson, L.
and Fuxe, K. (1993) Fast and widespread increase of basic
fibroblast growth factor messenger RNA and in the forebrain
after kainate-induced seizures. Neuroscience, 57: 913-922.
Isackson, P.J., Huntsman, M.M., Murray, K.D. and Gall, C.
(1991) BDNF mRNA expression is increased in adult rat
forebrain after limbic seizures: temporal pattens of induction
distinct from NGF. Neuron, 6: 937-948.
Jarrard, L. (1993) On the role of the hippocampus in learning
and memory in the rat. Behav. Neural Biol., 60: 9-26.
Johansson, C.B., Momma, S., Clarke, D.L., Risling, M., Lendahl,
U. and Fris6n, J. (1999) Identification of a neural stem cell in
the adult mammalian central nervous system. Cell, 96: 25-34.
Kaplan, M.S. and Hinds, J.W. (1977) Neurogenesis in adult
rat: electron microscopic analysis of light radioautographs.
Science, 197: 1092-1094.
Kirschenbaum, B. and Goldman, S. (1995) BDNF promotes
the survival of neurons arising from the adult rat forebrain
subventricular zone. Proc. Natl. Acad. Sci. USA, 92: 210-214.
Kishi, K. (1987) Golgi studies on the development of granule
cells of the rat olfactory bulb with reference to migration in
the subependymal layer. J. Comp. Neurol., 258:112-124.
Kornack, D.R. and Rakic, P. (1999) Continuation of neurogenesis
in the hippocampus of the adult macaque monkey. Proc. NatL
Acad. Sei. USA, 96: 5768-5773.
Kuhn, H.G., Dickinson-Anson, H. and Gage, EH. (1996) Neu-
rogenesis in the dentate gyms of the adult rat: age-related
decrease of neuronal progenitor proliferation. J. Neurosci., 16:
2027-2033.
Kuhn, H.G., Winkler, J., Kempermann, G., Thal, L.J. and Gage,
EH. (1997) Epidermal growth factor and fibroblast growth
factor-2 have different effects on neural progenitors in the
adult rat brain. J. Neurosci., 17: 5820-5829.
Liu, J., Solway, K., Messing, R.O. and Sharp, ER. (1998) In-
creased neurogenesis in the dentate gyms after transient global
ischemia in gerbils. J. Neurosci., 18: 7768-7778.
Lois, C. and Alvarez-Buylla, A. (1993) Proliferating subventric-
ular zone cells in the adult mammalian forebrain can differ-
entiate into neurons and glia. Proc. Natl. Acad. Sci. USA, 90:
2074-2077.
Lois, C. and Alvarez-Buylla, A. (1994) Long-distance neuronal
migration in the adult mammalian brain. Science, 264: 1145-
1148.
Lois, C., Garcfa-Verdugo, J.M. and Alvarez-Buylla, A. (1996)
Chain migration of neuronal precursors. Science, 271: 978-
981.
Lowenstein, D,H. and Parent, J.M. (1999) Brain, heal thyself.
Science, 283:1126-1127.
Luskin, M. (1993) Restricted proliferation and migration of post-
natally generated neurons derived from the forebrain subven-
tricular zone. Neuron, 11: 173-189.
Magavi, S.S., Leavitt, B.R. and Macklis, J.D. (2000) Induction
of neurogenesis in the neocortex of adult mice. Nature, 405:
951-955.
Markakis, E.A. and Gage, EH. (1999) Adult-generated neurons
in the dentate gyms send axonal projections to field CA3 and
are surrounded by synaptic vesicles. J. Comp. Neurol., 406:
449-460.
Mello, L.E., Cavalheiro, E.A., Tan, A.M., Kupfer, W.R., Preto-
flus, J.K., Babb, T.L. and Finch, D.M. (1993) Circuit mecha-
nisms of seizures in the pilocarpine model of chronic epilepsy:
cell loss and mossy fiber sprouting. Epilepsia, 34: 985-995.
Mello, L.M., Cavalheiro, E., Tan, A., Pretorius, J.K., Babb, T.
and Finch, D. (1992) Granule cell dispersion in relation to
mossy fiber sprouting, hippocampal cell loss, silent period and
seizure frequency in the pilocarpine model of epilepsy. In:
J. Engel Jr., C. Wasterlain, E.A. Cavalheiro, U. Heinemann
and G. Avanzini (Eds.), Molecular Neurobiology of Epilepsy.
Elsevier, Amsterdam, pp. 51-60.
Morshead, C.M. and van der Kooy, D. (1992) Postmitotic
death is the fate of constitutively proliferating cells in the
subependymal layer of the adult mouse brain. J. Neurosci., 12:
249-256.
Morshead, C.M., Craig, C.G. and van der Kooy, D. (1998) In
vivo clonal analyses reveal the properties of endogenous neu-
ral stem cell proliferation in the adult mammalian forebrain.
Development, 125: 2251-2261.
Nacher, J., Crespo, C, and McEwen, B.S. (2001) Doublecortin
expression in the adult rat telencephalon. Eur. J. Neurosci., 14:
629-644.
Nacher, J., Rosell, D.R. and McEwen, B.S. (2000) Widespread
expression of collapsin response-mediated protein 4 in the
telencephalon and other areas of the adult rat central nervous
system. J. Comp. Neurol., 424: 628-639.
Nait-Oumesmar, B., et al. (1999) Progenitor cells of the adult
mouse subventricular zone proliferate, migrate and differen-
tiate into oligodendrocytes after demyelination. Eur. J. Neu-
rosci., 11: 4357-4366.
Nakagawa, E., Aimi, Y., Yasuhara, O., Tooyama, 1., Shimada,
M,, McGeer, EL. and Kimura, H. (2000) Enhancement of
progenitor cell division in the dentate gyms triggered by initial
limbic seizures in rat models of epilepsy. Epilepsia, 41: 10-18.
Opanashuk, L.A., Mark, R.J., Porter, J., Datum, D., Mattson,
M.E and Seroogy, K.B. (1999) Heparin-binding epidermal
growth factor-like growth factor in hippocampus: modulation
of expression by seizures and anti-excitotoxic action. J.
Neurosci., 19: 133-146.
Palmer, T.D., Takahashi, J. and Gage, EH. (1997) The adult rat

hippocampus contains primordial neural stem cells. Mol. Cell.
Neurosci., 8: 389-404.
Parent, J.M. and Lowenstein, D.H. (1997) Mossy fiber reorgani-
zation in the epileptic hippocampus. Curr. Opin. Neurol., 10:
103-109.
Parent, J.M., Yu, T.W., Leibowitz, R.T., Geschwind, D.H.,
Sloviter, R.S. and Lowenstein, D.H. (1997) Dentate granule
cell neurogenesis is increased by seizures and contributes to
aberrant network reorganization in the adult rat hippocampus.
J. Neurosci., 17: 3727-3738.
Parent, J.M., Janumpalli, S., McNamara, J.O. and Lowenstein,
D.H. (1998) Increased dentate granule cell neurogenesis
following amygdala kindling in the adult rat. Neurosci Lett.,
247: 9-12.
Parent, J.M., Tada, E., Fike, J.R. and Lowenstein, D.H. (1999)
Inhibition of dentate granule cell neurogenesis with brain irra-
diation does not prevent seizure-induced mossy fiber synaptic
reorganization in the rat. J. Neurosci., 19: 4508-4519.
Perreto, P., Merighi, A., Fasolo, A. and Bonfanti, L. (1999) The
subependymal layer in rodents: a site of structural plasticity
and cell migration in the adult mammalian brain. Brain Res.
Bull., 49: 221-243.
Reynolds, B.A. and Weiss, S. (1992) Generation of neurons
and astrocytes from isolated ceils of the mammalian central
nervous system. Science, 255: 1707-1710.
Ribak, C.E., Tran, P.H., Spigelman, I., Okazaki, M.M. and
Nadler, J.V. (2000) Status epilepticus-induced hilar basal
dendrites on rodent granule cells contribute to recurrent
excitatory circuitry. J. Comp. Neurol., 428: 240-253.
Richards, L.J., Kilpatrick, T.J. and Bartlett, P.F. (1992) De novo
generation of neuronal cells from the adult mouse brain. Proc.
Natl. Acad. Sci. USA, 89: 8591-8595.
Riva, M.A., Gale, K. and Mocchetti, I. (1992) Basic fibroblast
growth factor mRNA increases in specific brain regions
following convulsive seizures. Mol. Brain Res., 15:311-318.
Scharff, C., Kirn, J.R., Grossman, M., Macklis, J.D. and
Nottebohm, E (2000) Targeted neuronal death affects neuronal
replacement and vocal behavior in adult songbirds. Neuron,
25: 481-492.
Scharfman, H.E., Goodman, J.H. and Sollas, A.L. (2000)
Granule-like neurons at the hilar/CA3 border after status
epilepticus and their synchrony with area CA3 pyramidal
cells: functional implications of seizure-induced neurogenesis.
J. Neurosci., 20: 6144-6158.
Scott, B.W., Wang, S., Burnham, W.M., De Boni, U. and
Wojtowicz, J.M. (1998) Kindling-induced neurogenesis in the
dentate gyms of the rat. Neurosci. Lett., 248: 73-76.
Seki, T. and Arai, Y. (1993) Highly polysialylated neural
cell adhesion molecule (NCAM-H) is expressed by newly
generated granule cells in the dentate gyms of the adult rat. J.
Neurosci., 13: 2351-2358.
Shors, T.J., Miesegaes, G., Beylin, A., Zhao, M., Rydel, T. and
Gould, E. (2001) Neurogenesis in the adult is involved in the
formation of trace memories. Nature, 410: 372-376.
Sloviter, R.S., Dean, E., Sollas, A.L. and Goodman, J.H. (1996)
Apoptosis and necrosis induced in different hippocampal
neuron populations by repetitive perforant path stimulation in
the rat. J. Comp. Neurol., 366: 516-533.
131
Spigelman, I., Yan, X.X., Obenaus, A., Lee, E.Y., Wasterlain,
C.G. and Ribak, C.E. (1998) Dentate granule cells form novel
basal dendrites in a rat model of temporal lobe epilepsy.
Neuroscience, 86: 109-120.
Stanfield, B.B. and Trice, J.E. (1988) Evidence that granule cells
generated in the dentate gyms of adult rats extend axonal
projections. Exp. Brain Res., 72: 399-406.
Sutula, T., Cascino, G., Cavazos, J., Parada, I. and Ramirez, L.
(1989) Mossy fiber synaptic reorganization in the epileptic
human temporal lobe. Ann. Neurol., 26: 321-330.
Sutula, T., Lauersdorf, S., Lynch, M., Jurgella, C. and Woodard,
A, (1995) Deficits in radial ann maze performance in kindled
rats: evidence for long-lasting memory dysfunction induced
by repeated brief seizures. J. Neurosci., 15: 8295-8301.
Szele, F.G. and Chesselet, M. (1996) Cortical lesions induce
an increase in cell number and PSA-NCAM expression in
the subventricular zone of adult rats. J. Comp. Neurol., 368:
439-454.
Tada, E., Parent, J.M., Lowenstein, D.H. and Fike, J.R. (2000)
X-irradiation causes a prolonged reduction in cell proliferation
in the dentate gyms of adult rats. Neuroscience, 99: 33-41.
Takagi, Y., Nozaki, K., Takahashi, J., Yodoi, J., Ishikawa, M. and
Hashimoto, N. (1999) Proliferation of neuronal precursor cells
in the dentate gyms is accelerated after transient forebrain
ischemia in mice. Brain Res., 831: 283-287.
Tauck, D. and Nadler, J. (1985) Evidence of functional
mossy fiber sprouting in hippocampal formation of kainic
acid-treated rats. J. Neurosci., 5: 1016-1022.
Thomas, L.B., Gates, M.A. and Steindler, D.A. (1996) Young
neurons from the adult subependymal zone proliferate and
migrate along an astrocyte, extracellular matrix-rich pathway.
Glia, 17: 1-14.
Wagner, J.P., Black, I.B. and DiCicco-Bloom, E. (1999)
Stimulation of neonatal and adult brain neurogenesis by
subcutaneous injection of basic fibroblast growth factor. J.
Neurosci., 19: 6006-6016.
Weinstein, D.E., Burrola, P. and Kilpatrick, T.J. (1996) Increased
proliferation of precursor cells in the adult rat brain after
targeted lesioning. Brain Res., 743:11-16.
Wenzel, H.J., Robbins, C.A., Tsai, L. and Schwartzkroin, P.A.
(2001) Abnormal morphological and functional organization
of the hippocampus in a p35 mutant model of cortical
dysplasia associated with spontaneous seizures. J. Neurosci.,
21: 983-998.
Wichterle, H., Garcfa-Verdugo, J.M. and Alvarez-Buylla, A.
(1997) Direct evidence for homotypic, glia-independent
neuronal migration. Neuron, 18: 779-791.
Willis, P., Berry, M. and Riches, A.C. (1976) Effects of trauma
on cell production in the subependymal layer of the rat
neocortex. Neuropathol. Appl. Neurobiol., 2: 377-388.
Young, D. and Dragunow, M. (1995) Neuronal injury following
electrically induced status epilepticus with and without
adenosine receptor antagonism. Exp. Neurol., 133: 125-137.
Zigova, T., Pencea, V., Wiegand, S.J. and Luskin, M.B. (1998)
Intraventricular administration of BDNF increases the number
of newly generated neurons in the adult olfactory bulb. Mol.
Cell. Neurosci., 11 : 234-245.
T. Sutula and A. Pitk~nen (Eds.)
Progress in Brain Research, Vol. 135
O 2002 Published by Elsevier Science B.V.
CHAPTER 11
Summary: Seizure-induced damage in
experimental models
Thomas Sutula x,2,, and Asla Pitk~inen 3,4
1 Department of Neurology and 2 Department of Anatomy, University of Wisconsin, Madison, WI 53792, USA
3 Epilepsy Research Laboratory, A.L Virtanen Institute for Molecular Sciences and 4 Department of Neurology,
Kuopio University Hospital, Kuopio, Finland
The association of seizures with brain damage
was initially recognized in the early 19th Century
with the identification of hippocampal sclerosis in
autopsy studies of patients with essentially untreated
epilepsy. From this neuropathological observation
linking epilepsy to a specific form of hippocampal
damage, subsequent experimental efforts have indis-
putably demonstrated that prolonged seizure activity,
as in status epilepticus, is sufficient to produce brain
damage even when systemic metabolic conditions
were optimized (Chapter 1). There is also long-
standing awareness from clinical studies that inad-
equately treated status epilepticus is often followed
by adverse neurological sequelae (Chapter 7). But
what about the effects of repeated brief seizures in
people with established epilepsy? Do these seizures,
which typically are limited to several minutes or
less, cause neuronal damage or injury? Section I has
addressed this issue at conceptual, experimental, and
translational levels based on currently available data.
Experimental efforts to determine when and how
seizures induce damage have proceeded in what
seems to be an ever-expanding range of models of
seizures with different clinical manifestations and
* Correspondence to: T. Sutula, Department of Neurology
H6/570, University of Wisconsin, Madison, WI 53792,
USA. Tel.: +1-608-263-5448; Fax: +1-608-263-0412;
E-mail: sutula@ neurology.wisc.edu
seizure durations. While reductionistic approaches
have been relatively successful for understanding spe-
cific mechanisms contributing to damage caused by
severe seizures (see Section II), another form of a
reductionistic approach, that is, determining the mini-
mal seizure event that produces damage, has produced
as many questions as answers. Some reasons for this
complexity are suggested in Chapter 2. For example,
in experimental models and in human epilepsy, the
effects of seizures cannot be conceptualized merely
in terms of how a seizure affects a single neuron. In-
deed, neural circuits, as complex systems with many
levels of organization, may become dysfunctional (or
damaged) by subtle, incremental effects involving a
relatively small number of components. Emphasis on
the effects of seizures at the level of the whole an-
imal, while difficult both clinically and experimen-
tally, may reveal dysfunction that seems dispropor-
tionate to the abnormality detected in a single path-
way or by a single measure, for example, the extent
of neuron loss. This is a significant obstacle for ex-
perimental approaches. Yet it is precisely the system
level dysfunctions, for example, increasing frequency
of seizures and cumulative seizure-related memory
dysfunction, that are troubling permanent features of
poorly controlled epilepsy.
Among the substantial challenges for assessing
the possible damaging effects of status epilepticus
and brief seizures are the technical difficulties pre-
sented in detecting neuronal loss, which are dis-
134
cussed with critical perspective in Chapters 3 and
4. The epilepsy research literature is filled with a
bewildering range of results supporting and denying
the occurrence of seizure-induced neuronal loss in a
variety of experimental models. Divergent or contra-
dictory interpretations in such studies are often based
on technical methods with substantial limitations in
sensitivity or variability. Examples of the challenges
of stereological analysis are evident in studies of
status epilepticus (Chapters 5 and 6) and in models
of brief seizures (Chapter 8 and 9).
In Chapters 5 and 6, it is reasonably proposed that
if spontaneous seizures after status epilepticus add
to the extent of neuronal loss, more neuronal loss
should be detected at longer intervals after the initial
status. While this was observed in Chapter 5, differ-
ing quantitative methods at the early and later time
points after kainic acid induced status epilepticus in
this model precluded the interpretation that the ad-
ditional seizures contributed to further neuronal loss.
In a model of recurring spontaneous seizures follow-
ing status epilepticus induced by amygdala stimula-
tion (Chapter 6), stereological analysis, histological
methods for labeling damaged neurons (Fluoro-Jade
B), and MRI methods detected initial status-induced
neuronal loss, but there was no evidence that re-
curring spontaneous seizures produced additional
damage. Progressive cell loss within the 2 months
after status epilepticus was associated with the initial
insult, that is, status epilepticus itself. In contrast,
cumulative neuronal loss was detected after repeated
brief seizures evoked by kindling in a pattern that
resembled hippocampal sclerosis, which was asso-
ciated with long-term seizure-induced memory dys-
function (Chapter 8). Congruent with these findings
and multiple previous stereological studies (Chapter
8), apoptosis has been detected in the dentate gyrus
after single evoked seizures (Chapter 9), an observa-
tion also confirmed in the dentate gyrns and in other
hippocampal and cortical regions (see Pretel et al.,
1997; Zhang et al., 1998, and Table 3 in Chapter 8).
While application of quantitative methods for de-
tection of seizure-induced neuronal loss is not sim-
ple, and rigorous application of these methods may
be challenging, it seems doubtful that the apparently
divergent outcomes in these studies (Chapters 6, 8
and 9) in regard to damaging effects of brief seizures
can be discounted simply as artifacts of the particu-
lar analysis methods employed in a given study. Be-
cause severe brain damage precedes the occurrence
of spontaneous seizures in status epilepticus mod-
els (Chapters 5 and 6), the most seizure-sensitive
neuronal populations may already be partially or
completely lost. In kindling, however, the neuronal
circuitry is intact at the time of the first stimulations.
Both models ultimately are associated with memory
dysfunction, which strongly indicates that repeated
seizures, whether the result of status epilepticus or
cumulative brief seizures, have long-term deleterious
effects on neuronal circuitry. Similar long-term ad-
verse effects are now also apparent in a variety of
experimental models of seizures in developing ani-
mals, even when overt damage or neuronal loss is
not apparent (Chapters 28 and 32).
What are the possible explanations for the ap-
parent discrepancy between the effects of repeated
seizures after status and in animals whose neural cir-
cuitry is normal when seizures are first induced? Cer-
tainly different sensitivity of the assessment methods
must always be considered in these studies, and in
the design of future experiments. A second pos-
sibility is that model-related differences in seizure
type and duration may be contributing. The recurrent
seizures that evolve in status models are often partial
or quite brief in duration (44-60 s, see Chapter 6).
In contrast, repeated secondary generalized seizures
evoked in kindled animals are typically of 1-2 min or
more in duration in advanced stages of kindling. This
difference is potentially significant from the point of
view of neuronal metabolism (Section II), and is also
of interest given evidence in human epilepsy that
hippocampal volume reduction (Chapters 22, 24, 25,
26) and cognitive impairment (Chapter 35) are re-
lated to the number of lifetime generalized tonic-
clonic seizures. A third possibility is that seizure-
induced neurogenesis (Chapter 10) contributes to the
outcome and the differences among studies in the
different models, which deserves further experimen-
tal consideration.
One is left with the impression that a definitive ex-
periment on the minimally damaging seizure has not
yet been performed, and that the possible differences
in factors such as seizure duration and neurogenesis
in different models have not received adequate atten-
tion. A further challenge is the possibility, if not the
likelihood, that the effects of seizures in a 'complex

system' such as neural circuitry may be influenced
conditionally by so many variables that the m i n i m a l
seizure that produces damage may vary depending
on the dynamic conditions of the neural circuits and
systemic factors.
Whatever the uncertainty about the m i n i m a l
seizure that produces damage, studies in a vari-
ety of experimental models have irrefutably demon-
strated that repeated seizures, whether prolonged or
brief, have extensive and profound long-term effects
in neural circuitry, and provide no reassurance that
these effects can be casually regarded as benign. This
impression is unavoidable in the studies of adult ani-
mals in this volume, and is also supported by exper-
iments assessing the long-term effects of seizures in
developing animals, where numerous adverse long-
term consequences are now being recognized in the
absence of overt morphological damage (Chapters
28, 32 and 33).
135
In attempting to assess the translational signif-
icance of these experimental studies for human
epilepsy, Simon Shorvon critically comments in
Chapter 7 on the widely held view that "evidence in
humans has been more difficult to define or quantify.
In the past, indeed, several authorities have doubted
that damage is prominent or clinically relevant." The
reader is encouraged to critically assess the latter
viewpoint in light of emerging clinical studies in
humans presented in Sections III-VI.
References
Pretel, S., Applegate, C.D. and Piekut, D. (1997) Apoptotic and
necrotic cell death following kindling induced seizures. Acta
Histochem., 99(1): 71-79.
Zhang, L.X., Smith, M., Li, X., Weiss, S. and Post, R.M. (1998)
Apoptosis of hippocampal neurons after amygdala kindled
seizures. Mol. Brain Res., 55(2): 198-208.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 12

Complications associated with genetic background effects

in models of experimental epilepsy

P. Elyse S c h a u w e c k e r *

Department of Cell and Neurobiology, University of Southern California, Keck School of Medicine, Los Angeles, CA 90089-9112, USA

Abstract: To elucidate the genetic influences contributing to susceptibility to seizure disorders, researchers have long used
selected lines and inbred strains of rodents. In recent years, the use of genetically altered mice as models of complex
human disease has revolutionized biomedical research into the genetics of disease pathogenesis and potential therapeutic
interventions. In particular, the study of transgenic and gene-deleted (knockout) mice can provide important insights into
the in vivo function and interaction of specific gene products. While a variety of inbred mouse mutations have been used to
directly evaluate the genetic basis of seizure disorders, data obtained from such genetically altered mice must be interpreted
carefully. An increasing number of scientific articles have reported that the phenotype of a given single gene mutation in
mice can be modulated by the genetic background of the inbred strain in which the mutation is maintained. This effect
is attributable to so-called modifier genes, which act in combination with the causative gene. In this review, the author
points out the importance of considering the genetic background of the strain used to create these animal models, the
potential problems with interpretation of phenotype, and solutions to selecting an appropriate mouse model of experimental
epilepsy. Despite these potential limitations, knockout mice provide a powerful tool for understanding the genetic and
neurobiological mechanisms contributing to experimental epilepsy.

Introduction excitatory amino acid release, glutamate receptor

While recent progress in mapping human genes for
epilepsy indicates that genetic factors contribute to
the etiology of seizure disorders (reviewed in Ander-
man, 1982; Elmslie and Gardiner, 1995; reviewed in
Bate and Gardiner, 1999; Serratosa, 1999; Steinlein,
1999; Gardiner and Lehesjoki, 2000), it is becoming
clear that the genetic susceptibility to these disorders
is complex. Additionally, it has been suggested that
a cascade of biological events involving increased
* Correspondence to: P.E. Schauwecker, Department of
Cell and Neurobiology, University of Southern California,
Keck School of Medicine, BMT 401, 1333 San Pablo
Street, Los Angeles, CA 90089-9112, USA. Tel.: +1-323-
442-2116; Fax: + 1-323-442-3466;
E-mail: schauwec @hsc.usc.edu
activation, influx of calcium into neurons, and subse-
quent neuronal degeneration and cell death, may un-
derlie the development and progression of epilepsy.
However, while reports of neuronal damage or loss
have been noted in patients with epilepsy for many
years (Mauritzen Dam, 1982; Babb et al., 1984; De
Lanerolle et al., 1989), it has been difficult to deter-
mine in human subjects whether neuronal loss is a
direct result of status epilepticus or results from other
systemic factors, such as preexisting brain pathology.
Differences in the phenotypic expression of epilepsy
disorders can occur between individuals or within a
single pedigree, suggesting that more than one gene
may predispose an individual to epilepsy and likely
in different etiologic combinations (reviewed in Bate
and Gardiner, 1999; Gardiner and Lehesjoki, 2000).
Regardless, the search for genes influencing traits
and disorders with a complex genetic background,
140
such as epilepsy, has become a realistic task based
on recent advances in molecular technology using
newly developed animal models. As a result, animal
modeling of seizure disorders has been instrumen-
tal in elucidating the pathophysiological mechanisms
underlying epilepsy and in designing more effective
therapies for seizure-induced damage. Importantly,
both spontaneous and genetically engineered animal
models of inherited epilepsy have been shown to
mimic closely the biological phenomena associated
with the seizure conditions, such as neurologic ab-
normalities, predisposition to hyperexcitability, and
behavioral traits associated with increased seizure
activity (Frankel et al., 1994; reviewed in McNa-
mara and Puranam, 1998; reviewed in Prasad et
al., 1999). While the abnormalities in these animal
models may be the result of a specific single gene
effect or may be the result of multiple genetic in-
teractions, genetic studies using these animal models
offer promising alternative approaches to localize
and identify genes involved with seizure susceptibil-
ity and/or seizure-induced cell death. Similar to the
human situation, phenotypic variability is also seen
in mice when spontaneous or induced mutations
have been placed on different strain backgrounds.
Thus, identification of the modifying genes in mice
that confer resistance to seizure-induced cell death
could be homologous to some of the multiple loci
involved in resistance to epilepsy in human. In this
review, we will discuss the use of normal inbred
mice as a model system to investigate intrastrain
(background) variation in susceptibility to seizure-
induced cell death, the effects of genetic background
strain on the phenotypes of mice lacking specific
genes, and the means by which to overcome po-
tential genetic background effects in experimental
models of epilepsy.
Strain-related differences in seizure-induced cell
death
Over the last ten years, substantial evidence has in-
dicated that laboratory mouse strains differ markedly
with regard to behavioral studies of complex learning
(Diana et al., 1994; Andrews et al., 1995; reviewed
in Crawley et al., 1997; Logue et al., 1997; Ger-
lai, 1998), tumor susceptibility (Malkinson and Beer,
1983; Jacoby et al., 1994; reviewed in Lee, 1998),
TABLE 1
Inbred mouse strains displaying differential vulnerability to
kainic acid-induced neurotoxicity
Resistant mouse strains Susceptible mouse strains
BALB/c DBA/2J
C3H FVB/N
C57BL/6 129/SvEMS
ICR
129/SvJ
SJL
and sensitivity to toxins (Seale et al., 1984; Zocchi et
al., 1998; reviewed in Crabbe et al,, 1999). A number
of studies have determined that genetic differences
can also affect seizure susceptibility in mice. Fer-
raro et al. (1995, 1997, 1998, 1999) have shown that
strain-dependent differences in seizure susceptibil-
ity to both electroconvulsive and chemically induced
seizures are conferred in a polygenic manner, sug-
gesting that sensitivity to seizures is a multifactorial
trait.
While it is well known that different strains of
rat or mice vary in their response to chemically
induced seizures, (Sanberg et al., 1979; Ferraro et
al., 1995, 1997; Golden et al., 1995), our studies
have also demonstrated that genetic factors in mice
influence the degree of sensitivity or resistance to
kainic acid-induced cell death (Schauwecker and
Steward, 1997). Studies in our laboratory have found
that commonly used inbred strains of mice demon-
strate dramatic differences in susceptibility to kainic
acid-induced excitotoxic cell death. One remark-
able finding is that certain inbred strains of mice
exhibit seizures following kainic acid (KA) adminis-
tration, but exhibit little, if any, excitotoxic cell death
(Schauwecker and Steward, 1997; Schauwecker,
2000; Schauwecker et al., 2000). Other strains of
mice exhibit similar seizures and a pattern of excito-
toxic cell death similar to what has been described in
rats (Table 1).
Resistant strains (C57BL/6, BALB/c, 129/SvJ,
C3H, ICR, and SJL) show no degeneration or cell
damage until doses at or exceeding the LD90 are
administered. Even at these high doses, degenera-
tion and cell death is only evident in a small sector
of the hippocampus (area CA3b) in a minority of
the mice (Schauwecker and Steward, 1997). Those
 141

C57BI.J6 FVBIN

Nissl stain

Fink-Heimer
silver stain

Gallyas
silver stain

Fig. l. Neuronal cell loss and degeneration 7 days following systemic kainate administration in a representative 'cell death-resistant' and
representative 'cell death-susceptible' strain of mice. Note that in the 'susceptible' strain, extensive cell loss is evident within the dentate
hilar region, as well as in area CA3. Less extensive damage is observed in area CA1. In contrast, cell loss is not evident in the 'resistant'
strain. Numerous cells positive for silver impregnation are observed through the dentate hilus and in area CA3 in the 'susceptible' strain,
while no degenerative debris is present in the 'resistant' strain.

mice vulnerable to K A - i n d u c e d cell death ( F V B / N ,
129/SvEMS, and D B A / 2 J ) show loss of hippocam-
pal pyramidal neurons and neurons in the hilus of the
dentate gyms, similar to what has been previously
described in rats (Fig. 1; Nadler and Cuthbertson,
1980; Nadler et al., 1980; Sperk et al., 1983; Ben-
Ari, 1985).
The virtual invulnerability cannot be explained by
decreased alterations in the extent of seizure activity
because representative 'cell death-resistant' and rep-
resentative 'cell death-susceptible' mice exhibit the
same classes of behavioral seizures, a qualitatively
similar level of seizure intensity, and a similar dura-
tion of severe seizures. Moreover, the pattern and ex-
tent of neuronal activity is comparable as revealed by
2-deoxyglucose autoradiography (Schauwecker and
Steward, 1997). Thus, differences in cell death do not
appear to be the result o f differences in b l o o d - b r a i n
barrier permeability or differences in the pattern of
neuronal activity during the seizures. In addition, it
is unlikely that strain differences in the response to
K A - i n d u c e d cell death result from differences in the
pharmacokinetics of K A as previous studies have
shown no difference in the uptake of 3H-KA into the
142
murine central nervous system (Ferraro et al., 1995)
in strains that have been identified as 'resistant' or
'susceptible'.
Rather, inter-strain differences in excitatory
amino acid receptor function (Lipartiti et al., 1993;
Magnusson and Cotman, 1993; Kelly et al., 1998),
and/or the presence of genes that either mediate
neuroprotection or predispose to excitotoxic damage
may govern the level of injury. In order to exam-
ine the contribution of background genetic factors
that may be linked to the differential response of
inbred strains to KA-induced cell death, we exam-
ined the susceptibility of F1 hybrid mice (129/SvJ
× 129/SvEMS) to KA-induced cell death. We chose
the 129/Sv strain as it was considered a relatively
'new' strain and since we had observed clear-cut
phenotypic differences within the different lines of
the 129 strain (e.g. 129/SvJ = resistant; 129/SvEMS
-= susceptible), we assumed that any genetic differ-
ences would be easier to differentiate within the
same inbred strain versus between different inbred
strains. By crossing strains that are resistant or
susceptible to KA-induced cell death, valuable in-
formation about the dominant or recessive nature
of resistance can be determined. Nearly all of the
mice generated from this cross (99%) were resistant
to excitotoxic cell death, suggesting that resistance
to excitotoxic cell death is a dominant trait. How-
ever, since previous studies have suggested that the
129/SvJ strains may be contaminated with genomic
material from another inbred strain (C57BL/6), and
thus may not be considered an 'inbred' strain (Simp-
son et al., 1997; Threadgill et al., 1997), we chose
to examine the genetic basis of resistance in inter-
crosses between other inbred strains.
As a thorough genetic analysis of resistance to ex-
citotoxic cell death requires the identification of any
elements that may positively or negatively control
cell death, we chose to use strains that display large
phenotypic (susceptibility or resistance to excitotoxic
cell death) and genotypic differences. Matings, per-
formed between the inbred C57BL/6 (resistant) and
FVB/N (susceptible) strains, produced 73 FI mice in
which we determined the susceptibility of heterozy-
gous animals to KA-induced cell death. Nearly all of
the F1 mice were resistant to cell death following KA
administration (89%) confirming our previous find-
ings with the 129/SvJ strain. These results suggest
that resistance to KA-induced cell death involves one
or more genes with a dominant effect.
The finding that many commonly used inbred
mouse strains and several Fls are resistant to KA-
induced excitotoxicity has important implications
for studies using these strains to examine neuronal
death. It may be that these strains, and any oth-
ers with similar resistance, will show very differ-
ent responses in any situation in which excitotoxic
cell death plays a role (for example, after brain or
spinal cord injury, transient ischemia, or epileptoge-
nesis). Furthermore, the relative resistance of many
mouse strains to seizure-induced cell death also has
implications for those studies using gene targeting
approaches.
Modeling experimental epilepsy using genetically
manipulated mice
To elucidate the molecular mechanisms responsi-
ble for the production of seizure-induced cell death,
previous studies have utilized genetic approaches,
including: (1) creation of transgenic mice in which
an exogenous gene is introduced into the mouse
genome; and (2) gene targeting in which an endoge-
nous gene is removed. The goal of experiments using
a genetic manipulation approach is to enable the as-
signment of functions to single genes and determine
the role of a particular gene within a specified sys-
tem. While it is clear that transgenic and knockout
strategies offer the opportunity to study the effects
of specific genes thought to be candidates for modu-
lating seizure and cell death susceptibility (Dawson
et al., 1996; Watanabe et al., 1996; Morrison et al.,
1996; Tsirka et al., 1997; Yang et al., 1997; Jiang
et al., 2000; Mazarati et al., 2000), several caveats
exist with regard to the design of these experiments.
The genetic background of mice may influence the
transgenic or knockout phenotype as unlinked genes
contained in the strain background (strain-specific
modifiers) can have a dramatic effect on the ex-
pected phenotype. Modifier genes can greatly affect
the manifestation of a mutant phenotype. Secondly,
with regard to gene targeting studies, if the genetic
background in which targeted gene deletions are
constructed is mixed (i.e. comprised of two different
strains), phenotypic differences observed may either
be the result of the null mutation or genetic link-

age from background (modifier) genes (reviewed in
Gerlai, 1996; Choi, 1997; Schauwecker and Steward,
1997; Frankel, 1998). The effects of these confounds
on interpretation of experimental epilepsy models
will be discussed below.
Phenotypic changes resulting from strain-specific
modifier genes
A major confound in assessment of a knockout phe-
notype is the issue of genetic background. Genetic
background can be defined as the collection of all
genes present within an organism that can influence
a particular trait or many traits. Thus, many muta-
tions are likely to have different consequences in
different genetic backgrounds. It has been well es-
tablished that even in monogenic diseases, caused
by mutations in a single gene, marked variations in
the symptoms of patients with the same disease can
exist. Variations in the phenotype of a disease are
thought to be the result of modifying effects of other
genes. Studies performed over the last few years
have clearly illustrated that phenotypes caused by
specific genetic modifications are strongly influenced
by genes unlinked to the target locus. For example,
whereas deletion of the p53 tumor suppressor gene
causes a dramatic increase in the frequency of tumor
formation in those mice compared with wild-type
mice, the types of tumor formed, their numbers per
animal, and age of tumor onset vary in different
genetic backgrounds (Van Meyel et al., 1998; Ku-
perwasser et al., 2000). In addition, while mutations
at different loci can produce a similar phenotype,
allelic variation at the same locus can produce dif-
ferent phenotypes (Prasad et al., 1999). Previous
studies have shown that wild-type genes can modify
the progression of phenotypic traits in either trans-
genic or knockout mice in a strain-dependent manner
(reviewed in Gingrich and Hen, 2000). Furthermore,
silencing of a targeted gene using traditional gene
knockout approaches can also result in the organism
attempting to compensate for the alteration. These
compensatory changes can then result in unexpected
phenotypic changes (reviewed in Crabbe et al., 1999;
and Clark, 2000).
The effects of strain on transgenic and knockout
mice have been reported extensively (Threadgill et
al., 1995; Schauwecker and Steward, 1997; Kelly
143
et al., 1998; Paradee et al., 1999). These and other
studies have demonstrated that a large number of
phenotypes observed in transgenic and gene-targeted
animals can be influenced by genetic background
including ethanol tolerance, locomotor activity, be-
havior, and seizure susceptibility (Diana et al., 1994;
Ferraro et al., 1995, 1998; Crabbe, 1996; Craw-
ley et al., 1997; Logue et al., 1997; Gerlai, 1998;
Kelly et al., 1998; Zocchi et al., 1998; Crabbe et
al., 1999). As an example of the latter, the sus-
ceptibility to pentylenetetrazole (PTZ) seizures in
mice differs when the knockout loci are present on
C57BL/6, 129/Sv or FVB/N backgrounds (Ferraro
et al., 1998).
While a number of recent gene targeting studies
have reported effects of null mutations on processes
that are triggered by or related to glutamate-mediated
excitotoxic cell death, the background genotype of
the null mutant mice, and its potential confounding
effects have been virtually ignored. As a result, it
remains unclear whether the phenotypical changes
observed in the mutant animals result from the tar-
geted mutation or in fact result from the effects of
other genes whose alleles are also different between
the mutant and control mice. One example of such
background gene effects comes from a study in p53
tumor suppressor knockout mice.
It has been reported that deletion of the p53 gene
in animals of a mixed genetic background (129/Sv x
C57BL/6) conferred protection against KA-induced
degeneration (Morrison et al., 1996). However, while
these results suggested that p53 may play a criti-
cal role in enhancing neuronal viability following
KA-induced seizures, our results documenting strain
differences in susceptibility to excitotoxic cell death
suggest that considerable genetic variability between
strains hosting the mutation may profoundly influ-
ence the resultant phenotype. In order to exam-
ine this issue further, we obtained p53 - / - mice
that had been constructed on three different genetic
backgrounds from Jackson Laboratories (Bar Har-
bor, ME). On a C57BL/6 background, p 5 3 - / - mice
were resistant to KA-induced cell death. However,
on either a 129/SvEMS or FVB/N background,
p 5 3 - / - mice were susceptible to KA-induced cell
death (Fig. 2). In essence, the p53-null mutation did
not influence KA-induced neuronal death even on
those genetic backgrounds susceptible to excitotoxic
144

120
t.- L

"6 96 9"//.

/'i
,.4 72 N
o 48
"6
lb..
m 24
.o
E
Z 0
CA3 Hilus CA1 DG

Hippocampal region

C57BL/6 ~ 129/SvEMS ~ FVB/N

Fig. 2. Susceptibility to kainate-induced neuronal loss in p53-/- mice is dependent on the genetic background. Quantification of
hippocampal cell loss following systemic kainate administration in p53 /- mice on three different genetic backgrounds (C57BL/6,
129/SvEMS, or FVB/N). Note that cell loss is observed throughout area CA3, area CAI, and the dentate hilus when the p53-/- is
generated in a 129/SvEMS or FVB/N genetic background. No cell loss is observed when the p53-/- is generated in a C57BL/6
background. Data represent the mean -t- SEM of 5-6 mice for each backgroundstrain. *P < 0.05.

cell death. Thus, the difference in susceptibility to
KA-induced cell death was attributable to a differ-
ence in the progenitor strains used to establish the
F2 background upon which the knockout existed.
These results have important implications for pre-
vious studies assessing the potential neuroprotective
effects of particular genes on seizure-induced cell
death. As the majority of these studies have been
performed on undefined genetic backgrounds, and
to a greater extent on mixed backgrounds, the phe-
notypical differences observed between mutant and
wild-type mice may be due either to the introduced
null mutation or to the background genes linked to
the targeted locus.
Use of hybrid strains for gene targeting
Another potential confound for gene targeting ex-
periments is the use of mixed genetic backgrounds,
such that loci from one strain may co-segregate
with the mutated gene when crossed to a different
strain. Unfortunately, the large majority of knock-
out mutants are often hybrids of two mouse strains
(typically, C57BL/6 × 129), While most studies
compare homozygous mutant, heterozygous mutant,
and wild-type littermates of an F2 population to
determine phenotypical changes resulting from the
null mutation, it is important to note that the genetic
background composition of these hybrid mice varies
among littermates because of gene segregation from
the hybrid (F1) parents. In particular, the alleles of
genes that surround the targeted locus in a mixed
background can be derived from one strain in null
mutant mice and of another strain in wild-type mice.
Thus, the mutation may actually be viewed as a
marker for background genes that are linked to the
locus of interest.
Many recent studies have examined genes in-
volved in susceptibility to excitotoxin-induced cell
death using gene targeting techniques in hybrid
mice. For example, null mutations of nitric oxide
synthase (Ayata et al., 1997), c-fos (Watanabe et
al., 1996), tissue plasminogen activator (Tsirka et
al., 1997), poly (ADP-ribose) polymerase (Eliasson
et al., 1997), prion protein (Coiling et al., 1997),
presenilin-1 (Gut et al., 1999), and glutathione per-
oxidase (Jiang et al., 2000) in 129Sv x C57BL/6
hybrids have been reported to influence excitotoxic
cell death. Although the mechanism of elicitation of
excitotoxicity differs from the paradigm used in our

studies, our data suggests that the use of the hybrids
with C57BL/6 genes might influence the resultant
phenotype.
Solutions to selecting or creating an appropriate
mouse model of experimental epilepsy
In order to identify genes that may modulate suscep-
tibility to seizure activity or seizure-induced damage,
it is important to keep in mind the complexity un-
derlying genetic studies. Thus, while gene targeting
techniques offer the opportunity to study the effect
of specific genes that may be candidates for modulat-
ing seizure activity or the extent of seizure-induced
cell death, careful attention must be paid to the
interpretation of observed phenotypes when using
gene targeting approaches. This review has revealed
that genetic background can confound experiments
designed to assess the effect of neuroprotective mea-
sures against seizure onset or seizure-induced cell
death. Based on the accumulated literature on the
genetic dissection of complex traits, following are
some suggestions as to how to cope best with the
genetic background problem.
While it would be most ideal to maintain a muta-
tion on a pure inbred genetic background, our results
demonstrating strain-dependent differences in sus-
ceptibility to seizure-induced cell death suggest that
the correct selection of the most suitable background
parental strain requires a thorough understanding of
which background genes might influence the resul-
tant phenotype. Thus, the ideal situation would be
to generate mutant mice with a pure genetic back-
ground that display a meaningful phenotype. By
assessing mice that differ only in the presence or
absence of a targeted locus, the power of identi-
fying a 'candidate' gene responsible for conferring
susceptibility or resistance can be substantially in-
creased. If the use of an inbred strain is not possible,
then congenic mice should be generated. Congenic
strains are created by transferring a short segment
of the chromosome around a marker gene from one
strain into an inbred genetic background by repeated
backcrossing and selection (Weft et al., 1997). This
approach assumes that the resultant strain pair retains
a phenotypic difference and then subsequent crosses
are made so that the trait locus is the only one
segregating. Thus, similar to inbred mouse strains,
145
congenic strains are homozygous at the majority of
loci, eliminating the variability that may confound
the resultant phenotype.
Secondly, when targeted gene deletions are con-
structed on a mixed background, the genetic back-
ground composition of the appropriate control mice
also varies among littermates. Thus, these control
mice can only provide an approximate genetic match
to mixed backgrounds. While one potential solution
involves backcrossing the hybrid mice to a strain
of the desired genetic background for 4-5 genera-
tions, a small section of one of the genomes will
always flank the targeted gene, and like the null
mutation, become homozygous following matings
between siblings to generate null mice. To check for
the possibility of flanking gene effects, one could ob-
tain littermates which are different from the targeted
locus, but homozygous for the flanking region or
use a polymorphic marker for the targeted genomic
region that can permit rapid exclusion of flanking
allele effects. However, the easiest solution to this
dilemma may be to avoid using null mutants cre-
ated on a mixed background, in accordance with
recommendations from geneticists at the Banbury
Conference on Genetic Background in Mice (1997).
The optimal approach to determine whether the
observed phenotypic effect is the result of a mutated
gene is through the use of rescue strategies, in which
the functional gene is introduced and studied for its
ability to reverse the observed phenotypic effect(s).
A number of recent studies have utilized transgenic
or lineage-specific rescue of disrupted genes and
shown that mutant phenotypes could be rescued (re-
viewed in Ishida et al., 1998; Lipp and Wolfer, 1998;
Schomberg et al., 1999; Aoyama et al., 2000). These
studies have not only aided in the development of
more sophisticated methods to create genomic alter-
ations, but can assist in defining phenotypes more
accurately. Thus future studies will need to focus on
dissecting pleiotropic effects of removal of a specific
gene by means of rescue experiments, or through
the use of other approaches including chimera and
mosaic studies, creation of dominant negative mu-
tants, or conditional (tissue-specific) gene knockout
techniques.
146
Conclusions
The availability of numerous inbred strains repre-
sents a useful tool for the genetic dissection of
the basis of differential susceptibility to excitatory
amino acid-induced cell death. As is clear from
the present discussion of genetic susceptibility to
KA-induced cell death, endogenous genes present in
certain strains of inbred mice can determine resis-
tance. Although the gene(s) conferring resistance to
excitotoxin-induced cell death have not been posi-
tionally cloned, analysis of phenotypic effects can
provide additional information regarding the mech-
anism of seizure-induced cell death and assist in
understanding the extent and nature of the genetic
complexity that underlies seizure disorders.
References
Anderman, E. (1982) Multifactorial inheritance of generalized
and focal epilepsy. In: V.E. Anderson, W.A. Hauser, J.K.
Penry and C.E Sing (Eds.), Genetic Basis of the Epilepsies.
Raven Press, New York, pp. 355-374.
Andrews, J.S., Jansen, J.H.M., Linders, S., Princen, A. and
Broekkamp, C.L.E. (1995) Performance of four different rat
strains in the autoshaping, two-object discrimination, and
swim maze tests of learning and memory. Physiol. Behav.,
57: 785-790.
Aoyama, S., Kase, H. and Borrelli, E. (2000) Rescue of loco-
motor impairment in dopamine D2 receptor-deficient mice by
an adenosine A2A receptor antagonist. J. Neurosci., 20: 5848-
5852.
Ayata, C., Ayata, G., Hara, H., Matthews, R.T., Beal, M.E,
Ferrante, R.J., Endres, M., Kim, A., Christie, R.H., Waeber,
C., Huang, EL., Hyman, B.T. and Moskowitz, M.A. (1997)
Mechanisms of reduced striatal NMDA excitotoxicity in type I
nitric oxide synthase knock-out mice. J. Neurosci., 17: 8906-
8917.
Babb, T.L., Brown, W.J., Pretorius, J., Davenport, C., Lieb,
J.R and Crandall, RH. (1984) Temporal lobe volumetric cell
densities in temporal lobe epilepsy. Epilepsia, 25: 729-740.
Banbury Conference on Genetic Background in Mice (1997)
Neuron, 19: 755-759.
Bate, L. and Gardiner, M. (1999) Genetics of inherited epilep-
sies. Epileptic Disord., 1: 7-19.
Ben-Ari, Y. (1985) Limbic seizure and brain damage produced
by kainic acid: mechanisms and relevance to human temporal
lobe epilepsy. Neuroscience, 14: 375-403.
Choi, D.W. (1997) Background genes: out of sight, but not out
of brain . . . . Trends Neurosci., 20: 499-500.
Clark, A.G. (2000) Limits to prediction of phenotype from
knowledge of genotypes. In: M.T. Clegg, M. Hecht and R.J.
Maclntrye (Eds.), Limits to Knowledge in Evolutionary Genet-
ics. Kluwer Academic/Plenum, New York, pp. 205-224.
Coiling, S.B., Khana, M., Collinge, J. and Jefferys, J.G.R. (1997)
Mossy fibre reorganization in the hippocampus of prion pro-
tein null mice. Brain Res., 755: 28-35.
Crabbe, J.C. (1996) A genetic animal model of alcohol with-
drawal. Alcohol Clin. Exp. Res., 20: 96A-100A.
Crabbe, J.C., Phillips, T.J., Buck, K.J., Cunningham, C.L. and
Belknap, J.K. (1999) Identifying genes for alcohol and drug
sensitivity: recent progress and future directions. Trends Neu-
rosci., 22: 173-179.
Crawley, J.N., Belknap, J.K., Collins, A., Crabbe, J.C., Frankel,
W., Henderson, N., Hitzemann, R.J., Maxon, S.C., Miner,
L.L., Silva, A.J., Wehner, J.M., Wynshaw-Boris, A. and Pay-
lor, R. (1997) Behavioral phenotypes of inbred mouse strains:
implications and recommendations for molecular studies. Psy-
chopharmacology, 132: 107-124.
Dawson, V.L., Kizushi, V.M., Huang, EL., Snyder, S.H. and
Dawson, T.M. (1996) Resistance to neurotoxicity in cortical
cultures from neuronal nitric oxide synthase-deficient mice. J.
Neumsci., 16: 2479-2487.
De Lanerolle, N.C., Kim, J.H., Robbins, R.J. and Spencer, D.D.
(1989) Hippocampal interneuron loss and plasticity in human
temporal lobe epilepsy. Brain Res., 495: 387-395.
Diana, G., Domenici, M.R., Loizzo, A., Scott de Carolis, A.
and Saratella, S. (1994) Age and strain differences in rat
place learning and hippocampal dentate gyrus frequency-
potentiation. Neurosci. Lett., 171: 113-116.
Eliasson, M.J., Sampei, K., Mandir, A.S., Hum, P.D., Traystman,
R.J., Bao, J., Pieper, A., Wang, Z.Q., Dawson, T.M., Snyder,
S.H. and Dawson, V.L. (1997) Poly (ADP-ribose) polymerase
gene disruption renders mice resistant to cerebral ischemia.
Nat. Med., 3: 1089-1095.
Elmslie, E and Gardiner, M. (1995) Genetics of the epilepsies.
Curr. Opin. NeuroL, 8: 126-129.
Ferraro, T.N., Golden, G.T., Smith, G.G. and Berrettini, W.H.
(1995) Differential susceptibility to seizures induced by sys-
temic kainic acid treatment in mature DBA/2J and C57BL/6J
mice. Epilepsia, 36:301-307.
Ferraro, T.N., Golden, G.T., Smith, G.G., Schork, N.J., St. Jean,
P., Ballas, C., Choi, H. and Berrettini, W.H. (1997) Map-
ping murine loci for seizure response to kainic acid. Mamm.
Genome, 8: 200-208.
Ferraro, T.N., Golden, G.T., Snyder, R., Laibinis, M., Smith,
G.G., Buono, R.J. and Berrettini, W.H. (1998) Genetic influ-
ences on electrical seizure threshold. Brain Res., 813: 207-
210.
Ferraro, T.N., Golden, G.T., Smith, G.G., St. Jean, P., Schork,
N.J., Mulholland, N., Ballas, C., Schill, J., Buono, R.J. and
Berrettini, W.H. (1999) Mapping loci for pentylenetetrazol-
induced seizure susceptibility in mice. J. Neurosci., 19: 6733-
6739.
Frankel, W.N. (1998) Mouse strain backgrounds: more than
black and white. Neuron, 20: 183.
Frankel, W.N., Taylor, B.A., Noebels, J.L. and Lutz, C.M. (1994)
Genetic epilepsy model derived from common inbred mouse
strains. Genetics, 138: 481-489.
Gardiner, M. and Lehesjoki, A.E. (2000) Genetics of the epilep-
sies. Curr. Opin. NeuroL, 13: 157-164.

Gerlai, R. (1996) Molecular genetic analysis of mammalian
behavior and brain processes: caveats and perspectives. Sem.
Neurosci., 8: 153-161.
Gerlai, R. (1998) Contextual learning and cue association in fear
conditioning in mice: a strain comparison and a lesion study.
Behav. Brain Res., 95: 191-203.
Gingrich, J.A. and Hen, R. (2000) The broken mouse: the role
of development, plasticity and environment in the interpre-
tation of phenotypic changes in knockout mice. Curr. Opin.
Neurobiol., 10: 146-152.
Golden, G.T., Smith, G.G., Ferraro, T.N. and Reyes, P.E (1995)
Rat strain and age differences in kainic acid induced seizures.
Epil. Res., 20: 151-159.
Guo, Q., Fu, W., Sopher, B.L., Miller, M.W., Ware, C.B., Martin,
G.M. and Mattson, M.P. (1999) Increased vulnerability of
hippocampal neurons to excitotoxic necrosis in presenilin-1
mutant knock-in mice. Nat. Med., 5: 101-106.
lshida, J., Sugiyama, E, Tanimoto, K., Taniguchi, K., Syouji,
M., Takimoto, E., Horiguchi, H., Murakami, K., Yagami, K.
and Fukamizu, A. (1998) Rescue of angiotensinogen-knockout
mice. Biochem. Biophys. Res. Commun., 252: 610-616.
Jacoby, R.F., Hohman, C., Marshall, D.J., Frick, T.J., Schlack,
S., Broda, M., Smutko, J. and Elliott, R.W. (1994) Genetic
analysis of colon cancer susceptibility in mice. Genomics, 15:
381-387.
Jiang, D., Akopian, G., Ho, Y.-S., Walsh, J.P. and Andersen,
J.K. (2000) Chronic brain oxidation in a glutathione peroxi-
dase knockout mouse model results in increased resistance to
induced epileptic seizures. Exp. Neurol., 164: 257-268.
Kelly, A., Conroy, S. and Lynch, M.A. (1998) Evidence that
nerve growth factor plays a role in long-term potentiation in
the rat dentate gyrus. Neuropharmacology, 37: 561-570.
Kuperwasser, C., Hurlbut, G.D., Kittrell, F.S., Dickinson, E.S.,
Laucirica, R., Medina, D., Naber, S.P. and Jerry, D.J. (2000)
Development of spontaneous mammary tumors in BALB/c
p53 heterozygous mice. A model for Li-Fraumeni syndrome.
Am. J. Pathol., 157: 2151-2159.
Lee, G.-H. (1998) Genetic dissection of murine susceptibilities
to liver and lung tumors based on the two-stage concept of
carcinogenesis. Path. Int., 48: 925-933.
Lipartiti, M., Fadda, E., Savoini, G., Siliprandi, R., Sautter, J.,
Arban, R. and Maney, H. (1993) In rats, the metabotropic
glutamate receptor-triggered hippocampal neuronal damage is
strain-dependent. Life Sci., 52: PL85-PL90.
Lipp, H.P. and Wolfer, D.P. (1998) Genetically modified mice
and cognition. Curt Opin. NeurobioL, 8: 272-280.
Logue, S.F., Owen, E.H., Rasmussen, D.L. and Wehner, J.M.
(1997) Assessment of locomotor activity, acoustic and tactile
startle, and prepulse inhibition of startle in inbred mouse
strains and F/ hybrids: implications of genetic background for
single gene and quantitative trait loci analyses. Neuroscience,
80: 1075-1086.
Magnusson, K.R. and Cotman, C.W. (1993) Age-related changes
in excitatory amino acid receptors in two mouse strains. Neu-
robiol. Aging, 14: 197-206.
Malkinson, A.M. and Beer, D.S. (1983) Major effect on suscepti-
147
bility to urethan-induced pulmonary adenoma by a single gene
in BALB/cBy mice. J. Natl. Cancer Inst., 70: 931-936.
Mauritzen Dam, A. (1982) Hippocampal neuron loss in epilepsy
and after experimental seizures. Acta Neurol. Scand., 66: 589-
606.
Mazarati, A.M., Hohmann, J.G., Bacon, A,, Liu, H., Sankar, R.,
Steiner, R.A., Wynick, D. and Wasterlain, C.G. (2000) Modu-
lation of hippocampal excitability and seizures by galanin. J.
Neurosci., 20: 6276-6281.
McNamara, J.O. and Puranam, R.S. (1998) Epilepsy genetics: an
abundance of riches for biologists. Curr. Biol., 8: 168-170.
Morrison, R.S., Wenzel, H.J., Kinoshita, Y., Robbins, C.A.,
Donehower, L.A. and Schwartzkroin, P.A. (1996) Loss of
the p53 tumor suppressor gene protects neurons from kainate-
induced cell death. Z Neurosci., 16: 1337-1345.
Nadler, LV. and Cuthbertson, G.J. (1980) Kainic acid neurotox-
icity toward hippocampal formation: dependence on specific
excitatory pathways. Brain Res., 195: 47-56.
Nadler, J.V., Perry, B.W., Gentry, C. and Cotman, C.W. (1980)
Loss and reacquisition of hippocampal synapses after selective
destruction of CA3-CA4 afferents with kainic acid. Brain
Res., 191: 387-403.
Paradee, W., Melikian, H.E., Rasmussen, D.L., Kenneson, A.,
Corm, P.J. and Warren, S.T. (1999) Fragile X mouse: strain ef-
fects of knockout phenotype and evidence suggesting deficient
amygdala function. Neuroscience, 94: 185-192.
Prasad, A.N., Prasad, C. and Stafstrom, C.E. (1999) Recent
advances in the genetics of epilepsy: insights from human and
animal studies. Epilepsia, 40: 1329-1352.
Sanberg, P.R., Pisa, M. and McGeer, E.G. (1979) Strain differ-
ences and kainic acid neurotoxicity. Brain Res., 166: 431-
435.
Schauwecker, P.E. (2000) Seizure-induced neuronal death is as-
sociated with induction of c-Jun N-terminal kinase and is
dependent on genetic background. Brain Res., 884: 116-128.
Schauwecker, P.E. and Steward, O. (1997) Genetic determinants
of susceptibility to excitotoxic cell death: implications for
gene targeting approaches. Proc. Natl. Acad. Sci. USA, 94:
4103-4108.
Schauwecker, P.E., Ramirez, J.J. and Steward, O. (2000) Genetic
dissection of the signals that induce synaptic reorganization.
Exp. Neurol., 161: 139-152.
Schomberg, D.W., Couse, J.F., Mukherjee, A., Lubahn, D.B.,
Sar, M., Mayo, K.E. and Korach, K.S. (1999) Targeted dis-
ruption of the estrogen receptor-alpha gene in female mice:
characterization of ovarian responses and phenotype in the
adult. Endocrinology, 140: 2733-2744.
Seale, T.W., Johnson, P., Carney, J.M. and Rennert, O.M. (1984)
Interstrain variation in acute toxic response to caffeine among
inbred mice. Pharmacol. Biochem. Behav., 20: 567-573.
Serratosa, J.M. (1999) Idiopathic epilepsies with a complex mode
of inheritance. Epilepsia, 40(Suppl. 3): 12-16.
Simpson, E.M., Linder, C.C., Sargent, E.E., Davisson, M.T., Mo-
braaten, L.E. and Sharp, J.J. (1997) Genetic variation among
129 substrains and its importance for targeted mutagenesis in
mice. Nat. Genet., 16: 19-27.
Sperk, G., Lassmann, H., Baran, H., Kish, S.J., Seitelberger, F.
148
and Horuykiewicz, O. (1983) Kainic acid induced seizures:
neurochemical and histopathological changes. Neuroscience,
10: 1301-1315.
Steinlein, O.K. (1999) New insights into the molecular and
genetic mechanisms underlying idiopathic epilepsies. Clin.
Genet., 54: 169-175.
Threadgill, D.W., Dlugosz, A.A., Hansen, L.A., Tennenbaum, T.,
Lichti, U., Yee, D., LaMantia, C., Mourton, T., Hen'up, K.
and Harris, R.C. (1995) Targeted disruption of mouse EGF
receptor: effect of genetic background on mutant phenotype.
Science, 269: 230-234.
Threadgill, D.W., Yee, D., Matin, A., Nadeau~ J.H. and Magnu-
son, T. (1997) Genealogy of the 129 inbred strains: 129/SvJ is
a contaminated inbred strain. Mamm. Genome, 8: 390-393.
Tsirka, S.E., Rogove, A.D., Bugge, T.H., Degen, J.L. and Strick-
land, S. (1997) An extracellular proteolytic cascade promotes
neuronal degeneration in the mouse hippocampus. J. Neu-
rosci., 17: 543-552.
Van Meyel, D.J., Sanchez-Sweatman, O.H., Kerkvliet, N., Stitt,
L., Ramsay, D.A., Khokha, R., Chambers, A.F. and Cairncross,
J.G. (1998) Genetic background influences timing, morphol-
ogy and dissemination of lymphomas in p53-deficient mice.
Int. J. Oncol,, 13: 917-922.
Watanabe, Y., Johnson, R.S., Butler, L.S., Binder, D.K., Spiegel-
man, B.M., Papaioannou, V.E. and McNamara, J.O. (1996)
Null mutation of c-fos impairs structural and functional plas-
ticities in the kindling model of epilepsy. J. Neurosci., 16:
3827-3836.
Weil, M.M., Brown, B.W. and Serachitopol, D.M. (1997) Geno-
type selection to rapidly breed congenic strains. Genetics, 146:
1061-1069.
Yang, D.D., Kuan, C.-Y., Whitmarsh, A.J., Rincon, M., Zheng,
T.S., Davis, R.J., Rakic, P. and Flavell, R.A. (1997) Absence of
excitotoxicity-induced apoptosis in the hippocampus of mice
lacking the Jnk3 gene. Nature, 389: 865-870.
Zocchi, A., Orsini, C., Cabib, S. and Puglisi-Allegra, S. (1998)
Parallel strain-dependent effect of amphetamine on locomotor
activity and dopamine release in the nucleus accumbens: an in
vivo study in mice. Neuroseience, 82:521-528.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B,V. All rights reserved

CHAPTER 13

Genomics and neurological phenotypes" applications for

seizure-induced damage

Jo A. Del Rio and Carrolee Barlow *

The Salk Institute for Biological Studies, The Laboratory of Genetics, 10010 North Torrey Pines Road, La Jolla, CA 92037, USA

Abstract: It is sometimes assumed that because the brain is such a complex organ, experimental genomics methods are
not directly applicable to neurobiological studies. In fact, it is because the brain and brain process are complex that it is
even more important to apply methods that allow large numbers of genes to be monitored across a significant number
of experiments. How can we begin to understand the mechanisms underlying various brain functions, and how can we
understand what can and does go wrong in disease? How can such tasks be accomplished without being overly costly and
time- and labor-intensive? We and others have put DNA microarray technology to work to address a variety of biological
problems, and in particular to study the brain and various brain functions. This review provides an overview of how we use
DNA microarray technology to identify the genes that are responsible for specific neurological responses, seizure-induced
responses, and the unique structures and functions of different brain regions.

Introduction how all the various components work together. By

New experimental methods have made it possible to
gain a global view of molecular and cellular events
at the level of transcription. Among the most use-
ful and versatile tools developed for molecular and
cellular studies are high-density D N A arrays that
allow complex mixtures of RNA and DNA to be
interrogated in a highly parallel fashion (Lipshutz et
al., 1995, 1999; Lockhart et al., 1996; Marshall and
Hodgson, 1998; Lockhart, 1999; Lockhart and Bar-
low, 2001). DNA arrays can be employed for many
different purposes, and they have been put to greatest
use to measure gene expression levels (messenger
RNA abundance) for tens of thousands of genes
simultaneously. The goal of these methods is to un-
derstand the underlying workings of the cell, and
combining these technologies with existing genetic
and neurobiological experimentation, it is possible
to broaden the scope of our questions to discover
the genetic determinants that underlie several read-
ily tractable biological phenotypes. We can ask for
example, what genes are important for mediating
resistance and susceptibility to genetic and environ-
mental insults? W h y are specific brain regions and
cell populations more susceptible to damage?
In this review, we provide an overview of the use
of genomic technologies. We discuss how to apply
array-based methods to the study of cells and com-
plex tissue, and describe some special considerations
for applying these methods to the study of the brain.
Global gene expression e x p e r i m e n t s - - an
overview

* Correspondence to: C. Barlow, The Salk Institute for The collection of genes that are expressed or tran-
Biological Studies, The Laboratory of Genetics, 10010 scribed from genomic DNA (often referred to as
North Torrey Pines Road, La Jolla, CA 92037, USA. the transcriptome) is a major determinant of cel-
E-mail: barlow@ salk.edu lular phenotype and function. Differences in gene
150
expression are both responsible for morphological
and phenotypic differences a's well as indicative of
cellular responses to environmental stimuli and per-
turbations. Unlike the genome, the transcriptome is
highly dynamic and changes in response to perturba-
tions. Changes in multi-gene patterns of expression
can provide clues about regulatory mechanisms and
broader cellular functions.
DNA arrays
Nucleic acid arrays have been used successfully to
measure transcript abundance in many different ex-
periments (for a review see Lockhart and Winzeler,
2000). The arrays are passive devices that work by
hybridization of labeled RNA or DNA samples to
DNA molecules attached at specific locations on a
surface. The DNA probes on the surface effectively
'count' the number of molecules of each type by
binding to molecules that contain their complemen-
tary sequence. DNA arrays are generally produced
in one of two basic ways: by deposition of nucleic
acids (PCR products, plasmids, or oligonucleotides)
onto a glass slide, or by in situ synthesis of oligonu-
cleotides using photolithography (Lipshutz et al.,
1999) or by the spatially specific application of reac-
tants. Regardless of how they are made, DNA arrays
are simply large collections of oligonucleotides or
cDNAs (generally 500-1000 bp of double stranded
DNA) at distinct positions on glass, and most of their
uses amount to the counting of different molecules.
In both cases, surface-bound probes are usually cho-
sen from sequences located nearer the 3'-end of the
gene (near the poly-A tail in eukaryotic mRNA),
and different probes can be used for different exons
to enable the detection of variant splice forms. The
monitored genes can be of known or unknown func-
tion; all that is needed to design probes for an array is
at least a couple hundred bases of sequence informa-
tion to design either PCR primers to make cDNAs,
or from which to choose appropriate complementary
oligonucleotides.
There are a number of possible variations on the
basic experimental approach, but the key elements
of parallel hybridization to localized, surface-bound
nucleic acid probes and subsequent detection and
quantification of bound molecules are ubiquitous.
In this review, we will emphasize the use of high-
density arrays of relatively short, specifically chosen,
in situ synthesized DNA oligonucleotides on glass
(often called DNA microarrays, oligonucleotide ar-
rays, Affymetrix GeneChip arrays, or simply 'chips')
and their use for parallel gene expression (mRNA
abundance) measurements (Fodor et al., 1991; Lip-
shutz et al., 1995; Lockhart et al., 1996).
Oligonucleotide arrays (Affymetrix GeneChip
arrays)
The Affymetrix GeneChip arrays are photolitho-
graphically synthesized arrays where ~ 107 copies of
each selected oligonucleotide (usually 25 nucleotides
in length) are synthesized base by base in a highly
parallel, combinatorial synthesis strategy to make
hundreds of thousands of different oligonucleotide
probes in distinct regions on a flat glass surface.
Typically for these arrays, multiple 16-20 probes
(a probe refers to the 25-mer oligonucleotide corre-
sponding to a unique sequence for the gene of inter-
est) per gene are placed on the array (Fig. 1). The
oligonucleotide probes for gene expression measure-
ments are designed directly from gene, gene frag-
ment or EST sequence information. Therefore, for
each RNA, multiple, different, and specific oligonu-
cleotide probes are chosen that are complementary in
sequence to each monitored mRNA. The advantage
of having multiple, different oligonucleotide probes
(non-overlapping if possible, but minimally overlap-
ping if necessary) is that they serve as independent
detectors for the same gene. The use of redundant,
but different probes for each mRNA also increases
both the qualitative and quantitative accuracy of the
results because consistent patterns of hybridization
(or hybridization differences) across probes of differ-
ent sequences for the same gene can be recognized.
The average behavior across the entire probe set can
be used for quantitation rather than relying on the
intensity of only a single detector or 'spot'.
Several unique features are incorporated into
these types of arrays. The high density and unifor-
mity of probe cells on oligonucleotide arrays permit
the building of redundancy as well as a variety of
controls into the design. For example, as mentioned
above, in order to increase confidence and improve
the accuracy of mRNA quantitation, multiple inde-
pendent probes (typically 25-mers) are used to detect
 151

mRNA referencesequence
, ,

,//t' ........ /

~~\Spaced DNA probepairs

Reference sequence
"" TGTGATGGTGGGAATGGGTCAGAA~ACTCCTATGTGGGTGACGAGGCC"'
Z TTACCCAGTCTT}C~3TGAGGATACACCCAC PerfectMatch~lOo
l [_TTACCCAGTCTT~JCTGAG GATACACCCAC MismatchOligo
Perfect match orobecells

\
Mismatch probeceils
Fig. 1. Gene expression probe set layout for oligonucleotide arrays. Multiple oligonucleotide probe sequences near the 3'-end and
complementary to the mRNA of interest are chosen. In a position physically adjacent (below in the schematic) to each perfect match
(PM) probe, is a probe that has a single base difference in the middle (the mismatch, or MM probe). The MM probes serve as specificity
Controls, and allow the discrimination between signals that are due to the specific RNA of interest and those that may be due to
cross-hybridization. The PM probes are chosen based on a measure of sequence uniqueness, expected absence of secondary structure,
and a set of sequence-based selection rules. The probes are not necessarily chosen from equally spaced regions of the transcript, and they
may have some degree of sequence overlap. For quantitation, the PM minus MM signal intensity differences are used because subtracting
the MM signals helps reduce contributions due to background and cross-hybridization. The patterns of hybridization (i.e., the consistency
of PM signals that are larger than MM signals, as expected from specific hybridization of the RNA for which the probes were designed)
are used to make a qualitative assessment of 'Present' or 'Absent' for each probe set (more precisely, 'detectable' and 'not detectable').
The average of the PM-MM values (referred to as the 'average difference'), after discarding outliers, is used to make a quantitative
assessment of RNA abundance. In some newer designs, the multiple PM/MM pairs for each gene are not located next to each other, but
are scattered on the array to minimize effects of spatial variation.

each expressed s e q u e n c e (see Fig. 1). In addition,
each probe is d e s i g n e d to be a 'perfect m a t c h ' (PM)
to a specific region of the expressed target sequence.
In addition, each P M probe is partnered with a single
m i s m a t c h ( M M ) to the target sequence. The M M
probe is synthesized i m m e d i a t e l y adjacent to and
b e l o w its c o r r e s p o n d i n g P M probe, f o r m i n g a series
of P M / M M probe pairs that m a k e up a probe set
(Fig. 1) for each gene or EST. T h e n u m b e r of probe
pairs in each probe set is typically 1 4 - 2 0 , d e p e n d i n g
on the type of array. The M M probes in each set pro-
vide a m e a s u r e for non-specific hybridization, a way
to d e t e r m i n e if the h y b r i d i z a t i o n signal is truly due
to the i n t e n d e d m e s s e n g e r R N A , and is also a conve-
n i e n t way to subtract out the potentially c o n f o u n d i n g
contributions of cross-hybridization and non-specific
b a c k g r o u n d signals. Therefore, the M M probes serve
as internal controls for h y b r i d i z a t i o n specificity, a n d
e n a b l e the effective subtraction of local b a c k g r o u n d
a n d cross-hybridization signals. In addition to the
sets of probes for each gene or E S T (referred to as
the probe set), there are a host of control probes that
are used for grid a l i g n m e n t , spatial n o r m a l i z a t i o n ,
array identification, and for assessments of R N A , ar-
ray and data quality, and overall detection sensitivity
and specificity.
152
Procedural overview
The basic steps, prior to hybridization, for perform-
ing an array-based expression measurement are sim-
ilar to those necessary for any mRNA measure-
ment (e.g., northerns, RT-PCR), and involve the
handling of animals, tissues, cells and RNA. The
exact procedures after total R N A extraction tend
to be more array specific (e.g., cDNA arrays ver-
sus oligonucleotide GeneChip arrays available from
Affymetrix), but the protocols all employ basic
molecular biological techniques and reagents. For
the Affymetrix arrays, the cellular mRNA is usually
amplified (by a factor of 50-200) using a linear in
vitro transcription (IVT) reaction. The IVT reaction
is run in the presence of labeled ribonucleotides to
produce labeled, complementary RNA (cRNA). The
single-stranded cRNA is randomly fragmented to an
average size of 30-50 bases prior to hybridization
to minimize the possible effects of RNA secondary
structure and to enhance hybridization specificity.
Following hybridization (typically overnight at a
temperature of 40-50°C), the sample is recovered
from the hybridization cartridge and saved for future
use (samples can be rehybridized multiple times)
(Lockhart and Barlow, 2001). The arrays are washed
to remove weakly bound molecules and to reduce
background signals and are then 'read' using a spe-
cially designed laser confocal scanner that scans the
entire array in only 5-10 rain at a spatial resolu-
tion of 3 Ixm. This scan produces the raw data file
(the 'image') that is then quantitatively analyzed and
interpreted, as discussed below. The raw data file
(the '.dat' file) for a 1.28 x 1.28 cm array read at
a resolution of 3 Ixm per pixel is approximately 44
MB in size, and the subsequent processed files (the
'.cel' and the '.chp' files) are both about 10 MB in
size. That means that the basic data from a single
experiment requires at least 64 MB of storage. Using
a single scanner, data can be collected as often as
every 10-15 rain.
Tissue dissection and RNA preparation
Several methods exist for obtaining high-quality
RNA from brain tissue. Based on our experience
in studies of the mouse brain, we have found that
animal to animal variation, and variation due to dis-
section can be readily minimized (Sandberg et al.,
2000; Lockhart and Barlow, 2001). It is important
that animals be handled in a systematic and consis-
tent manner prior to obtaining tissue. All animals
are singly housed for 7 days prior to sacrifice. All
euthanasia is performed using cervical dislocation.
We also go so far as to perform all dissections at
specified hours of the day. Dissections are carried
out on petri dishes filled with wet ice. Samples are
dissected and immediately frozen in dry ice and
stored at - 8 0 ° C until RNA is extracted. To prepare
total RNA from the frozen tissue, TRlzol (Gibco-
BRL) is added at approximately 1 ml per 100 mg
tissue and then homogenized (Polytron, Kinematica)
at maximum speed for 2 min. RNA is resuspended
in RNase-free water at a concentration of at least
1 mg/ml. The quality of the total RNA is checked
on an agarose gel (to check the distribution of RNA
lengths) and by an absorption measurement of the
RNA in TE and H20.
Sample preparation
In most current implementations of array-based ap-
proaches, the RNA or DNA to be hybridized must
be labeled prior to the hybridization reaction so that
surface-bound molecules can be fluorescently de-
tected and quantitated. Either RNA or DNA can be
hybridized to arrays, and different methods can be
used to prepare labeled material. We routinely start
with 5-10 ~tg of total RNA for each experiment.
This generally yields between 60 and 100 txg of
labeled cRNA. Approximately 30 Ixg of this cRNA
is used per hybridization. We have found that the
biotin-phycoerythrin labeling yields approximately
10 times as much signal per bound molecule than
when using straight incorporation of fluorescein.
With oligonucleotide arrays, each sample is labeled
identically and hybridized independently to differ-
ent arrays. Signal intensities can then be compared
directly between any individual array experiments.
Array data analysis
Following a quantitative fluorescence scan of a
typical, photolithographically synthesized oligonu-
cleotide array, a grid is aligned to the image using the
known dimensions of the array and the corner and

edge controls (laid out in specific patterns on every
array) as markers. The individual pixels (typically
50-60 per 24 × 24 Ixm synthesis feature - - newer
designs available from Affymetrix use 20 × 20-1xm
features) within each region are averaged (or most
commonly, the 75th percentile pixel intensity value
is used) after systematically eliminating those at the
border and discarding outliers. The details of noise
calculations for each array image, threshold settings,
and the logic of the voting scheme were established
based on extensive quantitative spiking and recon-
struction experiments, and on an assessment of an
acceptable false-positive rate (the false-positive rate
for 'present' calls in any single measurement on an
array is generally less than 1% of all genes monitored
when using standard conditions and default analysis
parameters). The default analysis algorithms exam-
ine the data in a number of ways to generate the final
qualitative and quantitative results. After background
subtraction, normalization or scaling of the data is
generally carried out to equalize the overall signal
intensities across different arrays used in a given set
of experiments. Next, a number of different metrics
are determined for every probe set. Along with the
qualitative assessment of the pattern to make a call of
present or absent, there is a quantitative assessment
to estimate the RNA concentration or abundance.
The determination of quantitative RNA abundance
is calculated from the average of the pairwise PM
minus MM differences, referred to as the 'average
difference', (the quantity shown to be proportional
to RNA concentration) across the set of probes for
each RNA. For example, each probe pair in a set is
checked for specific hybridization performance (PM
vs. MM) to insure reliable detection of the sampled
regions of the transcript above the noise of the assay.
The various metrics are integrated into a call of 'P'
for present, 'N for undetected, and 'M' for marginal
for the transcript or EST cluster represented by the
probe set. Because of the use of multiple, indepen-
dent probes for each gene or EST, it is possible to
use a consistent overall pattern of hybridization to
the PM and MM probes to determine if the signal
is due to the designated transcript. In effect, the set
of probes act as a jury, with each member given a
vote in order to make a qualitative assessment. The
members of the jury must agree to a reasonable ex-
tent (more like a civil trial in which unanimity is not
153
required) in order to make a call of present. In this
way, no single probe in a set has an undue influence,
and this makes the approach much more impervious
to the occasional outlier or strong and unpredictable
cross-hybridization event.
When assessing the differences between two dif-
ferent RNA samples (hybridized independently to
two different arrays), similar logic and criteria are
used, except the primary determinants in this case
are the changes in the individual P M - M M values
across the probe set. Prior to comparing any two
or more measurements, all signal intensities on an
array are multiplied by a factor (a linear 'scaling
factor' in the simplest case) that makes the mean
P M - M M value for any array measurement equal to
a preset value. This simple global scaling process is
designed to correct for any inter-array differences, or
small differences in sample concentration, labeling
efficiency or fluorescence detection, and it appears
to work rather well when experiments are performed
in a consistent fashion (e.g., identical hybridization
and washing conditions, and the same amount of
labeled material hybridized). In the case of a pair-
wise comparison of array results, the patterns of
change (with consistent 'voting') and the magnitude
of the changes are used to make both qualitative
calls of 'Increase' or 'Decrease', and quantitative
assessments of the absolute size (differences in sig-
nal, related to changes in the number of copies per
cell) and the relative size (ratio or 'fold change') of
any differences. These methods for qualitative and
quantitative assessments of mRNA abundance and
differential expression are codified in the standard,
commercially available Affymetrix GeneChip anal-
ysis software. Using this method, messenger RNAs
present at one to a few copies (relative abundance of
1 : 300,000) to thousands of copies per mammalian
cell can be detected (Lockhart et al., 1996; Wodicka
et al., 1997), and changes as subtle as a factor of 1.1
to 2.0, can be reliably detected (although changes of
at least a factor of 1.5 are more routinely trustwor-
thy) if data quality is high and replicate experiments
are performed.
The software integrates the comparisons for every
probe set into a call of 'I' for increase, 'D' for de-
crease, and 'NC' for no change (along with marginal
calls when patterns of change are more ambiguous).
The expression algorithms also produce quantitative
154
results that reflect transcript abundance and relative
changes between compared samples. The quantita-
tive metric, termed average difference, is literally
the average of the P M - M M differences across the
probes in the set. The average difference for a probe
set is calculated as a 'trimmed' mean (e.g. after out-
lier rejection) of the intensity differences (PM-MM)
for each probe pair in the set, and it has the advan-
tage of being automatically background subtracted.
The average difference is useful as a measure of
expression level because it has a nearly linear rela-
tionship with the transcript abundance over a wide
dynamic range of more than three orders of magni-
tude. In addition, an estimate of the relative change,
or fold change, of expression levels is calculated
based on the ratio of the average difference values
between any two experiments (after setting a mini-
mum possible denominator based on the size of the
noise to avoid dividing by zero or values that are not
significantly above the noise).
Because of the richness of the data and the built-
in redundancy (at the level of having both multiple
pixels per feature and multiple features per gene or
EST), there are of course a number of alternative
ways in which data of this type could be assessed.
These issues are being explored by many groups,
with the attainable goal of a significant increase in
the information content per array and data quality
without an increase in the difficulty, expense or time
required for an experiment.
Important considerations
To obtain results with the highest confidence, it is
necessary to perform experiments in a consistent
and careful fashion, and to perform quality control
checks at several points during the experiments. It
is very important to handle animals, tissue and cells
appropriately and to handle total RNA in ways that
minimize degradation. To insure that samples are of
suitable quality before hybridizing them to arrays,
the following procedures are employed:
(1) total RNA is run on a gel to check the size dis-
tribution relative to rRNA bands and by spec-
trophotometer to ensure an OD 260/280 ratio
of greater than or equal to 2.0.
(2) labeled, purified and unfragmented cRNA is
run on a gel to check for the correct size
distribution relative to quality standards, and
the amount of labeled product is quantitated
using a measurement of the absorbance at 260
nm (based on a full absorption spectrum from
220 to 340 nm);
(3) following fragmentation, the labeled cRNA is
run on a low molecular weight gel to check
for a suitable distribution of fragment lengths
(typically between 30 and 50 bases).
Following hybridization of a sample to an array,
collection of an image, and basic image analysis,
data 'triage' is performed to make sure that the array
data are of sufficient quality for further analysis
and comparison with other data sets. For example,
the background, noise, overall signal strength, the
ratio of the 3'- and Y-signals for actin and GAPDH
mRNA (a measure of RNA length and quality - -
degraded RNA will result in high 3'/5' ratios because
only the region of the mRNA near the 3' poly-A tail
will be amplified and labeled), and the percentage of
genes scored as 'present' should be similar between
chips. Typically, we expect to see % Present values
that are within 5% of each other, background and Q
values (Q is a measure of the minimum background
noise across the array image) within a factor of
two of each other, scaling factors (SF) within a
factor of two, and 3'/5' ratios for both actin and
GAPDH of less than 2.0. When experiments meet
these standards for sample and data quality, the
false-positive rate can be expected to be acceptably
low (Lockhart and Barlow, 2001).
The extent of change in expression level for any
gene is commonly given as the 'fold change'. For
example, if the expression level went from 5 to 10
copies per cell, this would be a two-fold change,
5-15 copies per cell, a three-fold change, and so
on. Usually we care most about the relative size of
a change rather than exactly how many copies of
mRNA per cell are found for a given gene, and we
generally would not interpret a change from 5 to
10 copies per cell any differently than we would a
change from 20 to 40 copies. Another reason the
ratio or fold change is used is that with spotted
cDNA arrays, the readout is a ratio of two intensities
at each 'spot' after a competitive hybridization of
two samples labeled with different fluorophores that
emit at different wavelengths (i.e., only the ratio is
interpreted). But a problem arises no matter which

type of array is being used if in one of the two
cases, the mRNA is absent or the level is extremely
low. For example, if the abundance of a transcript
really goes from zero to 10 copies per cell, the fold
change is infinite, and the difference between the
signals is a more appropriate measure than the ratio
and for oligonucleotide arrays the signal difference
has been shown to be quantitatively related to the
change in mRNA abundance. In cases such as this,
the ratio is also likely to be rather variable because it
is difficult to know where to set 'zero' and even if the
transcript abundance is not strictly zero, the signal
is not large relative to the background noise, and
cannot be quantified with any confidence. In both of
these cases, it is typical to have a minimum allowable
value (often set by a measure of the background or
the noise in the signals) for the denominator to avoid
dividing by zero or an unreasonably small and overly
noisy value. When at least one of the two values is
too small, an approximate fold change can be given,
but it must be remembered that it is an approximation
that is completely dependent on the specifics of how
the minimum denominator value was set, and that it
is likely to be an underestimate of the true value.
The importance of well-controlled, replicate
measurements
For high-throughput, parallel measurements, data
quality is of critical importance if one is attempt-
ing to identify with high confidence specific genes
that are differentially expressed. The reason is that
when monitoring, for example, 10,000 genes, even a
low false-positive rate of 1% results in 100 incorrect
difference calls, comparable to the number of true
changes observed in many types of experiments (a
false-positive here is defined as an assignment of a
gene as 'differentially expressed' when in fact the
mRNA abundance is not significantly changed). We
find that when experiments are performed with suffi-
cient care, the source of most of these false-positives
(which are in large part the result of setting the low-
est possible thresholds in the interest of sensitivity)
is random noise, small variations in sample prepara-
tion and other experimental steps, and the occasional
array-specific physical defect. Because these various
factors lead to largely random variations, observa-
tions made consistently in independent replicates
155
can yield a false-positive rate closer to 0.01% (i.e.,
1% of 1% ), or only one false call of 'different'
('increased' or 'decreased') for every 10,000 genes
monitored (Carter et al., 2001; Lockhart and Barlow,
2001).
Analysis of replicate data
To obtain a low false-positive rate, it is important to
use multiple criteria for assessing differences. One
key to obtaining a low false-positive rate is good,
consistent experimental technique while controlling
as much as possible all sources of experimental
variation (e.g., mouse handling, dissection protocols,
tissue handling, RNA extractions, amplification and
labeling reactions, hybridization and washing condi-
tions and array usage). For example, in experiments
done as independent duplicates using cell lines or
different isogenic mice, we typically require that:
(1) the probe set score as 'increased' or 'decreased'
in 2/2 comparisons, and (2) the fold change be at
least 1.8 fold in 2/2 comparison, and (3) the gene
scores as clearly 'present' in at least one of the four
(2 × 2) data sets, and (4) that the difference in the
signal be at least 50 in 2/2 comparisons (in arbitrary
units after scaling the overall intensity to a mean of
200 which corresponds to an RNA abundance in a
mammalian cell of about 3-5 copies per cell - - so
a signal change of 50 corresponds to a change in
mRNA abundance of roughly 1-2 copies per cell).
These specific thresholds are somewhat arbitrary, but
we have found that requiring all of the qualitative
and quantitative criteria be met together makes it so
each of the individual criteria can be fairly permis-
sive while the overall requirements are quite strict.
For example, requiring only a signal change of 50
alone, or a quantitative fold change of at least 1.8
without the other requirements would lead to an
increase in the false-positive rate by more than a
factor of 10. Again, it is important to be cautious
about interpreting a negative result because it is pos-
sible for some genes to miss passing the stringent
set of criteria for being differentially expressed. It
is always possible to reanalyze the data using more
permissive criteria to identify additional genes that
may have changed, but these should be interpreted
with greater caution than those that meet the stricter
criteria. Also, it is straightforward to query the data
156
to examine the behavior of any specific gene or any
chosen set of genes in which one has a particular
interest, apart from whether or not their behavior
meets the global selection criteria.
Verification and follow-up of array-based
observations
Although the array-based expression measurements
can be made highly quantitative and reproducible,
specific genes that are found to be differentially
expressed on arrays should be viewed as high-
probability candidates. Based on our experience and
that of others, we cannot stress strongly enough
the importance of great experimental care, well-
characterized and rigorous analysis, and the need for
appropriate follow-up and verification. When verify-
ing candidates and designing experiments, in almost
all cases, experiments should be performed at least
in duplicate, with replicates performed as indepen-
dently as possible (e.g., different mice or independent
dissections of a region, independent sample prepara-
tions, and independent hybridizations to physically
different arrays). It is not sufficient to merely re-
make samples from the same extracted RNA from
the same mouse or tissue sample, or to simply re-
hybridize samples to additional arrays, as has been
done. If genetically identical, inbred mice are not
used, then it is necessary to perform additional ex-
periments or to pool mice to effectively average out
differences due to genetic inhomogeneity (indepen-
dently pooled samples should be used as replicates).
The same considerations apply when using any other
animal or human tissue.
We routinely use northern blotting and quanti-
tative RT-PCR for selected sets of genes to verify
results and to validate experimental and analytical
methods. In these follow-up experiments, it is im-
portant to use independently prepared samples and
not simply the same RNA that was used for the
array experiments. Independent verification is even
more critical if untested or less stringent analysis
criteria are used, or if extremely subtle expression
differences are to be interpreted. In addition, West-
ern blots can be used to measure corresponding
protein levels, and immunohistochemistry and in situ
hybridization can be very useful to measure cell or
region specificity of proteins and mRNAs to both
confirm and extend the results obtained using mRNA
measurements on arrays.
Finally, global expression measurements should
be considered a starting point for the understanding
of a biological problem, and as a valuable tool for
obtaining information concerning a large number
of genes. These methods should be used in the
context of other types of measurements, knowledge
and information, and it should be understood that
findings will often need to be followed up with
further experiments of various, more conventional
types.
Gene expression profiling in neurobiology
Obviously, the brain is a complex and inhomoge-
neous organ containing a large number of different
regions and cell types. This does not mean, however,
that the brain is too complex to be studied using
these new tools. Instead, what is clear is that extra
care must be taken, experiments need to be designed
with the unique features of the brain in mind, and
that array-based measurements need to be applied in
combination with other methods.
We and others have used these techniques to study
the brain. The next section provides an overview of
specific experiments, with an emphasis on appropri-
ate experimental procedures and the potential use
of the technology for understanding brain function
(Ginsberg et al., 2000; Lee et al., 2000; Mimics et
al., 2000; Sandberg et al., 2000; Carter et al., 2001;
Lockhart and Barlow, 2001).
Transcriptional response to seizure
The molecular response to seizure has been exten-
sively studied. Many of these studies have been
designed to test the transcriptional or signal trans-
duction response of a particular gene or small set of
genes at various timepoints after a seizure. We used
a genomic approach to identify the global changes
in gene expression that occur in response to seizure
(Sandberg et al., 2000). In this study, C57BL/6J
(B6) and 129/SvEvTac (129) male mice at 8 weeks
of age were treated with pentylenetetrazol (PTZ) to
induce seizure. Two animals of each strain which
showed a similar response to seizure were studied
along with control animals to determine the tran-
 157

scriptional response to seizure in the hippocampus

and cerebellum one-hour after seizure induction. Im-
portantly, the experiment successfully detected the
induction of several known immediate-early genes
including members of the fos and jun family, serum
and glucocorticoid-regulated kinase (sgk), growth
factor inducible immediate early gene (3CH134),
cox-2, and the transcription factors KROX20 and
zif/268 verifying that changes are detectable and that
they recapitulate data generated in more traditional
types of studies.
Several questions could be addressed using the Induced
data. For example, what are the differences and sim-
ilarities between the transcriptional response of the
hippocampus and the cerebellum? In this analysis,
the two similar brain regions from the 129 samples
at baseline were c o m p a r e d to the two similar re-
gions from the 129 samples after seizure, and two
B6 samples at baseline were compared to two B6
samples after seizure using pair-wise comparisons.
The number of genes that were changed in the four
pair-wise comparisons for the 129 hippocampus and
for the B6 hippocampus were determined. A similar
analysis was performed on the cerebellar samples.
The number of genes differentially expressed after
seizure were determined by summing the genes that Repressed
were changed in 129 and in B6 using the criteria of Fig. 2. Seizure-induced differential gene expression in the cere-
a 1.8-fold change or greater, an absolute difference bellum and hippocampus of C57BL/6 and 129/SvEv TAC
change (ADC) of >50, and a call of I, MI, D or mice. Gene expression in the hippocampus and cerebellum from
C57BL/6 and 129/SvEvTac mice l h after seizure was com-
MD in three of the four comparison files for each
pared to gene expression from C57BL/6 and 129/SvEvTac mice
strain analyzed independently. As shown in Fig. 2, at baseline. Genes that had a 1.8 or greater fold change increase
84 genes were induced and 19 repressed in the hip- with an ADC in signal intensity of 50 or more were considered
pocampus whereas in the cerebellum, 85 genes were induced (upper panel), whereas genes that had a 1.8 or greater
induced and 32 genes repressed. Of those, 35 genes fold change decrease with an ADC in signal intensity of 50
or more were considered repressed (lower panel). The number
were regulated co-ordinately in both the hippocam-
of genes meeting these criteria in either the hippocampus or
pus and the cerebellum. the cerebellum is indicated in the outer portion of the circles,
Another key feature of the study was the finding whereas the number of genes meeting these criteria that are
of a differential response to seizure between the two expressed in both cerebellum and hippocampus are indicated in
strains. In this analysis of the data, all comparisons the overlapping portion of the circles. The numbers in parenthe-
ses are from a more stringent test in which the genes meeting
were included and the standard criteria had to be met
these criteria were required to have behaved consistently in both
in at least six o f the eight files, thereby ensuring that mouse strains (see text for details of the analysis method used).
the gene was consistently changed in both strains.
The results of this analysis are shown in Fig. 2 as the
numbers in parentheses. As shown, the number of both strains). This difference was largely due to a
genes that changed in both strains was significantly significant increase in the number of genes induced
less (a total of 84 induced in one of the two strains in the B6 hippocampus (49 in C 5 7 B L / 6 c o m p a r e d
versus 54 in both strains and a total of 51 repressed to 12 in 129SvEv, P < 0.001). Interestingly, how-
in one of the two strains versus 12 repressed in ever, the transcriptional response of several known
158
immediate-early genes, including members of thefos
and jun family, serum and glucocorticoid-regulated
kinase (sgk), growth factor inducible immediate early
gene (3CH134), cox-2, and the transcription factors
KROX20 and zif/268 showed a similar level of post-
seizure induction in the two strains (Sandberg et al.,
2000). Therefore, the immediate-early response to
seizure and the response to seizure in the cerebellum
were similar between the two strains whereas the
overall transcriptional response in the hippocampus
was blunted in 129 compared to that in B6.
The complete list of genes as well as the data
used to generate the lists in each of the categories
described above are available at our web site at
http :/ / www.salk.edu/ docs /labs /barlow /brainstrain /.
Brain region specific gene expression
measurements
An important use of region-specific expression stud-
ies is to identify uniquely expressed genes and their
promoters, which can be used to drive expression of
a transgene in specific cell types or tissues in ani-
mal models. The paucity of site-specific tools in the
mouse makes this an important use of the expression
results. In addition, determining which genes are re-
sponsible for the unique structures and functions of
specific brain regions will also prove informative.
Perhaps most importantly, for the case of seizure
induced damage, it will be interesting to identify
genes which are responsible for one sub-region to
be uniquely resistant or sensitive to seizure induced
damage.
We have performed gene expression analysis on
multiple brain regions to begin to address some of
these questions (Sandberg et al., 2000; Lockhart and
Barlow, 2001). Of the 13,069 probe sets analyzed,
7,169 (55%) gave a hybridization signal consistent
with a call of 'present' in at least one brain region.
This indicates that at least 55% of the genes cov-
ered on the murine arrays are detected in one or
more areas of the adult male mouse brain. We next
compared the expression profiles of cortex, cerebel-
lum and midbrain within the same strain and found
that, on average, a relatively small number of genes
(70/13,069 or 0.54%) were expressed in a pattern
suggesting they were highly enriched in or restricted
to a specific brain region. For example, 23 genes
were expressed in the cerebellum that were not de-
tected in other regions, and another 28 were not ex-
pressed in cerebellum but were present in other brain
regions indicating that the cerebellum appears to be
the most unique region of those tested. Importantly,
genes such as PCP-2, a known cerebellar-specific
gene, were identified as being specifically expressed
in the cerebellum, providing further validation of the
approach. In contrast to the cerebellum, the struc-
tures of the medial temporal lobe (hippocampus,
amygdala and entorhinal cortex) showed extremely
similar expression profiles. Only eight genes were
unique to one of the three regions. Of the seven
genes present in hippocampus but not amygdala or
entorhinal cortex, six were also expressed outside
of the medial temporal lobe. There was only one
gene uniquely expressed in the amygdala, and none
in the entorhinal cortex. This suggests that fore-
brain structures, despite some functional differences,
are highly similar at the molecular level. Finally,
the midbrain was interesting in that, although there
were ten genes uniquely expressed, no genes were
exclusively 'absent'. In contrast to the very small
number of differences between brain regions, 13.6%
(1,780/13,069) of the monitored genes were found
to be uniquely expressed between brain and fibro-
blasts, even though the two very different types of
cells express a similar overall number of genes. This
indicates, as might be expected, that various brain
regions are considerably more similar to each other
than to fibroblasts. However, in contrast to the all-
or-none analysis described above, many more genes
showed differential levels of expression at 1.8-fold or
higher between the various brain regions (Lockhart
and Barlow, 2001).
One important point is that these studies com-
pared large brain regions rather than sub-regions or
specific cell types. It may be that differences in gene
expression between various brain regions are much
more pronounced in certain cell types, and that the
high similarity in the expression patterns from dif-
ferent regions is due to averaging over all the cell
types in the tissue. More recently we have begun to
perform analysis on smaller sub-regions of the brain
(Fig. 3). Shown in Fig. 3 is an analysis of the sub-
regions of the hippocampus including the dentate
gyrus, CA1 and CA3 regions. Note that the dentate
gyrus is the most unique of the three regions. Impor-
 159

studying the brain and further our ability to under-

CA1 stand the interplay between genes that give rise to
unique brain functions and complex behaviors.
CA1 &
CA3 43 (23) CA3
CA3
Abbreviations
Dentate
88 (39) 58 (26) 67 (7)
Gyms
129 129/SvEvTac
Fig. 3. Differential gene expression in hippocampal sub-regions. A absent or undetected
The three major subregions of the hippocampus, CAI, CA3 ADC average difference change
and dentate gyms, were compared to each other to determine
the number of genes that differed between these regions. The B6 C57BL/6
number of genes meeting the criteria as described in the text in D decrease
2/2 comparisons between each region is shown. The numbers in I increase
parentheses represent genes meeting these criteria in both mouse IVT in vitro transcription
strains. M marginal
MD marginal decrease
MI marginal increase
tantly, of the 88 genes that were unique between CA 1
MM mismatch
and the dentate gyms, 32 genes are n o t present in
NC no change
CA3 suggesting they are unique to CA1. This exam-
P present or detected
ple suggests that by studying brain regions that are
PM perfect match
uniquely sensitive to specific insults it may be possi-
PTZ pentylenetetrazol
ble to identify genes that are uniquely expressed to
Q noise
determine why a particular region is sensitive or re-
sistant to neurotoxic insults. As it becomes possible
to use this technology for nuclei or even small cell Acknowledgements
populations in the CNS, higher resolution, region-
specific and cell-type specific information will be We would like to thank Cindy Doane for help with
gained. manuscript preparation, David J. Lockhart for con-
tinued advice, Daniel J. Lockhart for the devel-
Summary opment of the gene expression filtering tools and
members of the Barlow laboratory for comments.
This work was supported by grants from the Esther
These highly parallel gene expression approaches al-
A. and Joseph Klingenstein Fund and the Frederick
low one to look globally at the interactions of genes
B. Rentschler Developmental Chair to C.B, and by
and modifiers and their effects, and will greatly en-
the Joe W. and Dorothy Brown Foundation.
hance our ability to identify the genes that contribute
to important phenotypes, and to define the role of
developmental alterations, mutations, and compen- References
satory mechanisms in causing or modifying partic-
ular behaviors. The studies described in this review Carter, T.A., Del Rio, J.A., Greenhall, J.A., Latronica, M.L.,
demonstrate the feasibility and utility of expression Lockhart, D.J. and Barlow, C. (2001) Chipping away at com-
plex behavior: Transcriptome/phenotype correlations in the
profiling in the brain. The expression results serve mouse brain. Physiol. Behav., 73: 849-857.
as a framework to begin to understand, for example, Fodor, S.P.A., Read, J.L., Pirrung, M.C., Stryer, L., Lu, A.T. and
the factors responsible for the variation in behavioral Solas, D. (1991) Light-directed, spatially addressable parallel
phenotypes, drug sensitivity and neurotoxic-induced chemical synthesis. Science, 251: 767-773.
cell death. There is no doubt that the combina- Ginsberg, S.D., Hereby, S.E., Lee, V.M., Eberwine, J.H. and
Trojanowski, J.Q. (2000) Expression profile of transcripts in
tion of gene targeting technology, robust behavioral
Alzheimer's disease tangle-bearing CA1 neurons. Ann. Neu-
analysis, genetics, biochemistry and global gene ex- rol., 48: 77-87.
pression measurements will provide new avenues for Lee, C.K., Weindruch, R. and Prolla, T.A. (2000) Gene-
160
expression profile of the aging brain in mice. Nat. Genet.,
25: 294-297.
Lipshutz, R.J., Morris, D., Chee, M., Hubbell, E., Kozal, M.J.,
Shah, N., Shen, N., Yang, R. and Fodor, S.P. (1995) Us-
ing oligonucleotide probe arrays to access genetic diversity.
Biotechniques, 19: 442-447.
Lipshutz, R.J., Fodor, S.P., Gingeras, T.R. and Lockhart, D.J.
(1999) High density synthetic oligonucleotide arrays. Nat.
Genet., 21: 20-24.
Lockhart, D.J. (1999) The chipping forecast. Nat. Genet. SuppL,
21: 3-50.
Lockhart, D.J. and Barlow, C. (2001) Expressing what's on your
mind: DNA arrays and the brain . Nat. Rev. Neurosci., 2:
63-68.
Lockhart, D.J. and Winzeler, E.A. (2000) Genomics, gene ex-
pression and DNA arrays. Nature, 405: 827-836.
Lockhart, D.J., Dong, H., Byrne, M.C., Follettie, K.T., Gallo,
M.V., Chee, M.S., Mittmann, M., Wang, C., Kobayashi, M.,
Horton, H. and Brown, E.L. (1996) Expression monitoring
by hybridization to high-density oligonucleotide arrays. Nat.
Biotechnol., 14: 1675-1680.
Marshall, A. and Hodgson, J. (1998) DNA chips: an array of
possibilities. Nat. Biotechnol., 16: 27-31.
Mimics, K., Middleton, A.M., Lewis, D.A. and Levitt, P. (2000)
Molecular characterization of schizophrenia viewed by mi-
croarray analysis of gene expression in prefrontal cortex. Neu-
ron, 28: 53-67.
Sandberg, R., Yasuda, R., Pankratz, D.G.° Carter, T.A., Del Rio,
J.A., Wodicka, L., Mayford, M., Lockhart, D.J. and Badow,
C. (2000) From the cover: regional and strain-specific gene
expression mapping in the adult mouse brain. Proc. Natl.
Acad. Sci. USA, 97:11038-11043.
Wodicka, L., Dong, H., Mittmann, M., Ho, M.-H. and Lockhart,
D.J. (1997) Genome-wide expression monitoring in Saccha-
romyces cerevisiae. Nat. Biotechnol., 15: 1359-1367.
T. Sutula and A. Pitkanen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 14

Functional genomics in experimental and human temporal

lobe epilepsy: powerful new tools to identify molecular
disease mechanisms of hippocampal damage

Albert J. Becker *, Otmar D. Wiestler and lngmar Bltimcke

Department of Neuropathology, University of Bonn Medical Center, Bonn, Germany

Abstract: The human genome project is a milestone for molecular genetic studies on complex, sporadic disorders in the
human central nervous system (CNS). Functional analysis and tissue-/cell-specific expression profiles will be of particular
importance anticipating the magnitude of expressed genes in the brain and their dynamic epigenetic modifications.
The recent progress in microarray technologies allows expression studies for a large number of genes. In combination
with laser-microdissection and quantitative reverse transcription-polymerase chain reaction technologies, such large-scale
expression analyses can be successfully addressed in well-defined tissue specimens or cellular subpopulations. Complex,
sporadic diseases, such as temporal lobe epilepsy (TLE), are challenging for functional genomics. Issues of particular
importance in this field include molecular mechanisms of neurodevelopmental abnormalities, neuronal plasticity and
hyperexcitability as well as neuronal cell damage in affected CNS areas. The availability of anatomically well-preserved
surgical specimens, i.e. hippocampus obtained from epilepsy patients with Ammon's horn sclerosis or focal lesions not
affecting the hippocampus proper as well as comparisons with experimental TLE models may help to elucidate specific
molecular-pathological mechanisms during epileptogenesis and in chronic conditions of the disease.

Introduction gest the hippocampal formation to be critically in-

Temporal lobe epilepsy
Epilepsy is a common neurological disorder charac-
terized by recurrent spontaneous seizures that affects
about 2 - 3 % of the population worldwide. A substan-
tial fraction of epileptic patients does not respond to
antiepileptic drug therapy. In most of these patients,
seizures originate in the mesial temporal lobe (Elger
and Schramm, 1993). Several lines of evidence sug-
* Correspondence to: A.J. Becker, Department of Neu-
ropathology, University of Bonn Medical Center,
Sigmund-Freud Str. 25, 53105 Bonn, Germany. Tel.: +49-
228-287-9108; Fax: +49-228-287-4331;
E-mail: albert_becker @uni-bonn.de
volved in temporal lobe epilepsy (TLE): Recordings
from intracerebrally implanted electrodes demon-
strate that the first electrographic abnormalities in
temporal lobe seizures often appear within this struc-
ture (Van Roost et al., 1998). Surgical removal of
the amygdala and hippocampal formation consider-
ably diminishes or abolishes seizures in most phar-
macoresistant TLE patients (Zentner et al., 1995).
TLE pathogenesis involves a variety of developmen-
tal, metabolic and/or hypoxic alterations, while it
lacks significant genetic inheritance (Jackson et al.,
1998). A central question addresses the intriguing
issue whether the alterations observed in the chronic
epileptic state resemble an end stage of the disease
after long-term additive pathophysiological events,
maintenance of an initial etiologic episode or a com-
bination of both. Data from human and experimental
162
TLE suggest that recurrent seizures, but not nec-
essarily status epilepticus, progressively affect the
hippocampal formation (Cavazos et al., 1994; Kalvi-
ainen et al., 1998; Salmenpera et al., 1998). While
numerous molecular genetic alterations of cellular
injury have been identified in hippocampal neurons
following status epilepticus and within epileptoge-
nesis (Lynch et al., 1996; Coulter and DeLorenzo,
1999), molecular pathways associated with neuronal
damage and recurrent brief seizure episodes, i.e.
the chronic state of human TLE, are less character-
ized. With this review we will address the question
whether pathogenetic casades similar to those in-
duced by status epilepticus are active in the chronic
state of TLE and how functional genomics can gain
our understanding of region- and cell-specific epilep-
togenesis. How can such delicate experiments be
successfully applied in human tissue, in particular
since proper controls are, for obvious reasons, not
available?
Neuropathological evaluation of surgical speci-
mens is an important strategy to address this ob-
stacle. The majority of resected mesial temporal
lobe structures can be classified in two groups, i.e.
Ammon's horn sclerosis versus focal lesions not
affecting the hippocampus proper. The compara-
tive analysis between both groups of patients, i.e.
with respect to specific cell types and/or anatomical
regions, may help to identify pathogenetic mecha-
nisms specifically associated with each epileptogenic
lesion.
Ammon's horn sclerosis
Approximately 60% of TLE patients present with
severe unilateral atrophy of either the fight or left
hippocampus (fight/left = 1.08/1, n = 293, data
obtained from the archives of the Department of
Neuropathology, University of Bonn Medical Cen-
ter). Histopathologically, the hippocampal formation
shows segmental neuronal loss in CA1 and CA4,
whereas CA2 and dentate gyms granule cells ap-
pear more resistant (Bliamcke et al., 1999a). Dense
fibrillary astrogliosis and sclerosis of the tissue are
observed in all segments with prominent neuronal
cell loss. This macroscopic aspect has been first
described in 1880 and classified as Ammon's horn
sclerosis (AHS) (Sommer, 1880; Margerison and
Corsellis, 1966). Neuronal cell loss is also observed
in hippocampal segments others than CA1 and CA4
(Kim et al., 1990; BliJmcke et al., 1996b). In the
dentate gyms, specific cytoarchitectural abnormali-
ties have been described in AHS, which may reflect
seizure associated postnatal neurogenesis and persis-
tence of Cajal-Retzius-like interneurons (Bltimcke
et al., 1996a, 1999b, 2001; Nakagawa et al., 2000).
Along with hippocampal cell loss, the entorhinal
cortex and amygdala complex is affected in most
patients (Pitkanen et al., 1998; Yilmazer-Hanke et
al., 2000).
Lesion-associated TLE
A second group, representing approximately 30-
40% of TLE patients exhibit focal lesions within
the temporal lobe, which usually do not involve
the hippocampus proper. This group covers low-
grade glio-neuronal neoplasms, i.e. gangliogliomas
and dysembryoplastic neuroepithelial tumors (DNT),
low-grade astrocytomas and oligodendrogliomas as
well as glio-neuronal malformations, i.e. focal corti-
cal dysplasia (Wolf and Wiestler, 1993; Bltimcke et
al., 1999a). These lesions share predominant local-
ization within the temporal lobe and frequent asso-
ciation with chronic, intractable seizures combined
with benign biological behavior and rare recurrence
after surgical removal. Gangliogliomas and DNTs
are composed of a neoplastic glial and dysplastic
neuronal cell population (Bltimcke et al., 1999a).
Some of these tumors were found together with
a malformative lesion pointing towards a malde-
velopmental origin (Wolf and Wiestler, 1993; Wolf
et al., 1994; Blfimcke et al., 1999a). Recently, a
novel mutation in the TSC2 gene was selectively
detected within the glial component of a gangli-
oglioma suggesting that the glioma portion derives
from clonal evolution (Becker et al., 2001). In con-
trast to the characteristic pattern of neuronal cell loss
in AHS, no significant neuropathological alterations
are observed in the hippocampal formation of lesion-
associated epilepsy (Bltimcke et al., 2000). A small
subgroup of patients presents with dual pathology,
i.e. AHS in addition to focal lesions (Bliamcke et al.,
1999a).

The use of animal models to study functional
genomics of TLE
A major obstacle for the systematic analysis of sur-
gical specimens obtained from patients with phar-
macoresistant TLE is the lack of non-epileptic, age-
matched controls. Comparative analysis between two
groups of TLE patients, i.e. AHS versus lesion-
associated TLE can be applied with respect to
different clinico-pathological features, i.e. extent of
structural changes and duration/severity of seizures.
Rarely, biopsy samples from tumor patients with-
out epileptic seizures can be obtained as truly non-
epileptic controls. Autopsy specimens suffer from
a variable post mortem delay and are therefore not
appropriate for delicate molecular biological studies,
such as mRNA expression analysis.
Another strategy for the evaluation of epilepsy-
associated changes follows the comparison between
human epilepsy tissue and experimental animal mod-
els. In particular, alterations observed in both hu-
man and different experimental models appear more
likely to be of pathogenic relevance (Bltimcke et
al., 2000). Since surgical specimens are usually ob-
tained at a late stage of the disease, experimen-
tal data based on human samples may not allow
to distinguish between primary pathogenetic lesions
and secondary changes. Animal models provide the
possibility to analyze epileptogenesis and epilepsy-
associated structural and molecular changes. As an
example, studies on seizure-induced neuronal apop-
tosis are almost exclusively restricted to animal mod-
els, because terminal deoxynucleotidyl transferase
dUTP nick-end labeling (TUNEL-staining) can be
employed only for a limited time interval after the
excitotoxic event (Tuunanen et al., 1999; Venero
et al., 1999). It is extremely challenging to collect
groups of human surgical specimens within appro-
priate post seizure intervals.
Commonly used animal models for focal limbic
epilepsies are kainate-, pilocarpine- and kindling-
induced chronic seizures (Mello et al., 1993; Ben-Ari
and Cossart, 2000; Sutula, 2001). Induction of status
epilepticus by intracerebral or intraperitoneal injec-
tion of epileptogenic compounds induces delayed
segmental neuronal cell loss in the hippocampal for-
mation. The segmental pattern of cell loss partially
resembles that in human AHS with less severe neu-
163
ronal loss of CA1 in animals. On the other hand,
subconvulsive electrical kindling of the amygdala
or tractus perforans produces sustained hippocampal
seizure activity, which usually results in less signifi-
cant histopathological alterations compared to appli-
cation of epileptogenic compounds (Clusmann et al.,
1992; Bertram and Lothman, 1993). The degree of
histopathological changes also depends on the sever-
ity and frequency of seizures, in particular follow-
ing status epilepticus (Bertram and Lothman, 1993;
Cavazos et al., 1994; Ebert and L/Sscher, 1995).
In summary, different experimental paradigms have
been established with neuropathological changes
similar to TLE patients, i.e. pilocarpine or kainate
injections modeling AHS, whereas kindling asso-
ciated epileptogenesis resembles the epileptogenic
hippocampus in patients with focal lesions.
With increasing availability of transgenic mice
carrying targeted mutations in epilepsy-related can-
didate genes, such models will play a significant
role to study epileptogenesis and epilepsy-associated
structural and molecular alterations. However, it is
pivotal to note that mouse strains bear different sus-
ceptibilities for kainic acid-induced excitotoxic neu-
rodegeneration. With respect to studies on functional
genomics, mouse strain specific mRNA expression
levels as well as developmentally regulated and re-
gionally different gene expression profiles have to be
considered (Schauwecker and Steward, 1997; Wen et
al., 1998; Cantallops and Routtenberg, 2000; Sand-
berg et al., 2000).
Functional genomics of TLE specimens
Microarray technology offers the opportunity to an-
alyze human gene expression profiles on a genome
wide level (Brown and Botstein, 1999; Lipshutz et
al., 1999). In recent years, different expression array
technologies have been developed (Table 1) includ-
ing cDNA nylon arrays (Wellmann et al., 2000),
large-scale oligonucleotide (Lipshutz et al., 1999)
and glass microscope slide DNA arrays (Brown and
Botstein, 1999) (Fig. 1). Besides such large-scale
'chip' approaches, designed arrays and real-time re-
verse transcription-polymerase chain reaction (RT-
PCR) quantification represent useful tools to sub-
stantiate hypothesis based expression studies (Bar-
tosiewicz et al., 2000; Miyajima et al., 2001).
164

~" ~ ' ~ ",-

~'c u.~

• ,, ',; L
,
.~ ~ .'~ 0

0 [-- o ~n

• %'it q,' . "

' . %% • •
. "".~'~,, /~ ~ ~ ~ . ~
•, ~ •~ ", !

8
o6 m

O ] o

~ ~.~ ~.~

E
. m

<
Z ~ ~.~
~ -

e=
. i
i

es
C~ ~ ~
i

tU i
-i Q.
~- E ~ ~
z

E ~ ~ z ~
m
o
OH
e~
E N
mm

0 "~.
0
e~
e~
3:: 0 ~ m

0 ~ m

TABLE 1
Differentexpressionanalysis tools are outlined
Type Approach Scale Label type
Atlas-Array filters inductive low density radioactive
GeneChip microarrays inductive high density fluorescent
cDNA microarrays inductive high density fluorescent
PIQOR inductive low density fluorescent
Real-time RT-PCR deductive low density fluorescent
In-situ hybridization deductive singlegene fluorescent,
radioactive
Major strategies for chip analysis include com-
parisons between identified cell populations, brain
regions or groups of neuropathologically character-
ized individuals (Sandberg et al., 2000). The careful
selection of appropriate controls or matched pairs
of samples plays a pivotal role for expression pro-
filing experiments. Especially when starting from
hippocampal biopsy specimens of pharmacoresistant
TLE patients, there are a number of problems inher-
ent in such an approach. Besides significant expres-
sion differences between human subjects due to in-
dividual genetic background, temporal lobe epilepsy
patients may exhibit considerable heterogeneity with
respect to drug treatment, progression of the disease
and frequency, type and intensity of seizures. These
problems should be addressed by a careful matching
of patient subjects with respect to clinical criteria
and by increasing numbers of studied individuals per
group, for which real-time RT-PCR may provide a
particularly economical method.
In complex, sporadic brain disorders, such as tem-
poral lobe epilepsy a variety of molecular pathways
and genes are involved and differentially regulated
during the long medical history of the disease (Ta-
ble 2) (BRimcke et al., 1999a). The bioinformatic
analysis of large scale or even transcriptome expres-
sion (i.e. the level of each mRNA detectable in the
genome) is a major challenge (Mimics, 2001). Intro-
duction of certain reference or housekeeping genes
enables a systematic comparison between different
sets of experiments, including complex estimations,
such as cluster analysis (Eisen et al., 1998; Bassett
et al., 1999). However, the identification of reliable
housekeeping genes may considerably change with
experimental paradigms as has been shown to be
165
Methodicalfeature System Publication
cDNA,nylon Clontech Wellmann et al. (2000)
oligonucleotide Affymetrix Lipshutz et al. (1999)
cDNA P. Brown Brown and Botstein (1999)
cDNA Memorec
relativequantitation Applera Fink et al. (1998)
oligonucleotides, Lie et al. (2000);
RT-PCRproducts Chen et al. (2001)
relevant for the pilocarpine epilepsy model (Waha et
al., 1998; Chen et al., 2001).
At the present time, a major limitation of microar-
ray technology is the need of sufficient amounts of
region/cell specific mRNA. For the majority of mi-
croarray systems, approximately 50 Izg of total RNA
are recommended for reverse transcription (Duggan
et al., 1999). Due to these amounts of required start-
ing material, such strategies do not provide informa-
tion about cell specific patterns of gene regulation.
Furthermore, certain expression alterations may re-
flect changes in the composition of neuronal tissue,
if pronounced degeneration of specific cell types or
reactive cell infiltration is observed. Such problems
have to be considered for expression studies in TLE
since patients with AHS exhibit segmental neuronal
cell loss, reactive astrogliosis as well as structural
and molecular reorganization in the hippocampal for-
mation (Bltimcke et al., 1999a). Since altered mRNA
levels between hippocampi of patients with AHS and
control individuals may then reflect simply altered
tissue composition, expression array analyses from
TLE tissue have to be supplemented by a detailed
analysis of expression alterations at the cellular level.
Several approaches have been taken to establish
expression analysis with very low amounts of in-
put mRNA including RT-PCR and antisense mRNA
(aRNA) amplification techniques, aRNA amplifica-
tion has been used to generate sufficient amounts
of aRNA for array hybridization starting from in-
dividual cells (Eberwine et al., 1992; Phillips and
Eberwine, 1996; Luo et al., 1999). An advantage
of this approach is the opportunity to screen large
numbers of genes starting from minute amounts of
mRNA. This linear amplification technique may se-
166

TABLE 2
Pathogenic mechanisms potentially involved in TLE

TLE-associated pathomechanism Candidate genes

1 Apoptosis
2 Cytoarchitectural malformations
3 Axonal reorganization
4 Cellular hyperexcitability
5 Gliosis
iNOS, PIN, JIP-1, JNK, c-JUN, caspases, heat shock, ubiquitin, bcl, bax
Reelin, CDK5, p35, TSC1, TSC2
Extracellular matrix molecules and receptors, cadherin, neurotransmitter-receptors
Voltage dependent Ca2+, Na +, K+-channels, neurotransmitter-receptors
Connexins, extracellular matrix molecules and receptors, K+-inward rectifiers

lect for certain populations of mRNAs, a problem
which may be overcome by a novel strategy com-
bining linear amplification and a template switch
effect for microarray probe preparation (Wang et
al., 2000). Compared to these techniques, real-time
RT-PCR allows to monitor reaction dynamics of the
PCR amplification and relative efficiency of target as
well as reference gene amplification for every cycle.
It provides detailed information regarding the linear
dynamic range of the reactions (Fink et al., 1998).
However, RT-PCR will usually be restricted to a
limited number of genes. RT-PCR combined with
laser microdissection (Fink et al., 1998; Schtitze and
Lahr, 1998; Lahr, 2000) of hippocampal subfields
will provide a reproducible tool to confirm and/or
localize differentially regulated genes of interest to
respective hippocampal cell populations. In addition
to the confirmation of differential gene expression
levels with RT-PCR, experimental errors introduced
by false annotation of spotted sequences have to be
controlled (Knight, 2001). These obstacles underline
the need for alternative strategies to analyze expres-
sion profiles and to confirm their regional and cel-
lular origin. Large-scale expression studies offer the
unique opportunity to identify novel pathways poten-
tially involved in sporadic diseases, such as TLE and
AHS. It is important to note that the choice of the
expression-monitoring tool, i.e. real-time RT-PCR
or microarrays, strongly influences the experimental
design. Simultaneous, transcriptome wide expression
analysis describes an inductive approach. Expression
profiles are compared between a variety of physio-
logical and/or pathophysiological states. The result
is an indefinite number of differentially expressed
genes, which is used to build up a hypothesis for
further experiments. However, for certain genes, it
might be difficult to transfer differential expression
into functional consequences. Using a deductive or
'top down' approach, expression analysis of a lim-
ited number of genes requires a certain hypothesis to
be verified or disproven (Bassett et al., 1999).
Molecular pathways of seizure-induced
hippocampal damage
Necrosis and apoptosis have been shown as two in-
dependent pathways of excitotoxic neuronal damage
(Ankarcrona et al., 1995; Van Lookeren Campagne
et al., 1995). While necrosis results from cellu-
lar swelling, bursting and lysis, apoptosis follows
a programmed mode of active cellular degeneration
(Nicotera et al., 1997). Hippocampal apoptosis has
been described in several epilepsy models. Follow-
ing pilocarpine and kainate-induced status epilepti-
cus, neuronal apoptosis is pronounced in CA3 and
CA1 neurons, whereas dentate gyrus granule cells
are more resistant (Mello et al., 1993; Ben-Ari and
Cossart, 2000). The molecular pathogenesis of neu-
ronal apoptosis has been associated with a glutamate
receptor-mediated pronounced intracellular Ca 2+ in-
crease (Choi, 1987; Wahlestedt et al., 1993). Sub-
sequently, excitotoxicity proceeds via stimulation
of various intracellular signaling cascades includ-
ing the c-Jun amino-terminal kinase (JNK) group
of mitogen-activated protein kinases (Gupta et al.,
1996; Martin et al., 1996; Kawasaki et al., 1997;
Schwarzschild et al., 1997) and the formation of
nitric oxide (NO) with caspase-mediated apoptosis
(Bruno et al., 1993; Leist et al., 1997; Montecot et
al., 1998). Mice with a targeted mutation of the JNK3
isoform selectively expressed in the nervous system
show an increased resistance to kainic acid-induced
cell loss (Yang et al., 1997). Kainate-induced ex-
pression of JNK-1 relates to increased apoptosis in
hippocampal neurons, while serine-73 phosphoryla-
tion of c-Jun is associated with resistance to cell

death (Schauwecker, 2000). In the kainate model,
an inverse correlation is observed between the hip-
pocampal distribution of kainic acid receptors and
the pattern of neuronal cell loss, i.e. low receptor
density in the highly vulnerable segment CA1 and
vice versa in the dentate gyrus (Sperk et al., 1983).
A striking relationship occurs between expression of
the endogenous protein inhibitor of neuronal nitric
oxide synthase (PIN), a cytoplasmic inhibitor of the
JNK signal transduction pathway designated JNK
interacting protein-1 (JIP-1) and the gene for the
apoptosis-executing protease caspase-3 to patterns
of hippocampal vulnerability after kainate-induced
seizures (Dickens et al., 1997; Jaffrey and Snyder,
1996; Becker et al., 1999). In the dentate gyrus, no
delayed cell loss is observed although high kainate
receptor densities are encountered in this area (Sperk
et al., 1983). Here, PIN and JIP-1 mRNA signals
increase significantly, whereas caspase-3 expression
remains at basal levels. In CA1 with extensive neu-
ronal cell loss and low kainate receptor density,
weaker expression of JIP-1 and PIN vs. induction
of caspase-3 are observed compared to the dentate
gyrus (Sperk et al., 1983; Becker et al., 1999). This
selective regulation may serve as example for the
capacity of downstream apoptotic signaling cascades
to interfere with excitotoxic apoptotic stimuli in dif-
ferent hippocampal subfields. Functional pathways
involved in seizure-associated apoptosis include ex-
pression of the TP53 tumor suppressor (Sakhi et al.,
1994; Liu et al., 1999) and the tissue plasminogen
activator gene (Tsirka et al., 1995). Certain lines
of evidence suggest that single intermittent seizures,
resembling the chronic state of TLE, induce apop-
tosis. Severe neuronal cell loss is observed after
repeated kindling seizures (Cavazos et al., 1994).
Also, apoptosis occurs in the dentate gyrus following
intermittent kindling stimulation in the ventral CA1
region (Bengzon et al., 1997). There is evidence that
a limited number of brief repeated kindling seizures
do not alter total amygdaloid or hilar neuronal cell
numbers, but may induce degeneration of certain
neuronal subpopulations (Pretel et al., 1997; Tuu-
nanen et al., 1997; Tuunanen and Pitkiinen, 2000).
However, novel data suggest that neurodegenerative
pathways in the chronic TLE state may be similar
to those which occur early during TLE pathogene-
sis. Expression of bcl-2, bcl-xL, bax, caspase-3 and
167
caspase-1 proteins shows alterations in resected tem-
poral lobe structures from patients with long-term
pharmacoresistant TLE (Henshall et al., 2000). The
molecular signals predisposing hippocampal neurons
to enhanced or reduced susceptibility for seizure-
induced damage in the chronic TLE state have not
yet been fully characterized. Potential candidates
include a variety of ionotropic and metabotropic
neurotransmitter receptors.
Neurodegeneration or neuroprotection: role of
neurotransmitter receptors
Several lines of evidence suggest that recurrent spon-
taneous seizures in human as well as experimen-
tal chronic TLE are caused by alterations in the
balance between inhibitory and excitatory neuro-
transmitter systems (Meldrum et al., 1999; Ben-Aft
and Cossart, 2000; Chapman, 2000; Kullmann et
al., 2000). Changes in neurotransmitter receptor ex-
pression, subunit composition and their functional
consequences may not only contribute to enhanced
seizure susceptibility but also predispose or pro-
tect neuronal cells for/from cellular damage. This
has been demonstrated for excitatory ionotropic and
metabotropic glutamate receptors as well as for in-
hibitory ionotropic GABAA receptor pathways (Ja-
cobs et al., 2000; Meldrum, 2000; Coulter, 2001).
With respect to epilepsy-associated neuronal dam-
age, neuroprotection as well as novel pharmacolog-
ical treatment strategies, metabotropic glutamate re-
ceptors (mGluRs) have emerged as interesting target
molecules. The mGluR family consists of at least 8
different subtypes (Nicoletti et al., 1996). Activation
of class I mGluRs (i.e. mGluR1 and mGluR5) results
in excitatory membrane depolarization followed by
release of Ca 2+ from intracellular stores, which ap-
pears to be mediated by inositol phosphate hydrol-
ysis. Class II (mGluR2 and mGluR3) and class III
(mGluR4, mGluR6-8) mGluRs operate mainly via
a G-protein-mediated inhibition of adenylate cyclase
(Nicoletti et al., 1996). Immunohistochemical stud-
ies and in-situ hybridization revealed distinct pre-
or postsynaptic localization of mGluR isoforms in
rat (Baude et al., 1993; Shigemoto et al., 1997) and
human hippocampus (Bliimcke et al., 1996c; Lie et
al., 2000). Recent molecular, pharmacological and
physiological data point to a role for specific mGluR
168
subtypes in the generation and propagation of epilep-
tiform activity (Mayat et al., 1994; Attwell et al.,
1995; Holmes et al., 1996; Aronica et al., 1997; Mer-
lin et al., 1998). In particular, agonists of excitatory
class I mGluRs exert significant convulsant proper-
ties, whereas class I antagonists can prevent excito-
toxic neuronal damage (Mukhin et al., 1996; Strasser
et al., 1998; O'Leary et al., 2000). Furthermore,
kainate and kindling models revealed enhanced ex-
pression of class I mGluRs as well as increased
phosphoinositide hydrolysis (Nicoletti et al., 1987;
Akbar et al., 1996). Expression alterations of exci-
tatory class I (mGluR1 and mGluR5) and inhibitory
class III (mGluR4) metabotropic glutamate receptors
were observed in chronic TLE. mRNA expression
and protein distribution analysis of mGluR1 and
mGluR5 revealed a striking induction of mGluRlc~
in the hippocampal dentate gyms with an almost
identical regional distribution in kainic acid-treated
and amygdala-kindled, chronic epileptic animals as
well as in human TLE specimens (Bltimcke et al.,
2000). This expression alteration may significantly
predispose cells with enhanced mGluRlc~ expres-
sion to neuronal excitability. An opposite functional
effect may be the result of regional and cellular in-
duction of the mGluR4 subtype in chronic TLE. In
contrast to control hippocampus obtained from non-
epileptic controls, i.e. patients suffering from diffuse
infiltrating malignant gliomas, most TLE specimens
showed a significant increase of mGluR4 protein
and mRNA expression within the dentate gyms and
residual CA4 neurons (Lie et al., 2000). With respect
to a neuroprotective potential of mGluR4 in various
cell culture models, mGluR4 induction may consti-
tute a cellular mechanism to antagonize excitatory
hippocampal activity and critical intracellular Ca 2+
overload (Gasparini et al., 1999; Bruno et al., 2000).
In the pilocarpine animal model, the acute sta-
tus epilepticus is frequently followed by a silent
period of weeks before chronic spontaneous limbic
seizures occur (Coulter, 2000). In the hippocampus,
sprouting of zinc containing mossy fibers can be
observed during this adaptation phase (Cavazos et
al., 1991; Mello et al., 1993). GABAA receptors of
dentate gyms granule cells show enhanced sensitiv-
ity to blockade by zinc in chronic TLE. Expression
profiling of single cells and functional analysis re-
vealed major alterations in subunit composition of
the GABAA receptor (Brooks-Kayal et al., 1998).
The enhanced sensitivity of dentate gyms granule
cell GABAA receptors to blockade by zinc in chronic
TLE may be due to decreased expression of the
c~l subunit of the GABAA receptor. The combina-
tion of increased zinc sensitive GABAA receptors
and sprouted zinc-containing mossy fiber terminals
may result in a failure of inhibition and concomitant
enhanced seizure propensity triggering chronic TLE
and cellular damage (Brooks-Kayal et al., 1998).
Enhanced potency of GABA in activating GABAA
receptors as well as reduced c~2 and c~5 GABA
subunit expression in CA1 and additional changes
in subunit expression in other hippocampal neurons
have also been described using a combined approach
of expression arrays and electrophysiology (Rice et
al., 1996; Gibbs et al., 1997; Becker et al., 1998;
Coulter, 1999; Coulter and DeLorenzo, 1999).
Perspectives for functional genomics in human
TLE
The plethora of functional cascades involved in the
pathogenesis of chronic TLE is a challenging fea-
ture of this complex, sporadic disease. With the
opportunity to study large-scale gene expression us-
ing novel microarray technologies, we may discover
novel pathways of TLE associated hyperexcitability,
neuronal damage or functional/stmctural plasticity.
Due to the complexity of human TLE tissue, TLE an-
imal models and the expression array data, epilepsy
researchers using array technology would benefit
from intemet platforms for functional genomics pro-
viding access to brief annotations of specific genes
as well as links to known biochemical pathways and
interactions at the transcriptional level to verify and
extend their observations. Currently, experimental
conditions and potential problems of expression data
are discussed intensively (Geschwind, 2001; Lock-
hart and Barlow, 2001) and first internet platforms
for expression array data such as Gene Expression
Omnibus (GEO) and ArrayExpress are established.
Uniform expression data formats and integrated anal-
ysis tools will also be essential for a successful appli-
cation of a functional genomics approach in human
and experimental TLE.

Acknowledgements
T h e authors thank S. N o r m a n n for e x c e l l e n t techni-
cal assistance. W e like to a c k n o w l e d g e the grateful
support and contribution of our clinical c o l l e a g u e s
Profs. E l g e r and S c h r a m m to the interdisciplinary
e p i l e p s y p r o g r a m . Our w o r k is g e n e r o u s l y supported
by D e u t s c h e F o r s c h u n g s g e m e i n s c h a f t ( S F B - T R 3 ) ,
B M B F ( G e n o m i c N e t w o r k s , S P l l ) and the B O N -
F O R p r o g r a m o f the U n i v e r s i t y of B o n n M e d i c a l
Center.
References
Akbar, M.T., Rattray, M., Powell, J.F. and Meldrum, B.S. (1996)
Altered expression of group I metabotropic glutamate recep-
tors in the hippocampus of amygdala-kindled rats. Mol. Brain
Res., 43(1-2): 105-116.
Ankarcrona, M., Dypbukt, J.M., Bonfoco, E., Zhivotovsky, B.,
Orrenius, S., Lipton, S.A. and Nicotera, R (1995) Glutamate-
induced neuronal death: a succession of necrosis or apoptosis
depending on mitochondftal function. Neuron, 15(4): 961-
973.
Aronica, E.M., Gorter, J.A., Paupard, M.C., Grooms, S.Y., Ben-
nett, M.V. and Zukin, R.S. (1997) Status epilepticus-induced
alterations in metabotropic glutamate receptor expression in
young and adult rats. J. Neurosci., 17(21): 8588-8595.
Attwell, R, Kaura, S., Sigala, G., Bradford, H.F., Croucher,
M.J., Jane, D.E. and Watkins, J.C. (1995) Blockade of both
epileptogenesis and glutamate release by (lS,3S)-ACPD, a
presynaptic glutamate receptor agonist. Brain Res., 698(1-2):
155-162.
Bartosiewicz, M., Trounstine, M., Barker, D., Johnston, R. and
Buckpitt, A. (2000) Development of a toxicological gene array
and quantitative assessment of this technology. Arch. Biochem.
Biophys., 376(1): 66-73.
Bassett, D.E., Eisen, M.B. and Boguski, M.S. (1999) Gene
expression informatics--it's all in your mine. Nat. Genet., 21:
51-55.
Baude, A., Nusser, Z., Roberts, J.D., Mulvihill, E., Mcllhin-
ney, R.A. and Somogyi, P. (1993) The metabotropic glutamate
receptor (mGluR1 alpha) is concentrated at perisynaptic mem-
brane of neuronal subpopulations as detected by immunogold
reaction. Neuron, 11(4): 771-787.
Becket, A.J., Rikhter, T.Y., Bl0mcke, I., Wiestler, O.D. and
Coulter, D.A. (1998) Alterations of GABAA receptor sub-
unit mRNA expression in the hippocampal CA3 region of
pilocarpine-treated rats [Abstract]. Epilepsia, 39(Suppl. 6):
11-12.
Becker, A.J., Gillardon, F., Bltimcke, I., Langendorfer, D.,
Beck, H. and Wiestler, O.D. (1999) Differential regulation
of apoptosis-related genes in resistant and vulnerable subfields
of the rat epileptic hippocampus. Mol. Brain Res., 67(1): 172-
176.
169
Becker, AJ., Ltibach, M., Klein, H., Normann, S., Ntithen, M.M.,
von Deimling, A., Mizuguchi, M., Elger, C.E., Schramm, J.,
Wiestler, O.D. and Bltimcke, I. (2001) Mutational analysis of
TSCI and TSC2 genes in gangliogliomas. Neuropathol. Appl.
NeurobioL, 27: 105-114.
Ben-Aft, Y. and Cossart, R. (2000) Kainate, a double agent that
generates seizures: two decades of progress. Trends Neurosci..
23(11): 580-587.
Bengzon, J., Kokaia, Z., Elmer, E., Nanobashvili, A., Kokaia, M.
and Lindvall, O. (1997) Apoptosis and proliferation of dentate
gyrus neurons after single and intermittent limbic seizures.
Proc. Natl. Acad. Sci. USA, 94(19): 10432-10437.
Bertram, E.H.D. and Lothman, E.W. (1993) Morphometric ef-
fects of intermittent kindled seizures and limbic status epilep-
ticus in the dentate gyrus of the rat. Brain Res., 603(1): 25-
31.
Bltimcke, I., Beck, H., Nitsch, R., Eickhoff, C., Scheffler, B., Ce-
lio, M.R., Schramm, J., Elger, C.E., Wolf, H.K. and Wiestler,
O.D. (1996a) Preservation of calretinin-immunoreactive neu-
rons in the hippocampus of epilepsy patients with Ammon's
horn sclerosis. J. Neuropathol. Exp. Neurol., 55(3): 329-341.
Bltimcke, I., Beck, H., Scheffler, B., Hof, P.R., Morrison, J.H.,
Wolf, H.K., Schramm, J., Elger, C.E. and Wiestler, O.D.
(1996b) Altered distribution of the alpha-amino-3-hydroxy-5-
methyl-4-isoxazole propionate receptor subunit GluR2(4) and
the N-methyl-D-aspartate receptor subunit NMDARI in the
hippocampus of patients with temporal lobe epilepsy. Acta
Neuropathol. (Berl. ), 92(6): 576-587.
Bltimcke, I., Behle, K., Malitschek, B., Kuhn, R., Kn6pfel, T.,
Wolf, H.K. and Wiestler, O.D. (1996c) Immunohistochemi-
cal distribution of metabotropic glutamate receptor subtypes
mGluRlb, mGluR2/3, mGluR4a and mGluR5 in human hip-
pocampus. Brain Res., 736(1-2): 217-226.
Bltimcke, I., Beck, H., Lie, A.A. and Wiestler, O.D. (1999a)
Molecular neuropathology of human mesial temporal lobe
epilepsy. Epilepsy Res., 36(2-3): 205-223.
Bltimcke, I., Zuschratter, W., Schewe, J.C., Suter, B., Lie, A.A.,
Riederer, B.M., Meyer, B., Schramm, J., Elger, C.E. and
Wiestler, O.D. (1999b) Cellular pathology of hilar neurons in
Ammon's horn sclerosis. J. Comp. Neurol., 414: 437-453.
Bltimcke, I., Becker, A.J., Klein, C., Scheiwe, C., Lie, A.A.,
Beck, H., Waha, A., Friedel, M., Kuhn, R., Emson, P., EI-
ger, C. and Wiestler, O.D. (2000) Temporal lobe epilepsy
associated up-regulation of metabotropic glutamate receptors:
correlated changes in mGluR1 mRNA and protein expression
in experimental animals and human patients. J. Neuropathol.
Exp. Neurol., 59(I): 1-10.
Bltimcke, I., Schewe, J.C., Normann, S., Brtistle, O., Schranma,
J., Elger, C.E. and Wiestler, O.D. (2001) Increase of nestin-
immunoreactive cells in the dentate gyrus of pediatric patients
with early onset temporal lobe epilepsy. Hippocampus, 11(3):
311-321.
Brooks-Kayal, A.R., Shumate, M.D., Jin, H., Lin, D.D., Rikhter,
T.Y. and Coulter, D.A. (1998) Selective changes in single
GABA(A) receptor subunit expression and function in tempo-
ral lobe epilepsy. Nat. Med., 4(10): 1166-1172.
170
Brown, EO. and Botstein, D. (1999) Exploring the new world of
the genome with DNA microarrays. Nat. Genet., 21(1): 33-37.
Bruno, V., Scapagnini, U. and Canonico, EL. (1993) Excitatory
amino acids and neurotoxicity. Funct. Neurol., 8(4): 279-292.
Bruno, V., Battaglia, G., Ksiazek, I., van der Putten, H., Catania,
M.V., Giuffrida, R., Lukic, S., Leonhardt, T., Inderbitzin, W.,
Gasparini, E, Kuhn, R., Hampson, D.R., Nicoletti, E and
Flor, EJ. (2000) Selective activation of mGlu4 metabotropic
glutamate receptors is protective against excitotoxic neuronal
death. J. Neurosci., 20(17): 6413-6420.
Cantallops, I. and Routtenberg, A. (2000) Kainic acid induc-
tion of mossy fiber sprouting: dependence on mouse strain.
Hippocampus, 10(3): 269-273.
Cavazos, J.E., Golarai, G. and Sutula, T.E (1991) Mossy fiber
synaptic reorganization induced by kindling: time course
of development, progression, and permanence. J. Neurosci.,
11(9): 2795-2803.
Cavazos, J.E., Das, I. and Sutula, T.P. (1994) Neuronal loss
induced in limbic pathways by kindling: evidence for induc-
tion of hippocampal sclerosis by repeated brief seizures. J.
Neurosci., 14: 3106-3121.
Chapman, A.G. (2000) Glutamate and epilepsy. J. Nutr., 130(4S
Suppl.): 1043-1045.
Chen, J., Sochivko, D., Beck, H., Marechal, D., Wiestler, O.D.
and Becker, A.J. (2001) Activity-induced expression of com-
mon reference genes in individual CNS neurons. Lab. Invest.,
81(6): 913-916.
Choi, D.W. (1987) Ionic dependence of glutamate neurotoxicity.
J. Neurosci., 7(2): 369-379.
Clusmann, H., Stabel, J., Stephens, D.N. and Heinemann, U.
(1992) Alterations in medial perforant path and mossy fiber
induced field potentials in amygdala and beta-carboline (FG
7142) kindled rats. Neurosci. Lett., 146(1): 65-68.
Coulter, D.A. (1999) Chronic epileptogenic cellular alterations in
the limbic system after status epilepticus. Epilepsia, 40(Suppl
1): 23-33.
Coulter, D.A. (2000) Mossy fiber zinc and temporal lobe
epilepsy: pathological association with altered garnma-
aminobutyric acid A receptors in dentate granule cells. Epilep-
sia, 41(Suppl 6): 96-99.
Coulter, D.A. (2001) Epilepsy-associated plasticity in gamma-
aminobutyric acid receptor expression, function, and inhibitory
synaptic properties. Int. Rev. Neurobiol., 45(6): 237-252.
Coulter, D.A. and DeLorenzo, R.J. (1999) Basic mechanisms of
status epilepticus. Adv. Neurol., 79(4): 725-733.
Dickens, M., Rogers, J.S., Cavanagh, J., Raitano, A., Xia, Z.,
Halpern, J.R., Greenberg, M.E., Sawyers, C.L. and Davis, R.J.
(1997) A cytoplasmic inhibitor of the JNK signal transduction
pathway. Science, 277(5326): 693-696.
Duggan, D.J., Bittner, M., Chen, Y., Meltzer, P. and Trent, J.M.
(1999) Expression profiling using cDNA microarrays. Nat.
Genet., 21(1): 10-14.
Ebert, U. and L/~scher, W. (1995) Differences in mossy fibre
sprouting during conventional and rapid amygdala kindling of
the rat. Neurosci. Lett., 190(3): 199-202.
Eberwine, J., Yeh, H., Miyashiro, K., Cao, Y., Nair, S., Finnell,
R., Zettel, M. and Coleman, P. (1992) Analysis of gene ex-
pression in single live neurons. Proc. Natl. Acad. Sci. USA,
89(7): 3010-3014.
Eisen, M.B., Spellman, ET., Brown, P.O. and Botstein, D. (1998)
Cluster analysis and display of genome-wide expression pat-
terns. Proc. Natl. Acad. Sci. USA, 95(25): 14863-14868.
Elger, C.E. and Schramm, J. (1993) The surgical treatment of
epilepsy. Radiologe, 33(4): 165-171.
Fink, L., Seeger, W., Ermert, L., Hanze, J., Stahl, U., Grim-
minger, F., Kummer, W. and Bohle, R.M. (1998) Real-time
quantitative RT-PCR after laser-assisted cell picking. Nat.
Med., 4(11): 1329-1333.
Gasparini, E, Bruno, V., Battaglia, G., Lukic, S., Leonhardt,
T., Inderbitzin, W., Laurie, D., Sommer, B., Varney, M.A.,
Hess, S.D., Johnson, E.C., Kuhn, R., Urwyler, S., Saner, D.,
Portet, C., Schmutz, M., Nicoletti, E and Flor, P.J. (1999)
(R,S)-4-phosphonophenylglycine, a potent and selective group
III metabotropic glutamate receptor agonist, is anticonvulsive
and neuroprotective in vivo. J. Pharmacol. Exp. Ther., 289(3):
1678-1687.
Geschwind, D.H. (2001) Sharing gene expression data: an array
of options. Nat. Rev. Neurosci., 2(6): 435-438.
Gibbs, J.W.I., Shumate, M.D. and Coulter, D.A. (1997) Differen-
tial epilepsy-associated alterations in postsynaptic GABA(A)
receptor function in dentate granule and CA1 neurons. J.
Neurophysiol., 77(4): 1924-1938.
Gupta, S., Barrett, T., Whitmarsh, A.J., Cavanagh, J., Sluss,
H.K., Derijard, B. and Davis, R.J. (1996) Selective interaction
of JNK protein kinase isoforms with transcription factors.
EMBO J., 15(11): 2760-2770.
Henshall, D.C., Clark, R.S., Adelson, P.D., Chen, M., Watkins,
S.C. and Simon, R.E (2000) Alterations in bcl-2 and cas-
pase gene family protein expression in human temporal lobe
epilepsy. Neurology, 55(2): 250-257.
Holmes, K.H., Keele, N.B. and Shinnick-Gallagher, P. (1996)
Loss of mGluR-mediated hyperpolarizations and increase
in mGluR depolarizations in basolateral amygdala neurons
in kindling-induced epilepsy. J. Neurophysiol., 76(4): 2808-
2812.
Jackson, G.D., Mclntosh, A.M., Briellmann, R.S. and Berkovic,
S.E (1998) Hippocampal sclerosis studied in identical twins.
Neurology, 51(1): 78-84.
Jacobs, K.M., Graber, K.D., Kharazia, V.N., Parada, 1. and
Prince, D.A. (2000) Postlesional epilepsy: the ultimate brain
plasticity. Epilepsia, 41(Suppl 6): 153-161.
Jaffrey, S.R. and Snyder, S.H. (1996) PIN: an associated pro-
tein inhibitor of neuronal nitric oxide synthase. Science,
274(5288): 774-777.
Kalviainen, R., Salmenpera, T., Partanen, K., Vainio, P., Riekki-
nen, E and Pitkanen, A. (1998) Recurrent seizures may cause
hippocampal damage in temporal lobe epilepsy. Neurology,
50(5): 1377-1382.
Kawasaki, H., Morooka, T., Shimohama, S., Kimura, J., Hirano,
T., Gotoh, Y. and Nishida, E. (1997) Activation and involve-
ment of p38 mitogen-activated protein kinase in glutamate-
induced apoptosis in rat cerebellar granule cells. J. Biol.
Chem., 272(30): 18518-18521.
Kim, J.H., Guimareas, P.O., Shen, M.Y., Masukawa, L.M. and

Spencer, D.D. (1990) Hippocampal neuronal density in tempo-
ral lobe epilepsy with and without gliomas. Acta Neuropathol.,
80: 41-45.
Knight, J. (2001) When the chips are down. Nature, 410(6831):
860-861.
Kullmann, D.M., Asztely, F. and Walker, M.C. (2000) The role
of mammalian ionotropic receptors in synaptic plasticity: LTP,
LTD and epilepsy. Cell. Mol. Life. Sci., 57(11): 1551-1561.
Lahr, G. (2000) RT-PCR from archival single cells is a suit-
able method to analyze specific gene expression. Lab. Invest.,
80(9): 1477-1479.
Leist, M., Volbracht, C., Kuhnle, S., Fava, E., Ferrando-May,
E. and Nicotera, P. (1997) Caspase-mediated apoptosis in
neuronal excitotoxicity triggered by nitric oxide. Mol. Med.,
3(11): 750-764.
Lie, A.A., Becket, A., Behle, K., Beck, H., Malitschek, B.,
Conn, P.J., Kuhn, R., Nitsch, R., Plaschke, M., Schramm,
J., Elger, C.E., Wiestler, O.D. and BRimcke, I. (2000) Up-
regulation of the metabotropic glutamate receptor mGluR4 in
hippocampal neurons with reduced seizure vulnerability. Ann.
Neurol., 47(1): 26-35.
Lipshutz, R.J., Fodor, S.P., Gingeras, T.R. and Lockhart, D.J.
(1999) High density synthetic oligonucleotide arrays. Nat.
Genet., 21(1): 20-24.
Liu, W., Rong, Y., Baudry, M. and Schreiber, S.S. (1999) Status
epilepticus induces p53 sequence-specific DNA binding in
mature rat brain. Mol. Brain Res., 63(2): 248-253.
Lockhart, D.J. and Barlow, C. (2001) Expressing what's on your
mind: DNA arrays and the brain. Nat. Rev. Neurosci., 2(1):
63-68.
Luo, L., Salunga, R.C., Guo, H., Bitmer, A., Joy, K.C., Galindo,
J.E., Xiao, H., Rogers, K.E., Wan, J.S., Jackson, M.R. and Er-
lander, M.G. (1999) Gene expression profiles of laser-captured
adjacent neuronal subtypes. Nat. Med., 5(1): 117-122.
Lynch, M.W., Rutecki, P.A. and Sutula, T.P. (1996) The effects
of seizures on the brain. Curr. Opin. Neurol., 9(2): 97-102.
Margerison, J.H. and Corsellis, J.A.N. (1966) Epilepsy and the
temporal lobes: A clinical, electroencephalographic and neu-
ropathological study of the brain in epilepsy, with particular
reference to the temporal lobes. Brain, 89: 499-530.
Martin, J.H., Mohit, A.A. and Miller, C.A. (1996) Developmental
expression in the mouse nervous system of the p493F12 SAP
kinase. Mol. Brain Res., 35(1-2): 47-57.
Mayat, E., Lerner Natoli, M., Rondouin, G., Lebrun, E, Sassetti,
I. and Reasens, M. (1994) Kainate-induced status epilepti-
cus leads to a delayed increase in various specific glutamate
metabotropic receptor responses in the hippocampus. Brain
Res., 645(1-2): 186-200.
Meldrum, B.S. (2000) Glutamate as a neurotransmitter in the
brain: review of physiology and pathology. J. Nutr., 130(4S
Suppl.): 1007-1015.
Meldrum, B.S., Akbar, M.T. and Chapman, A.G. (1999) Gluta-
mate receptors and transporters in genetic and acquired models
of epilepsy. Epilepsy Res., 36(2-3): 189-204.
Mello, L.E., Cavalheiro, E.A., Tan, A.M., Kupfer, W.R., Preto-
flus, J.K., Babb, T.L. and Finch, D.M. (1993) Circuit mecha-
171
nisms of seizures in the pilocarpine model of chronic epilepsy:
cell loss and mossy fiber sprouting. Epilepsia, 34(6): 985-995.
Merlin, L.R., Bergold, P.J. and Wong, R.K. (1998) Requirement
of protein synthesis for group I mGluR-mediated induction of
epileptiforrn discharges. J. Neurophysiol., 80(2): 989-993.
Mirnics, K. (2001) Microarrays in brain research: the good, the
bad and the ugly. Nat. Rev. Neurosci., 2(6): 444-447.
Miyajima, K., Tamiya, S., Oda, Y., Adachi, T., Konomoto,
T., Toyoshiba, H., Masuda, K. and Tsuneyoshi, M. (2001)
Relative quantitation of p53 and MDM2 gene expres-
sion in leiomyosarcoma; real-time semi-quantitative reverse
transcription-polymerase chain reaction. Cancer Lett., 164(2):
177-188.
Montecot, C., Rondi-Reig, L., Springhetti, V., Seylaz, J. and
Pinard, E. (1998) Inhibition of neuronal (type 1) nitric oxide
synthase prevents hyperaemia and hippocampal lesions result-
ing from kainate-induced seizures. Neuroseience, 84(3): 791-
800.
Mukhin, A., Fan, L. and Faden, A.I. (1996) Activation of
metabotropic glutamate receptor subtype mGluR1 contributes
to post-traumatic neuronal injury. J. Neurosci., 16(19): 6012-
6020.
Nakagawa, E., Aimi, Y., Yasuhara, O., Tooyama, I., Shimada,
M., McGeer, EL. and Kimura, H. (2000) Enhancement of
progenitor cell division in the dentate gyrus triggered by initial
limbic seizures in rat models of epilepsy. Epilepsia, 41(i):
10-18.
Nicoletti, F., Wroblewski, J.T., Alho, H., Eva, C., Fadda, E.
and Costa, E. (1987) Lesions of putative glutamatergic path-
ways potentiate the increase of inositol phospholipid hydrol-
ysis elicited by excitatory amino acids. Brain Res., 436(1):
103-112.
Nicoletti, E, Bruno, V., Copani, A., Casabona, G. and Knopfel,
T. (1996) Metabotropic glutamate receptors: a new target for
the therapy of neurodegenerative disorders?. Trends Neurosci.,
19(7): 267-271.
Nicotera, P., Ankarcrona, M., Bonfoco, E., Orrenius, S. and
Lipton, S.A. (1997) Neuronal necrosis and apoptosis: two
distinct events induced by exposure to glutamate or oxidative
stress. Adv. Neurol., 72(4): 95-101.
O'Leary, D.M., Movsesyan, V., Vicini, S. and Faden, A.I. (2000)
Selective mGluR5 antagonists MPEP and SIB-1893 decrease
NMDA or glutamate-mediated neuronal toxicity through ac-
tions that reflect NMDA receptor antagonism. Br. J. Pharma-
col., 131(7): 1429-1437.
Phillips, J. and Eberwine, J.H. (1996) Antisense RNA amplifica-
tion: a linear amplification method for analyzing the mRNA
population from single living cells. Methods, 10(3): 283-288.
Pitkanen, A., Tuunanen, J., Kalviainen, R., Partanen, K. and
Salmenpera, T. (1998) Amygdala damage in experimental and
human temporal lobe epilepsy. Epilepsy Res., 32(1-2): 233-
253.
Pretel, S., Applegate, C.D. and Piekut, D. (1997) Apoptotic and
necrotic cell death following kindling induced seizures. Acta
Histochem., 99(1): 71-79.
Rice, A., Rafiq, A., Shapiro, S.M., Jakoi, E.R., Coulter, D.A. and
Delorenzo, R.J. (1996) Long-lasting reduction of inhibitory
172
function and gamma- aminobutyric acid type A receptor sub-
unit mRNA expression in a model of temporal lobe epilepsy.
Proc. Natl. Acad. Sci. USA, 93(18): 9665-9669.
Sakhi, S., Bruce, A., Sun, N., Tocco, G., Baudry, M. and
Schreiber, S.S. (1994) p53 induction is associated with neu-
ronal damage in the central nervous system. Proc. Natl. Acad.
Sci. USA, 91(16): 7525-7529.
Salmenpera, T., Kalviainen, R., Partanen, K. and Pitkanen, A.
(1998) Hippocampal damage caused by seizures in temporal
lobe epilepsy. Lancet, 351(9095): 35.
Sandberg, R., Yasuda, R., Pankratz, D.G., Carter, T.A., Del Rio,
J.A., Wodicka, L., Mayford, M., Lockhart, D.J. and Barlow, C.
(2000) Regional and strain-specific gene expression mapping
in the adult mouse brain. Proc. Natl. Acad. Sci. USA, 97(20):
11038-11043.
Schauwecker, EE. (2000) Seizure-induced neuronal death is as-
sociated with induction of c-Jun N-terminal kinase and is
dependent on genetic background. Brain Res., 884(1-2): 116-
128.
Schauwecker, EE. and Steward, O. (1997) Genetic determinants
of susceptibility to excitotoxic cell death: implications for
gene targeting approaches. Proe. Natl. Acad. ScL USA, 94(8):
4103-4108.
Sch~itze, K. and Lahr, G. (1998) Identification of expressed
genes by laser-mediated manipulation of single cells. Nat.
Biotechnol., 16(8): 737-772.
Schwarzschild, M.A., Cole, R.L. and Hyman, S.E. (1997) Glu-
tamate, but not dopamine, stimulates stress-activated protein
kinase and AP-l-mediated transcription in striatal neurons. J.
Neurosci., 17(10): 3455-3466.
Shigemoto, R., Kinoshita, A., Wada, E., Nomura, S., Ohishi,
H., Takada, M., Flor, EJ., Neki, A., Abe, T., Nakanishi, S.
and Mizuno, N. (1997) Differential presynaptic localization of
metabotropic glutamate receptor subtypes in the rat hippocam-
pus. J. Neurosci., 17(19): 7503-7522.
Sommer, W. (1880) Die Erkrankung des Ammonshorns als ae-
tiologisches Moment der Epilepsie. Arch. Psychiat. Nervenkr.,
308: 631-675.
Sperk, G., Lassmann, H., Baran, H., Kish, S.J., Seitelberger, E
and Hornykiewicz, O. (1983) Kainic acid induced seizures:
neurochemical and histopathological changes. Neuroscienee,
10(4): 1301-1315.
Strasser, U., Lobner, D., Behrens, M.M., Canzoniero, L.M. and
Choi, D.W. (1998) Antagonists for group I mGluRs atten-
uate excitotoxic neuronal death in cortical cultures. Eur J.
Neurosci., 10(9): 2848-2855.
Sutula, T.P. (2001) Secondary epileptogenesis, kindling, and in-
tractable epilepsy: a reappraisal from the perspective of neural
plasticity. Int. Rev. Neurobiol., 45: 355-386.
Tsirka, S.E., Gualandris, A., Amaral, D.G. and Strickland,
S. (1995) Excitotoxin-induced neuronal degeneration and
seizure are mediated by tissue plasminogen activator. Nature,
377(6547): 340-344.
Tuunanen, J. and Pitk~inen, A. (2000) Do seizures cause neuronal
damage in rat amygdala kindling?. Epilepsy Res., 39(2): 171-
176.
Tuunanen, J., Halonen, T. and Pitk~inen, A. (1997) Decrease in
somatostatin-immunoreactive neurons in the rat amygdaloid
complex in a kindling model of temporal lobe epilepsy.
Epilepsy Res., 26(2): 315-327.
Tuunanen, J., Lukasiuk, K., Halonen, T. and Pitkanen, A. (1999)
Status epilepticus-induced neuronal damage in the rat amyg-
daloid complex: distribution, time-course and mechanisms.
Neuroscience, 94(2): 473-495.
Van Lookeren Campagne, M., Lucassen, P.J., Vermeulen, J.P. and
Balazs, R. (1995) NMDA and kainate induce internucleosomal
DNA cleavage associated with both apoptotic and necrotic cell
death in the neonatal rat brain. Eur. J. Neurosci., 7(7): 1627-
1640.
Van Roost, D., Solymosi, L., Schramm, J., van Oosterwyck, B.
and Elger, C.E. (1998) Depth electrode implantation in the
length axis of the hippocampus for the presurgical evaluation
of medial temporal lobe epilepsy: a computed tomography-
based stereotactic insertion technique and its accuracy. Neuro-
surgery, 43(4): 819-826.
Venero, J.L., Revuelta, M., Machado, A. and Cano, J. (1999)
Delayed apoptotic pyramidal cell death in CA4 and CA1
hippocampal subfields after a single intraseptal injection of
kainate. Neuroscience, 94(4): 1071-1081.
Waha, A., Watzka, M., Koch, A., Pietsch, T., Przkora, R., Peters,
N., Wiestler, O.D. and von Deimling, A. (1998) A rapid and
sensitive protocol for competitive reverse transcriptase (cRT)
PCR analysis of cellular genes. Brain Pathol., 8(1): 13-18.
Wahlestedt, C., Golanov, E., Yamamoto, S., Yee, E, Ericson,
H., Yoo, H., Inturrisi, C.E. and Reis, D.J. (1993) Antisense
ofigodeoxynucleotides to NMDA-R1 receptor channel pro-
tect cortical neurons from excitotoxicity and reduce focal
ischaemic infarctions. Nature, 363(6426): 260-263.
Wang, E., Miller, L.D., Ohnmacht, G.A., Liu, E.T. and Marin-
cola, F.M. (2000) High-fidelity mRNA amplification for gene
profiling. Nat. Biotechnol., 18(4): 457-459.
Wellmann, A., Thieblemont, C., Pittaluga, S., Sakai, A., Jaffe,
E.S., Siebert, P. and Raffeld, M. (2000) Detection of differ-
entially expressed genes in lymphomas using cDNA arrays:
identification of clusterin as a new diagnostic marker for
anaplastic large-cell lymphomas. Blood, 96(2): 398-404.
Wen, X., Fuhrman, S., Michaels, G.S., Carr, D.B., Smith, S.,
Barker, J.L. and Somogyi, R. (1998) Large-scale temporal
gene expression mapping of central nervous system develop-
ment. Proc. Natl. Acad. Sci. USA, 95(1): 334-339.
Wolf, H.K. and Wiestler, O.D. (1993) Surgical pathology of
chronic epileptic seizure disorders. Brain Pathol., 3(4): 371-
380.
Wolf, H.K., Zentner, J., Hufnagel, A., Campos, M.G., Schramm,
J., Elger, C.E. and Wiestler, O.D. (1994) Morphological find-
ings in temporal lobe epilepsy: experience with 216 consec-
utive surgical specimens. Verh. Dtsch. Ges. Pathol., 78: 438-
442.
Yang, D.D., Kuan, C.Y., Whitmarsh, A.J., Rincon, M., Zheng,
T.S., Davis, R.J., Rakic, P. and Flavell, R.A. (1997) Absence of
excitotoxicity-induced apoptosis in the hippocampus of mice
lacking the Jnk3 gene. Nature, 389(6653): 865-870.
Yilmazer-Hanke, D.M., Wolf, H.K., Schramm, J., Elger, C.E.,
Wiestler, O.D. and Bliimcke, I. (2000) Subregional pathology

of the amygdala complex and entorhinal region in surgical
specimens from patients with pharmacoresistant temporal lobe
epilepsy. J. Neuropathol. Exp. Neurol., 59(10): 907-920.
Zentner, J., Hufnagel, A., Wolf, H.K., Ostertun, B., Behrens,
E,, Campos, M.G., Solymosi, L., Elger, C.E., Wiestler, O.D.
173
and Schramm, J. (1995) Surgical treatment of temporal lobe
epilepsy: clinical, radiological, and histopathological findings
in 178 patients. J. Neurol. Neurosurg. Psychiat~, 58(6): 666-
673.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 15

What synaptic lipid signaling tells us about

seizure-induced damage and epileptogenesis

Nicolas G. Bazan *, Bin Tu and Elena B. Rodriguez de Turco

Neuroscience Center of Excellence and Department of Ophthalmology, Louisiana State University Health Sciences Center,
New Orleans, LA 70112, USA

Abstract: Glutamate, the most abundant excitatory neurotransmitter in the mammalian CNS, plays a central role in many
neuronal functions, such as long-term potentiation, which is necessary for learning and memory formation. The fast
excitatory glutamate neurotransmission is mediated by ionotropic receptors that include AMPA/kainate and N-methyl-D-
aspartate (NMDA) receptors, while the slow glutamate responses are mediated through its interaction with metabotropic
receptors (mGluRs) coupled to G-proteins. During seizures, massive release of glutamate underlies excitotoxic neuronal
damage as it triggers an overflow of calcium in postsynaptic neurons mediated by NMDA-gated channels. The early
upstream postsynaptic events involve the activation of phospholipases, with the release of membrane-derived signaling
molecules, such as free arachidonic acid (AA), eicosanoids, and platelet-activating factor (PAF). These bioactive lipids
modulate the early neuronal responses to stimulation as they affect the activities of ion channels, receptors, and enzymes;
and when released into the extracellular space, they can contribute to the modulation of presynaptic neurotransmitter
release/re-uptake, and/or affect other neighboring neuronal/glial cells. The downstream postsynaptic events target the
nucleus, leading to activation of gene-expression cascades. Syntheses of new proteins are the basis for seizure-induced
sustained physiological and/or pathological changes that occur hours, days, or months later, such as synaptic reorganization
and repair, and apoptotic/necrotic neuronal death. The intricate mesh of signaling pathways converging to the nucleus,
and connecting upstream to downstream synaptic events, are at present the focus of many research efforts. We describe
in this chapter how seizure-induced glutamate release activates the hydrolysis of membrane AA-phospholipids via
phospholipase A2 (PLA2), PLC, and PLD, thus releasing bioactive lipids that, in turn, modulate neurotransmission. We
discuss mechanisms through which lipid messengers, such as AA and PAF, may turn into injury mediators participating in
seizure-induced brain damage.

Introduction integral protein functions (i.e., receptors, ion chan-

Arachidonoyl phospholipids (AA-PLs) and docosa-
hexaenoyl-PLs (DHA-PLs) are highly unsaturated
lipid components of neuronal membranes that pro-
vide fluidity and the proper environment for active
* Correspondence to: N,G. Bazan, LSU Health Sciences
Center, Neuroscience Center of Excellence, 2020 Gravier
Street, Suite D, New Orleans, LA 70112, USA. Tel.: +1-
504-599-0832; Fax: +1-504-568-5801;
E-mail: nbazan@lsuhsc.edu
nels, enzymes) (Stubbs and Smith, 1984; Spector and
Yorek, 1985; Yeagle, 1989). AA- (and DHA-) PLs
play a highly dynamic role in cellular function as a
reservoir of messengers for agonists such as neuro-
transmitters, growth factors, and cytokines that, by
interacting with plasma-membrane receptors, mod-
ulate phospholipase activity, thus switching on in-
tracellular signaling pathways by releasing mem-
brane PL-derived second messengers (Fig. 1). Phos-
pholipase A2 (PLA2) hydrolyzes AA-PLs, releasing
AA; PLC generates AA-diacylglycerols (DAG) from
polyphosphoinositides (PPI); and PLD preferentially
176

Membrane N-AA-PE PC PPI AA-PLs AlkyI-AA-PC Oxidized Pl.s

Substrates
I I
[ PLD
I
Phospholipases I

Bioactive
Products
I .Anandamide
(A.EA)
•PA ~
I
.DAG ~ .AA.4"~
l
.lsoprostanes
.Neuroprostanes

..,o,, ;®
COX-2 Gene
. ~ oAA-LysoPA4=.~ .2-AG Expression
•12-OH-AEA -PGE2-ethanolamide

°HPTES -Protaglandins
•HETES -Prostacyclin
V •LTs .Thromboxanes

Cellular Neurogenesis - S y n a p t o g e n e s i s
Responses
~> A p o p t o s i s
Fig. 1. Cascade of bioactive metabolites triggered by activation of PLAz, PLC, and PLD that are involved in cellular responses to
stimulation. Closed circlesindicatebioactivelipids including IP3. For details, see text.

targets phosphatidylcholine (PC), releasing phospha- Metabotropic glutamate receptors and

tidic acid (PA).
The excitatory neurotransmitter glutamate, which
is involved in the induction of long-term potentiation
(LTP, a synaptic model of learning and memory)
(Bliss and Collingridge, 1993; Nakanishi, 1994), ac-
tivates PLA2 and PLC, generating AA, PAR and
DAG (Fig. 1), bioactive lipids that are implicated
in neuronal plasticity. The same signaling path-
ways that contribute to synaptic plasticity, when
they are overstimulated during seizures, ischemia,
trauma, and neurodegeneration, lead to excitotoxic
brain damage (Bazan et al., 1995; Bazan and Allan,
1998).
The goals of this chapter are: (1) to give an
overview of the different signaling pathways that,
activated at the plasma membrane by glutamate, con-
tribute to bioactive lipid generation; and (2) to show
how different avenues and pathways of the cascade
may underlie plasticity changes and/or neuronal in-
jury in epilepsy.
PLC-mediated DAG signaling
Glutamate neurotransmission is mediated by differ-
ent types and subtypes of receptors located at the
pre- and postsynapse and in glial cells. The gluta-
mate ionotropic receptors (iGluRs), AMPA/kainate,
and NMDA, mediate the fast excitatory neurotrans-
mission, while the slow glutamate responses are
mediated by metabotropic receptors (mGluRs) cou-
pled to G-proteins (for review, see Nakanishi, 1994;
Conn and Pin, 1997). The mGluRs are classified into
three groups: group I mGluRs includes mGluR1 and
mGluR5, which are linked to phosphatidylinositol
4,5-bis-phosphate (PIP2)-PLC pathway activation;
and Groups II and III mGluRs are negatively cou-
pled to adenylate cyclase. Their distribution varies
among different neuronal populations, with NMDA
receptors located postsynaptically, while mGluRs
subtypes are at the pre- and postsynapse. Glial cell
response to glutamate is mediated by AMPA and

mGluR5 receptors (Conn and Pin, 1997). All these
widely distributed types of glutamate receptors con-
tribute to and modulate glutamate neurotransmission.
NMDA-gated calcium channels are central players in
excitatory glutamate neurotransmission facilitated by
post-synaptic group I mGluR.
Activation of group I mGluRs coupled to PLC
during seizures leads to a rapid accumulation of
AA-DAG in the brain (Bazan et al., 1995). This
is a short-lived signal, since the released AA-DAG
activates PKC, which, in turn, contributes to feed-
back inhibition of the PLC pathway (Nishizuka,
1995). However, the mGluR-PLC pathway elicits
potent and sustained consequences in other signal-
ing pathways, since PKC activates PLD and PLA2.
DAG kinase epsilon (DGKs) selectively phospho-
rylates AA-DAG to generate AA-phosphatidic acid
(PA), thereby shutting off the DAG signal (Tang
et al., 1996; Pettitt and Wakelam, 1999). Activa-
tion of group I mGluR and PKC¥ is involved in
synaptic plasticity, such as in learning, memory, and
LTP (Abeliovich et al., 1993a,b; Aiba et al., 1994a;
Conquet et al., 1994; Nakanishi, 1994; Wilsch et al.,
1998), and long-term depression (Aiba et al., 1994b).
Moreover, alterations of this signaling pathway have
been implicated in neurological and psychiatric dis-
eases, such as epilepsy, Alzheimer's, and depression
(Bazan et al., 1995; Pacheco and Jope, 1996; Conn
and Pin, 1997; Bordi and Ugolini, 1999).
The central role played by mGluR signaling in
glutamate neurotransmission was revealed by stud-
ies in mice with targeted disruption of the DGK~
gene (Rodriguez de Turco et al., 2001). DGKe-/-
mice display higher resistance to seizures induced
by electroconvulsive shock (ECS) and attenuation of
LTP in the hippocampus. The genetic background of
these DGK~-/- mice (generated from 129Ola-type
ES introduced into blastocyst-stage embryos from
C57BL/6 mice, followed by intercrossing of the
heterozygous null-mutant mice with BL6) may con-
tribute to the observed phenotypic changes (Gerlai,
1996). However, the magnitude of seizure suscepti-
bility displayed by heterozygous ( + / - ) mice was in-
termediate between wild-type ( + / + ) and DGKs-/-
mice, indicating that background genes were not re-
sponsible for the DGKs-/- mouse response to ECS.
Nevertheless, other adaptive changes may occur as
a consequence of DGKe targeting, such as overex-
177
pression of other DGK enzymes to take over the
functional role of DGK~. Interestingly, not only the
PPI-PLC pathway was greatly affected by the mu-
tation, but also the cPLA2-AA and the PLD-DAG
pathways, reflecting the direct impact of the former
in modulating multiple signaling pathways essential
for synaptic activity and neuronal plasticity.
Activation of phospholipase A2 triggered by
seizures
Seizures trigger an early activation of synaptic PLA2,
reflected in a rapid accumulation of free fatty acids
(FFA) (Bazan, 1970; Bazan et al., 1993). How-
ever, the detailed events involved in the activa-
tion of neuronal and/or glial phospholipases un-
der physiological and pathophysiological conditions
are still not fully understood. Furthermore, PLA2
is a large family of enzymes classified into three
types: cytosolic calcium-dependent PLA2 (cPLA2;
type IV), calcium-independent (iPLA2; type VI) and
low-molecular weight, secretory PLAzs (sPLAzs)
(Balsinde et al., 1999). The cPLA2 displays high
selectivity for AA-PLs, thus activating the AA cas-
cade and the generation of eicosanoids (Clark et
al., 1991). There is a general consensus that cPLA2
is the enzyme involved in signaling, and which is
activated by agonists that either trigger increased
calcium influx or that stimulate calcium mobilization
from the intracellular stores pathway (Clark et al.,
1991; Nicotera et al., 1992).
Increased postsynaptic calcium permeation
through channels gated by NMDA-glutamate re-
ceptor leads to activation of cPLA2 and AA release
in primary cultures of striatal neurons and cerebellar
granule cells (Dumuis et al., 1988), and in hip-
pocampal slices (Pellerin and Wolfe, 1990), and is
blocked by PLA2 inhibitors (Sanfeliu et al., 1990).
Also, cPLA2 can be activated by glutamate interac-
tion with group I mGluRs coupled to G-proteins and
PLC, which promotes calcium mobilization from in-
tracellular stores (Conn and Pin, 1997). The release
of AA triggered by the mGluRs plays a central role
in hippocampal LTP (Izumi et al., 2000).
Activation of calcium-dependent cPLA2 also in-
volves its phosphorylation by mitogen-activated pro-
tein kinase (MAPK) and its translocation from the
cytosol to the nuclear membrane and endoplasmic
178
reticulum, where AA-PLs are hydrolyzed (Clark et
al., 1991; Peters-Golden et al., 1996; Leslie, 1997;
Hirabayashi et al., 1999). Its full activation de-
pends upon the duration of cytosolic Ca 2+ elevation
(Hirabayashi et al., 1999). The glutamate-NMDA
pathway activates MAPK in hippocampal neurons
(Kurino et al., 1995), and PAF, a potent second mes-
senger generated by the glutamate-NMDA-PLA2
pathway, is used as the messenger (Mukherjee et al.,
1999).
Activation of PLA2 by glutamate opens the win-
dow for a cascade of second messengers, such as
AA, eicosanoids, and PAF (as summarized in Fig. 1),
which are directly involved in the modulation of ex-
citotoxic neurotransmission, as is discussed in the
following sections.
Arachidonic acid and eicosanoid signaling
Free AA is a potent signaling molecule that is main-
tained under normal physiological conditions at very
low levels and which, upon neuronal stimulation,
is released from membrane AA-PLs by cPLA2 (Pi-
omelli, 1993; Bazan et al., 1995). PLC and PLD
signaling pathways also contribute to the free AA
pool used for the synthesis of the biologically ac-
tive prostaglandins, leukotrienes, thromboxanes, and
hydroxyeicosatrienoic acids (Fig. 1).
Multiple proteins are targeted by AA at the
synapse, leading to a positive modulation of glu-
tamatergic neurotransmission. Postsynaptically, AA
increases NMDA open-channel probability (Miller
et al., 1992) and presynaptically glutamate and AA
interaction with mGluRs autoreceptors increases glu-
tamate release (Corm and Pin, 1997). The levels of
glutamate at the synapse are tightly controlled by
glutamate transporters present in glia and neuronal
cells (Vesce et al., 1999; Danbolt, 2001). AA, by
blocking glutamate re-uptake, elevates its synaptic
concentration, favoring excitotoxicity (Volterra et al.,
1992; Vesce et al., 1999). Glial cells are actively in-
volved in glutamate neurotransmission. They play a
central role in the uptake of glutamate at the synapse,
which is then metabolized to glutamine and deliv-
ered back to the neuronal cell, thus fueling glutamate
synthesis (Vesce et al., 1999). But glial cells can also
release glutamate into the synapse, when presynap-
tically released glutamate interacts with glial type I
mGluRs and activates the cPLA2-AA cascade (Conn
and Pin, 1997).
The number of sites in glutamatergic neurotrans-
mission under modulation through the cPLA2 path-
way is greatly enlarged when AA is metabolized to
eicosanoids, which are potent modulators of synaptic
transmission, glial function, and cerebrovasculature
properties (Piomelli and Greengard, 1990; Shimizu
and Wolfe, 1990; Piomelli, 1994). The cyclooxyge-
nase (COX) enzymes catalyze the cyclooxygenation
of AA to PGG2, which then undergoes hydroperox-
idation to PGH2, the substrate for the synthesis of
biologically active prostaglandins and thromboxanes
(Vane et al., 1998). There are two forms of COX
enzymes: COX-l, which is constitutively expressed
in all tissues, and COX-2, which is expressed in re-
sponse to inflammatory signals (Vane et al., 1998).
The brain is one of the few organs where the COX-
2 enzyme is constitutively expressed, mainly in the
cortex and hippocampus (Yamagata et al., 1993;
Vane et al., 1998), and consistently localized in
neuronal dendritic spines actively involved in neuro-
transmission (Kaufmann et al., 1996).
The expression of the COX-2 gene in rat brain
is dynamically regulated by the NMDA receptor-
dependent synaptic activity that is implicated in both
LTP and exeitotoxic neuronal damage (Yamagata et
al., 1993). The most abundant prostaglandins gener-
ated in the brain through COX-I/COX-2 pathways,
PGE2, PGF2~, and PGD, are modulators of synap-
tic activity as they exert paracrine functions through
pre- and postsynaptic receptors as well as autocrine
roles as intraneuronal second messengers (Piomelli,
1994). COX-2, but not COX-l, can signal to the nu-
cleus as it is translocated to the nuclear membrane,
generating prostanoids involved in gene expression
(Morita et al., 1995; Vane et al., 1998). PGE2 inter-
acts with a nuclear EP1 receptor, and its activation
leads to calcium mobilization and gene transcrip-
tion (Bhattacharya et al., 1998). Thus, the NMDA-
COX-2-PGE2-EP1 receptor-gene expression path-
way may lead to long-lasting changes related to
synaptic plasticity.
The lipoxygenase (LOX)-mediated oxygenation
of AA opens a new cascade of bioactive metabo-
lites involved in the modulation of synaptic activity
(Piomelli and Greengard, 1990; Shimizu and Wolfe,
1990). These include hydroperoxy-eicosatetraenoic

acids (HPETEs), which are further hydrolyzed to
HETEs. The 5- and 12-LOX pathways, which are the
most active in the brain and retina (for review see
Birkle and Bazan, 1986; Piomelli, 1994), generate
(in the case of 5-LOX) leukotrienes (LTB4), sulfi-
dopeptide LTC4, LTD4, LTE4, and lipoxins (Piomelli
and Greengard, 1990), and in the case of 12-LOX,
12S-HPETE, 12-HETES, and hepoxilins (HxA3 and
HxB3; Piomelli and Greengard, 1990; Pace-Asciak,
1994). Interestingly, metabolites generated through
the 12-LOX pathway (12-HPETE/12-HETE/Hx) in-
hibit, at the presynaptic level, neurotransmitter re-
lease (Piomelli and Greengard, 1990), including glu-
tamate release from hippocampal mossy-fiber termi-
nals (Freeman et al., 1991).
PAF signaling: intracellular and extracellular
targets
PAF (1-O-alkyl-2-acetyl-glycero-3-phosphocholine)
is a potent lipid mediator that is actively involved in
glutamatergic neurotransmission, both under phys-
iological and pathophysiological conditions (Bazan
and Allan, 1998; Prescott et al., 2000). Stimulation
of NMDA receptors activates PAF synthesis and PAF
is produced in brain in response to seizures and is-
chemia (Kumar et al., 1988; Nishida and Markey,
1996). Glutamate-NMDA-induced calcium increase
and activation of cPLA2 in postsynaptic neurons
activates PAF synthesis through 'the remodeling
pathway' (Bazan and Rodriguez de Turco, 1995).
Alkyl-AA-glycerophosphorylcholine is acted upon
by cPLA2, releasing AA and lyso-PAF, which is then
acetylated by lyso-PAF acetyltransferase, generat-
ing PAF (Fig. 1). PAF action is rapidly terminated
by PAF-acetylhydrolase (PAF-AH) (Bazan, 1995).
This enzyme can also hydrolyze certain species of
oxidatively damaged phospholipids that are gen-
erated during brain oxidative stress, a component
of seizures, ischemia-reperfusion, neurotrauma, and
neurodegenerative diseases (Prescott et al., 2000).
These PAF-like species possess PAF-like activity at
the PAF receptor (Prescott et al., 2000).
PAF actions are mediated by its interaction with
extracellular receptors that are members of the seven
membrane-spanning domain, G protein-coupled re-
ceptor superfamily (for review, see Prescott et al.,
2000), and which are present in neuronal and glial
179
cells, with a very high expression in microglia (Mori
et al., 1996). In addition to the PAF extracellular
receptor, two other different types of PAF-binding
sites have been found in brain synaptosomal mem-
branes and in microsomal membranes. These extra-
and intracellular binding sites can be pharmacologi-
cally differentiated, since the former is inhibited by
the synthetic hetrazepine BN 52021, and the lat-
ter by BN 50730, a terpenoid extracted from the
leaf of the Ginkgo biloba tree (Marcheselli et al.,
1988; Marcheselli and Bazan, 1990; Marcheselli and
Bazan, 1994).
Presynaptic receptor-mediated PAF actions poten-
tiate glutamatergic transmission, and downstream of
postsynaptic NMDA receptors, PAF is the messenger
of glutamate actions that lead to gene expression and
neuronal plasticity (Bazan, 1998). Postsynaptic neu-
ronal activity activates PAF synthesis, which in turn
acts as a retrograde messenger, stimulating presy-
naptic glutamate release (Clark et al., 1992), thus
contributing to LTP (Wieraszko et al., 1993; Kato
et al., 1994) and memory formation (Jerusalinsky et
al., 1994: Izquierdo et al., 1995; Bazan, 1998). In
fact, animals deficient in the PAF receptor displayed
attenuated LTP (Chen et al., 2001). PAF-mediated
effects through the BN 50730-sensitive intracellular
receptor are linked with PAF-mediated effects on
gene expression in the CNS (Bazan, 1998). Electro-
convulsive shock and kainic acid-induced seizures
activate early gene expression in the hippocampus,
including expression of the inducible COX-2, and
this induction is inhibited by BN 50730, but not by
BN 52021 (Marcheselli and Bazan, 1994, 1996).
Glutamate triggers the activation of the MAPK
signaling pathway (Bading and Greenberg, 1991;
Fiore et al., 1993; Kurino et al., 1995), and PAF is the
mediator of glutamate-NMDA activation of JNK,
p38, and ERK MAPK (Mukherjee et al., 1999). The
MAPK cascade is also activated in the hippocam-
pus during kainic acid-induced seizures (Kim et al.,
1994) and transient cerebral ischemia (Hu and Wie-
loch, 1994). Because PAF-MAPK activation may
stimulate cPLA2 (Clark et al., 1991) and also may be
upstream of PAF-induced COX-2 expression, both
effects may converge in potentiating the AA cascade
and eicosanoid synthesis.
Finally, PAF can be the trigger for the previously
mentioned COX-2-PGE2-EP1 receptor pathway at
180
the nuclear level, leading to a late gene-transcription
activation.
Can lipid mediators contribute to neuronal
death?
Glutamate signaling has dual properties: under phys-
iological conditions it is involved in synaptic plastic-
ity, learning, and memory, and in pathological con-
ditions, when high and sustained levels of glutamate
are present at the synapse, it triggers excitotoxic
neuronal damage (Bazan et al., 1995). It is logical
to argue that the same signaling pathways, including
those regulated by phospholipases, may be the ones
used by glutamatergic neurotransmission to reach the
two opposite ends of the spectrum: plasticity changes
and cell survival or cell death.
One of the central pathways contributing to glu-
tamate excitotoxicity is the calcium-mediated acti-
vation of cPLA2. Its activation during seizures and
ischemia contributes to neuronal injury and degen-
eration (Bazan et al., 1993; Bonventre, 1996). In
fact, cPLA2 knockout mice are more resistant to
brain ischemic insult (Bonventre et al., 1997). One
direct consequence of cPLA2 overstimulation is the
generation of free AA and lyso-phospholipids and
perturbations in membrane structure affecting the
activity of receptors, ion channels, enzymes, and cy-
toskeletal proteins (Fig. 2). In addition, the viability
of free AA is the rate-limiting step for the COX-
1/COX-2-eicosanoid pathways, with the release of
free radicals and potential mediators of peroxidative
membrane damage (Bazan et al., 1995).
The cPLA2-mediated PAF synthesis and its tran-
scriptional activation of COX-2 are activated during
seizures and ischemia, and its expression precedes
apoptotic neuronal death (Yamagata et al., 1993;
Adams et al., 1996; Kaufmann et al., 1996; March-
eselli and Bazan, 1996; Miettinen et al., 1997; Tocco
et al., 1997). COX-2 overexpression is involved in
NMDA-induced neuronal cell death (Hewett et al.,
2000). Several lines of experimental evidence sup-
port the central role of PAF-COX-2 in excitotoxic
damage: (1) transgenic mice overexpressing COX-2
are more susceptible to neuronal excitotoxic dam-
age (Kelley et al., 1999); (2) COX-2 inhibition
prevents ischemia and NMDA-induced cell death
(Nakayama et al., 1998; Hewett et al., 2000); (3)
NMDA neurotoxicity is reduced in COX-2-deficient
mice (Iadecola et al., 2001); (4) the antagonist of
the PAF intracellular binding site, BN50730, inhibits
seizure-induced COX-2 expression (Marcheselli and
Bazan, 1996) and greatly reduces seizure-induced
hippocampal damage (Marcheselli and Bazan, un-
published observations); (5) PAF-AH attenuates
NMDA-induced hippocampal neuronal apoptosis
(Ogden et al., 1998); (6) seizure-induced COX-2
induction occurs in those areas with the highest neu-
ronal damage, i.e., hippocampus > cortex (Marche-
selli and Bazan, 1996); (7) the inflammatory cy-
tokine 1L-l[3, whose expression is increased in the
brain during seizures, contributes to neuronal dam-
age by activating PAF-COX-2 signaling (Serou et
al., 1999). All the above observations strongly sup-
port the involvement of cPLA2 activation in excito-
toxic pathways mediated by PAF-COX-2 induction
leading to neuronal death.
We have recently reported that PAE by direct in-
teraction with the mitocbondria, activates the open-
ing of the transition pore and cytochrome c release
(Parker et al., in press). This newly identified tar-
get of PAF action leads, through caspase activation,
to apoptotic neuronal death (Fig. 2). Mitochondrial
dysfunction and oxidative stress play a central role
in neurodegenerative diseases (Beal, 1998) and may
also, during seizures, severely compromise neuronal
function. Thus, the reported NMDA-induced alter-
ation of mitochondrial function and free-radical gen-
eration (Dugan et al., 1995) may be mediated by
activation of the PLA2-PAF pathway.
Kindling: COX-2 and cPLA2 induction in the
cortex and hippocampus
Kindling is a widely used model of human temporal-
lobe epilepsy that is characterized by hippocam-
pal cell death and sclerosis, and also by plasticity
changes, including sprouting of mossy fibers, synap-
tic reorganization, and cell proliferation in the den-
tate gyrus (Cavazos et al., 1994; Bengzon et al.,
1997). The mechanisms that contribute to this aber-
rant synaptic plasticity and epileptogenesis are not
defined but could be the ones that set in motion
enhanced excitability contributing to seizure devel-
opment and propagation. The PAF-COX-2 path-
way that is activated during seizures (Marcheselli
 181

tcPLAa Lyso PLs i

FreeAA ~ Peroxidation I Alterationsin:
I • Receptors
~ , ~ _ _ _ _ ~ Free Radicals ] • Ion Channels
Pimp
F 'C O X ' ~ ids -j • CytoskeletalProteins

1
/'kProtein COX-2 mRNA
~Kinases _ ~
\ ~'~ Transcription
~\ Factors
~k~Gi(~uPresy;Tetl: ase Excitotoxicity

l
"~ ~ Opening
PermeabilityTransitionPore
+
Cytochromec Release
Caspases Ib

t
Dysregulationof
tPLC ~ DAG
IP3 -+ t[Ca2*]il Actv
iatoi nSUStani edpKcP
/ LA2 signaling
modulated by PKC
Fig. 2. Involvement of phospholipid-derived second messengers in neuronal excitotoxic damage.

and Bazan, 1996) may contribute to epileptogenesis
(Bazan and Serou, 1999). To explore the correlation
between this signaling pathway and the progression
of excitability, the induction of cPLA2 and COX-2
during kindling was followed in the hippocampus
and the cortex (Tu and Bazan, submitted). Rats were
treated with subconvulsive electrical stimulation at
30-min intervals 12 times daily for 4 days (Fig. 3).
Seizure behaviors gradually increase, reaching class
5 by the scale of Racine (1972) by days 3 and
4. One month later, maximal seizure response was
obtained using the same low stimulation, indicat-
ing that neuronal circuitries involved in seizures
were permanently modified by the kindling proto-
col. In both hippocampi, COX-2 messenger RNA
increased by 13-fold after the first day of treatment,
decreased in-between daily stimulations, and reached
the highest increase by day 3 (20-fold), when ani-
mals reached class-5 seizures. Interestingly, in the
cortex, no changes in COX-2 mRNA were detected
during the first 2 days post-seizure, but 2 h prior
to day-3 stimulation it was increased 12-fold, and
then it reached a 29-fold increase after seizure. The
profile of cPLA2 induction was of much lower mag-
nitude than that of COX-2, with a sustained increase
from day 1 in the hippocampus and from day 3
in the cortex. The early increase of COX-2 in the
hippocampus could contribute to neuronal damage
in this highly susceptible area of the brain, while
the profile of changes by day 3 in both the cortex
and hippocampus suggest the involvement of COX-2
signaling in the maturation of epileptogenesis and in
evoking epileptic activity in the motor cortex. The
spreading of COX-2 and cPLA2 gene induction from
the hippocampus to the cortex during kindling may
result from permanently modified synaptic networks,
as new connections are generated and/or old ones
are modified by seizure activity.
182

+ + + +
30 -5

25 ,. ,. ,. . ., ., . . :.:.2":.>2 .....'.'.'. 2:::::::2:2

4
::::::::::: :::..:: ;:::::::::~, :::::::::::
20

15 -
iiii!iiii
~
iii !iiiiil RHI COX 2 _
LH~ "
3m

2.~,
8

10

>, 5 _ i .!iliiii!iii " LH 1

'o 2" " ' l l ~ m ' = ~ ~:~. . . . . . . cPLA2
"~
f~ 0
,,,,.%. 0
I:i:!:!:i:i: t t ::::::::~: I I:::::::::: I I ::::::::::~ I
t~
,,Q
Day 1 Day 2 Day 3 Day 4
o

4
20 i i i i !i !i'iiii!i i i;": iiiiii O

: i i i i i)~i ~li!))i))i ~~LC}'!)i))))))

i: i))))))Re
))))COX.2
2.--.o
10
5 - ; i E i i ~ i:i:]}:~i:i : : : i : i " : i : i ..:.':':::: LCJ
0 I ::::::::::: I I ::::~:::~: I I:::::::::: I , I :::::::;:;:1 I 0
10 20 30 40 50 60 70 80 90 100
Time(houm)
Fig. 3. Early induction of COX-2 and cPLA2 mRNA in the hippocampus and delayed changes in the cortex during kindling
epileptogenesis.

Conclusion the other side of the coin, when overproduced, con-

trois multiple downstream neuronal events involved
Do seizures damage the brain? And are lipid me- in apoptotic cell death.
diators involved in neuronal damage? Many times,
structural damage and death of neurons may occur Acknowledgements
as a consequence of a disarray and imbalance of
neuronal signaling pathways activated by excessive The authors' research described here was supported
excitatory or deficient inhibitory stimulation. Other by NS23002 (NIH).
times, seizures do not result in cell death, but in func-
tional damage as a consequence of aberrant signal- References
ing, with overstimulation of membrane PL hydroly-
sis, the source of messengers underlying long-lasting Abeliovich, A., Chen, C., Goda, Y., Silva, A.J., Stevens, C.F.
and progressive neuronal dysfunctions. Synaptic ac- and Tonegawa, S. (1993a) Modified hippocampal long-term
potentiation in PKC gamma-mutant mice. Cell, 75: 1253-
tivity correlates with the degree of phospholipase 1262.
activation and the release of the potent lipid mediator Abeliovich, A., Paylor, R., Chen, C., Kim, J.J., Wehner, J.M.M.
PAF, which mediates LTP, plasticity changes, and, on and Tonegawa, S. (1993b) PKC gamma mutant mice exhibit

mild deficits in spatial and contextual learning. Cell, 75: 1263-
1271.
Adams, J., Colla~o-Moraes, Y. and de Belleroche, J. (1996)
Cyclooxygenase-2 induction in cerebral cortex: an intracellular
response to synaptic excitation. J. Neurochem., 66: 6-13.
Aiba, A., Chen, C., Herrup, K., Rosenmund, C., Steven, C.E
and Tonegawa, S. (1994a) Reduced hippocampal long-term
potentiation and context-specific deficit in associative learning
in mGluR1 mutant mice. Cell, 79: 365-375.
Aiba, A., Kano, M., Chen, C., Stanton, M.E., Fox, G.D., Her-
rup, K., Zwingman, T.A. and Tonegawa, S. (1994b) Deficient
cerebellar long-term depression and impaired motor learning
in mGluR1 mutant mice. Cell, 79: 377-388.
Bading, H. and Greenberg, M.E. (1991) Stimulation of pro-
tein tyrosine phosphorylation by NMDA receptor activation.
Science, 253: 912-914.
Balsinde, J., Balboa, M.A., Insel, P.A. and Dennis, E.A. (1999)
Regulation and inhibition of phospholipase A2. Annu. Rev.
Pharmacol. Toxicol., 39: 175-189.
Bazan, N.G. (1970) Effects of ischemia and electroconvulsive
shock on free fatty acid pool in the brain. Biochim. Biophys.
Acta, 218: 1-10.
Bazan, N.G. (1995) A signal terminator. Nature, 374: 501-502.
Bazan, N.G. (1998) Bioactive lipids and gene expression in
neuronal plasticity. Adv. Exp. Med. Biol., 446: 37-49.
Bazan, N.G. and Allan, G. (1998) Platelet-activating factor and
other bioactive lipids. In: M.D. Ginsberg and J. Bogousslavsky
(Eds.), Cerebrovascular Disease, Pathophysiology, Diagnosis
and Management. Blackwell Science, Malden, MA, pp. 532-
555.
Bazan, N.G. and Rodriguez de Turco, E.B. (1995) Platelet-
activating factor is a synapse messenger and a modulator of
gene expression in the nervous system. Neurochem. Int., 26:
435-441.
Bazan, N.G. and Serou, M.J. (1999) Second messengers, long-
term potentiation, gene expression and epileptogenesis. In:
A.V. Delgado-Escueta, W.A. Wilson, R.W. Olsen and R.J.
Porter (Eds.), Jasper's Basic Mechanisms of the Epilepsies,
3rd ed. Advances in Neurology, Vol 79. Lippincott, Williams
and Wilkins, Philadelphia, PA, pp. 659-664.
Bazan, N.G., Allan, G. and Rodriguez de Turco, E.B. (1993)
Role of phospholipase A2 and membrane-derived lipid second
messengers in excitable membrane function and transcriptional
activation of genes: implications in cerebral ischemia and
neuronal excitability. Prog. Brain Res., 96: 247-257.
Bazan, N.G., Rodriguez de Turco, E.B. and Allan, G. (1995)
Mediators of injury in neurotrauma: intracellular signal trans-
duction and gene expression. J. Neurotrauma, 12: 791-814.
Beal, M.F. (1998) Mitochondfial dysfunction in neurodegenera-
tive diseases. Biochim. Biophys. Acta, 1366:211-223.
Bengzon, J., Kokaia, Z., Elmer, E., Nanobashvili, A., Kokaia, M.
and Lindvall, O. (1997) Apoptosis and proliferation of dentate
gyms neurons after single and intermittent limbic seizures.
Proc. Natl. Acad. Sci. USA, 94: 10432-10437.
Bhattacharya, M., Peri, K.G., Almazan, G., Ribeiro-da-Silva,
A., Shichi, H., Durocher, Y., Abramovitz, M., Hou, X.,
Varma, D.R, and Chemtob, S. (1998) Nuclear localization
183
of prostaglandin E2 receptors. Proc. Natl. Acad. Sci. USA, 95:
15792-15797.
Birkle, D.L. and Bazan, N.G. (1986) The arachidonic acid cas-
cade and phospholipid and docosahexaenoic acid metabolism
in the retina. In: N. Osborne and J. Chader (Eds.), Progress in
Retinal Research, Vol. 5. Pergamon Press, London, pp. 309-
322.
Bliss, T.V.E and Collingridge, G.L. (1993) A synaptic model of
memory: long-term potentiation in the hippocampus. Nature,
361: 31-39.
Bonventre, J.V. (1996) Roles of phospholipases A2 in brain cell
and tissue injury associated with ischemia and excitotoxicity.
J. Lipid Med. Cell Signal., 14: 15-23.
Bonventre, J.V., Huang, Z., Taheri, M.R., O'Leary, E., Li, E.,
Moskowitz, M.A. and Sapirstein, A. (1997) Reduced fertility
and postischaemic brain injury in mice deficient in cytosolic
phospholipase A2. Nature, 390: 622-625.
Bordi, E and Ugolini, A. (1999) Group I metabotropic glutamate
receptors: implications for brain diseases. Prog. Neurobiol.,
59: 55-79.
Cavazos, J.E., Das, I. and Sutula, T.E (1994) Neuronal loss
induced in limbic pathways by kindling: evidence for induc-
tion of hippocampal sclerosis by repeated brief seizures. J.
Neurosci., 14: 3106-3121.
Chen, C., Magee, J.C., Marcheselli, V., Hardy, M. and Bazan,
N.G. (2001) Attenuated LTP in hippocampal dentate gyms
of mice deficient in the PAF receptor. J. Neurophysiol., 85:
384-390.
Clark, J.D., Lin, L.L., Kriz, R.W., Ramesha, C.S., Sultzman,
J.A., Lin, A.Y., Minola, N. and Knopf, J.L. (1991) A novel
arachidonic acid-selective cytosolic PLA2 contains a Ca 2+-
dependent translocation domain with homology to PKC and
GAE Cell, 65: 1043-1051.
Clark, G.D., Happel, L.T., Zorumski, C.E and Bazan, N.G.
(1992) Enhancement of hippocampal excitatory synaptic trans-
mission by platelet-activating factor. Neuron, 9:1211-1216.
Conn, EJ. and Pin, J.E (1997) Pharmacology and functions
of metabotropic glutamate receptors. Annu. Rev. Pharmacol.
Toxicol., 37: 205-237.
Conquet, F., Bashir, Z.I., Davies, C.H., Daniel, H., Ferraguti,
F., Bordi, E, Franz-Bacon, K., Reggiani, A., Matarese, V.
and Conde, E et al. (1994) Motor deficit and impairment
of synaptic plasticity in mice lacking mGluR1. Nature, 372:
237-243.
Danbolt, N.C. (2001) Glutamate uptake. Prog. Neurobiol., 65:
1-105.
Dugan, L.L., Sensi, S.L., Canzoniero, L.M., Handran, S.D.,
Rothman, S.M., Lin, T.S., Goldberg, M.E and Choi, D.W.
(1995) Mitochondrial production of reactive oxygen species in
cortical neurons following exposure to N-methyl-D-aspartate.
J. Neurosci., 15: 6377-6388.
Dumuis, A., Sebben, M., Haynes, J.-E and Bockaert, J. (1988)
NMDA receptors activate the arachidonic acid cascade system
in striatal neurons. Nature, 336: 68-70.
Fiore, R.S., Murphy, T.H., Sanghera, J.S., Pelech, S.L. and Bara-
ban, J.M. (1993) Activation of p42 mitogen-activated protein
184
kinase by glutamate receptor stimulation in rat primary corti-
cal cultures. J. Neurochem., 61: 1626-1633.
Freeman, E.J., Damron, D.S., Tertian, D.M. and Dorrnan, R.V.
(1991) 12-Lipoxygenase products attenuate the glutamate re-
lease and Ca2+ accumulation evoked by depolarization of
hippocampal mossy fiber nerve endings. J. Neurochem., 56:
1079-1082.
Gerlai, R. (1996) Gene-targefing studies of mammalian behav-
ior: is it the mutation of the background genotype?. Trends
Neurosci., 19: 177-181.
Hewett, S.J., Uliasz, T.E, Vidwans, A.S. and Hewett, J.A.
(2000) Cyclooxygenase-2 contributes to N-methyl-D-aspartate-
mediated neuronal cell death in primary cortical cell culture.
J. Pharmacol. Exp. Ther., 293: 417--425.
Hirabayashi, T., Kume, K., Hirose, K., Yokomizo, T., Iino, M.,
Itoh, H. and Shimizu, T. (1999) Critical duration of intracel-
lular Ca2+ response required for continuous translocation and
activation of cytosolic phospholipase A2. J. Biol. Chem., 274:
5163-5169.
Hu, B.R. and Wieloch, T. (1994) Tyrosine phosphorylation
and activation of mitogen-activated protein kinase in the rat
brain following transient cerebral ischemia. J. Neurochem., 62:
1357-1367.
Iadecola, C., Niwa, K., Nogawa, S., Zhao, X., Nagayama, M.,
Araki, E., Morham, S. and Ross, M.E. (2001) Reduced sus-
ceptibility to ischemic brain injury and N-methyl-D-aspartate-
mediated neurotoxicity in cyclooxygenase-2-deficient mice.
Proc. Natl. Acad. Sci. USA, 98: 1294-1299.
Izquierdo, I., Fin, C., Schmitz, P.K., Da Silva, R.C., Jerusalinsky,
D., Quillfeldt, J.A., Ferreira, M.B.G., Medina, J.H. and Bazan,
N.G. (1995) Memory enhancement by intrahippocampal, in-
traamygdala, or intraentorhinal infusion of platelet-activating
factor measured in an inhibitory avoidance task. Proc. Natl.
Acad. Sci. USA, 92: 5047-5051.
Izumi, Y., Zarrin, A.R. and Zorurnski, C.F. (2000) Arachidonic
acid rescues hippocampal long-term potentiation blocked by
group I metabotropic glutamate receptor antagonists. Neuro-
science, 100: 485-491.
Jerusalinsky, D., Fin, C., Quillfeldt, J.A., Ferreira, M.B.,
Schmitz, P.K., Da Silva, R.C., Walz, R., Bazan, N.G., Medina,
J.H. and Izquierdo, I. (1994) Effect of antagonists of platelet-
activating factor receptors on memory of inhibitory avoidance
in rats. Behav. Neural Biol., 62: 1-3.
Kato, K., Clark, G.D., Bazan, N.G. and Zorumski, C.F. (1994)
Platelet-activating factor as a potential retrograde messenger in
CA1 hippocampal long-term potentiation. Nature, 367: 175-
179.
Kaufmann, W.E., Worley, P.E, Pegg, J., Bremer, M. and Isakson,
P. (1996) COX-2, a synaptically induced enzyme, is expressed
by excitatory neurons at postsynaptic sites in rat cerebral
cortex. Proc. Natl. Acad. Sci. USA, 93: 2317-2321.
Kelley, K.A., Ho, L., Winger, D., Freire-Moar, J., Borelli,
C.B., Aisen, P.S. and Pasinetti, G.M. (1999) Potentiation
of excitotoxicity in transgenic mice overexpressing neuronal
cyclooxygenase-2. Am. J. PathoL, 155: 995-1004.
Kim, Y.S., Hong, K.S., Seong, Y.S., Park, J.B., Kuroda, S.,
Kishi, K., Kaibuchi, K. and Takai, Y. (1994) Phosphorylation
and activation of mitogen-activated protein kinase by kainic
acid-induced seizure in rat hippocampus. Biochem. Biophys.
Res. Commun., 202: 1163-1168.
Kumar, R., Harvey, S.A.K., Kester, M., Hanahan, D.J. and Olson,
M.S. (1988) Production and effects of platelet-activating factor
in the rat brain. Biochim. Biophys. Acta, 963: 375-383.
Kurino, M., Fukunaga, K., Ushio, Y. and Miyamoto, E. (1995)
Activation of mitogen-activated protein kinase in cultured rat
hippocampal neurons by stimulation of glutamate receptors. J.
Neurochem., 65: 1282-1289.
Leslie, C.C. (1997) Properties and regulation of cytosolic phos-
pholipase A2. J. BioL Chem., 272: 16709-16712.
Marcheselli, V.L. and Bazan, N.G. (1990) Quantitative analysis
of fatty acids in phospholipids, diacylglycerols, free fatty
acids, and other lipids. J. Nutr. Biochem., 1: 382-388.
MarcheseUi, V.L. and Bazan, N.G. (1994) Platelet-activating
factor is a messenger in the electroconvulsive shock-induced
transcriptional activation of c-fos and zif-268 in hippocampus.
J. Neurosci. Res., 37: 54-61.
Marcheselli, V.L. and Bazan, N.G. (1996) Sustained induction
of prostaglandin endoperoxide synthase-2 by seizures in hip-
pocampus: inhibition by a platelet-activating factor antagonist.
J. Biol. Chem., 271: 24794-24799.
Marcheselli, V.L., Scott, B.L., Reddy, T.S. and Bazan, N.G.
(1988) Quantitative analysis of acyl group composition of
brain phospholipids and neutral lipids, and free fatty acids. In:
A.A. Boulton, G.B. Baker and L.A. Horrocks (Eds.), Lipids
and Related Compounds, Neuromethods. Humana Press, New
Jersey, pp. 68-85.
Miettinen, S., Fusco, ER., Yrj~nheikki, J., Kein~inen, R., Hirvo-
nen, T., Roivainen, R., Narhi, M., H6kfelt, T. and Koistinaho,
J. (1997) Spreading depression and focal brain ischemia in-
duce cyclooxygenase-2 in cortical neurons through N-methyl-
D-aspartic acid-receptors and phospholipase A2. Proc. Natl.
Acad. Sci. USA, 94: 6500-6505.
Miller, B., Sarantis, M., Traynelis, S.E and Attwell, D. (1992)
Potentiation of NMDA receptor currents by arachidonic acid.
Nature (Lond.), 355: 722-725.
Moil, M., Aihara, M., Kume, K., Hamanoue, M., Kohsaka, S.
and Shimizu, T. (1996) Predominant expression of platelet-
activating factor receptor in the rat brain microglia. J. Neu-
rosci., 16: 3590-3600.
Morita, I., Schindler, M., Regier, M.K., Otto, J.C., Hori, T.,
DeWitt, D.L. and Smith, W.L. (1995) Different intracellular
locations for prostaglandin endoperoxide H synthase-1 and -2.
J. Biol. Chem., 270: 10902-10908.
Mukherjee, P.K., Decoster, M., Campbell, EZ., Davis, R.J. and
Bazan, N.G. (1999) Glutamate receptor signaling interplay
modulates stress-sensitive mitogen-activated protein kinases
and neuronal cell death. J. Biol. Chem., 274: 6493-6498.
Nakanishi, S. (1994) Metabotropic glutamate receptors: synaptic
transmission, modulation, and plasticity. Neuron, 13: 1031-
1037.
Nakayama, N., Uchimura, K., Zhu, R.L., Nagayama, T., Rose,
M.E., Stetler, R.A., Isakson, P.C., Chert, J. and Graham, S.H.
(1998) Cyclooxygenase-2 inhibition prevents delayed death of

CAI hippocampal neurons following global ischemia. Proc.
Natl. Acad. Sci. USA, 95: 10954-10959.
Nicotera, P., Bellomo, G. and Orrenius, S. (1992) Calcium-
mediated mechanisms in chemically induced cell death. Annu.
Rev. Pharmacol. Toxicol., 32: 449-470.
Nishida, K. and Markey, S.P. (1996) Platelet-activating factor in
brain regions after transient ischemia in gerbils. Stroke, 27:
514-519.
Nishizuka, Y. (1995) Protein kinase C and lipid signaling for
sustained cellular responses. FASEB J., 9: 489-496.
Ogden, E, DeCoster, M.A. and Bazan, N.G. (1998) Recom-
binant plasma-type platelet-activating factor acetylhydrolase
attenuates NMDA-induced hippocampal neuronal apoptosis. J.
Neurosci. Res., 53: 677-684.
Pace-Asciak, C.R. (1994) Hepoxilins: a review on their cellular
actions. Biochim. Biophys. Acta, 1215: 1-8.
Pacheco, M.A. and Jope, R.S. (1996) Phosphoinositide signaling
in human brain. Prog. Neurobiol., 50: 255-273.
Parker, M.A., Bazan, H.E.P., Marcheselli, V., Rodriguez de
Turco, E.B. and Bazan, N.G. (2002) Platelet-activating fac-
tor induces permeability transition and cytochrome c release
in isolated brain mitochondria, in press.
Pellerin, L. and Wolfe, L.S. (1990) Release of arachidonic acid
by NMDA-receptor activation in the rat hippocampus. Neu-
rochem. Res., 16: 983.
Peters-Golden, M., Song, K., Marshall, T. and Brock, T. (1996)
Translocation of cytosolic phospholipase A2 to the nuclear
envelope elicits topographically localized phospholipid hy-
drolysis. Biochem. J., 318: 797-803.
Pettitt, T.R. and Wakelam, M.J.O. (1999) Diacylglycerol kinase
e, but not g, selectively removes polyunsaturated diacylglyc-
erol, inducing altered protein kinase C distribution in vivo. J.
Biol. Chem., 274: 36181-36186.
Piomelli, D. (1993) Arachidonic acid in cell signaling. Curr.
Opin. Cell. Biol., 5(2): 274-280.
Piomelli, D. (1994) Eicosanoids in synaptic transmission. Crit.
Rev. Neurobiol., 8: 65-83.
Piomelli, D. and Greengard, P. (1990) Lipoxygenase metabo-
lites of arachidonic acid in neuronal transmembrane signaling.
Trends Pharmacol. Sci., 11: 367-373.
Prescott, S.M., Zimmerman, G.A., Stafforini, D.M. and McIn-
tyre, T.M. (2000) Platelet-activating factor and related lipid
mediators. Annu. Re~: Biochem., 69: 419-445.
Racine, R. (1972) Modification of seizure activity by electri-
cal stimulation. II. Motor seizure. Electroencephalogr. Clin.
Neurophysiol., 32: 281-294.
Rodriguez de Turco, E.B., Tan, W., Tophan, M.K., Sakane, E,
Marcheselli, V.L., Chen, C., Taketomi, A., Prescott, S. and
Bazan, N.G. (2001) Diacylglycerol kinase epsilon regulates
seizures susceptibility and long-term potentiation through in-
ositol lipid signaling. Proc. Natl. Acad. Sci. USA, 98: 4740-
4745.
185
Sanfeliu, C., Hunt, A. and Patel, A.J. (1990) Exposure to N-
metbyl-D-aspartate increases release of arachidonic acid in
primary cultures of rat hippocampal neurons and not in astro-
cytes. Brain Res., 526: 241-248.
Serou, M., DeCoster, M.A. and Bazan, N.G. (1999) Interleukin-I
beta activates expression of cyclooxygenase-2 and inducible
nitric oxide synthase in primary hippocampal neuronal cul-
ture: platelet-activating factor as a preferential mediator of
cyclooxygenase-2 expression. J. Neurosci. Res., 58: 593-598.
Shimizu, T. and Wolfe, L.S. (1990) Arachidonic acid cascade
and signal transduction. J. Neurochem., 55: 1-15.
Spector, A.A. and Yorek, M.A. (1985) Membrane lipid composi-
tion and cellular function. J. Lipid Res., 26: 1015-1035.
Stubbs, C.D. and Smith, A.D. (1984) The modification of mam-
malian membrane polyunsaturated fatty acid composition in
relation to membrane fluidity and function. Biochim. Biophys.
Acta, 779: 89-137.
Tang, W., Bunting, M., Zimmerman, G.A., McIntyre, T.M. and
Prescott, S.M. (1996) Molecular cloning of a novel human dia-
cylglycerol kinase highly selective for arachidonate-containing
substrates. J. Biol. Chem., 271: 10237-10241.
Tocco, G., Freire-Moar, J., Schreiber, S.S., Sakhi, S.H., Aisen,
P.S. and Pasinetti, G.M. (1997) Maturation regulation and re-
gional induction of cyclooxygenase-2 in rat brain: implications
for AIzheimer's disease. Exp. Neurol., 144: 339-349.
Tu, B. and Bazan, N.G. (submitted) Hippocampal kindling
epileptogenesis upregulates neuronal neocortical COX-2 ex-
pression.
Vane, J.R., Bakhle, Y.S. and Botting, R.M. (1998) Cyclooxyge-
nases 1 and 2. Annu. Rev. Pharmacol. Toxieol., 38: 97-120.
Vesce, S., Bezzi, P. and Volterra, A. (1999) The highly integrated
dialogue between neurons and astrocytes in brain function.
Sci. Prog., 82: 251-270.
Volterra, A., Trotti, D., Cassutti, P., Tromba, C., Galimberti, R.,
Lecchi, P. and Racgni, G. (1992) A role for the arachidonic
acid cascade in fast synaptic modulation: ion channels and
transmitter uptake systems as target proteins. Adv. Exp. Med.
Biol., 3138: 147-158.
Wieraszko, A., Li, G., Kornecki, E., Hogan, M.V. and Ehrlich,
Y.H. (1993) Long-term potential in the hippocampus induced
by platelet-activating factor. Neuron, 10: 553-557.
Wilsch, V.W., Behnisch, T., Jager, T., Reymann, K.G. and
Balschun, D. (1998) When are class I metabotropic glutamate
receptors necessary for long-term potentiation?. J. Neurosci.,
18: 6071-6080.
Yamagata, K., Andreasson, K.I., Kaufmann, W.E., Barnes, C.A.
and Worley, RE (1993) Expression of a mitogen-inducible cy-
clooxygenase in brain neurons: Regulation by synaptic activity
and glucocorticoids. Neuron, 11: 371-386.
Yeagle, EL. (1989) Lipid regulation of cell membrane structure
and function. FASEB J., 3: 1833-1842.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All fights reserved

CHAPTER 16

The role of mitochondria and oxidative stress in neuronal

damage after brief and prolonged seizures

H a n n a h R. C o c k *

Department of Clinical and Experimental Epilepsy, Institute of Neurology, Queen Square, London WCIN 3BG, UK

Abstract: Studies in vitro and in other disease states where excitotoxicity is believed to be important have demonstrated
that mitochondrial function is a critical determinant of cell death, reflecting key roles in intracellular calcium homeostasis,
energy production and oxidative stress. Central to this is the process of mitochondrial permeability transition, for which
there are numerous influencing factors, although many, if not all, may specifically act though effects on the redox state
of the cell and oxidative stress. Mitochondrial function in relation to seizure-induced cell death has been little studied
until recently, but there is now accumulating evidence that similar mechanisms operate, certainly in cell death, following
prolonged seizures. To what extent these same mechanisms might contribute to non-fatal but pathologically significant
functional cellular changes in epilepsy, and the significance of reported free radical production after brief seizures is as yet
uncertain. However, with the wide range of established techniques available to study mitochondrial function and oxidative
stress, and those currently under development, these questions are undoubtedly answerable in the near future. Increased
understanding of the mechanisms involved in seizure-induced cellular damage is an essential basis for the development of
rational neuroprotective strategies.

Introduction then summarize the major conclusions from studies

Seizure activity results in a large number of changes
and cascades of events at a cellular level. Changes
in gene expression, receptor composition, synaptic
physiology and the activation of some late cell death
pathways (e.g. caspase activation) will have been
covered elsewhere. This chapter will focus on the
potential role of mitochondria, including their ca-
pacity to produce free radicals, in seizure-associated
neuronal damage. Following an introduction to nor-
mal mitochondrial functions, I will briefly discuss
some of the methodological issues in this area. I will
* Correspondence to: H.R. Cock, Department of Clinical
and Experimental Epilepsy, Institute of Neurology, Queen
Square, London WC1N 3BG, UK. Tel.: -t-44-207-837-
3611, ext. 4256; Fax: +44-207-278-5616;
E-mail: h.cock@ion.uct.ac.uk
on neuronal death in vitro and in other disease states,
where there has been extensive work on excitotoxic
cell death, which underpins the more limited work to
date in epilepsy. Finally, I will review the work that
has been done in this field with respect to seizure-
associated cell death, before concluding with my
own perspective on the future in this area.
Mitochondrial structure and function
Mitochondria are ubiquitous intracellular organelles,
whose primary function is the production of cel-
lular energy in the form of adenosine triphospate
(ATP) from food-derived fuels. Each mitochon-
drion (Fig. 1) consists of a double membrane-
bound structure, with an internal matrix in which
many metabolic systems involved in breaking down
food fuels reside. These include the fatty acid [~-
oxidation enzymes, and those of the tricarboxylic
188
glugose
0 mtDI
MP"
Inner membrane//
outer membrane
Fig. 1. Schematicrepresentationof a mitochondrion.See text for details, mtDNA,mitochondrialDNA; MPT,mitochondrialpermeability
transition; TCA, tricarboxylicacid cycle; I, II, III, IV, V, complexesof the mitochondrialrespiratorychain.
acid (TCA/Kreb's) cycle to break down carbohy-
drates. Electrons from these systems are passed
to the mitochondrial respiratory chain (MRC) sit-
uated on the inner mitochondrial membrane, which
through a series of enzymatic processes (complexes
I-IV), passes the electrons to the final acceptor, oxy-
gen, which is reduced to water (Darley-Usmar et al.,
1994). At complexes I, III and IV, electron transport
is coupled to vectoral proton translocation, creating
an electrochemical gradient across the inner mito-
chondrial membrane. This potential energy is then
utilized by Complex V to generate ATE ATP is the
basic unit of cellular energy and as such not only a
pre-requisite for cell survival, but also essential for
a wide range of cellular functions (McCormack and
Denton, 1994), including several ionic homeosta-
sis mechanisms (e.g. Na+-K + ATPase; Na+-Ca 2--
ATPase), repair systems, and the ability of neurons
to generate action potentials.
In addition to their oxidative metabolism func-
tion, mitochondria play a key role in a variety of
other processes believed to be important in cell
death (Fig. 2). Mitochondria are crucial to intra-
fatty acids
cellular calcium homeostasis (Duchen, 2000), and
possess several calcium transport systems (Nicholls,
1985). The concentration of free intracellular cal-
cium is central to normal neuronal functioning, and
in turn this has been shown to be critically dependent
on functioning mitochondria, as well as secondarily
on sodium/calcium exchange (White and Reynolds,
1995). Intramitochondrial calcium levels also have
important regulatory functions, including direct in-
fluence on enzymes of the TCA cycle and conse-
quent metabolic rate, which will be further discussed
by Heinemann et al. (2002, this volume).
Finally, the MRC has long been recognized as
the major source of free radicals in the cell (Cade-
nas et al., 1977). Free radicals are highly reactive
oxygen species, which, unopposed, can damage all
cell structures, including lipids, proteins and DNA
(Halliwell and Gutteridge, 1985). Some radicals are
toxic via secondary reactions, one of the most im-
portant being the production of the highly damaging
peroxynitrite from nitric oxide and the superoxide
radical. Mitochondria possess a calcium-dependent
nitric oxide synthase, thus have the potential for per-
 189

Glutamate

_ ~ C a ++ ""~

MPT ~ /--/"~ "/ /

Caspase , ~ ~ ~-,~.t ~l~r"v // Repa~ system
ATPase activation L ~ Tca*÷~J"-"~"-'"-'~/ ......... Proteins ~,~ .

| ATP ~ ............ \,, ~i /" ....

Free ~[adicals "

Antioxidants

Fig. 2. Mechanisms of mitochondrial involvementin excitotoxic cell death in a single neuron. Points of interaction are represented
by arrows, see text for details. ONOO-, peroxynitrite; nNOS, neuronal nitric oxide synthase; NO, nitric oxide; MPT, mitochondrial
permeability transition.

oxynitrite production in addition to those directly
produced by the MRC. Under physiological condi-
tions numerous antioxidant systems exist, including
superoxide dismutase, catalase, and glutathione, to
'mop' up any free radicals as soon as they are pro-
duced. Under pathological conditions, however, this
balance can be disturbed, either due to an excess
production of free radicals, or failure of the normal
antioxidant systems, resulting in a state known as
oxidative stress. As inhibition of the MRC results
in excess free radical production, and free radicals
themselves are direct inhibitors of the MRC (Zhang
et al., 1990) this can result in a vicious cycle leading
to considerable oxidative cell damage. Furthermore,
the inherent biochemical and physiological charac-
teristics of the brain, including high lipid content and
energy requirements make it particularly susceptible
to oxidative damage.
Reflecting their central role in cellular metabo-
lism, mitochondria have been proposed to act as the
'stress sensor', and in extreme circumstances 'exe-
cutioner' of the cell (Green and Reed, 1998). Pivotal
to this role is a process known as mitochondrial
permeability transition (MPT). This is traditionally
represented as a pore straddling the two membranes
which when opened releases large molecules includ-
ing cytochrome c in to the cell cytoplasm (Martinou,
1999). This not only directly activates known cell
death pathways (e.g. caspases), but also dissipates
the mitochondrial membrane potential crucial to ox-
idative phosphorylation. To date, although it is gen-
erally agreed that MPT is protein mediated, no novel
190
inner membrane pore with appropriate characteris-
tics has been identified, and MPT is almost certainly
caused by a group of modified and assembled in-
ner and outer membrane components, including the
ADP/ATP translocator, cyclophillin D and possibly
porin and hexokinase (Kowaltowski et al., 2001).
Numerous factors are known to regulate MPT both
from within the mitochondria (e.g. calcium, oxida-
tive stress, membrane potential) and the cytosol (e.g.
bcl-2 proteins, nitric oxide) (Kroemer and Reed,
2000); however, there is evidence to suggest that
oxidative stress links all of these factors and is the
critical determinant (Kowaltowski et al., 2001).
Methods for assessing mitochondrial
function/oxidative stress
Many of the methods used to study mitochondria and
oxidative stress are well established, and have been
extensively validated over many years. These in-
clude spectrophotometric analysis of MRC and ma-
trix enzyme activities, and substrate-linked respira-
tion studies using oxygen electrodes (polarography:
Darley-Usmar et al., 1994). These can be applied to
tissue homogenates, purified mitochondrial/enzyme
preparations, or in the case of polarography to brain
slice preparations. HPLC methods can quantify a
variety of important metabolites (e.g. glutathione,
N-acetyl aspartate (Heales et al., 1995)), and gene
expression and protein synthesis within mitochon-
dria can also be readily studied (Darley-Usmar et
al., 1994). Various patterns of enzymatic inactivation
in relation to particular insult type/mechanisms are
also well recognized. For instance, complex I of the
respiratory chain is particular susceptible to super-
oxide damage (Zhang et al., 1990), and the matrix
enzyme aconitase is readily inactivated in the pres-
ence of peroxynitrite (Gardner et al., 1994). Methods
for measuring ionic transport across mitochondrial
membranes (e.g. calcium) and mitochondrial mem-
brane potential are also available, most involving
the use of fluorescent dyes (e.g. Schuchmann et al.,
2000).
Fluorescent dyes can also be used to detect free
radical production in vitro and ex-vivo, but do have
limitations with variable auto-oxidation, photocon-
version and retention in cells, and possible direct
effects themselves on mitochondrial function (Buck-
man et al., 2001). Free radical detection, particularly
in vivo, is difficult due to their short half-life and
low concentrations. Direct colorimetric and lumi-
nescent probes (e.g. nitro-blue tetrazoleum (NBT),
cytochrome c reduction (Bauknight et al., 1992))
only measure free radicals that leave cells, making
them of limited value. Most commonly, investigators
instead look for evidence of free radical damage, and
there are established methods for quantifying lipid
(http: / / www.oxisresearch.com / products / assays),
protein (Cini and Moretti, 1995) and DNA oxida-
tion (Williams et al., 1998). This is a vast field,
and I have been able only to touch on what is a
formidable repertoire of available techniques avail-
able in addition to which new refinements to many
are constantly developing.
Mitochondria, oxidative stress and cell death
Mitochondria and excitotoxic cell death
As will have been discussed in previous chapters,
and has been comprehensively reviewed elsewhere
(Meldrum, 1993), cell death in epilepsy is believed
to involve excitotoxicity, whereby excessive gluta-
mate causes over stimulation of the post-synaptic
NMDA receptors, with a resultant accumulation of
intracellular calcium leading to ultimately to cell
death. Excitotoxic cell death is also believed to be
important in a wide range of other diseases includ-
ing stroke, trauma and neurodegenerative conditions
(Sattler and Tymianski, 2000), where it has been
extensively studied.
Conventional thinking in recent years has subclas-
sifted cell death as either necrotic (acute) or apoptotic
(delayed) on largely morphological grounds (Bon-
foco et al., 1995). Apoptosis is an energy-requiring
process, thus mitochondrial respiratory function is
believed to be a critical determinant of the mode
of excitotoxic cell death (Ankarcrona et al., 1995):
essentially where MRC function is significantly im-
paired, for example due to oxidative damage, necro-
sis occurs; in contrast, where there is adequate MRC
function to survive the initial insult, a delayed cell
death by apoptosis occurs. The definition of apopto-
sis, however, is primarily a morphological one (Kerr,
1971), and other than implying a certain energy re-
serve within the cell at the time of commitment

to death, its presence alone does not tell us what
mechanisms initiated the process. Furthermore it
is increasingly accepted that neuronal apoptosis in
the context of excitotoxicity differs from 'classical'
apoptosis (originally described in a developmental
context). The primary event in the latter has been
considered to be independent of mitochondrial func-
tion, being genetically based and protein activated,
and focused on the caspase-8 activation pathway
(Ashkenazi and Dixit, 1998). In contrast, in exci-
totoxicity, the primary event probably centers on
mitochondrial dysfunction, involving calcium influx
and oxidative stress, with secondary MPT and cas-
pase (9) activation. However, secondary changes in
mitochondrial function including MPT can and un-
doubtedly do occur in classical apoptosis, and in the
context of excitotoxicity and neurodegenerative dis-
eases, features of both necrosis and apoptosis may
identifiable in individual cells. Furthermore, in neu-
ral tissue 'apoptosis' can be variably triggered by
a variety of 'necrotic' insults (Roy and Sapolsky,
1999) making classification somewhat confusing.
The distinction has been further confounded by the
relative non-specificity of some of the methods used
(e.g. TUNEL histochemistry) to identify apoptotic
changes (Charriaut-Marlangue and Ben-Ari, 1995).
Thus some authors have argued that the distinction
between apoptosis and necrosis in excitotoxic cell
death is somewhat artificial, each representing one
end of a continuum depending on the nature/severity
of the causative insult and properties of the cell in
question (Martin et al., 1998). From a pragmatic
perspective, in the context of seizure-related cell
death, many of the involved mechanisms are prob-
ably common to both 'excitotoxic apoptosis' and
'necrosis'. For this reason, in the rest of this chap-
ter I will be referring to excitotoxic cell death as
a whole, without drawing mechanistic conclusions
from morphological data. I will focus on the role
of mitochondria and oxidative stress, but not be
discussing pathways specific to the development of
apoptotic changes (e.g. caspases activation, genetic
regulation of MPT) as these will have been covered
elsewhere in this volume. Neither will I cover the un-
doubtedly important role of bioactive lipid pathways,
although these can affect mitochondrial function, as
this will be covered by Bazan et al. (2002, this
volume).
191
Studies in vitro and in other disease status have
highlighted a number of mechanisms contributing
to excitotoxic cell death (Fig. 2). These include
calcium influx into the cell (Hartley et al., 1993),
oxidative damage via the production of free radicals
(Beal, 1996; Lafoncazal et al., 1993), and specifically
mitochondrial nitric oxide/peroxynitrite production
(Almeida et al., 1998).
Of note, from a mitochondrial perspective, it ap-
pears that ATP depletion, although it may lower the
threshold for cell death, is not the crucial step. Elo-
quent studies have demonstrated that impairment of
mitochondrial calcium sequestration is the key de-
terminant (Stout et al., 1999). This in turn requires
ATE but is also in part potential driven, involving
the MPT pore mentioned previously (Schinder et al.,
1996). Thus even in the presence of adequate ATP,
if the mitochondrion is unable to sequester calcium
cell death ensues.
It is likely that all of these factors contribute
to excitotoxic cell death, though some may be
more important than others depending on the ex-
act system/disease under study. Equally, there are
numerous ways of counteracting each of these parts
of the cascade (e.g. calcium channel blockers, an-
tioxidants). The key in addressing this in epilepsy,
however, is to ascertain which, if any, of these mech-
anisms are important in seizure-associated cell death.
Non-fatal cell damage
Whilst the focus of this book has concentrated
largely on cell death, it should be remembered that
the same cellular mechanisms might also result in
non-fatal cell damage and dysfunction. Free radicals,
probably through membrane (lipid) oxidation may
influence channel/receptor function (reviewed by
Cock and Schapira, 1999). Oxidative protein modi-
fications (Orrenius et al., 1992) have wide potential
ramifications, and calcium is recognized as a key
messenger in a range of cell functions (Duchen,
2000), including probable feedback inhibition of the
NMDA receptor (Rosenmund et al., 1995), and regu-
lation metabolic activity. Thus understanding of cell
death mechanisms could have a wider application in
preventing perhaps more widespread non-fatal func-
tional damage, although to date this possibility has
been little explored.
t92
Evidence for mitochondrial
dysfunction/oxidative stress in epilepsy
The first observation to make is that compared to
the wealth of in vitro data on excitotoxicity, and the
large number of studies in other disease states, both
using animal models and human samples, there is
a relative paucity of data about mitochondrial func-
tion and oxidative stress in epilepsy. In part, this
probably reflects that human epilepsy, by definition
with spontaneous seizures is not a condition easily
modelled, and the study of human tissue is largely
confined to surgical specimens or post-mortem ma-
terial, which inevitably represents the end stage of
whatever processes are occurring. What data there is
largely relates to prolonged seizures (status epilep-
ticus). I will review this first, before going on to
the little data on brief seizures, and drawing some
conclusions.
In vitro evidence of oxidative stress/mitochondrial
dysfunction
Frantseva et al. (1999) have reported studies using
fluorescent dyes in hippocampal slice preparations.
These dyes have limitations, as discussed previously,
and of course epilepsy, with clinical manifestations
by definition, cannot be replicated in a slice. How-
ever, hippocampal slices are widely used to study
synaptic physiology and ionic changes, and the re-
ported results are persuasive. Rhythmic synchronous
activity was induced with topical bicuculline, and in-
creased free radical production was apparent within
10-15 min, particularly in the CA3 region where
neurons subsequently degenerated. Both the free rad-
ical production and cell death correlated with a per-
sistent and progressive increase in intracellular cal-
cium, beyond the duration of activity. Heinemann et
al. (2002, this volume) have taken this a stage further
using similar methods applied to organotypic slice
cultures and a variety of seizure inducers. This has
demonstrated a clear relationship between neuronal
activity, intramitochondrial calcium handling, meta-
bolic rate and mitochondrial depolarization, which
would be anticipated to lead to cell death. It has
been further demonstrated (Frantseva et al., 2000)
that free radical scavengers (vitamin E and glu-
tathione) significantly reduced the seizure-induced
neurodegeneration, suggesting that free radical over-
production is directly related to seizure-induced cell
death.
In vivo studies of oxidative stress/mitochondrial
function after prolonged seizures
There have been a number of studies looking for
evidence of oxidative damage following seizures, but
most involve acute seizure provocation models and
it is not possible to definitively separate the effect
of the agent used (e.g. iron, bicuculline, kainate)
from the seizures per se. This is particularly true for
iron, which is well recognized as a potent stimulant
of free radical production in its own right (Gut-
teridge, 1992). Intracortical iron, used as a model
of post-traumatic epilepsy, certainly produces both
free radicals (mainly hydroxyl radical) and seizures
(e.g. Kucukkaya et al., 1998), but cause and ef-
fect have not been clearly established. Pretreatment
with free radical scavengers (adenosine (Yokoi et
al., 1995) and melatonin (Kabuto et al., 1998)) have
been shown to reduce iron-induced hydroxyl radical
production in vitro, and variably delay/prevent the
occurrence of spike discharges in vivo in this model.
However, both have adenosine and melatonin have
actions in addition to their antioxidant capacities,
and the conclusion that free radical scavenging sup-
presses the epileptogenesis following iron injection
is perhaps premature.
A number of groups have looked at oxidative
stress in kainate-induced seizures. Bruce and Baudry
(1995) demonstrated that in the early stages (8-16
h) after prolonged (5-6 h) seizure activity, there was
increased lipid peroxidation and protein oxidation
in regional brain homogenates, correlating with and
preceding histological cell damage that was most ap-
parent at 5 days post-status (predominantly affecting
CA1 and CA3 in mature, but not young animals).
There was also a later (5 days post-status) increase
in antioxidant enzyme activities (glutathione peroxi-
dase), postulated to reflect compensatory micro-glial
activation and proliferation. Gulyaeva et al. (1999)
reported similar findings with evidence of lipid per-
oxidation, and reduced glutathione levels 3 days after
kainate-induced status. Melatonin pretreatment has
also been studied in this model, and shown to par-
tially ameliorate the development of acute seizures

(Giusti et al., 1996) and neuronal damage (Uz et
al., 1996; TUNEL and Nissl staining at 72 h). This
is all in keeping with the hypothesis that oxidative
stress plays an early role in the cascade to cell death
in kainate-induced excitotoxicity. The anticonvulsant
and antioxidant effects of melatonin cannot be dis-
tinguished in these studies. However, further support
for the hypothesis has been provided by studies in-
volving pretreatment with a synthetic antioxidant
(EUK-134), which had no effect on kainate-induced
seizures, also partially ameliorated early evidence of
oxidative stress (specific gene induction, and nitroty-
rosine immunohistochemistry at 8-16 h post-status)
and histological damage evident at 5 days (Rong et
al., 1999).
A handful of studies in other chemoconvulsant
models have also been reported: (Bauknight et al.,
1992) demonstrated increased free radicals (spec-
trophotometric analysis of the SOD inhibitable re-
duction of NBT) in the CSF overlying the seizure fo-
cus (bicuculline-induced) in cats; Rauca et al. (1999)
studied free radical production after acutely pro-
voked and kindled seizures following pentylenete-
trazole administration to rats. The method used is
reported to detect free hydroxyl radicals, trapped by
systemically applied salicylate, resulting in a stable
and quantifiable product. Increased free radical pro-
duction was seen in the early minutes (1-15) after
acute or kindled seizures, but had normalized by 60
rain. However despite the small number and limita-
tions of some of these studies, the overall message is
consistent - - supporting free radical production as a
consequence of seizures.
In contrast to the more detailed studies of MRC
function and other enzyme systems known to be sen-
sitive to oxidative stress, undertaken in other disease
models, there has been little in this area in epilepsy.
Kunz et al. (1999) have performed polarography and
fluorescent spectroscopy on hippocampal slices pre-
pared from kainate treated rats. The animals were
sacrificed at least a month after initial kainate treat-
ment, having exhibited initial status and subsequent
spontaneous seizures. The main finding was an in-
crease in oxidative metabolic rates in the seizure
animals compared to controls, suggested to rep-
resent increased mitochondrial energy turnover, in
turn possibly reflecting futile calcium cycling, which
would fit with existing hypotheses. Markers of oxida-
193
tive stress, or individual enzyme activities were not,
however, reported so no conclusions can be drawn
in this respect. Our own work has been in the per-
forant path stimulation model of status epilepticus,
which avoids the potentially confounding effects of
extrinsic chemoconvulsants (Cock et al., 2002). We
have observed significant decreases in the activities
of aconitase and a-ketoglutarate dehydrogenase, two
mitochondrial enzymes known to be critically sensi-
tive to oxidative stress, particularly involving nitric
oxide (peroxynitrite), as well as reduced levels of
glutathione, in the brain homogenates of status an-
imals compared to sham-operated controls. These
changes were detectable up to 40 h after the 5 h of
seizure activity, and preceded maximal histological
neuronal damage (detected at 8 days post-status in
this study), again supporting a role for free radical
production in the pathogenesis of cell death after
prolonged seizures.
In vivo studies of oxidative stress/mitochondrial
dysfunction after brief seizures
There has been less work looking for oxidative
stress after brief seizures. Following electroconvul-
sive shock in rats, an acute decrease in regional
brain antioxidant levels has been reported (Erakovic
et al., 2000), persisting for at least 48 h after a sin-
gle seizure, although exact seizure duration is not
specified in the paper. The decrease was even more
marked where there had been repeated brief seizures.
This could be either as a result of, or contributing
to, oxidative stress in this model, and direct evidence
of free radical production was not sought. Arnaiz et
al. (1998) used a chemiluminescent assay to look for
lipid peroxidation after 3-mercaptopropionic acid-
induced seizures in rats. Even in animals sacrificed
during the seizures (3-6 min after onset), a 20-40%
increase in lipid peroxidation was found in some vul-
nerable brain regions, although not in all. This had
largely normalized 20 min later, which is somewhat
surprising given the rate of lipid turnover, and total
antioxidant capacity did not change at all through-
out. An immediate increase in free radical production
following individual seizures has also been demon-
strated in PTZ-kindled animals (Rauca et al., 1999).
Thus it does appear that even brief seizures can in-
crease free radical production, though perhaps only
194
very transiently and the patho-physiological conse-
quences of this have not been sufficiently elucidated
to draw further conclusions.
Human studies of oxidative stress/mitochondrial
function in epilepsy
Studies of mitochondrial function using spectropho-
tometric enzyme analysis on regional brain ho-
mogenates, and polarography on hippocampal slices
have been reported from 40 surgical resection spec-
imens from patients with hippocampal sclerosis
(Kudin et al., 1999). Control tissue is of course
difficult to obtain for such studies, and the three
'controls' had pathologically normal hippocampi,
but did also have epilepsy associated with other le-
sions. Complex I activity was found to be decreased
in the CA3 region in the sclerosed specimens, and
the authors speculate that this might be of signifi-
cance in the pathogenesis of temporal lobe epilepsy.
However, whilst clearly of interest, it is difficult to
draw mechanistic conclusions from such work as
the tissue clearly represents the end stage of a very
long process, both in terms of neuronal damage and
epileptogenesis. Further studies of this nature in ap-
propriate disease models may help address this issue,
and are underway in our own laboratory.
Conclusions and areas for future attention
Overall, the fairly consistent data from a range of
animal models, suggests that impaired mitochon-
drial calcium handling and significant free radical
production occur following prolonged seizures, and
furthermore that there is evidence of local oxidative
cell damage preceding neuronal death in vulnerable
brain regions. Many of the models studied have only
complex partial seizures, without additional cardio-
respiratory compromise, and the changes observed
can probably be ascribed directly to the seizure
activity, particularly where extrinsic chemoconvul-
sants have been avoided. Following status epilep-
ticus, there appears to be a potential therapeutic
window following status of at least a few hours, al-
though all the neuroprotective studies to date in this
area have involved antioxidant pre-treatment, so this
is at present speculative. However, it is by no means
clear which free radicals are of particular impor-
tance in epilepsy (e.g. hydroxl radicals, superoxide,
peroxynitrite?), where they come from, or which
cell components are especially vulnerable (e.g. lipid
membranes, MRC or other enzymes, channels or
receptors etc.). Different antioxidant neuroprotective
strategies may apply depending on the particular
mechanisms operate (e.g. glutathione mainly pro-
tects against complex I damage, vitamin E against
complex IV), and 'random' neuroprotective attempts
without a good understanding are probably inappro-
priate (Delanty and Dichter, 2000). Perhaps more
important to establish is to what extent the various
pathways activated act in parallel or in series. If the
former applies, then multiple neuroprotective strate-
gies would be needed to prevent cell death/damage,
either via a single agent with multiple actions, or
using multiple agents. Such an approach is clearly
likely to have more widespread, perhaps damaging,
implications on other cell functions and may ac-
count for why antioxidant/neuroprotective strategies
in the clinical arena have been so disappointing to
date (Delanty and Dichter, 2000). It is further pos-
sible that different mechanisms will prove important
in different models and in different epilepsy syn-
dromes, which will need to be considered in experi-
mental design. However, despite these hurdles, there
are a number of well-established techniques in this
area, which have been sparsely applied to epilepsy
models, so further laboratory-based work addressing
these questions is clearly not only necessary, but
possible. This should be followed by rationale ap-
propriately designed clinical trials of neuroprotective
strategies both in animal models and in man, based
on an increased understanding of the mechanisms
involved in epilepsy.
The question of whether repeated brief seizures
might be trigger the same mechanism(s) also needs
addressing from the mitochondrial/oxidative stress
perspective. The results of Rauca et al. (1999) sug-
gest that any oxidative stress with brief seizures may
be short lived. If this finding is replicated in other
models, it would suggest a very short window of
opportunity for antioxidant therapy in the acute sit-
uation, but there may be a cumulative effect with
frequent seizures such that prophylaxis in patients
with chronic epilepsy may be justified. A random-
ized double blind trial of vitamin E in children with
epilepsy (Ogunmekan and Hwang, 1989) showed

that 10 o f the 12 in the t r e a t m e n t group had at
least a 6 0 % i m p r o v e m e n t in seizure f r e q u e n c y o v e r
a 3 - m o n t h p e r i o d c o m p a r e d to n o n e in the p l a c e b o
group. A l t h o u g h this is a single small study, and
it has perhaps surprisingly not b e e n replicated on
a larger scale, this surely should fuel the n e e d for
m o r e w o r k in this area, both in a n i m a l models, and
u l t i m a t e l y in man.
Acknowledgements
W i t h thanks to collaborators on m y o w n w o r k at
the Institute o f N e u r o l o g y : S i m o n Shorvon, M a t t h e w
Walker, Phillip Patsalos, X i n Tong ( D e p a r t m e n t o f
C l i n i c a l and E x p e r i m e n t a l Epilepsy); J o h n Clark, Si-
m o n H e a l e s , Iain H a r g r e a v e s ( D e p a r t m e n t o f N e u r o -
chemistry); Maria Thom; Mike Groves (Department
o f N e u r o p a t h o l o g y ) and to Tony S c h a p i r a at the
Royal Free Hospital Department of Clinical Neuro-
sciences.
References
Almeida, A., Heales, S.R., Bolanos, J.E and Medina, J.M.
(1998) Glutamate neurotoxicity is associated with nitric oxide-
mediated mitochondrial dysfunction and glutathione depletion.
Brain Res., 790: 209-216.
Ankarcrona, M., Dypbukt, J.M., Bonfoco, E., Zhivotovsky, B.,
Orrenius, S., Lipton, S.A. and Nicotera, P. (1995) Glutamate-
induced neuronal death: a succession of necrosis or apoptosis
depending on mitochondrial function. Neuron, 15: 961-973.
Arnaiz, S.L., Travacio, M., Llesuy, S. and Arnaiz, G.R.D. (1998)
Regional vulnerability to oxidative stress in a model of experi-
mental epilepsy. Neuroehem. Res., 23: 1477-1483.
Ashkenazi, A. and Dixit, V.M. (1998) Death receptors: signalling
and modulation. Science, 281: 1305-1308.
Bauknigbt, G.C., Wei, E.E and Kontos, H.A. (1992) Superoxide
production in experimental seizures in cats. Stroke, 23: 1512-
1514.
Bazan, N.G., Tu, B. and Rodriguez de Turco, E.B. (2002) What
synaptic lipid signaling tells us about seizure-induced damage
and epileptogenesis. In: T. Sutula and A. Pitk~inen (Eds.), Do
Seizures Damage the Brain. Progress in Brain Research, Vol.
135. Elsevier, Amsterdam, pp. 175-185.
Beal, M.E (1996) Mitochondria, free radicals, and neurodegen-
eration. Curr. Opin. Neurobiol., 6: 661-666.
Bonfoco, E., Krainc, D., Ankarcrona, M., Nicotera, P. and Lip-
ton, S.A. (1995) Apoptosis and necrosis: two distinct events
induced, respectively, by mild and intense insults with N-
methyl-D-aspartate or nitric oxide/superoxide in cortical cell
cultures. Proc. Natl. Acad. Sci. USA, 92: 7162-7166.
Bruce, A.J. and Bandry, M. (1995) Oxygen-free radicals in rat
195
limbic structures after kainate-induced seizures. Free Radic.
Biol. Med., 18: 993-1002.
Buckman, J.E, Hernandez, H., Kress, G.J., Votyakova, T.V., Pal,
S. and Reynolds, I.J. (2001) MitoTracker labeling in primary
neuronal and astrocytic cultures: influence of mitochondftal
membrane potential and oxidants. J. Neurosci. Methods, 104:
165-176.
Cadenas, E., Boveris, A., Ragan, C.I. and Stoppani, A.O.M.
(1977) Production of superoxide radicals and hydrogen perox-
ide by NADH-ubiquinone reductase and ubiquinol-cytochrome
c reductase from beef heart mitochondria. Arch. Biochem. Bio-
phys., 180: 248-257.
Charriaut-Marlangue, C. and Ben-Aft, Y. (1995) A cautionary
note on the use of the TUNEL stain to determine apoptosis.
NeuroReport, 7: 61-64.
Cini, M. and Moretti, A. (1995) Studies on lipid peroxidation
and protein oxidation in the ageing brain. Neurobiol. Ageing,
16: 53-57.
Cock, H.R. and Schapira, A.H.V. (1999) Mitochondrial DNA
mutations and mitochondrial dysfunction in epilepsy. Epilep-
sia, 40: 33-40.
Cock, H.R., Tong, X., Hargreaves, I.P., Heales, S.J.R., Clark,
J.B., Patsalos, P.N., Thorn, M., Groves, M., Schapira, A.H.V.,
Shorvon, S.D. and Walker, M.C. (2002) Mitochondrial dys-
function associated with neuronal death following status
epilepticus in rat. Epilepsy Res., in press.
Darley-Usmar, V.M., Ragan, C.I., Smith, P.R. and Wilson, M.T.
(1994) The proteins of the mitochondrial inner membrane and
their role in oxidative phosphorylation. In: V.M. Darley-Usmar
and A.H.V. Schapira (Eds.), Mitochondria: DNA, Proteins
and D&ease, Portland Press Research Monographs. Portland
Press, London, pp. 1-27.
Delanty, N. and Dichter, M.A. (2000) Antioxidant therapy in
neurologic disease. Arch. NeuroL, 57: 1265-1270.
Duchen, M.R. (2000) Mitochondria and calcium: from cell sig-
nalling to cell death. J. PhysioL, 529: 57-68.
Erakovic, V., Zupan, G., Varljen, J., Radosevic, S. and Simonic,
A. (2000) Electroconvulsive shock in rats: changes in superox-
ide dismutase and glutathione peroxidase activity. Mol. Brain
Res., 76: 266-274.
Frantseva, M.V., Velazquez, J.L.E, Hwang, EA. and Carlen, EL.
(1999) Free radical production correlates with cell death in an
in vitro model of epilepsy. Epilepsia, 40: 139-140.
Frantseva, M.V., Velazquez, J.L.E, Hwang, P.A. and Carlen, EL.
(2000) Free radical production correlates with cell death in an
in vitro model of epilepsy. Eur. J. Neurosci., 12: 1431-1439.
Gardner, ER., Nguyen, D.D. and White, C.W. (1994) Aconitase
is a sensitive and critical target of oxygen poisoning in cul-
tured mammalian cells and in rat lungs. Proc. Natl. Acad. Sci.
USA, 91: 12248-12252.
Giusti, E, Lipartiti, M, Franceschini, D., Schiavo, N., Floreani,
M. and Manev, H. (1996) Neuroprotection by melatonin from
kainate-induced excitotoxicity in rats. FASEB J., 10: 891-896.
Green, D.R. and Reed, J.C. (1998) Mitochondria and apoptosis.
Science, 281: 1309-1310.
Gulyaeva, N.V., Stepanichev, M . Y . , Onufftev, M.V.,
Chernyavskaya, L.I., Moiseeva, Y.V., Lazareva, N.A. and Fliss,
196
H. (1999) Seizure severity in kainic acid-treated rats correlates
with transcriptional activity, oxidative stress, and apoptosis in
the hippocampus. J. Neurochem., 73: $9.
Gutteridge, J.M.C. (1992) Iron and oxygen radicals in brain.
Ann. Neurol., 32: S16-$21.
Halliwell, B. and Gutteridge, J.M.C. (1985) Free Radicals in
Biology and Medicine. Clarendon Press, Oxford.
Hartley, D.M., Kurth, M.C., Bjerkness, L., Weiss, J.H. and Choi,
D.W. (1993) Glutamate receptor induced 45Ca2+ accumulation
in cortical cell culture correlates with subsequent neuronal
degeneration. J. Neurosci., 13: 1993-2000.
Heales, S.J., Davies, S.E.C., Bates, T. and Clark, J.B. (1995)
Depletion of brain glutathione is accompanied by impaired
mitochondrial function and decreased N-acetyl aspartate con-
centration. Neurochem. Res., 20: 31-38.
Heinemann, U., Buchheim, K., Gabriel, S., Kann, O., Kovacs,
R. and Schuchmann, S. (2002) Cell death and metabolic
activity during epileptiform discharges and status epilepticus
in the hippocampus. In: T. Sutula and A. Pitk~inen (Eds.), Do
Seizures Damage the Brain. Progress in Brain Research, Vol.
135. Elsevier, Amsterdam, pp. 197-210.
Kabuto, H., Yokoi, I. and Ogawa, N. (1998) Melatonin inhibits
iron-induced epileptic discharges in rats by suppressing perox-
idation. Epilepsia, 39: 237-243.
Kerr, J.ER. (1971) Shrinkage necrosis: a distinct mode of cellular
death. J. Pathol., 105: 13-20.
Kowaltowski, A.J., Castilho, R.E and Vercesi, A.E. (2001) Mi-
tochondrial permeability transition and oxidative stress. FEBS
Lett., 495: 12-15.
Kroemer, G. and Reed, J.C. (2000) Mitochondrial control of cell
death. Nat. Med., 6: 513-519.
Kucukkaya, B., Aker, R., Yuksel, M., Onat, E and Yalcin,
A.S. (1998) Low dose MK-801 protects against iron-induced
oxidative changes in a rat model of focal epilepsy. Brain Res.,
788: 133-136.
Kudin, A., Vielhaber, S., Beck, H., Elger, E.C. and Knnz, W.S.
(1999) Mitochondrial respiratory chain complex I deficiency
in human epileptic hippocampus. J. Neurochem., 73: $217.
Kunz, W.S., Goussakov, I.V., Beck, H. and Elger, C.E. (1999) Al-
tered mitochondrial oxidative phosphorylation in hippocampal
slices of kainate-treated rats. Brain Res., 826: 236-242.
Lafoncazal, M., Pietri, S., Culcasi, M. and Bockaert, J. (1993)
NMDA-dependent superoxide production and neurotoxicity.
Nature, 364: 535-537.
Martin, L.J., AI Abdulla, N.A., Brambrink, A.M., Kirsch, J.R.,
Sieber, EE. and Portera-Cailliau, C. (1998) Neurodegeneration
in excitotoxicity, global cerebral ischemia, and target depri-
vation: A perspective on the contributions of apoptosis and
necrosis. Brain Res. Bull., 46:281-309.
Martinou, J.C. (1999) Apoptosis: key to the mitochondrial gate.
Nature, 399:411-412.
McCormack, J.G. and Denton, R.M. (1994) Mammalian mi-
tochondrial metabolism and its regulation. In: V.M. Darley-
Usmar and A.H.V. Schapira (Eds.), Mitochondria: DNA, Pro-
teins and Disease. Porton Press, London, pp. 81-112.
Meldrum, B.S. (1993) Excitotoxicity and selective neuronal loss
in epilepsy. Brain Pathol., 3: 405-412.
Nicholls, D.G. (1985) A role for the mitochondrion in the pro-
tection of cells against calcium overload?. Prog. Brain Res.,
63: 97-106.
Ogunmekan, A.O. and Hwang, P.A. (1989) A randomised
double-blind, placebo-controlled, clinical trial of D-alpha-
tocophorol acetate (vitamin E), as add on therapy for epilepsy
in children. Epilepsia, 30: 84-89.
Orrenius, S., Burkitt, M.J., Kass, G.E.N., Dypbukt, J.M. and
Nicotera, P. (1992) Calcium ions and oxidative cell injury.
Ann. Neurol., 32: $33-$42.
Rauca, C., Zerbe, R. and Jantze, H. (1999) Formation of free
hydroxyl radicals after pentylenetetrazol- induced seizure and
kindling. Brain Res., 847: 347-351.
Rong, Y.Q., Doctrow, S.R., Tocco, G. and Baudry, M. (1999)
EUK-134, a synthetic superoxide dismutase and catalase
mimetic, prevents oxidative stress and attenuates kainate-
induced neuropathology. Proc. Natl. Acad. Sci. USA, 96:
9897-9902.
Rosenmund, C., Feltz, A. and Westbrook, G.L. (1995) Calcium-
dependent inactivation of synaptic NMDA receptors in hip-
pocampal neurons. J. Neurophysiol., 73: 427-430.
Roy, M. and Sapolsky, R. (1999) Neuronal apoptosis in acute
necrotic insults: why is this subject such a mess?. Trends
Neurosci., 22: 419-422.
Sattler, R. and Tymianski, M. (2000) Molecular mechanisms of
calcium-dependent excitotoxicity. J. MoL Med., 78: 3-13.
Schinder, A.E, Olson, E.C., Spitzer, N.C. and Montal, M. (1996)
Mitochondrial dysfunction is a primary event in glutamate
neurotoxicity. J. Neurosci., 16: 6125-6133.
Schuchmann, S., Luckermann, M., Kulik, A., Heinemann, U. and
Ballanyi, K. (2000) Ca(2+) - and metabolism-related changes
of mitochondrial potential in voltage-clamped CA1 pyramidal
neurons in situ. J. Neurophysiol., 83: 1710-1721.
Stout, A.K., Raphael, H.M., Kanterewicz, B.I., Klann, E. and
Reynolds, I.J. (1999) Glutamate-induced neuron death requires
mitochondrial calcium uptake. Nat. Neurosci., 1: 366-373.
Uz, T., Giusti, P., Franceschini, D., Kharlamov, A. and Manev,
H. (1996) Protective effect of melatonin against hippocampal
DNA damage induced by intraperitoneal administration of
kainate to rats. Neuroscience, 73:631-636.
White, R.J. and Reynolds, I.J. (1995) Mitochondria and
Na+/Ca 2+ exchange buffer glutamate-induced calcium loads
in cultured cortical neurons. J. Neurosci., 15: 1318-1328.
Williams, M.D., Van Remmen, H., Conrad, C.C., Huang, T.T.,
Epstein, C.J. and Richardson, A. (1998) Increased oxidative
damage is correlated to altered mitochondrial function in het-
erozygous manganese superoxide dismutase knockout mice. J.
Biol. Chem., 273: 28510-28515.
Yokoi, I., Toma, J., Liu, J.K., Kabuto, H. and Mori, A. (1995)
Adenosines scavenged hydroxyl radicals and prevented post-
traumatic epilepsy. Free Radic. Biol. Med., 19: 473-479.
Zhang, Y., Marcillat, O., Giulivi, C., Emster, L. and Davies, J.A.
(1990) The oxidative inactivation of mitochondrial electron
transport chain components and ATPase. J. Biol. Chem., 265:
16330-16336.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAFFER 17

Cell death and metabolic activity during epileptiform

discharges and status epilepticus in the hippocampus

U. Heinemann *, K. Buchheim, S. Gabriel, O. Kann, R. Kovacs and S. Schuchmann

Johannes Mailer Institute of Physiology, Charitd, Humboldt University Berlin, D-lOll7 Berlin, Germany

Abstract: Mechanisms of seizure-induced cell death were studied in organotypic hippocampal slice cultures. These develop
after withdrawal of magnesium recurrent seizure-like events (SLE), which lead to intracellular and intramitochondrial
calcium accumulation. The intramitochondrial Ca accumulation seems to be involved in causing increased production of
NADH, measured as NAD(P)H autofluorescence. During SLEs, depolarization of mitochondria and increased production
of free radicals is indicated by fluorescence measurements with appropriate dyes. During recurrent seizures, an increased
failure to produce NADH is noted while at the same time free radical production seems to increase. This increase and the
decline in NADH production could be involved in transition to late recurrent discharges, a phase in which status epilepticus
becomes pharmacoresistant. It also coincides with increased cell death as determined with propidium iodide fluorescence.
Interestingly, some of these changes can be prevented by application of a-tocopherol, a free radical scavenger, which also
has neuroprotective effects under our experimental conditions. The results suggest that free radical-induced mitochondrial
impairment is involved in seizure-induced cell death.

Introduction 1999). After a seizure, transport processes have to be

Interictal and ictal discharges indicate synchronized
hyperactivity in large ensembles of neurons. These
discharges are associated with significant changes
of the extracellular ionic microenvironment (Lux et
al., 1986). During a seizure, extracellular potassium
concentration ([K+]o) can rise to 12 mM, while
[Na+]o, [Ca2+]o and the size of the extracellular
space decreases (Lux et al., 1986). Consequently
intracellular ion concentrations change (Ballanyi et
al., 1987; Gloveli et al., 1999) and transmembrane
fluxes of C1- appear (Dietzel et al., 1982). Moreover,
pH measurements reveal an initial transient alkalo-
sis followed by an acidic shift (Gutschmidt et al.,
*Correspondence to: U. Heinemann, Johannes Mtiller
Institute of Physiology, Charit6, Humboldt University
Berlin, D-10117 Berlin, Germany. Tel.: +49-30-4505-
28091; Fax: +49-30-4505-28962;
E-mail: uwe.heinemann @charite.de
activated in order to restore ionic gradients. These
processes depend on sufficient supply of ATE
Biochemical evidence suggests that about 60% of
cerebral ATP consumption is used for operation of
the electrogenic Na,K-pump which transports three
Na ions out of the cell in exchange for two K ions
(Ames, 2000). The Na,K-ATPase is activated by in-
tracellular Na accumulation, but some variants of the
Na,K-ATPase, particularly those in glial cells, can
also be activated by extracellular K accumulation
(Grisar et al., 1979). Many other transport processes
in nerve cells, such as uptake of glutamate, choline
and GABA are dependent on the transmembrane Na
gradient. Ca can, in addition to Na/Ca exchange,
also be transported by the Ca,Mg-ATPase. The ATP
content within a nerve cell is rather limited and other
stores for energy production are also scarce. Neurons
in the CNS can utilize GABA for ATP production
through the GABA shunt and also metabolize lac-
tate (Schousboe et al., 1997; Waagepetersen et al.,
1999). Particularly consumption of GABA for ATP
198
synthesis may be a dangerous event, as this would
lead to depletion of the GABA pool during recur-
ring seizures. Indeed, transition of recurring seizures
to drug resistant late status epilepticus (Dreier and
Heinemann, 1991; Zhang et al., 1995) may depend
on increased GABA consumption.
It is widely held that the energy demands of a
group of nerve cells are covered by local adaptation
of blood flow (Mathiesen et al., 1998; Caesar et al.,
1999), which indeed strongly increases (by up to
a factor of seven) (Nilsson et al., 1976; Meldrum,
1983) in areas participating in seizure activity (Hor-
ton et al., 1980; Ingvar and Siesjo, 1983). Rises in
[K+]o, decreases in Ca, acidosis, release of adeno-
sine and generation of NO seem to be factors in-
volved in this coupling process (Dirnagl et al., 1994;
Dirnagl, 1997).
Prolonged status epilepticus is a condition which
can cause considerable cell loss (Meldrum and Chap-
man, 1993). This cell loss seems to include glial
cells as well (Schmidt-Kastner and Ingvar, 1996).
Four hypotheses were proposed to explain status
epilepticus-induced cell death. The original idea that
energy supply to the brain may be reduced due to
systemic factors was rejected early on the basis of
glucose consumption and blood flow measurements
(Pinard et al., 1984). However, when status epilep-
ticus lasts for a prolonged period, a decline in ATP
content (Folbergrova et al., 1985) and a change in
the redox potential (Wasterlain and Plum, 1973; Fu-
jikawa et al., 1988) was found, suggesting that during
recurring seizures, energy production, in spite of in-
creased supply, may be hampered (Folbergrova et al.,
1985). The idea that excitotoxic cell damage alone
is responsible for seizure-induced cell death always
faced the difficulty that glutamate-induced cell death
normally spares glial cells which contribute to cell
loss during status epilepticus. More recently, it was
suggested that cell death could occur, when intracel-
lular Ca is elevated, causing mitochondrial depolar-
ization (Duchen, 1999). Depolarized mitochondria
may exploit 02 incompletely, resulting in an in-
creased production of radical oxygen species (ROS).
As a result, mitochondrial function may be com-
promised, leading to reduced generation of NADH
and subsequently reduced production of ATE On the
other hand, increases in intracellular Ca concentra-
tion may lead to uptake of Ca in mitochondria and
to increased formation of NADH and FADH. Indeed,
some enzymes in the tricarboxylic acid cycle are
sensitive to Ca and thereby Ca may play an impor-
tant role in adjusting the ATP production to a given
state of neuronal activity (McCormack and Denton,
1993a,b; Hansford and Zorov, 1998). We decided
to exploit imaging techniques to get an insight into
possible damage cascades during glutamate exposure
and during seizures.
Methods
The experiments were done on three types of prepa-
rations. Studies on glutamate-induced cell damage
were done in dissociated hippocampal cell cultures
(Schuchmann et al., 1998; Schuchmann and Heine-
mann, 2000a) with some additional experiments in
organotypic slice cultures. Both preparations were
performed as previously described (Peacock et al.,
1979; Stoppini et al., 1991).
Subsequently, we turned to complex entorhi-
nal cortex and hippocampal slices, where recurrent
seizures are readily induced by lowering of extracel-
lular Mg concentration or application of 4AP in the
entorhinal cortex and neighboring structures, such as
the subiculum and the temporal neocortex (Walther
et al., 1986). This activity progresses after some time
into late recurrent discharges (Dreier and Heine-
mann, 1991) which are resistant to the presently
available anticonvulsant drugs (Zhang et al., 1995).
All experiments with respect to ictal activity in this
paper were done by removing extracellular Mg con-
centration. We recently exploited the advantages of
organotypic slice cultures. These cultures develop a
strong excitatory coupling which leads to facilitated
seizure generation during application of low Mg
or bicuculline in comparison to age-matched slices
(Gutierrez et al., 1999).
Dissociated and slice cultures offer the advantage
that they can be readily bulk loaded with different
dyes which permit imaging of cytosolic and mito-
chondrial Ca concentration changes, measurements
of mitochondrial potentials, formation of ROS and
of NAD(P)H. When excited with 360 nm light,
NAD(P)H produces a bright autofluorescence. The
recordings were done under an upright microscope
equipped with a photomultiplier and a CCD camera
and a monochromator suitable to generate light with

wavelength between 200 and 1000 nm. Most fre-
quently, the photomultiplier was used to sample light
emission from area CA3, the hilus and part of area
CA1. In slices, we either injected single cells with
a given dye or used the NAD(P)H autofluorescence
in order to gain insight into mechanisms involved in
cellular metabolism. For methodological details see
Schuchmann et al. (1999, 2000, 2001) and Kovacs et
al. (2001).
Cell death determinations
In order to determine cell death in organotypic and
dissociated cultures we used propidium iodide stain-
ing (Kov~ics et al., 1999). This dye is normally
excluded from healthy cells which can be marked
by acridine orange, for example. When the plasma
membrane is damaged the propidium iodide enters
nerve cells and forms a bright fluorescence after
binding to RNA and DNA. The intensity of this
staining was used to determine the degree of cell
loss after 2 h of status epilepticus or exposure to
glutamate.
Results
Glutamate-induced fluorescence signals in
hippocampal dissociated cell cultures and
organotypic slice cultures
Glutamate dose-dependently induced an increase in
cytosolic Ca concentration from a baseline concen-
tration of about 80 nM as determined by ratiometric
Fura-2 measurements. Application of 100 ttM of
glutamate induced an increase in cytosolic Ca con-
centration in the order of 400 nM in cultures older
then 2 weeks (Schuchmann et al., 1998). This com-
pared to a 300-1000 nM increase in intracellular
free Ca concentration in slices during seizure-like
events (Gloveli et al., 1999). Application of 100 IxM
glutamate for 1 h led to a reduction of viable cells
by roughly 60% within 6 h of glutamate exposure
and by roughly 80% after 24 h (Schuchmann and
Heinemann, 2000a). Application of cyclosporin A
but not of tocopherol could protect against this cell
death. This suggested an involvement of mitochon-
dria and perhaps development of transition pores in
the glutamate-induced cell death.
199
We therefore decided to obtain more information
on the effects of glutamate on mitochondrial po-
tential. For this we employed the fluorescent dye
rhodamine-123 which is positively charged and ac-
cumulated, therefore, within mitochondria where the
fluorescence is quenched. When mitochondria be-
come depolarized, part of the rhodamine-123 leaves
the mitochondria resulting in a rhodamine-123 fluo-
rescence increase (see e.g. Schuchmann et al., 1998,
2000). Application of 100 IxM glutamate-induced a
pronounced mitochondrial depolarization which was
absent when glutamate was applied in the pres-
ence of lowered extracellular Ca concentration. The
rhodamine-123 fluorescence increase amounted to
about 10% in cultures older than 2 weeks. The
fluorescence increase was, moreover, dose- and age-
dependent as well as being dependent on application
time.
The depolarization of mitochondria might inter-
fere with their capability to generate NADH. We
therefore determined the NAD(P)H autofluorescence
in cultured hippocampal cells and found that fol-
lowing an initial decrease in NAD(P)H autofluores-
cence there was a subsequent increase in NAD(P)H
fluorescence, suggesting that in spite of mitochon-
drial depolarizations, the cells were able to generate
NAD(P)H. This increase lasted for some 200 s before
it returned to baseline (Schuchmann et al., 1998). It
was about 3%. in cultures older than 2 weeks.
In the presence of depolarized mitochondria, uti-
lization of 02 is less complete and the formation of
free radicals is facilitated. We therefore determined
whether glutamate-induced Ca load leads to an in-
creased formation of free radical oxygen species.
Unfortunately dyes which are used to measure ROS
production are not very specific. We therefore com-
pared the oxidation of three dyes which become
fluorescent upon oxidation. These were dihydroethi-
dine (HEt), 2'-7'-dichloro dihydroftuorescein (DCF)
and dihydrorhodamine (DHR). Upon exposure to
100 IzM glutamate, all three dyes became rapidly
oxidized and thereby fluorescent (Fig. 1). Control
measurements with biochemical methods indicated
there was, indeed, an increased production of ROS
species (Schuchmann and Heinemann, 2000b).
The increased production of ROS will eventu-
ally lead to increased consumption of glutathione.
We therefore also studied the effect of glutamate
200

A
=~ 100 pM glutamate

B
o~" 100 pM glutamate

n,
-1- 0 J
121

C
o~" 100 pM glutamate

._~

0 OJ I I
o 100 s
Fig. 1. Measurements of ROS production induced by glutamate in cultured hippocampal neurons using different ROS indicators.
Application of 100 IxM glutamate for 100 s induced an increase of the fluorescence signal of ethidium, the oxidized form of
hydroethidium (HEt, A), rhodamine-123, the oxidized form of dihydrorhodamine (DHR, B) and dichlorofluorescein (DCF, C). All signals
were expressed as changes in baseline signal in %.

exposure on the glutathione content in cultured hip-
pocampal neurons. For this, we employed the dye
monochlorobimane (MBCL) which predominantly
reacts with glutathione - - but only in its reduced
form - - to emit a bright fluorescence (Stabel-Burow
et al., 1997; Schuchmann and Heinemann, 2000a;
Reichelt et al., 1997; Huster et al., 2000). Gluta-
mate applied with 100 txM for 1 h leads to a fall
in GSH content by about 5%, which slowly recovers
to baseline within 6 h. In the presence of glutamate
receptor antagonists (NBQX and 2APV), glutamate
instead caused an increase in MBCL fluorescence
due to a glutamate-dependent increased synthesis of
glutathione which could be further augmented by
cystine or cysteine (Schuchmann and Heinemann,
2000a).
The findings suggested that exposure of neurons
to elevated glutamate levels induces a Ca-dependent
depolarization of mitochondria leading to an in-
creased formation of ROS. The glutamate-induced
cell death could be prevented in part by upregulation
of glutathione or by application of cyclosporin A,
an inhibitor of transition pores in the mitochondria.
If such pores are formed, release of cytochromes is
expected which might be involved in induction of
apoptosis (Bernardi, 1996; Zamzami et al., 1996).

Properties of status epilepticus in combined
entorhinal cortex hippocampal slices
We noted earlier (Walther et al., 1986) that the low-
ering of Mg can induce different patterns of epilepti-
form activity in combined slices of the hippocampus
and neighboring structures, such as the ento- and
perirhinal cortex. Lowering of extracellular Mg con-
centration in these preparations induces recurrent
seizure-like events characterized by slow negative
shifts superimposed by tonic- and clonic-like dis-
charges. The SLEs are accompanied by similar ionic
changes, as in vivo, and are blocked by anticonvul-
sant drugs (Zhang et al., 1995; Dreier et al., 1998).
These events recur regularly, but after some 20-40
repetitions they change their appearance (Dreier and
Heinemann, 1991). The late recurrent discharges are
shorter in duration and recur with a relatively high
frequency. Studies on the pharmacological sensitivity
to clinically employed anticonvulsants has revealed
that these late recurrent discharges no longer respond
to clinically employed anticonvulsants and thus seem
to model the late pharmacoresistant status epilepti-
cus which presents with considerable problems in
clinical care. In slices, it was shown that this drug-
resistant status epilepticus can readily be reversed to
treatable status epilepticus, when GABA is supple-
mented (Pfeiffer et al., 1996). This is in contrast to
high levels of midazolam or phenobarbital, which are
without effect. The finding that GABA and muscimol
can stop the late recurrent discharges in this model
of drug-resistant discharges then points to a loss of
GABA during recurrent seizures, presumably due to
consumption by neurons and glia in the GABA shunt
of the tricarboxylic acid cycle.
To test this hypothesis further, we studied the
effects of anticonvulsants on 4AP-induced seizure-
like events. These are similar in appearance to low
Mg-induced SLEs, but recur, in our hands, in a
somewhat lower frequency (Brtickner and Heine-
mann, 2000; Buchheim et al., 2000; Schuchmann et
al., 1999). They differ from those induced by low
Mg in that one type of interictal discharge can per-
sist (albeit reduced in amplitude) when the seizure-
like events are blocked by CNQX combined with
2APV, antagonists of ionotropic glutamate receptors
(Briickner et al., 2000). These interictal discharges
are further reduced in amplitude when bicuculline
201
is applied (Perreault and Avoli, 1991). This sug-
gests an involvement of GABA in the generation of
these events. However, the used concentrations also
lead to blockade of glycinergic currents (Shirasaki
et al., 1991) and to blockade of Ca-dependent small
conductance K channels (Khawaled et al., 1999;
Strobaek et al., 2000). The interictal discharges of
this type frequently occur just at the onset of a SLE
(Lucke et al., 1995). However, thorough counting re-
veals that this varies from slice to slice and may also
change during the course of recurring SLEs. Also in
the 4AP model transition to late recurrent discharges
is frequently observed. This process can be accel-
erated when bicuculline is employed together with
4AP (Brtickner et al., 1999). Under that condition,
SLEs change almost immediately to late recurrent
discharges. The same is observed with the combined
application of low Mg and bicuculline (Pfeiffer et
al., 1996). Tests on the pharmacological sensitivity
of these late discharges revealed that they are also
insensitive to clinically employed anticonvulsants,
even in the toxic concentration range (Zhang et al.,
1995).
Seizure-induced changes in NAD(P )H
autofluorescence in entorhinal cortex slices
The seizure-like events in parahippocampal struc-
tures, such as the subiculum the entorhinal cortex,
the perirhinal cortex and neighboring temporal neo-
cortex were characterized by 30-90-s-long negative
potential shifts superimposed by initial tonic-like
and then clonic-like field potential transients. These
events were followed by interictal discharges. Fura-2
measurements revealed rises in [Ca2+]i by 200-900
txM, depending on cell type (Gloveli et al., 1999).
Interestingly, the rises in [Ca2+]i were particularly
large in layer III neurons, a cell group which is
particularly vulnerable during status epilepticus (Du
et al., 1993; Du et al., 1995). The SLEs were usu-
ally initiated in medial entorhinal cortex from where
they spread to neighboring areas (Buchheim et al.,
2000). In adult tissue from normal rats, invasion of
SLEs into the hippocampus were usually not ob-
served. This was different in slices from juvenile
animals (Weissinger et al., 2000) and from adult ani-
mals which had previously experienced a pilocarpine
status epilepticus or which were kindled by recur-
202
ring stimulation of the amygdala (Behr et al., 1998;
Wozny et al., 2000).
With time, the appearance of the SLEs changed
and after roughly 20-40 SLEs, the activity changed
abruptly into late recurrent discharges. In order to
test for the hypothesis that metabolism is altered dur-
ing recurring seizure-like events and may be com-
promised during transition to late drug-resistant dis-
charges, we measured the changes in NAD(P)H aut-
ofluorescence during recurring seizure-like events.
We found that each seizure-like event was accompa-
nied by an initial decrease in NAD(P)H autofluores-
cence followed by a long-lasting increase. With re-
curring numbers of SLEs, the amplitude of the rises
in NAD(P)H autofluorescence declined, while the
initial decreases in these signals remained constant.
At the time when seizure-like events were replaced
by late recurrent discharges, the NAD(P)H over-
shoots had disappeared (Schuchmann et al., 1999).
These findings suggested that recurrent seizures
can damage mitochondrial functions and that this
process may be involved in causing cell death. Un-
fortunately, detailed studies with respect to this dam-
age cascade cannot be readily performed in slices.
This is due to the fact that slices underwent a pe-
riod of hypoxia during preparation, that they have
damaged axons and dendrites and that due to these
alterations also microglial cells become activated.
Moreover, the oxygen tension in the slice is variable
depending on distance to the cut surface of the slice.
Staining of slices with fluorescent probes is also not
readily performed as exposure to dyes in stagnant
chambers may alter viability of slices further. We
therefore took advantage of organotypic slice cul-
tures which also develop seizure-like events when
exposed to low Mg concentration (Gutierrez et al.,
1999).
Recurring seizure-like events in organotypic
hippocampal cultures
Unlike hippocampal slices from rats aged 2-3
weeks, where lowering of extracellular Mg concen-
tration induces SLEs only in area CA1 and the
subiculum, slice cultures of similar developmen-
tal age generate SLEs, which rapidly synchronize
throughout the preparation. These events involve the
DG, the hilus, area CA3 and CA1 (Gutierrez et al.,
1999; Kov~ics et al., 1999). This is due to the devel-
opment of aberrant connectivity in the slice culture
presumably due to deafferentation and deefferenta-
tion in the isolation procedure. In such cultures,
recurrent axon collaterals can be demonstrated for
mossy fibers and mutual connections between CA1
and CA3 and CA1 and the DG also exist (Gutier-
rez and Heinemann, 1999). This is actually com-
parable to the synaptic organization in slices from
rats with pilocarpine- or kainate-status epilepticus-
induced hippocampal sclerosis where similar aber-
rant connectivities were also demonstrated (Esclapez
et al., 1999; Lehmann et al., 2000, 2001; Smith and
Dudek, 2001). The SLEs induced by exposure to Mg
free ACSF are rather similar to the SLEs induced
in the entorhinal cortex. They recur with an average
frequency of one SLE every 15 min. By applying
short-stimulus trains to the mossy fibers, such events
can also be electrically triggered (Fig. 2). They con-
sist of an initial bursting discharge followed by a
tonic- and clonic-like discharge period and a pos-
tictal depression (Kovacs et al., 2001) Before and
after a SLE, interictal discharges appeared. The ionic
changes accompanying such SLEs are quite compa-
rable to those which we observed in intact animals.
The [Ca2+]o drops by, on average, 0.6 mM and
[K+]o rises to about 9 mM. After the 15th to 20th
SLE, recurrent late discharges develop.
We preloaded, in the incubator, slice cultures
with different dyes and used photomultiplier and
imaging techniques to follow the intracellular events
during recurring SLEs. Staining with Ca green, an
indicator which signals cytosolic Ca concentration
changes, revealed that each seizure-like event was
characterized by typical intracellular Ca fluctuations.
The Ca concentration rose rapidly during the IBP,
declined just before the tonic discharge period during
which the Ca climbed to a plateau level. During the
CLADE the Ca declined slowly although each clonic
discharge was accompanied by a transient increase
in Ca concentration. These kinetics were very similar
from SLE to SLE. However, the amplitudes of Ca
green signals declined rapidly by about 30% from
the first to 3rd seizure-like event and then remained
constant (Kovacs et al., 2001) (Fig. 3A).
When we stained the cultures with Rhod-2, a Ca-
sensing fluorescent probe, which, due to its positive
charge, accumulates within mitochondria, we were

CLADP
TLP
IBP
Fig. 2. Typical seizure-likeevents in an organotypichippocampal slice culture, prepared at around P7 and studied about 1 week later.
IBP, initial bursting discharge; TLP, tonic-likedischarge phase; CLADP,clonic-likeafter discharge period; fp, field potential recording.
The Ca signal was linearizedby us using the Nernst equation.
able to monitor changes in intramitochondrial Ca
concentration (Fig. 3B). During SLEs, the Rhod-2
fluorescence signals indicated a rapid rise of intrami-
tochondrial Ca during the initial burst discharge fol-
lowed by a secondary rise during the tonic discharge
phase. By contrast to Ca green and Fluo signals sin-
gle afterdischarges were not reflected in the Rhod-2
signals. Moreover, the decay of the Rhod-2 signals
during and following the clonic afterdischarge period
was much slower than that of the Ca green signals.
These findings suggest that the Rhod-2 fluorescence
came from a different compartment than that of the
Ca green signals and reliably reflected intramito-
chondrial rises in [Ca 2+] (see Fig. 3B). During the
course of recurring SLEs, the intramitochondrial Ca
concentration signals also declined in amplitude. The
amplitudes decreased by roughly 60% from the first
to the 15th SLE. This is much more than indicated
by the cytosolic Ca signals and may point to a loss
of mitochondrial function.
We also used rhodamine-123 to follow changes in
mitochondrial membrane potential. It turned out that
each SLE was associated with a mitochondrial de-
polarization, which during late recurrent discharges
reflected in a steadily increased mitochondrial poten-
tial.
To determine whether production of ROS signals
is increased during single seizure-like events, we
measured the changes in HEt fluorescence (Fig. 4).
We found that each SLE was accompanied by an in-
203
2 mV
0.45 mM
crease in ethidium fluorescence. However, while Ca
signals declined in amplitude these signals increased
in amplitude from seizure to seizure.
In a further step, we analyzed the NAD(P)H fluo-
rescence signals (Fig. 5). As was the case in slices,
these signals also declined in amplitude during recur-
ring seizures and rises in NAD(P)H autofluorescence
were abolished shortly before or at the time of tran-
sition into late recurrent discharges.
These findings indicated that during status epilep-
ticus, Ca enters not only the cytoplasm, but also the
mitochondria where they probably stimulated Ca-
sensitive enzymes in the tricarboxylic acid cycle,
resulting in increased production of NADH. How-
ever, as the amplitudes of these signals declined
with time, we hypothesized that production of free
radicals might have affected the mitochondrial func-
tion. In order to test this hypothesis, we pretreated
our slice cultures with ct-tocopherol, which is a
widely used free radical scavenger acting mostly at
lipid membranes. In the presence of ct-tocopherol,
the rises in HEt fluorescence were initially reduced
while the decline in NAD(P)H autofluorescence sig-
nals no longer occurred (Figs. 4 and 5) and transition
to late recurrent discharges was protracted.
This corroborated the idea that the HEt fluores-
cence increase was indeed due to increases in ROS
production and that ROS-induced impairment of mi-
tochondrial function might be involved in a reduced
capability of nerve cells and glia to adapt their cellu-
204

A CaGreen

avf0 2%

fp ~ ~ I 1 mV

ICa"l. O.4Sm
50 s
SLE, No 1 SLE, No 15

B Rhod-2

Af/fo ~ 1 2%

[Ca Is I 0.45mM
S

SLE, No 1 SLE, No 15
Fig. 3. Fluorescence signals of Ca green and Rhod-2 during the first (SLE, No. 1) and 15th SLE (SLE, No. 15). Ca green indicates
changes in cytosolic Ca concentration and Rhod-2 predominantly changes in intramitochondrial Ca concentration. Simultaneously
recorded changes in field potentials (fp) and extracellularCa concentrationare also displayed.

lar metabolism to the energy demands imposed onto
cells by increased activity. It was therefore of inter-
est to test whether tocopherol also protected against
seizure-induced cell loss.
Propidium iodide staining following 2 h of status
epilepticus
We have previously shown that slice cultures, when
stained with propidium iodide after 2 h of status
 205

A
Ethidium
untreated

AV,o ~'~ i 2 o/°

~ 1 1mY
fp
[Ca2*]e
~ k"~"~'J 0.2 mM

SLE, No 1 SLE, No 15

B
Ethidium (~-tocopherol

Af/fo 12%

f0 I 1mY

[Ca2*]e 0.2 mM

SLE, No 1 SLE, No 15
Fig. 4. Effects of recurrent seizures on increases in ethidium fluorescence after staining with hydroethidium(HEt). (A) Note increase in
fluorescence signal from the first to 15th seizure-likeevent, while fp and changes in calcium concentrationremain largely unaltered. (B)
In the presence of a-tocopherol, the increases in HEt fluorescence are reduced while fp and Ca concentrationchanges are not largely
altered.

epilepticus, developed an intense increase in PI flu-
orescence. This affected all principal cell layers in
the organotypic slice culture, namely the granule cell
layer, the CA3 region and the CA1 region. In the
presence of c~-tocopherol, this fluorescence increase
was much reduced suggesting that seizure associated
production of free radicals were indeed involved in
status epilepticus-induced cell loss (Fig. 6).
206

A
NAD(P)H
untreated

Af/fo

__~~ 12mV
fp
[Ca2+]e
~ 0.2 mM

SLE, Nol SLE, No15

B
NAD(P)H
~-tocopherol

Af/fo J ~ 12%

fp 4~ll~ -~~12mv
[Ca2+]e --~Js 0.2 mM

SLE, No 1 SLE, No 15
Fig. 5. Changes in NAD(P)H autofluorescence during the first and 15th SLE in untreated slice cultures (A) and in slice cultures pretreated
with a-tocopherol (B). Note reduced decline in NAD(P)H autofluorescence from the first to the 15th SLE in B.

Discussion and conclusions Na,K-ATPase. This depends on oxygen and glucose.

Our findings suggest that during status epilepticus,
Ca has a role in adapting N A D H synthesis in mi-
tochondria and thereby ATP synthesis to the needs
for ion homeostasis which require activation of the
As during seizures mitochondria depolarize, there is
the risk of increased production of free radicals. Due
to the increase in blood flow during seizures, oxygen
supply may be augmented and consequently the risk
of ROS generation could be further enhanced. This

nontreated
o~-tocopherol
CA1
CA3
Fig. 6. Exampleof propidium iodide staining in an untreated and
c~-tocopherol-treatedslice culture after 2 h of status epilepticus.
Note neuroprotectiveeffect of the free radical scavenger.
seems to result in damage of mitochondrial func-
tion as indicated by the reduced capability to take
up Ca, the decrease in NAD(P)H autofluorescence
and the increase in HEt-fluorescence. The fact that
some of these alterations as well as cell death can
be prevented by application of a free radical scav-
enger raises the interesting possibility that cell loss
during status epilepticus involves generation of free
radicals.
We have previously shown that the intracellu-
lar levels of glutathione influence sensitivity to free
207
radical-induced cell death (Schuchmann and Heine-
mann, 2000a). The synthesis of GSH depends on
uptake of glycine, glutamate and cystine in glial
cells while neurons require glycine and glutamyl-
cysteine for GSH synthesis. The cystine uptake into
glia and the cysteine uptake into neurons depend
on exchange transport against glutamate. As during
seizures extracellular glutamate is elevated, the ef-
ficacy of glutamate-cystine antiport and the supply
of neurons with cysteine may be hampered while,
at the same time, due to increased ROS production,
GSH may become oxidized. It was shown in oligo-
dendrocyte cultures as well as in hippocampal dis-
sociated cell cultures (Schuchmann and Heinemann,
2000a) that supply of cysteine can enhance intracel-
lular glutathione levels. In oligodendrocyte cultures,
the clinically well known N-acetylcysteine was also
effective in cell protection. This might imply that
N-acetylcysteine and c~-tocopherol could exert some
neuroprotection during status epilepticus. We are on
the way to test these interesting hypotheses.
The increases in intracellular Ca concentration
correspond to those observed during application of
about 100 IxM glutamate in dissociated cultures.
In addition, this treatment induces cell death which
likely involves activation of apoptosis. One signal
commonly considered to stimulate apoptosis is mi-
tochondrial release of cytochrome c. We do not
yet know whether this also occurs during status
epilepticus, but it will be interesting to see whether
SE-induced cell death can also be prevented by in-
hibitors of mitochondrial transition pore formation.
Acknowledgements
This research was supported by the BMBF, the SFB
507 C3 and the Graduate College 238: Damage
processes in the central nervous system: studies with
imaging techniques. We are grateful to H. Siegmund
and H.-J. Gabriel for technical assistance.
References
Ames III, A. (2000) CNS energy metabolism as related to
function. Brain Res. Rev., 34: 42-68.
Ballanyi, K., Grafe, P. and ten Bruggencate, G. (1987) Ion
activities and potassium uptake mechanisms of glial cells in
guinea-pig olfactorycortex slices. J. Physiol., 382: 159-174.
Behr, J., Lyson, K.J. and Mody, I. (1998) Enhanced propagation
208
of epileptiform activity through the kindled dentate gyrus. J.
Neurophysiol., 79: 1726-1732.
Bemardi, P. (1996) The permeability transition pore. Control
points of cyclosporin A-sensitive mitochondrial channel in-
volved in cell death. Biochim. Biophys. Acta, 1275: 5-9.
Brtickner, C. and Heinemann, U. (2000) Effects of standard
anticonvulsant drugs on different patterns of epileptiform dis-
charges induced by 4-aminopyridine in combined entorhinal
cortex-hippocampal slices. Brain Res., 859: 15-20.
Brtickner, C., Stenkamp, K., Meierkord, H. and Heinemann,
U. (1999) Epileptiform discharges induced by combined ap-
plication of bicuculline and 4-aminopyridine are resistant to
standard anticonvulsants in slices of rats. Neurosci. Lett., 268:
163-165.
Brtickner, C., Stenkamp, K., Meierkord, H. and Heinemann, U.
(2000) Effects of bicuculline and different glutamate recep-
tor antagonists on 4-aminopyridine-induced epileptiform dis-
charges in rat hippocampal entorhinal cortex slices. Neurosci.
Res. Commun., 26: 41-49.
Buchheim, K., Schuchmann, S., Siegmund, H., Weissinger, F.,
Heinemann, U. and Meierkord, H. (2000) Comparison of
intrinsic optical signals associated with low Mg 2+- and 4-
aminopyridine induced seizure-like events reveals characteris-
tic features in adult rat limbic system. Epilepsia, 41: 635-
641.
Caesar, K., Akgoren, N., Mathiesen, C. and Lauritzen, M.
(1999) Modification of activity-dependent increases in cere-
bellar blood flow by extracellular potassium in anaesthetized
rats. J. Physiol., 520(1): 281-292.
Dietzel, I., Heinemann, U., Hofmeier, G. and Lux, H.D. (1982)
Stimulus-induced changes in extracellular Na + and Cl- con-
centration in relation to changes in the size of the extracellular
space. Exp. Brain Res., 46: 73-84.
Dirnagl, U. (1997) Metabolic aspects of neurovascular coupling.
Adv. Exp. Med. BioL, 413: 155-159.
Dirnagl, U., Niwa, K., Lindauer, U. and Villringer, A. (1994)
Coupling of cerebral blood flow to neuronal activation: role of
adenosine and nitric oxide. Am. J. Physiol., 267: H296-H301.
Dreier, J.P. and Heinemann, U. (1991) Regional and time de-
pendent variations of low magnesium induced epileptiform
activity in rat temporal cortex. Exp. Brain Res., 87: 581-596.
Dreier, J.P., Zhang, C.L. and Heinemann, U. (1998) Phenytoin,
phenobarbital, and midazolam fail to stop status epilepticus-
like activity induced by low magnesium in rat entorhinal
slices, but can prevent its development. Acta Neurol. Scand.,
98: 154-160.
Du, E, Whetsell Jr., W.O., Abou-Khalil, B., Blumenkopf, B.,
Lothman, E.W. and Schwarcz, R. (1993) Preferential neuronal
loss in layer III of the entorhinal cortex in patients with
temporal lobe epilepsy. Epilepsy Res., 16: 223-233.
Du, E, Eid, T., Lothman, E.W., Kohler, C. and Schwarcz, R.
(1995) Preferential neuronal loss in layer III of the medial
entorhinal cortex in rat models of temporal lobe epilepsy. J.
Neurosci., 15: 6301-6313.
Duchen, M.R. (1999) Contributions of mitochondria to animal
physiology: from homeostatic sensor to calcium signalling and
cell death. J. Physiol., 516(Pt 1): 1-17.
Esclapez, M., Hirsch, J.C., Ben Ari, Y. and Bernard, C. (1999)
Newly formed excitatory pathways provide a substrate for
hyperexcitability in experimental temporal lobe epilepsy. J.
Comp. Neurol., 408: 449-460.
Folbergrova, J., Ingvar, M., Nevander, G. and Siesjo, B.K. (1985)
Cerebral metabolic changes during and following fluorothyl-
induced seizures in ventilated rats. J. Neurochem., 44: 1419-
1426.
Fujikawa, D.G., Vannucci, R.C., Dwyer, B.E. and Wasterlain,
C.G. (1988) Generalized seizures deplete brain energy reserves
in normoxemic newborn monkeys. Brain Res., 454: 51-59.
Gloveli, T., Egorov, A.V., Schmitz, D., Heinemann, U. and
Mtiller, W. (1999) Carbachol-induced changes in excitability
and [Ca2+]i signalling in projection cells of medial entorhinal
cortex layers II and IlL Eur. J. Neurosci., 11: 3626-3636.
Grisar, T., Frere, J.-M. and Franck, G. (1979) Effect of K+-ions
on kinetic properties of the (Na+,K+)-ATPase (EC 3.6.1.3)
of bulk isolated glial cells, perikarya and synaptosomes from
rabbit brain cortex. Brain Res., 165: 87-103.
Gutierrez, R. and Heinemann, U. (1999) Synaptic reorganization
in explanted cultures of rat hippocampus. Brain Res., 815:
304-316.
Gutierrez, R., Armand, V., Schuchmann, S. and Heinemann, U.
(1999) Epileptiform activity induced by low Mg 2+ in cultured
rat hippocampal slices. Brain Res., 815: 294-303.
Gutschmidt, K.U., Stenkamp, K., Buchheim, K., Heinemann,
U. and Meierkord, H. (1999) Anticonvulsant actions of
furosemide in vitro. Neuroscience, 91: 1471-1481.
Hansford, R.G. and Zorov, D. (1998) Role of mitochondrial
calcium transport in the control of substrate oxidation. Mol.
Cell. Biochem., 184: 359-369.
Horton, R.W., Meldrum, B.S., Pedley, T.A. and McWilliam,
J.R. (1980) Regional cerebral blood flow in the rat during
prolonged seizure activity. Brain Res., 192: 399-412.
Huster, D., Reichenbach, A. and Reichelt, W. (2000) The glu-
tathione content of retinal Miiller (glial) cells: effect of patho-
logical conditions. Neurochem. Int., 36: 461-469.
Ingvar, M. and Siesjo, B.K. (1983) Local blood flow and glucose
consumption in the rat brain during sustained bicuculline-
induced seizures. Acta Neurol. Scand., 68: 129-144.
Khawaled, R., Bruening-Whright, A., Adelman, J.P. and Maylie,
J. (1999) Bicuculline block of small-conductance calcium-
activated potassium channels. Pflugers Arch., 438: 314-328.
Kov~cs, R., Gutierrez, R., Kivi, A., Schuchmann, S., Gabriel, S.
and Heinemann, U. (1999) Acute cell damage after low Mg 2+-
induced epileptiform activity in organotypic hippocampal slice
cultures. NeuroReport, 10: 207-213.
Kovacs, R., Schuchmann, S., Gabriel, S., Kardos, J. and Heine-
mann, U. (2001) Ca 2+ signalling and changes of mitochon-
drial function during low-Mg2+-induced epileptiform activity
in organotypic hippocampal slice cultures. Eur. J. Neurosci.,
13: 1311-1319.
Lehmann, T.N., Gabriel, S., Kovacs, R., Eilers, A., Kivi, A.,
Schulze, K., Lanksch, W.R., Meencke, H.J. and Heinemann,
U. (2000) Alterations of neuronal connectivity in area CA1 of
hippocampal slices from temporal lobe epilepsy patients and

from pilocarpine-treated epileptic rats. Epilepsia, 41(Suppl. 6):
S190-S194.
Lehmann, T.N., Gabriel, S., Eilers, A., Njunting, M., Kov~cs, R.,
Schulze, K. and Heinemann, U. (2001) Fluorescent tracer in
pilocarpine-treated rats shows widespread aberrant hippocam-
pal neuronal connectivity. Eur. J. Neurosci., 14: 83-95.
Lucke, A., Nagao, T., Kohling, R. and Avoli, M. (1995) Syn-
chronous potentials and elevations in [K+]o in the adult rat
entorhinal cortex maintained in vitro. Neurosci. Lett., 185:
155-158.
Lux, H.D., Heinemann, U. and Dietzel, I. (1986) Ionic changes
and alterations in the size of the extracellular space during
epileptic activity. In: A.V. Delgado-Escueta, A.A. Ward, D.M.
Woodbury and R.J. Porter (Eds.), Advances in Neurology,
Vol. 44, Basic Mechanisms of the Epilepsies: Molecular and
Cellular Approaches. Raven Press, New York, pp. 619-639.
Mathiesen, C., Caesar, K., Akgoren, N. and Lauritzen, M. (1998)
Modification of activity-dependent increases of cerebral blood
flow by excitatory synaptic activity and spikes in rat cerebellar
cortex. Z Physiol., 512(Pt 2): 555-566.
McCormack, J.G. and Denton, R.M. (1993a) Mitochondrial Ca 2+
transport and the role of intramitochondrial Ca 2+ in the regu-
lation of energy metabolism. Dev. Neurosci., 15: 165-173.
McCormack, J.G. and Denton, R.M. (1993b) The role of in-
tramitochondrial Ca 2+ in the regulation of oxidative phospho-
rylation in mammalian tissues. Biochem. Soc. Trans., 21(3):
793-799.
Meldrum, B.S. (1983) Metabolic factors during prolonged
seizures and their relation to nerve cell death. In: A.V.
Delgado-Escueta, C.G. Wasterlain, D.M. Treiman and R.J.
Porter (Eds.), Advances in Neurology. Raven Press, New York,
pp. 261-275.
Meldrum, B.S. and Chapman, A.G. (1993) Epilepsy and epileptic
brain damage. Brain Pathol., 3: 355-356.
Nilsson, B., Meldrum, B., Norberg, K. and Siesj6, B.K. (1976)
Correlation of changes in blood flow and acid-base changes in
the brain during induced epileptic seizures. In: E. Betz (Ed.),
Ionic Actions on Vascular Smooth Muscle. Springer, Berlin,
pp. 105-116.
Peacock, J.H., Rush, D.E and Mathers, L.H. (1979) Morphology
of dissociated hippocampal cultures from fetal mice. Brain
Res., 169: 231-346.
Perreault, E and Avoli, M. (1991) Physiology and pharmacology
of epileptiform activity induced by 4-aminopyridine in rat
hippocampal slices. J. Neurophysiol., 65: 771-785.
Pfeiffer, M., Dragubn, A., Meierkord, H. and Heinemann, U.
(1996) Effects of 7-aminobutyric acid (GABA) agonists and
GABA uptake inhibitors on pharmacosensitive and pharma-
coresistant epileptiform activity in vitro. Br. J. Pharmacol.,
119: 569-577.
Pinard, E., Tremblay, E., Ben-Ari, Y. and Seylaz, J. (1984) Blood
flow compensates oxygen demand in the vulnerable CA3
region of the hippocampus during kainate-induced seizures.
Neuroscience, 13: 1039-1099.
Reichelt, W., Stabel-Burow, J., Pannicke, T., Weichert, H. and
Heinemann, U. (1997) The glutathione level of retinal Mtiller
209
glial cells is dependent on the high-affinity sodium-dependent
uptake of glutamate. Neuroscience, 77: 1213-1224.
Schmidt-Kastner, R. and Ingvar, M. (1996) Laminar damage of
neurons and astrocytes in neocortex and hippocampus of rat
after long-lasting status epilepticus induced by pilocarpine.
Epilepsy Res. Suppl., 12: 309-316.
Schousboe, A., Westergaard, N., Waagepetersen, H.S., Larsson,
O.M., Bakken, I3. and Sonnewald, U. (1997) Trafficking be-
tween glia and neurons of TCA cycle intermediates and related
metabolites. Glia, 21: 99-105.
Schuchmann, S. and Heinemann, U. (2000a) Diminished glu-
tathione levels causes spontaneous and mitochondria-mediated
cell death in neurons from trisomy 16 mice: a model of
Down's syndrome. J. Neurochem., 74: 1205-1214.
Schucbmann, S. and Heinemann, U. (2000b) Increased mito-
chondrial superoxide generation in neurons from trisomy 16
mice: a model of Down's syndrome. Free Radic. Biol. Med.,
28: 235-250.
Schuchmann, S., Buchheim, K., Meierkord, H. and Heinemann,
U. (1999) A relative energy failure is associated with low-
Mg 2+ but not with 4-aminopyridine induced seizures-like
events in entorhinal cortex. J. Neurophysiol., 81: 399403.
Schuchmann, S., Kovfics, R., Kann, O., Heinemann, U. and
Buchheim, K. (2001) Monitoring NAD(P)H autofluores-
cence to assess mitochondrial metabolic functions in rat
hippocampal-entorhinal cortex slices. Brain Res. Protoc., 7:
267-276.
Schuchmann, S., L~ckermann, M., Kulik, A., Heinemann, U. and
Ballanyi, K. (2000) Ca 2+- and metabolism-related changes of
mitochondrial potential in voltage-clamped CA1 pyramidal
neurons in situ. J. Neurophysiol., 83: 1710-1721.
Schuchmann, S., Mtiller, W. and Heinemann, U. (1998) Altered
CaZ+-signaling and mitochondrial deficiencies in hippocampal
neurons of trisomy 16 mice: a model of Down's syndrome. J.
Neurosci., 18: 7216-7231.
Shirasaki, T., Klee, M.R., Nakaye, T. and Akaike, N. (1991)
Differential blockade of bicuculline and strychnine on GABA-
and glycine-induced responses in dissociated rat hippocampal
pyramidal cells. Brain Res., 561: 77-83.
Smith, B.N. and Dudek, F.E. (2001) Short- and long-term
changes in CA1 network excitability after kainate treatment
in rats. J. Neurophysiol., 85: 1-9.
Stabel-Burow, J., Kleu, A., Schuchmann, S. and Heinemann, U.
(1997) Glutathione levels and nerve cell loss in hippocam-
pal cultures from trisomy 16 mouse - - a model of Down
syndrome. Brain Res., 765: 313-318.
Stoppini, L., Buchs, P.-A. and Muller, D. (1991) A simple
method for organotypic cultures of nervous tissue. J. Neurosci.
Methods, 37: 173-182.
Strobaek, D., Jorgensen, T.D., Christophersen, E, Ahring, EK.
and Olesen, S.E (2000) Pharmacological characterization of
small-conductance Ca(Z+)-activated K(+)channels stably ex-
pressed in HEK 293 cells. Br. J. Pharmacol., 129: 991-999.
Waagepetersen, H.S., Sonnewald, U. and Schousboe, A. (1999)
The GABA paradox: multiple roles as metabolite, neuro-
transmitter, and neurodifferentiative agent. J. Neurochem., 73:
1335-1342.
210
Walther, H., Lambert, J.D.C., Jones, R.S.G., Heinemann, U. and
Hamon, B. (1986) Epileptiform activity in combined slices
of the hippocampus, subiculum and entorhinal cortex during
perfusion with low magnesium medium. Neurosci. Lett., 69:
156-161.
Wasterlain, C.G. and Plum, E (1973) Vulnerability of developing
rat brain to electroconvulsive seizures. Arch. Neurol., 29: 38-
45.
Weissinger, E, Buchheim, K., Siegmund, H., Heinemann, U. and
Meierkord, H. (2000) Optical imaging reveals characteristic
seizure onsets, spread patterns and propagation velocities in
hippocampal-entorhinal cortex slices of juvenile rats. Neuro-
biol. Dis., 7: 286-298.
Wozny, C., Heinemann, U., Gabriel, S. and Behr, J. (2000) The
entorhinal cortex entrains epileptiform activity in area CA1
in a model of temporal lobe epilepsy. Eur. J. Neurosci., 12
(Suppl. 11): 102.02 (Abstract).
Zamzami, N., Susin, S.A., Marchetti, E, Hirsch, T., G6mez-
Monterrey, I., Castedo, M. and Kroemer, G. (1996) Mitochon-
drial control of nuclear apoptosis. J. Exp. Med., 182: 1533-
1544.
Zhang, C.L., Dreier, J.P. and Heinemann, U. (1995) Paroxysmal
epileptiform discharges in temporal lobe slices after prolonged
exposure to low magnesium are resistant to clinically used
anticonvulsants. Epilepsy Res., 20:105-111.
T. Sutula and A. Pitk~inen (Eels.)
Progress in Brain Research, Vol. 135
© 2002 Published by Elsevier Science B.V.
CHAPTER 18
Summary: Mechanisms of seizure-induced damage
Thomas Sutula 1,2,, and Asla Pitk~inen 3,4
I Department of Neurology and 2 Department of Anatomy, University of Wisconsin, Madison, WI 53792, USA
3 Epilepsy Research Laboratory, A.I. Virtanen Institute for Molecular Sciences, and 4 Department of Neurology,
Kuopio University Hospital, Kuopio, Finland
Following the pioneering observation of Meldrum
and coworkers demonstrating that prolonged seizures
during status epilepticus cause neuronal damage,
there have been significant experimental insights
into the mechanisms by which neurons experienc-
ing synchronous activity may undergo injury and
death. These experimental efforts have revealed that
neurons may die by at least two distinctive mech-
anisms, namely, excitotoxic necrosis and apoptosis,
although some have pointed out that there may be
overlap of these modes of cell death (e.g., Chapter
29). Epilepsy research has not only greatly benefited
from, but indeed has played a significant role in ad-
vancing fundamental knowledge about mechanisms
of neuronal death. Understanding of the ionic fluxes,
second messenger systems, and intrinsic death path-
ways that lead to neuronal loss after severe seizures
have proceeded with some success, as indicated by
the historical and contemporary perspectives devel-
oped in Chapters 1, 15, 16, 17. These chapters
provide a detailed review of some of the meta-
bolic pathways activated by seizures, beginning with
excessive release of the excitatory neurotransmitter
glutamate, and proceeding with second messenger
systems including Ca 2+, G-proteins, membrane de-
rived signaling molecules, and eventually involve-
ment of mitochondrial systems, oxidative damage,
* Correspondence to: T. Sutula, Department of Neurology
H6/570, University of Wisconsin, Madison, WI 53792,
USA. Tel.: -t-1-608-263-5448; Fax: +1-608-263-0412;
E-mail: sutula@neurology.wisc.edu
activation of caspases and death proteins, and neu-
ronal death (Chapters 15, 16, 17). The experiments
described in these chapters represent the successful
use of a reductionistic approach, which has provided
increasing insight into the molecular and cellular
features of seizure-induced processes that lead to
neuronal death, and may eventually permit therapeu-
tic interventions and neuroprotection (Chapters 1 and
44). The reviews of second messenger systems and
mitochondrial pathways activated by seizures (Chap-
ter 15, 16) offer a glimpse of the potentially rich op-
portunity for development of drugs that specifically
act on downstream pathways that are sequentially
activated after repeated seizures, whether prolonged
or brief, which contribute to neuronal dysfunction or
death, and ultimately to gene expression that plays a
role in adverse consequences of seizures for neural
circuitry.
The influence of genetics on the consequences
of seizures is not limited to seizure-induced gene
expression that contributes to long-term effects of
seizures on neural circuits (Chapter 12, 13). There
is a powerful role of genetic background in de-
termining the acute effects of seizures, as demon-
strated by the pronounced differences in susceptibil-
ity to acute seizure-induced damage among different
mouse strains (Chapter 12). The effects of genetic
background and strain differences are often over-
looked in interpretation of experiments addressing
the effects of seizures. These background genetic
influences are sufficient to drastically modify the
effects of genes on seizure-induced damage, such
212
as p53 (Chapter 12). The implications of these ob-
servations are significant not only for interpretation
of experimental studies, but also are potentially of
major importance for understanding individual dif-
ferences in susceptibility to seizure-induced damage
from both status epilepticus and repeated seizures in
humans.
While there has been major interest and emphasis
on 'epilepsy genes' that underlie genetic syndromes
in human families, these syndromes represent rare or
relatively uncommon causes of epilepsy. In the more
common idiopathic, cryptogenic, and symptomatic
epilepsy syndromes, comprehensive descriptions of
the mouse, rat, and human genomes are likely to
provide insights into genetic influences on meta-
bolic and signal transduction pathways activated by
seizures, and on gene-dependent individual differ-
ences in susceptibility to seizure-induced damage.
The application of contemporary genomics-based
methods for study of epilepsy are presented in Chap-
ters 13 and 14. These approaches are in their infancy,
but offer promise for unraveling the genetic contri-
butions to epileptogenesis and to consequences of
seizures in both animals and humans.
If genetic background has a powerful effect on
acute and long-term susceptibility to damage in ani-
mals, is it not likely that these influences are also a
potent factor in humans? The reader is encouraged
to keep this perspective in mind as the effects of
seizures in humans are presented using epidemiolog-
ical, pathological, imaging, and neuropsychological
approaches in Sections III-VI.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Published by Elsevier Science B.V.

CHAPTER 19

Do seizures beget seizures?

W. Allen Hauser 1,, and Ju R. Lee 2

Sergievsky Center, College of Physicians and Surgeons, Columbia University, 630 W 168 Street, New York, NY 10032, USA
2 California Medical Review Inc., San Francisco, CA 94104, USA

Abstract: There have been suggestions that seizures in some way modify brain function and that each seizure increases
the risk for further seizures. Reports thus far on this phenomenon have been flawed because of inappropriate study design.
We have evaluated the risk for seizure recurrence following a first unprovoked seizure in a cohort identified at their first
unprovoked seizure. Individuals with low risk for a seizure recurrence demonstrate a significant increase in risk for seizure
recurrence with increasing numbers of seizures. This is the first time that a progressive increase in risk for seizures with
increasing number of seizures has been demonstrated in humans. Since the majority of these cases will ultimately go into
remission and discontinue antiseizure medication, there must be competing forces that increase seizure risk and promote
seizure suppression. We need appropriate animal models to better understand both processes and their interactions.

Introduction dress the question of increasing risk for seizure

There is substantial data from animals suggesting
that seizures cannot only damage the brain but can
also result in self-propagation. Most of the animal
models deal with seizures rather than epilepsy. The
concept of epilepsy as a progressive illness is not
new. Gowers in 1881 suggested that each seizure
in some way increases the risk for further seizures
(Gowers, 1881). Reynolds and colleagues suggested
that the risk for persistent epilepsy increased with
the number of seizures prior to initiation of treatment
for epilepsy (Reynolds, 1995) although this is an in-
direct assessment of the hypothesis. There are more
recent data suggesting that it is seizure density rather
than seizure frequency that predicts persistence of
epilepsy. None of these studies directly address the
question of seizure worsening with increasing num-
bers of seizures. We have used a patient population
followed from their first unprovoked seizure to ad-
* Correspondence to: W.A. Hauser, 630 W 168th St., New
York, NY 10032, USA. Tel.: +1-212-305-2447; Fax: +1-
212-305-2518; E-mail: wahl @spyral.net
recurrence with increasing numbers of seizures.
Methods
The methods involved in this study are described
elsewhere but are briefly reviewed here (Hauser et
al., 1998).
Patients
A surveillance system was established to identify
patients who were evaluated because of newly iden-
tified seizures. Once their informed consent was ob-
tained, the patients were screened to determine their
eligibility for a series of studies, in which case it was
scheduled after discharge. The subjects included in
this study were restricted to the patients who at the
time of the initial evaluation had had a definite un-
provoked seizure, documented by an eyewitness; had
no evidence in the history of a previous unprovoked
seizure; were identified and signed informed-consent
forms within 24 h of the initial seizure; and com-
pleted the baseline interview within 30 days of the
initial seizure. Altogether, 271 patients were seen
216
and recruited on the day of the index seizure. For 67
of these patients, the intake interview was not com-
pleted within 30 days. The remaining 204 patients
were included in the analysis.
Classification of seizures
All seizures were categorized as partial or general-
ized on the basis of the description of the onset of
the seizure by an eyewitness, according to criteria
recommended by the International League against
Epilepsy (Commission on Classification and Termi-
nology of the International League Against Epilepsy,
1981; Commission on Epidemiology and Progno-
sis, International League Against Epilepsy, 1993).
Seizures were categorized according to the witness's
description, without regard to the findings on EEG
or the neurologic examination.
Each patient's seizure was also categorized as
idiopathic/cryptogenic (seizures occurring in the ab-
sence of a documented insult that was thought to in-
crease substantially the risk of unprovoked seizures)
or as remote symptomatic (seizures in persons with
a history of insult to the central nervous system
that was known to increase substantially the risk for
subsequent epilepsy). In those with a first unpro-
voked seizure, information was collected for each
subsequent seizure, thus potentially allowing reclas-
sification of the seizure according to type or cause.
Persons with status epilepticus (seizures continuing
for 30 min or more without interruption) or clusters
of seizures (two or more) in the same 24-h period
were considered to have had a single seizure. This
was an observational study, and we made no attempt
to influence the practice of the treating physicians
once patients had been identified. Thus, there was
neither standardization of treatment (if any) nor sys-
tematic monitoring of the adequacy of therapy in
patients for whom antiseizure medication was rec-
ommended.
Follow-up
Subjects were contacted by telephone at 6-month
intervals for 2 years from the date of the first seizure
and annually thereafter. Data collected included the
date, duration, and clinical characteristics of any
subsequent seizures, potential precipitating events,
concurrent and previous use of antiseizure medica-
tion, and the details of neurologic insults, if any,
since the previous follow-up contact. The medical
records of those who reported additional seizure ac-
tivities were reviewed to document the occurrence of
seizures and to confirm reported medication use. The
medical records generally confirmed the recurrence
of seizures, but seldom provided specific informa-
tion on the type, frequency, or specific dates of
seizures. Thus, the information used in our analysis
came primarily from the interviews with patients.
The medical records of those who did not report
additional seizures were also reviewed periodically
for other reasons, and no additional patients with
seizures were identified. Follow-up was terminated
for any of the following reasons: death, the occur-
rence of an event associated with an increased risk
of unprovoked seizures (e.g., head injury with loss
of consciousness), or a decision by the patient to
terminate participation in the study. Data were ob-
tained on each seizure through the fourth episode.
The institutional review board of the University of
Minnesota approved all protocols.
Statistical analysis
To determine recurrence risk for a second unpro-
voked seizure, subjects who had experienced a first
unprovoked seizure were entered into the analysis
on the date of the first unprovoked seizure and were
followed until the date of the second unprovoked
seizure or the last date of follow-up. A similar strat-
egy was used to evaluate risk for a third/fourth un-
provoked seizure following a second/third. Seizure
characteristics and etiology was classified based
upon most recent data. The cumulative risks of
recurrence for subgroup seizure were determined
by Kaplan-Meier methods, with an 'event' defined
as an unprovoked seizure recurrence (Kaplan and
Meier, 1958). The computed risks, therefore, repre-
sent the risk of recurrence conditional on survival.
'Events' were classified into subgroups to evalu-
ate the possibility of evidence for increasing risk
for seizure recurrence with increasing numbers of
seizures. Based on previous work, we have identi-
fied groups at differential risk for seizure recurrence
(Hauser et al., 1990, 1998). To evaluate the possibil-
ity of 'Progression' or 'kindling' effect following a

percent recurrence
80 r
60
40
20
0 20 40 60
monthsfrom index seizum
I-x-no risk factor 1 to 2 -*-with risk factor 1to 2 --2 to3 --3 to 41
Fig. 1. Estimated recurrence risk from index seizure.
first seizure. Six groups were formed based on etiol-
ogy, family history of epilepsy, EEG G S W feature,
number of recurrences and sample size of subgroup.
They were: first idiopathic seizure event with no
G S W (generalized spike and wave) in EEG and no
family history of epilepsy (group 1, the reference
group, n = 122); first idiopathic seizure events with
presence of G S W in EEG or a family history of
epilepsy (group 2, n = 23); first remote symptomatic
seizures (group 3, n = 59); second idiopathic symp-
tomatic seizures (group 4, n = 37); third idiopathic
seizures (group 5, n = 20); second and third remote
symptomatic seizures (group 6, n = 47).
The proportional hazards model was used to es-
timate rate ratios, defined as the ratio of the rate of
seizure recurrence in the group of patients with
a given factor to the rate of seizure recurrence
to the reference group (Cox, 1972). All statistical
analyses were performed using the SAS software
(SAS). Findings were considered significant when
the bounds of the 95% confidence interval did not
include unity. All P-values are two tailed.
Results
Overall recurrence risk
A second seizure occurred in 63 of the 204 (31%)
patients identified at the time of the first seizure. A
217
80 100 120
third seizure occurred in 41 of the 63 (65%) who had
a second seizure. A fourth seizure occurred in 63%
of those with three seizures. Analysis of the Kaplan
Meier curves failed to demonstrate any difference in
the estimated percentages in recurrence in those with
two and with three seizures.
Recurrence risk within etiologic subgroups
The absolute recurrence risk was significantly greater
in those with remote symptomatic epilepsy when
compared with those with idiopathic/cryptogenic
epilepsy, and the Kaplan-Meier curves were differ-
ent when these two groups were compared (Fig. 1).
Because of this, we separately analyzed those with
and without a presumed etiology to evaluate the
impact of number of seizures on risk of recurrence.
Effect of number of seizures on recurrence risk
Estimated recurrence among people with a first
unprovoked seizure
People with no identified antecedent. We evaluated
the risk for further seizures among people with a first
seizure and no clear antecedent. The recurrence risk
by 5 years after the initial event was 25% for those
with neither EEG abnormalities nor a first-degree
relative with epilepsy, 39% for those with either or
218

TABLE 1
Seizure recurrence in each assigned risk group

Risk group Number 1-Year risk 3-Year risk 5-Year risk

1st idiopathic
Family H x - and G S W - 122 13.3% 20.7% 24.8%
Family Hx + / G S W + 23 39.1% 39.1% 39.1%
1st remote symptomatic 59 30.8% 44.5% 47.9%
2nd idiopathic 37 49.5% 52.4% 64.3%
3rd idiopathic 20 59.2% 75.5% 75.5%
2nd and 3rd remote symptomatic 47 65.0% 82.2% 82.2%

both of those risk factors (Table 1). The risk for a Unprovoked seizures with an identified etiology. Un-
third seizure was 64% at 5 years; the risk for a fourth like those with epilepsy of unknown cause, we saw
seizure was 76%. no progression in risk after the second seizure (Ta-
ble 2).
People with an identified antecedent. Among people
with an identified antecedent, the risk for a second Discussion
seizure was 48%. The risk was 82% for a third and
a fourth seizure. There was no discernable increment In his 1881 text, Gowers wrote "When one attack
between the third and fourth seizure. has occurred, whether in apparent consequence of
an immediate excitant or not, others usually follow
Risk for seizure recurrence based upon number of without any immediate traceable cause. The effect of
seizures a convulsion on the nerve centers is such as to render
the occurrence of another more easy, to intensify, the
Unprovoked seizures of unknown cause. We also de- predisposition that already exists. This every fit may
termined the risk for subsequent seizures using as be said to be, in part, the result of those that have
a referent, the recurrence following a first seizure preceded it, the cause of those which follow it."
in the group for low risk of recurrence. We find The first component of this hypothesis seems
an incremental increase in risk ratio with increasing answered. Acute symptomatic seizures do not in
numbers of seizures (Table 2). This was true if anal- conventional terms beget (unprovoked) seizures. In
ysis was restricted to those with no risk factors or to studies of brain injury, early seizures seem a sur-
those with a family history and or an abnormal EEG. rogate for severity of head injury (Annegers et
al., 1998). Similarly, acute symptomatic seizures in
stroke are associated with size and location of the
TABLE 2 lesion (Labowitz). These same factors are associ-
Recurrence rate ratio a by seizure category ated with an increased risk for epilepsy following
stroke. Acute symptomatic seizures associated with
Risk group Number Rate ratio 95% Confidence systemic metabolic disturbance do not increase the
1 st idiopathic risk for subsequent unprovoked seizures (Hesdorffer
Family H x + / G S W + 23 2.3 1.1-4.8 et al., 1998).
1st remote symptomatic 59 2.2 1.3-3.9 There is a considerable literature on the question
2nd idiopathic 37 3.7 2. I--6.5
3rd idiopathic 20 5.8 2.9-11.6
of seizures begetting seizures in humans but most
2nd and 3rd remote 47 6.4 3.8-10.6 consist of review articles with indirect evidence used
symptomatic to support varying opinions on the outcome. Only the
article by Elwes et al. (1988) attempted to address
a The reference group consisted of patients with 1st idiopathic
seizure, EEG negative of GSW and no family history of epilepsy this question directly. This study seems fatally flawed
(n = 122). from a methodological standpoint as reviewed (Berg

and Shinnar, 1997). The other studies in humans
use indirect evidence to answer this question by
assessing remission in people with epilepsy.
This is the first study to address the question of an
escalating risk for unprovoked seizures in humans.
The analyses would seem to support an increasing
risk for further seizures with increasing numbers
of seizures. In this small sample, the phenomenon
can be identified only in those with epilepsy of
unknown cause. If there is accelerating pathology
associated with seizures, it would appear to occur
to appear only in those with more subtle pathology
underlying the epileptogenic tendency. This study
does not address the question of treatment effect.
Treatment was recommended for the majority of
people in the current study, but seldom was optimal
dosing used, and most did not take medications as
recommended.
These data suggest that a complex process of
competing forces is involved in the persistence of
epileptogenesis. A tendency for increasing ease of
seizure occurrence is counterbalanced by a drive to
inhibit seizures. From our epidemiologic studies it
would appear that for most people with recurrent
unprovoked seizures, the factors favoring normal-
ization are dominant. This seems true regardless of
therapeutic interventions (Feksi et al., 1991).
To understand the dynamics of the process of
epileptogenesis, we need animal models of epilepsy
rather than acute seizures, and need to be able to
distinguish the effects of the mechanisms used to
induce seizures from the effects of the seizures per
se. We also need to understand the mechanisms
associated with resolution of the tendency to have
seizures.
219
References
Annegers, J.E, Hauser, W.A., Coan, S. and Rocca, W.A. (1998)
A population-based study of seizures after traumatic brain
injuries. New Engl. J. Med., 338: 20-24.
Berg, A.T. and Shinnar, S. (1997) Do seizures beget seizures?
An assessment of the clinical evidence in humans. J. Clin.
Neurophysiol., 14: 102-110.
Commission on Classification and Terminology of the Interna-
tional League Against Epilepsy (1981) Proposal for revised
clinical and electroencephalographic classification of epileptic
seizures. Epilepsia, 22: 489-501.
Commission on Epidemiology and Prognosis, International
League Against Epilepsy (1993) Guidelines for epidemiologic
studies on epilepsy. Epilepsia, 34: 592-596.
Cox, D.R. (1972) Regression models and life-tables. J. R. Stat.
Soc. (B), 34: 187-220.
Elwes, R.D., Johnson, A.L. and Reynolds, E.H. (1988) The
course of untreated epilepsy. Br. Med. J., 297: 948-950.
Feksi, A., Kaamugisha, J., Gatiti, S., Sander, J. and Shorvon, S.
(1991) Comprehensive primary health care antiepileptic drug
treatment programme in rural and semi-urban Kenya. Lancet,
337: 406-409.
Gowers, W.R. (1881) Epilepsy and other chronic convulsive
diseases. London, Churchill.
Hauser, W.A., Rich, S.S., Annegers, J.E and Anderson, V.E.
(1990) Seizure recurrence after a 1st unprovoked seizure: an
extended follow-up. Neurology, 40:1163-1170.
Hauser, W.A., Rich, S.S., Lee, J.R., Annegers, J.E and Anderson,
V.E. (1998) Risk of recurrent seizures after two unprovoked
seizures. New Engl. J. Med., 338: 429-434.
Hesdorffer, D.C., Logroscino, G., Cascino, G., Annegers, J.E and
Hauser, W.A. (1998) Risks of unprovoked seizure following
acute symptomatic seizure: effects of status epilepticus. Ann.
Neurol, 44: 908-912.
Kaplan, E. and Meier, E (1958) Nonparametric estimation from
incomplete observations. J. Am. Stat. Assoc., 53: 457-481.
Reynolds, E.H. (1995) Do anticonvulsants alter the natural
course of epilepsy? Treatment should be started as early as
possible. Br. Med. J., 310: 176-177.
SAS Software for HP-UX, Release 6.12. SAS Institute Inc.,
Cary, NC.
T. Sutulaand A. Pitk~inen(Eds.)
Progress in Brain Research, Vol. 135
© 2002 ElsevierScienceB.V. All rightsreserved

CHAPTER 20

Do occasional brief seizures cause detectable clinical

consequences?

Shlomo Shinnar 1,, and W. Allen Hauser 2

l Comprehensive Epilepsy Management Center, Montefiore Medical Center, Albert Einstein College of Medicine, Bronx, NY 10467, USA
2 Sergievsky Center, College of Physicians and Surgeons, Columbia University, New York, NY 10032, USA

Abstract: Seizures, particularly when prolonged or frequent, have been associated with a variety of adverse outcomes.
However, epidemiological data provide little evidence for adverse effects of isolated brief seizures per se. Even the animal
data is mostly for prolonged or frequent seizures. Febrile seizures lasting < 10 min have not been associated with adverse
seizures or cognitive outcomes. Treating either febrile seizures or other acute symptomatic seizures does not reduce the
risk of subsequent epilepsy. In subjects with a first unprovoked seizure, seizure duration does not influence recurrence risk.
Furthermore, treatment after a first unprovoked seizure reduces recurrence risk, but does not alter long-term prognosis. In
epidemiological studies of newly diagnosed epilepsy, the number of seizures prior to therapy does not influence prognosis.
There are a variety of specific epilepsy syndromes associated with poor cognitive outcomes and with progressive loss of
function. However, the poor outcomes in these syndromes do not appear to be the result of seizures per se but rather to the
specific syndrome and to the frequent interictal spike activity seen in these patients. Antiepileptic drugs, while effective
in reducing seizure recurrence are also associated with a variety of potential adverse effects. On a risk-benefit basis,
the available epidemiologic data do not justify starting treatment after the first seizure to attempt to influence long-term
prognosis.

Introduction Reynolds, 1995). In other words, that seizures beget

Gowers (1881) wrote that "The tendency of the
disease is toward self-perpetuation; each attack facil-
itates the occurrence of another by increasing the in-
stability o f the nerve elements." This became d o g m a
for many years and provided the justification for
treatment after the first seizure and for the view that
what made epilepsy intractable was not the underly-
ing disorder, but rather that each seizure promoted
the occurrence of the next seizure and made the
epileptic focus more severe (Shorvon and Reynolds,
1982; Reynolds et al., 1983; Elwes et al., 1984;
seizures. More recent epidemiological data have
cast considerable doubt on this view (Sander, 1993;
Chadwick, 1995; Camfield et al., 1996; Shinnar and
Berg, 1996; Berg and Shinnar, 1997; Sillanpaa et
al., 1998a). There is no question that even a brief
seizure, if it occurs in the wrong place at the wrong
time (e.g. while swimming or driving) can have dis-
astrous consequences. However, the evidence that
one or several brief seizures per se have significant
long-term functional consequences is less clear. This
paper will review the clinical evidence that occa-
sional brief seizures can affect long-term outcomes.

* Correspondence to: S. Shinnar, Comprehensive Epilepsy
Management Center, Montefiore Medical Center, 111 E
210th St., Bronx, NY 10467, USA. Tel.: +1-718-920-
4378; Fax: +1-718-655-8070; E-mail: sshinnar@aol.com
Febrile seizures
Febrile seizures are a form of acute symptomatic
seizures (National Institutes of Health, 1980; Com-
mission on E p i d e m i o l o g y and Prognosis, 1993).
222
They occur in 2 - 5 % of children and are the most
common form of childhood seizures. In the past, it
was believed that most febrile seizures represented
a form of epilepsy and that the prognosis was not
favorable. Febrile seizures were believed to cause
brain damage as well as subsequent epilepsy (Taylor
and Ounsted, 1971; Wallace, 1980). However, data
from large epidemiological studies over the past 25
years have shown that they are largely benign and are
not associated with adverse outcomes (Ellenberg and
Nelson, 1978; Nelson and Ellenberg, 1978; Annegers
et al., 1979b, 1987; Maytal and Shinnar, 1990; Ver-
ity and Golding, 1991; Verity et al., 1998; Shinnar
et al., 2001a). Consideration of febrile seizures is
relevant as for many years they were thought to
cause epilepsy. Whether or not febrile seizures cause
mesial temporal sclerosis remains one of the more
controversial topics in epileptology (Shinnar, 1998).
A small proportion of children with febrile
seizures do develop subsequent epilepsy, but the risk
is increased primarily in those with complex febrile
seizures, especially when prolonged, those who are
neurologically abnormal and those with a family
history of epilepsy (Nelson and Ellenberg, 1978;
Annegers et al., 1987; Verity and Golding, 1991;
Berg and Shinnar, 1996a; Hesdorffer and Hauser,
2002). Cognitive outcomes are also favorable (Ellen-
berg and Nelson, 1978; Verity et al., 1998; Chang et
al., 2000, 2001; Hirtz, 2002). Children with simple
febrile seizures perform as well as controls in mea-
sures of intelligence and academic performance and
behavior in large studies that utilized either sibling
(Ellenberg and Nelson, 1978) or population based
(Verity et al., 1998; Chang et al., 2000) controls. A
recent population based study from Taiwan reported
that children with simple febrile seizures perform at
least as well as population based controls on memory
tasks (Chang et al., 2001).
Recent animal data has suggest that prolonged
febrile seizures may lead to long-lasting changes in
hippocampal circuits. In a rat model of prolonged
febrile seizures, cyto-skeletal changes in neurons
were evident within 24 h and persisted for several
weeks without leading to cell loss (Toth et al., 1998).
However, altered functional properties of these in-
jured neurons were evident (Chen et al., 1999; Dube
et al., 2000; Dube, 2002). Thus, it appears that ex-
posure of hippocampal neurons to prolonged febrile
seizures in early childhood may lead to transient
injury and more sustained dysfunction of these neu-
rons. However, even in this model that has produced
convincing data for functional changes, required a
seizure duration of 20 min or more. Seizures lasting
10 min or less were not associated with any anatomic
or functional changes.
Recent studies of prolonged febrile seizures that
have imaged children within 72 h of the seizure
episode have demonstrated acute changes on MRI
in some cases which were followed by later chronic
changes in a few children (VanLandingham et al.,
1998; Mitchell and Lewis, 2002). These studies pro-
vide the most convincing evidence to date in humans
of seizure induced injury. However, these were very
prolonged febrile seizures with a mean duration of
over 90 min. Of note is that only children with
seizures that were both focal and prolonged devel-
oped either acute changes or mesial temporal scle-
rosis (MTS). Also to date, only one of the children
who developed MTS has gone on to have temporal
lobe epilepsy. Long-term follow-up of such cohorts
utilizing both clinical and imaging data may provide
more answers as to how often this phenomenon actu-
ally occurs. While of great interest, these studies are
not directly relevant to the issues of whether brief
seizures cause damage.
If brief seizures promote the occurrence of sub-
sequent seizures, then preventing febrile seizures
should reduce the risk of subsequent epilepsy. There
have been three well designed randomized clinical
trials for preventing febrile seizure recurrence (Wolf
et al., 1977; Knudsen and Vestermark, 1985; Ros-
man et al., 1993a) which have also assessed the risk
of subsequent epilepsy (Wolf and Forsythe, 1989;
Rosman et al., 1993b; Knudsen et al., 1996). In two
of these studies, follow-ups of 10 or more years
were available (Wolf and Forsythe, 1989; Knudsen
et al., 1996). Despite the fact that the treatment
arm was effective in reducing the risk of recur-
rent febrile seizures in all three studies, there was
no difference in the rate of developing epilepsy in
the treatment arm compare to those untreated in
any of the three studies. In general, there is no
evidence from prospective randomized trials that
treating febrile seizures or any other form of acute
symptomatic seizures prevents subsequent epilepsy
(Shinnar and Berg, 1996; Berg and Shinnar, 1997;

Knudsen, 2002). While these trials included only a
small number of children with very prolonged febrile
seizures, the implications in terms of brief seizures
are clear and consistent with those seen in other
settings such as other forms of acute symptomatic
seizures and first unprovoked seizures.
Other acute symptomatic seizures
The occurrence of acute symptomatic seizures other
than febrile seizures is associated with an increased
risk of subsequent epilepsy but the data do not sug-
gest a causal relationship between brief acute symp-
tomatic seizures and subsequent epilepsy. The data,
in both children and adults, for acute symptomatic
seizures such as post-traumatic and post-craniotomy
are similar to the data from randomized treatment tri-
als for febrile seizures. The occurrence of seizures in
the immediate post-traumatic period following head
trauma is associated with an increased risk of subse-
quent epilepsy (Annegers et al., 1980). Randomized
clinical trials have demonstrated that antiepileptic
drugs (AEDs) are effective in preventing acute post-
traumatic seizures (Temkin et al., 1990). However,
prevention of acute post-traumatic seizures using
AEDs does not seem to alter the risk of developing
post-traumatic epilepsy a year or two later (Temkin
et al., 1990). After controlling for other factors,
acute post traumatic seizures do not alter prognosis
(Hauser et al., 1984; Annegers et al., 1998). We
have previously argued (Hauser et al., 1984; Shinnar
and Berg, 1996; Annegers et al., 1998) that these
seemingly contradictory findings are best explained
by regarding the occurrence of seizures in the acute
post-injury period as a marker for the severity of
the brain injury and its epileptogenic potential, not
the cause itself of later epilepsy. One can mask or
suppress this marker with AEDs, but doing so does
not alter the severity of the injury or its later conse-
quences, specifically the development of epilepsy. If
the seizures per se resulted in damage, then prevent-
ing them should alter the subsequent clinical course.
Similar data have been reported from studies of
seizures in the acute post-craniotomy period where
pretreatment with AEDs will prevent the occurrence
of seizures in the immediate postoperative period but
does not influence the subsequent risk of developing
epilepsy (Foyet al., 1992).
223
First unprovoked seizure
There is a substantial amount of data from prospec-
tive studies of children and adults who present with a
first unprovoked seizure. These include observational
studies as well as randomized therapeutic trials
Observational epidemiological studies
Following a first unprovoked seizure the best es-
timates of the risk of seizure recurrence within 2
years are approximately 40% (95% confidence inter-
val 37-43%) (Berg and Shinnar, 1991). These data
come from a meta-analysis of prospective studies
in children and adults done up to 1990. Subsequent
studies have produced similar recurrence risks (Van
Donselaar et al., 1992; First Seizure Trial Group,
1993; Shinnar et al., 1996, 2000; Hauser et al., 1998;
Stroink et al., 1998). Factors consistently associated
with an increased risk of recurrence include a re-
mote symptomatic etiology, an abnormal electroen-
cephalogram and the occurrence of the first seizure
in sleep (Hauser et al., 1982, 1990; Camfield et al.,
1985; Annegers et al., 1986; Hopkins et al., 1988;
Shinnar et al., 1990, 1996, 2000; Berg and Shinnar,
1991; Van Donselaar et al., 1992; First Seizure Trial
Group, 1993; Hauser et al., 1998; Stroink et al.,
1998; Hirtz et al., 2000). These factors appear to be
relevant in both children and adults. The duration of
the first seizure is not associated with a differential
risk of recurrence in patients with cryptogenic or
idiopathic seizures (Shinnar et al., 1996, 2001b).
The data regarding seizure duration is of partic-
ular relevance to this discussion. If seizures 'begat'
seizures, then the risk of recurrence should be higher
following prolonged seizures than following brief
seizures. This is not the case. However, in children
with a first unprovoked seizure who do experience a
recurrence, the duration of the second seizure is cor-
related with the duration of the first seizure. Thus, in
the 137 children with recurrent seizures whose first
seizure lasted <10 min, the second seizure lasted
>10 min in 11 (8%), >20 min in 5 (4%) and >30
min in only 2 (1%). On the other hand, in the 25
children with recurrent seizures whose first seizure
lasted >30 rain, the second seizure lasted >10 min
in 11 (44%), _>20 min in 9 (36%) and >30 min in
6 (24%) (P < 0.001) (Shinnar et al., 2001b). The
224
same results have been reported for febrile seizures.
Having a prolonged febrile seizure does not increase
the risk of another febrile seizure (Nelson and E1-
lenberg, 1978; Annegers et al., 1990; Berg et al.,
1990, 1992, 1997; Offringa et al., 1992, 1994; Berg
and Shinnar, 1996b). However, if another febrile
seizure does occur, it is more likely to be prolonged
(Berg and Shinnar, 1996b). Twin studies have also
shown that if one twin has status epilepticus, the
other twin is at higher risk not just for seizures
but for status epilepticus (Corey et al., 1998). In a
population-based study of patients with childhood-
onset epilepsy followed for over 30 years, if status
epilepticus did occur, the first episode occurred early
in the course of the disorder (Sillanpaa et al., 1998b).
Furthermore, the occurrence of status epilepticus in
otherwise normal children does not significantly al-
ter long-term prognosis or remission following either
a first unprovoked seizure (Shinnar et al., 1995) or
newly diagnosed childhood onset epilepsy (Sillanpaa
et al., 1998a,b; Berg et al., 1999, 2001). Thus the
epidemiologic data argue for a subgroup of children
with a predisposition for prolonged seizures rather
than the duration of the seizures altering prognosis.
Randomized treatment trials following a first
unprovoked seizure
If seizures indeed do beget seizures then early treat-
ment may be crucial to preventing the evolution of
a chronic process. There are four randomized clini-
cal trials that have examined the effect of treatment
after a first seizure in both children and adults (Cam-
field et al., 1989; Chandra, 1992; First Seizure Trial
Group, 1993; Gilad et al., 1996). All four studies
reported that recurrence risk in the treatment arm
was reduced by 50% or more. The magnitude of
the reduction ranged from 51% in the Italian multi-
center study of 417 children and adults (First Seizure
Trial Group, 1993) which is the largest study with
the longest follow-up, to 97% reduction in risk in the
study by Chandra which included 91 adults.
The Italian study followed the subjects long term
to address the crucial question of whether delayed
treatment affects long-term prognosis. While treat-
ment following the first seizure reduced recurrence
risk (First Seizure Trial Group, 1993), it did not alter
the probability of attaining 1- or 2-year remission
in long-term follow-up (Musicco et al., 1997). This
is the only study addressing the important issue of
prevention of future epilepsy, and does not support a
long-term benefit of treatment after a single seizure.
Number of seizures and outcome
What is the clinical evidence that occasional brief
seizures adversely affect outcome? In a well known
series of papers, Reynolds and colleagues (Shorvon
and Reynolds, 1982; Reynolds et al., 1983; Elwes
et al., 1984) reported that in patients with newly
diagnosed epilepsy, the probability of attaining 1-
year remission following initiation of AED therapy
was inversely proportional to the number of seizures
prior to the initiation of therapy. These data are
frequently cited as clinical evidence that even brief
seizures are associated with a worse prognosis and
that treatment therefore needs to be initiated after
the first seizure in order to prevent the development
of intractable epilepsy (Reynolds, 1995). However,
there are several flaws in this argument. This was not
a randomized study. The reason there are patients
in this study who were not treated until they had
10 or more seizures, is because they did not present
to medical attention until that time. Therefore, the
subjects with higher numbers of seizures prior to
treatment were those with complex partial seizures
who did not get diagnosed until later whereas those
with tonic-clonic seizures presented to medical at-
tention after only a few seizures. Careful scrutiny of
the data from this British study reveals that outcome
was only correlated with the number of complex
partial seizures prior to initiating AEDs. There was
no difference in the number of generalized tonic-
clonic seizures in those who did and did not respond
to therapy (Shorvon and Reynolds, 1982). Complex
partial seizures are known to be associated with a
poorer prognosis and a lower probability of attaining
remission on medications than tonic-clonic seizures
(Annegers et al., 1979a). Therefore, these data do not
really provide solid evidence for an adverse effect of
brief seizures on long-term prognosis.
Several other studies have found that the number
of seizures prior to treatment does not alter long-
term prognosis. A collaborative multi-center study
from Italy reported no difference in outcomes be-
tween patients where AED therapy was started after

two to five seizures and those where therapy was not
initiated until six or more seizures had occurred (Col-
laborative Group for the Study of Epilepsy, 1992). In
a population-based study of childhood onset seizures
in Nova Scotia, Canada, having up to 10 seizures
prior to initiation of AED therapy did not alter the
likelihood of attaining remission (Camfield et al.,
1996). While children with more than 10 seizures
had a lower chance of entering remission, this group
was heavily weighted toward those with complex
partial seizures (59% if more than 10 seizures vs
16% if 10 or fewer seizures). Note that none of
these studies randomized to delayed versus imme-
diate therapy. In all of them, therefore, the group
with a higher number of seizures prior to initiation
of therapy was skewed to those with complex partial
seizures.
In the studies from developed countries, essen-
tially all patients who presented to medical attention
with two or more seizures were treated. The differ-
ences between groups with multiple seizures before
treatment and those with only a few may therefore
be due to the differences in the underlying epilepsy
syndromes. Ideally, to determine if delayed treat-
ment has an impact on prognosis, one would design
a randomized study of early versus late treatment.
However, ethical issues prevent these studies being
carried out except in the case of a first seizure or of
specific benign childhood epilepsy syndromes, such
as benign rolandic epilepsy. In these benign syn-
dromes, however, randomized treatment trials may
provide useful information about the efficacy of the
drug in preventing seizures but are unlikely to pro-
vide useful data regarding long-term outcomes due
to the generally favorable clinical course of these
syndromes.
The situation in developing countries, where
AEDs may not be readily available, is different.
There, even patients with tonic-clonic seizures may
be untreated due to lack of resources. This un-
fortunate situation allows one to examine whether
patients whose treatment was delayed respond as
well as newly diagnosed patients (Feksi et al., 1991;
Sander, 1993). In a randomized trial comparing two
antiepileptic drugs in drug-naive patients in Kenya,
the response to treatment was quite comparable
to what is seen in more economically developed
countries in patients with newly diagnosed epilepsy
225
(Feksi et al., 1991). Half of the patients in the
Kenyan study had epilepsy of more than 5-years'
duration, and about a third had a history of more
than 100 generalized tonic-clonic seizures. Within
the trial, patients with longer duration of epilepsy
and those with a history of more than 100 seizures
responded equally well to medication as did those
with epilepsy of briefer duration and fewer seizures.
Such comparability of outcomes would not be ex-
pected if the occurrence of seizures did, in fact,
exacerbate the underlying disease or process. The
epidemiologic data from developing countries has
been comprehensively reviewed by Sander (1993).
Further evidence against an adverse impact of
occasional brief seizures on long-term prognosis
comes from longitudinal epidemiological studies of
the prognosis of childhood onset seizures. Sillanpaa
et al. (1998a) followed a population based cohort
of childhood onset epilepsy in Turku Finland for
over 30 years. On multivariable analysis of predic-
tors of remission or lack of remission, the number
of seizures prior to treatment was not significant.
Rather, it was whether the patient responded to
treatment within the 3 months or not. Berg et al.
(2001) have examined early predictors of intractabil-
ity in a community based cohort of 613 children
with newly diagnosed epilepsy in Connecticut. The
number of seizures prior to diagnosis was not sig-
nificant. What was very significant was the seizure
frequency. Children with a higher seizure frequency
were more likely to develop medically refractory
epilepsy within a few years of diagnosis. Both these
studies indicate that one can indeed identify subjects
who may not do well early, but that it is the un-
derlying biology of the particular epilepsy syndrome
that is important rather than a specific number of
seizures.
The results from the British National General
Practice Study of Epilepsy are also consistent with
this finding (Cockerell et al., 1997; MacDonald et
al., 2000). In this analysis, the probability of re-
mission was related to the number of seizures in
the 6-month period after the first identified seizure.
While the authors talk about the number of seizures
as the predictive variable in the study, it is clear that
in fact they were looking at seizure frequency rather
than the absolute number of seizures. Having more
than 10 seizures prior to diagnosis was not associated
226
with a differential probability of remission. However,
having > 10 seizures in the 6 months following diag-
nosis, presumably on AED therapy though this is not
explicitly stated, was associated with a substantially
reduced chance of remission. The number of seizures
in 6 months is a measure of seizure frequency rather
than of absolute number of seizures. Thus these
results are very consistent with those from epidemio-
logical studies of childhood onset seizures discussed
above (Sillanpaa et al., 1998a; Berg et al., 2001).
Seizure frequency at the time of initial referral
was also reported to be associated with long-term
prognosis in a recent study from Japan (Ohtsuka et
al., 2001).
Time course of seizures
In a retrospective analysis of newly diagnosed pa-
tients with epilepsy, Elwes et al. (1988) reported that
untreated epilepsy follows a progressive course with
decreasing intervals between seizures and argued
that this demonstrates the Gowers hypothesis that
seizures beget seizures. However, other studies have
not found this progression. In the Dutch prospective
study of newly diagnosed childhood epilepsy, Van
Donselaar et al. (1997) found that the interseizure
interval was variable showing a decelerating course
in some and an accelerating course in others with no
consistent pattern being found. They concluded that
their data did not demonstrate a progressive course
and that fear of disease progression should not be
used as an argument for early therapy. In a prospec-
tive study of children followed from the time of their
first seizure, Shinnar et al. (2000) examined the risk
of subsequent seizures after each seizure. Once a
second seizure has occurred, the risk of subsequent
seizures was approximately 70%, an observation that
has also been made in adults (Hauser et al., 1998).
However, the subsequent risk of seizures remained
approximately the same over the first five or six
seizures. In other words, the probability of a third
seizure once a second seizure has occurred was the
same as the probability of a fourth seizure after a
third seizure which was the same as the probability
of a fifth seizure once a fourth seizure has occurred.
These findings argue against a progressive course as
a result of a few seizures early in the course of the
disorder.
In the current volume, Hauser and Lee (Chapter
19) report an increasing risk for seizure recurrence
with increasing numbers of seizures in a select group
of people with a first seizure. Paradoxically, this
finding is limited to those with no risk factors for
recurrence - the group with lowest initial recurrence
risk and a group with high probability of remission
(Shafer et al., 1988). Thus the long-term impact of
this phenomenon which was not found in the analysis
of Shinnar et al. (2000) of a similar data set remains
unclear.
Seizures or epileptiform EEG?
Epileptiform activity on the electroencephalogram
(EEG) is the hallmark interictal finding in patients
with epilepsy. Interictal spikes are by definition not
a seizure but an interictal signature of the seizure
focus. They do represent abnormal brain activity.
Paradoxically, the evidence for damage for interictal
spikes is far more convincing than the evidence for
actual clinical seizures. The issues of kindling and of
secondary epileptogenesis are discussed elsewhere
in this volume and are beyond the scope of this
discussion. It should be noted that, while of theo-
retical concern, their occurrence in humans remains
controversial (Goldensohn, 1984; Engel and Shew-
mon, 1991). However, there are several epilepsy syn-
dromes where it is the interictal spikes rather than
the seizures per se that are thought to be responsible
for the damage. The best known of these are continu-
ous spike wave in sleep also known as electrographic
status epilepticus in sleep (Tassinari et al., 1992), the
Landau-Kleffner syndrome (Beaumanoir, 1992) and
infantile spasms (Jeavons and Livet, 1992).
Epilepsy with electrical status epilepticus during
sleep (ESES) also known as epilepsy with continuous
spikes and waves during slow sleep (CSWS)
Children with this form of childhood onset epilepsy
usually have a variety of seizure types both general-
ized and partial (Tassinari et al., 1992). The seizures
are not usually medically refractory. The hallmark
EEG of this syndrome is that during slow wave sleep,
80% or more of the EEG tracing consists of spike
and wave activity. Cognitive and behavioral deterio-
ration are common in this syndrome with the specific

area of deterioration often associate with the location
of the spike focus. It may involve language, mem-
ory, executive functions, affect and behavior. The
deterioration occurs even if the clinical seizures are
well controlled with AED therapy. Seizures usually
remit in adolescence but the cognitive and behavioral
problems often persist. Treatment is therefore aimed
not just at seizure control but at elimination of the
abnormal electrical activity and therefore involves
agents, such as steroids, which are thought to sup-
press not just seizures but also the underlying EEG
focus.
Acquired epileptic aphasia (Landau-Kleffner
syndrome)
The Landau-Kleffner syndrome (LKS) is a child-
hood disorder consisting of an acquired aphasia and
epileptiform discharges involving the temporal or
parietal regions of the brain (Beaumanoir, 1992).
Onset is usually between age 4 and 10 years. The
majority of children (70-80%) have clinical seizures,
usually readily controlled with AED therapy, but the
occurrence of clinical seizures is not part of the diag-
nostic criteria. The onset of the aphasia may be acute
or insidious and may precede or follow the onset of
clinical seizures by several months. LKS is a pre-
dominantly receptive aphasia with verbal auditory
agnosia being the typical language disorder though
many children become mute. Many children learn to
communicate using sign language. The EEG criteria
for the diagnosis of LKS are less well defined than
those for ESES (Beaumanoir, 1992). The most com-
mon pattern is of spikes or spike-and-wave activity,
usually in the temporal or parietal-occipital area
accentuated by sleep. There are no clear frequency
criteria for the spikes and all night EEG recordings
may be needed to detect them. While LKS is a clin-
ically distinct entity, there is some debate as to how
much it overlaps with ESES, but this is beyond the
scope of this review.
The seizures in LKS, if they occur, readily re-
spond to conventional AED therapy. However, the
language deterioration occurs despite good seizure
control and is thought to be related to the interictal
epileptiform activity involving the temporal lobes,
though the mechanism for this is not established.
Seizures essentially always remit in this syndrome.
227
This is why it was considered a relatively benign
form of childhood epilepsy for many years. How-
ever, while language function may improve, deficits
in language, often quite severe, persist even after
the disappearance of the spike focus (Bishop, 1985;
Marescaux et al., 1990; Dugas et al., 1991).
As is the case with ESES, treatment is aimed
not so much at suppressing seizure which are usu-
ally infrequent and respond to any of the standard
AEDs, but at suppression of the spike focus and
even reversal of he underlying encephalopathic pro-
cess. Drugs such as valproate and benzodiazepines
which suppress generalized spikes have been used
(Marescaux et al., 1990). High-dose steroids are
commonly used for cases where language function
fails to improve with conventional AED therapy
though controlled studies as to their efficacy are not
available (Marescaux et al., 1990; Lerman et al.,
1991). A few centers have even used subpial transec-
tion as a surgical means of abolishing the interictal
spike activity (Morrell et al., 1995; Rintahaka et al.,
1995).
Infantile spasms (West syndrome)
Infantile spasms or West syndrome is an age-specific
epileptic disorder of infancy with peak onset between
4 and 6 months of age. The usual features are onset
of infantile spasms associated with a hypsarrhyth-
mic EEG followed by developmental regression and
loss of previously acquired milestones (Jeavons and
Livet, 1992). The etiologies are varied. Of particular
interest to our discussion are the 10-20% of cases
who are of cryptogenic etiology (i.e. were previously
developmentally normal and have normal imaging
studies). While the spasms themselves are an age-
dependent phenomenon that eventually remits with
or without treatment, these children are often left
with severe cognitive impairment.
Children with infantile spasms, even if initially
developmentally normal, often regress and lose mile-
stones following the onset of the disorder which is
characterized as an epileptic encephalopathy. The
typical EEG pattern is hypsarrhythmia which con-
sists of high-voltage, multifocal independent spikes
and waves superimposed on a very disorganized
background. The presumption is that it is this wildly
abnormal EEG pattern rather than the brief seizures
228
that is responsible for the regression. Treatment for
cryptogenic cases is usually high-dose adrenocorti-
cotrophic hormone (ACTH) (Baram et al., 1996) and
therapy is aimed not just at suppressing seizures,
but at reversing the hypsarrhythmic EEG (Baram
et al., 1996; Riikonen, 2000). While many children
do poorly despite treatment, a proportion of cryp-
togenic cases will normalize their EEGs and have
normal developmental outcomes as well as no fur-
ther seizures. Favorable outcomes are more common
in population-based cohorts. In a population-based
incident series from Iceland, all five children with
cryptogenic infantile spasms were seizure free and
in a normal school setting at follow-up (Ludvigs-
son et al., 1994). Note that treatment is aimed at
reversing the EEG abnormality not just suppressing
seizures and that developmental improvement is as-
sociated with improvement of the EEG. ACTH is not
a conventional AED and is a drug that may well be
considered to be not just antiseizure but antiepilepto-
genic in the true sense of the word as it does seem to
alter the underlying process.
What all these three seemingly very different syn-
dromes share in common is the presence of cognitive
and behavioral deterioration in the presence of an
epileptiform process. However, one cannot leap to
the conclusion that seizures per se are the cause of
this decline. In cases of LKS, clinical seizures are
not always even present and in the case of ESES
they are usually readily controlled with AEDs. In
neither case is seizure control associated with either
preventing or reversing the decline in function which
is thought to be due to the frequent interictal ac-
tivity. Infantile spasms is a very different syndrome
where the seizures may be difficult to control and
which is often associated with subsequent medically
refractory epilepsy. Discussing it in the same context
serves to highlight the concept that it is not the brief
myoclonic seizures per se that cause the damage,
but the epileptiform encephalopathy that underlies it.
Even in cases where the spasms remit and no further
seizures occur, the child may be left with devastating
cognitive and behavioral sequelae. Infantile spasms
are also a disorder where therapy is explicitly aimed
at not just controlling seizures but at reversing the
underlying EEG abnormalities. ACTH is used pre-
cisely because of its demonstrated ability to reverse
the hypsarrhythmic EEG pattern thought to be re-
sponsible for the clinical deterioration (Baram et al.,
1996; Riikonen, 2000).
The evidence reviewed suggests that it is not
the seizure per se that cause deterioration, but the
underlying epileptic process. The implication of this
for those who argue for early treatment of seizures
to prevent sequelae is that in these syndromes it is
insufficient to treat seizures, but one must eliminate
the seizure focus. Most of our conventional AEDs
including specifically sodium channel blockers such
as carbamazepine and phenytoin are excellent at
suppressing seizures, but do not significantly affect
the interictal spike focus and may even exacerbate
the EEG. Elimination of the spike focus would be
an argument for early surgical rather than medical
intervention with early being defined as after only
a few seizures and regardless of whether clinical
seizures are occurring (Moshe and Shinnar, 1993;
Shinnar and Berg, 1996). This would be difficult to
justify on a risk-benefit basis without considerably
more supportive data than are currently available.
Epilepsysyndrome
It increasingly appears that, in humans, progno-
sis both for seizure remission or development of
medically refractory epilepsy and for development
of cognitive and behavioral sequelae is primarily a
function of the specific epilepsy syndrome. Seizures
per se, while clearly relevant, may not be the primary
determinant. We have already discussed several syn-
dromes (LKS, ESES, infantile spasms) associated
with adverse cognitive and behavioral outcomes.
Several other syndromes merit specific discussion
in this context.
Benign Rolandic epilepsy
Benign Rolandic epilepsy (BRE), also called benign
childhood epilepsy with centrotemporal spikes, is
characterized by daytime partial seizures and noc-
turnal tonic-clonic seizures of presumed focal on-
set. Age of onset is between ages 3 and 12 years
(Lerman, 1992). The EEG pattern is that of centra-
temporal spikes with a characteristic dipole. The
spikes are more frequent in sleep. Seizure frequency
is usually low and up to half the people with the
EEG trait never have clinical seizures. Seizures are

usually easily controlled with appropriate AEDs,
and the condition virtually always remits by mid-
adolescence regardless of whether AED therapy is
used or not. Many children with centro-temporal
spikes never experience clinical seizures. Because
the seizures are usually infrequent, brief, and of-
ten occur at night, there is growing debate over the
need to treat children with this self-limited form
of epilepsy (Freeman et al., 1987; Ambrosetto and
Tassinari, 1990; O'Dell and Shinnar, 2001).
Childhood absence epilepsy and juvenile myoclonic
epilepsy
Two primary generalized idiopathic epilepsy syn-
dromes, childhood absence and juvenile myoclonic
epilepsy provide additional evidence that it is usu-
ally not seizures per se that alter prognosis (Loiseau,
1992; Wolf, 1992). The seizures in both syndromes
are usually readily controlled with appropriate AED
therapy. The prognosis is quite different. The major-
ity of children with childhood absence epilepsy enter
remission during adolescence, and the generalized
spike and wave EEG abnormalities typical of this
syndrome also disappear. While treatment is benefi-
cial in that it improves the child's ability to attend
to a task in school and learn, there is no evidence
that treatment improves the likelihood of ultimately
achieving remission off medication. In contrast, ju-
venile myoclonic epilepsy rarely remits even with
AED therapy, and the EEG features persists at least
into the fourth or fifth decade though they may
be masked by AED therapy. Long-term therapy is
needed to maintain control of seizures. In terms
of cognitive outcomes, however, juvenile myoclonic
epilepsy has a better prognosis with favorable cog-
nitive outcomes. A recent study of children with
childhood absence epilepsy found that these chil-
dren had impaired academic performance compared
with a control population of children with juvenile
rheumatoid arthritis which is a far more disabling
disorder. While those with uncontrolled seizures did
worse, even those whose seizures were fully con-
trolled did worse than the controls (Wirrell et al.,
1997). Children with idiopathic epilepsy also per-
formed worse than population based normal controls
on a variety of measures of psychosocial function
(Sillanpaa et al., 1998a).
229
Mesial temporal lobe epilepsy
The syndrome of mesial temporal lobe epilepsy
(MTLE) has gained increased recognition as an
epilepsy syndrome that can be progressive. Patients
with medically refractory MTLE frequently have im-
pairment of memory (Sass et al., 1992; Bell and
Davies, 1998; Fuerst et al., 2001). In addition, recent
studies have suggested that the degree of hippocam-
pal atrophy may be correlated with the duration of
the seizure disorder (Fuerst et al., 2001; Sutula and
Pitkanen, 2001). As this epilepsy syndrome responds
well to resective surgery, a cogent argument can be
made for early surgical intervention in this epilepsy
syndrome for cases that are medically refractory (En-
gel, 2001; Sutula and Pitkanen, 2001; Wiebe et al.,
2001).
As the majority of seizures in patients with MTLE
are brief complex partial seizures, the above data has
also been cited as evidence that even brief seizures
can cause damage (Fuerst et al., 2001; Sutula and
Pitkanen, 2001). There are several problems with
this line of reasoning. Firstly the evidence comes
primarily from patients with medically refractory
MTLE. These patients have typically had hundreds if
not thousands of seizures by the time they are being
evaluated for surgery. While there is no question
that some of these patients have had a progressive
course, it is difficult to understand how one can
extrapolate the data from these patients to patients
with occasional brief seizures. Other studies have
suggested that there is a wide spectrum of clinical
manifestations of MTS and that it is not always
associated with medically refractory MTLE (Kim et
al., 1999; Kobayashi et al., 2001).
In addition, while the interictal EEGs from sur-
face recordings are often relatively silent, intracranial
recordings with depth electrodes frequently demon-
strate a very active spike focus with very frequent
discharges that are not being seen at the surface due
to the anatomy of the hippocampus which creates a
closed field. Is it possible that in analogy with ESES
and Landau-Kleffner syndrome, at least some of the
progressive symptomatology, including impairment
of memory, may be due to the very frequent spike
activity that is taking place in the hippocampus?
230
Summary
The specific epilepsy syndrome plays a key role in
determining long-term prognosis. There are clearly
syndromes, such as benign rolandic epilepsy, whose
prognosis is favorable regardless of therapy. Other
syndromes, such as LKS and ESES, have a favorable
prognosis in terms of seizures, but an unfavorable
one in terms of cognitive outcomes. Infantile spasms
and the Lennox-Gastaut syndrome are associated
with a poor prognosis for both remission of seizures
and cognitive and behavioral outcomes. MTLE is a
syndrome with variable outcomes. In cases of med-
ically refractory MTLE, the data suggest that the
syndrome may be progressive and early surgical in-
tervention may be justified once medical intractabil-
ity is established. However, the data do not suggest
an adverse effect on outcome as a consequence of an
occasional brief seizure.
Rationale for early intervention
From a clinical perspective, the issue needs to be
framed from a risk-benefit perspective. Few people
believe that seizures are good for you. Even brief
seizures have the potential for adverse outcomes, es-
pecially if they occur in the wrong place at the wrong
time (O'Dell and Shinnar, 2001). As elegantly out-
lined throughout this volume, there are also potential
physiologic changes that occur following seizures.
Some of these changes may be persistent though
here the evidence is strongest for prolonged or fre-
quent seizures rather than occasional brief seizures.
Thus from a theoretical perspective, it is appropriate
to be concerned about the possible adverse effects
of even brief seizures. However, AEDs, both new
and old, are also not without adverse effects which
have been reviewed extensively elsewhere (Com-
mittee on Drugs, 1995; O'Dell and Shinnar, 2001).
These include idiosyncratic and dose-related effects
as well as the potential for teratogenicity. Subtle ef-
fects on cognition and behavior are common even in
individuals who do not demonstrate overt cognitive
symptomatology (Vining et al., 1987; Committee on
Drugs, 1995; O'Dell and Shinnar, 2001).
In all the discussion of adverse effects of seizures,
the reverse side of the coin is rarely considered. For
example, in Hauser and Lee (2002, this volume) an
increasing risk for seizure recurrence with increasing
numbers of seizures is reported in a select group of
people with a first seizure. However, this finding is
limited to those with no risk factors for recurrence
- - the group with lowest initial recurrence risk and
a group with high probability of remission (Shafer
et al., 1988). What are the factors that influence
remission in this group of patients which includes
adults as well as some children? The brain must
have some mechanisms that will suppress the seizure
focus as, in this primarily adult population, devel-
opmental factors are unlikely to play a major role.
Could the seizures themselves have a role to play? Is
it possible that, at least in some cases, seizures may
be in some way a response to an underlying patho-
logic state and reflect a response of homeostatic
mechanisms to modify a pathologic substrate? They
may in some settings be responsible for establishing
the milieu for the remission that characterizes the
majority of cases of epilepsy regardless of etiology
or age of onset. The majority of the seizure models
are models of acute symptomatic seizures rather than
of chronic epilepsy. While it is difficult to seriously
argue a beneficial effect for seizures, the epidemi-
ological data certainly do not demonstrate adverse
effects from occasional brief seizures per se.
For the clinician, the discussion does not focus
on whether even brief seizures may be harmful, but
on a risk-benefit analysis. In adults, there is now
consensus that after the second seizure, treatment
is usually indicated. This is not based on evidence
that waiting longer will worsen outcome but rather
on epidemiological data that once a second seizure
has occurred the risk of a third seizure is approx-
imately 70% and that therefore, treatment is indi-
cated on a risk-benefit basis (Hauser et al., 1998;
O'Dell and Shinnar, 2001). Even in this setting spe-
cial circumstances, such as a woman who wishes
to have children and does not need to drive, may
change the risk-benefit analysis towards no treat-
ment in selected cases. In children, the recurrence
risks are similar, but there is much more controversy
on the need to treat following a second seizure (Free-
man et al., 1987; Duchowny, 2000; Shinnar et al.,
2000; O'Dell and Shinnar, 2001). This is because
on a risk-benefit basis, the potential consequences
of seizures are somewhat less than in adults, the
risk of adverse effects from AEDs somewhat greater

and the probability that they have a self-limited age-
dependent childhood seizure disorder must also be
factored in (Shinnar et al., 2000; O'Dell and Shinnar,
2001).
If even brief seizures produce damage, one would
logically initiate treatment after the first seizure. To
justify this, one would have to demonstrate that AED
therapy after the first seizure improves prognosis
compared with waiting until at least two have oc-
curred. While there is basic science data suggesting
that even brief seizures have potential adverse con-
sequences, the clinical data from randomized and
epidemiological studies have not demonstrated any
adverse effects on long-term outcomes from delay-
ing therapy until at least two seizures have occurred.
This needs to remain the fundamental justification
for putting patients on drugs all of which have poten-
tial toxicities. The evidence to date while intriguing
and justifying further research does not provide a
sufficient rationale justify treating individual with a
first unprovoked seizure with AEDs in order to alter
the long-term prognosis. It clearly does justify treat-
ing most individuals with recurrent seizures in order
to prevent further seizures.
The data on potential adverse effects from in-
terictal spike activity is also of concern and raises
similar risk-benefit issues. In general, our conven-
tional AEDs do not suppress interictal spike activity
with the exception of the generalized spike and wave
activity seen in the primary generalized epilepsy syn-
dromes. Therefore, if one desires to suppress them,
one needs to either use nonconventional medications,
such as steroids, or to advocate for very early surgi-
cal intervention to remove the epileptic focus even in
patients whose clinical seizures are controlled with
AEDs. Indeed this rationale has been used to justify
subpial transection of the posterior temporal lobe in
some cases of children with language regression and
LKS who had epileptic loci as the presumed cause of
the regression (Morrell et al., 1995; Rintahaka et al.,
1995). The same argument, namely that one would
need a surgical rather than medical intervention, can
be made with regard to preventing kindling or sec-
ondary epileptogenesis (Moshe and Shinnar, 1993;
Shinnar and Berg, 1996). The clinical data at this
time do not justify the use of these procedures in this
setting outside of a controlled clinical trial.
231
Conclusions
The epidemiological data do not provide clear ev-
idence for adverse effects from occasional brief
seizures. Evidence for a progressive adverse effects
of seizures comes primarily from specific epilepsy
syndromes, often with markedly abnormal interictal
patterns. Treatment with conventional AEDs appears
to be effective in reducing seizure recurrence but
does not alter long-term prognosis. Chronic AED
therapy is also associated with a variety of adverse
effects. Animal models elegantly presented in this
volume report data that are a cause for concern and
justify further study. However, on a risk-benefit ba-
sis, the clinical data do not justify early intervention
after a single seizure to attempt to alter the long-term
outcome.
Acknowledgements
Supported in part by Grant R01 NS26151 (to S.S.)
from the National Institute of Neurological Disorders
and Stroke, NIH, Bethesda, MD.
References
Ambrosetto, G. and Tassinari, C.A. (1990) Antiepileptic drug
treatment of benign childhood epilepsy with rolandic spikes:
is it necessary?. Epilepsia, 31: 802-805.
Annegers, J.F., Hauser, W.A. and Elveback, L.R. (1979a) Re-
mission of seizures and relapse in patients with epilepsy.
Epilepsia, 20: 729-737.
Annegers, J.E, Hauser, W.A., Elveback, L.R. and Kurland, L.T.
(1979b) The risk of epilepsy following febrile convulsions.
Neurology, 29: 297-303.
Annegers, J.F., Grabow, J.D., Groover, R.V., Laws Jr., E.R.,
Elveback, L.R. and Kurland, L.T. (1980) Seizures after head
trauma: a population study. Neurology, 30: 683-689.
Annegers, J.F., Shirts, S.B., Hauser, W.A. and Kurland, L.T.
(1986) Risk of recurrence after an initial unprovoked seizure.
Epilepsia, 27: 43-50.
Annegers, J.F., Hauser, W.A., Shirts, S.B. and Kurland, L.T.
(1987) Factors prognostic of unprovoked seizures after febrile
convulsions. New Engl. J. Med., 316: 493-498.
Annegers, J.F., Blakely, S.A., Hauser, W.A. and Kurland, L.T.
(1990) Recurrence of febrile convulsions in a population-based
cohort. Epilepsy Res., 66: 1009-1012.
Annegers, J.F., Hauser, W.A., Coan, S. and Rocca, W.A. (1998)
A population-based study of seizures after traumatic brain
injuries. New Engl. J. Med., 338: 20-24.
Baram, T.Z., Mitchell, W.G., Touruay, A., Snead, O.C., Han-
son, R.A. and Horton, E.J. (1996) High-dose corticotropin
232
(ACTH) versus prednisone for infantile spasms: a prospective,
randomized, blinded study. Pediatrics, 97: 375-379.
Beaumanoir, A. (1992) The Landau-Kleffner syndrome. In: J.
Roger, M. Bureau, C. Dravet, EE. Dreifuss et al. (Eds.),
Epileptic Syndromes in Infancy, Childhood and Adolescence,
2nd edn. John Libbey, London, pp. 231-243.
Bell, B. and Davies, K. (1998) Hippocampal sclerosis and mem-
ory: Recent neuropsychological findings. Neuropsychol. Rev.,
8: 25-41.
Berg, A.T. and Shinnar, S. (1991) The risk of seizure recurrence
following a first unprovoked seizure: a quantitative review.
Neurology, 41: 965-972.
Berg, A.T. and Shinnar, S. (1996a) Unprovoked seizures in
children with febrile seizures: short term outcomes. Neurology,
47: 562-568.
Berg, A.T. and Shinnar, S. (1996b) Complex febrile seizures.
Epilepsia, 37: 126-133.
Berg, A.T. and Shinnar, S. (1997) Do seizures beget seizures?
An assessment of the clinical evidence in humans. J. Clin.
Neurophysiol., 14: 102-110.
Berg, A.T., Shinnar, S., Hauser, W.A. and Leventhal, J.M. (1990)
Predictors of recurrent febrile seizures: a meta-analytic review.
J. Pediatr., 116: 329-337.
Berg, A.T., Shinnar, S., Hauser, W.A., Alemany, M., Shapiro,
E.D., Salomon, M.E. and Crain, E.E (1992) A prospective
study of recurrent febrile seizures. New Engl. J. Med., 327:
1122-1127.
Berg, A.T., Shinnar, S., Darefsky, A.S., Holford, T.R., Shapiro,
E.D., Salomon, M.E., Crain, E.E and Hauser, W.A. (1997)
Predictors of recurrent febrile seizures. Arch. Pediatr. Adolesc.
Med., 151: 371-378.
Berg, A.T., Shinnar, S., Levy, S.R. and Testa, EM. (1999) Status
epilepticus in children with newly diagnosed epilepsy. Ann.
Neurol., 45: 618-623.
Berg, A.T., Shinnar, S., Levy, S.R., Testa, EM., Smith-Rapaport,
S. and Beckerman, B. (2001) Early development of intractable
epilepsy in children: a prospective study. Neurology, 56: 1445-
1452.
Bishop, D.V.M. (1985) Age of onset and outcome in 'ac-
quired aphasia with convulsive disorder' (Landau-Kleffner
syndrome). Dev. Med. Child Neurol., 27: 705-712.
Camfield, ER., Camfield, C.S., Dooley, J.M., Tibbles, J.A.R.,
Fung, T. and Garner, B. (1985) Epilepsy after a first unpro-
voked seizure in childhood. Neurology, 35: 1657-1660.
Camfield, E, Camfield, C., Dooley, J., Smith, E. and Garner,
B. (1989) A randomized study of carbamazepine versus no
medication following a first unprovoked seizure in childhood.
Neurology, 39:851-852.
Camfield, C., Camfield, E, Gordon, K. and Dooley, J. (1996)
Does the number of seizures before treatment influence ease
of control or remission of childhood epilepsy? Not if the
number is l0 or less. Neurology, 464: 41-44.
Chadwick, D. (1995) Do anticonvulsants alter the natural course
of epilepsy? Case for early treatment is not established. Br.
Med. J., 310: 177-178.
Chandra, B. (1992) First seizure in adults: to treat or not to treat.
Clin. Neurol. Neurosurg., 94(Suppl.): $61-$63.
Chang, Y.-C., Gut, N.-W., Huang, C.-C., Wang, S.-T. and Tsai,
J.-J. (2000) Neurocognitive attention and behavior outcome of
school-age children with a history of febrile convulsions: a
population study. Epilepsia, 41: 412-420.
Chang, Y.C., Gut, N.W., Wang, S.T., Huang, C.C. and Tsai,
J.J. (2001) Working memory of school-aged children with a
history of febrile convulsions: a population study. Neurology,
in press.
Chen, K., Baram, T.Z. and Soltesz, I. (1999) Febrile seizures
in the developing brain result in persistent modification of
neuronal excitability in limbic circuits. Nat. Med., 5: 888-894.
Cockerell, O.C., Johnson, A.L., Sander, J.W. and Sborvon, S.D.
(1997) Prognosis of epilepsy: a review and further analysis
of the first nine years of the British National General Prac-
tice Study of Epilepsy, a prospective population-based study.
Epilepsia, 38: 31-46.
Collaborative Group for the Study of Epilepsy (1992) Prognosis
of epilepsy in newly referred patients: a multicenter prospec-
tive study of the effects of monotherapy on the long-term
course of epilepsy. Epilepsia, 33:45-51.
Committee on Drugs (1995) American Academy of Pediatrics.
Behavioral and cognitive effects of anticonvulsant therapy.
Pediatrics, 96: 538-540.
Commission on Epidemiology and Prognosis (1993) Interna-
tional League Against Epilepsy. Guidelines for epidemiologic
studies on epilepsy. Epilepsia, 34: 592-596.
Corey, L.A., Pellock, J.M., Boggs, J.G., Miller, L.L. and De-
Lorenzo, R.J. (1998) Evidence for a genetic predisposition for
status epilepticus. Neurology, 50: 558-560.
Dube, C. (2002) Do prolonged 'febrile' seizures in an immature
rat model cause epilepsy? In: T.Z. Baram and S. Shinnar
(Eds.), Febrile Seizures. Academic Press, San Diego, CA, pp.
215-229.
Dube, C., Chen, K., Eghbal-Ahmadi, M., Brunson, K., Soltesz,
I. and Baram, T.Z. (2000) Prolonged febrile seizures in the
immature rat model enhance hippocampal excitability long
term. Ann. Neurol., 47: 336-344.
Duchowny, M. (2000) Seizure recurrence in childhood epilepsy:
"the future ain't what it used to be". Ann. NeuroL, 48: 137-
139.
Dugas, M., Gerard, C.L., Franc, S. et al. (1991) Natural history,
course and prognosis of the Landau and Kleffner syndrome.
In: I.P. Martins, A. Castro-Caldas, H.R. Van Dongen and A.
van Hout (Eds.), Acquired Aphasia in Children: Acquisition
and Breakdown of Language in the Developing Brain. Kluwer
Academic, Dordrecht, pp. 263-277.
Ellenberg, J.H. and Nelson, K.B. (1978) Febrile seizures and
later intellectual performance. Arch. Neurol., 35: 17-21.
Elwes, R.D., Johnson, A.L., Shorvon, S.D. and Reynolds, E.H.
(1984) The prognosis for seizure control in newly diagnosed
epilepsy. New Engl. J. Med., 311 : 944-947.
Elwes, R.D., Johnson, A.L. and Reynolds, E.H. (1988) The
course of untreated epilepsy. Br. Med. J., 297: 948-950.
Engel Jr., J. (2001) Finally, a randomized, controlled trial of
epilepsy surgery. New Engl. J. Med., 345: 365-367.
Engel, J. and Shewmon, D.A. (1991) The impact of the kindling
phenomenon on clinical epileptology. In: E Morrell (Ed.),

Kindling and Synaptic Plasticity: The Legacy of Graham God-
dard. Birkhauser, Boston, MA, pp. 195-210.
Feksi, A.T., Kaamugisha, J., Sander, J.W., Gatiti, S. and Shorvon,
S.D. (1991) Comprehensive primary health care antiepileptic
drug treatment in rural and semi-urban Kenya. Lancet, 337:
406-407.
First Seizure Trial Group (1993) Randomized clinical trial on the
efficacy of antiepileptic drugs in reducing the risk of relapse
after a first unprovoked tonic-clonic seizure. Neurology, 43:
478-483.
Foy, P.M., Chadwick, D.W., Rajgopalan, N., Johnson, A.L. and
Shaw, M.D. (1992) Do prophylactic anticonvulsant drugs alter
the pattern of seizures after craniotomy?. J. Neurol. Neurosurg.
Psychiatry, 55: 753-757.
Freeman, J.M., Tibbles, J., Camfield, C. and Camfield, P. (1987)
Benign epilepsy of childhood: a speculation and its ramifica-
tions. Pediatrics, 79: 864-868.
Fuerst, D., Shah, J., Kupsky, W.J., Johnson, R., Shah, A.,
Hayman-Abello, B., Ergh, T., Poore, Q., Canady, A. and Wat-
son, C. (2001) Volumetric MRI, pathological, and neuropsy-
chological progression in hippocampal sclerosis. Neurology,
57: 184-188.
Gilad, R., Lampl, Y., Gabbay, U., Eshel, Y. and Sarova-Pinhas,
I. (1996) Early treatment of a single generalized tonic-clonic
seizure of prevent recurrence. Arch. Neurol., 53:1149-1152.
Goldensohn, E.S. (1984)The relevance of secondary epilepto-
genesis to the treatment of epilepsy: kindling and the mirror
focus. Epilepsia, 25(Suppl. 2): S156-S168.
Gowers, W.R. (1881) Epilepsy and Other Chronic Convulsive
Disorders. Churchill, London.
Hauser, W.A. and Lee, J.R. (2002) Do seizures beget seizures?
In: T. Sutula and A. Pitk~nen (Eds.), Do Seizures Damage
the Brain. Progress in Brain Research, Vol. 135. Elsevier,
Amsterdam, pp. 215-219.
Hauser, W.A., Anderson, V.E., Loewenson, R.B. and McRoberts,
S.M. (1982) Seizure recurrence after a first unprovoked
seizure. New Engl. J. Med., 307: 522-528.
Hauser, W.A., Tabaddor, K., Factor, P. and Feiner, C. (1984)
Seizures and head injury in an urban community. Neurology,
34: 746-758.
Hauser, W.A., Rich, S.S., Annegers, J.E and Anderson, V.E.
(1990) Seizure recurrence after a 1st unprovoked seizure: an
extended followup. Neurology, 40:1163-1170.
Hauser, W.A., Rich, S.S., Lee, J.R., Annegers, J.F. and Anderson,
V.E. (1998) Risk of recurrent seizures after two unprovoked
seizures. New Engl. J. Med., 338: 429-434.
Hesdorffer, D.C. and Hauser, W.A. (2002) Febrile seizures and
the risk for epilepsy. In: T.Z. Baram and S. Shinnar (Eds.),
Febrile Seizures. Academic Press, San Diego, CA, pp. 63-76.
Hirtz, D. (2002) Cognitive outcome of febrile seizures. In: T.Z.
Baram and S. Shinnar (Eds.), Febrile Seizures. Academic
Press, San Diego, CA, pp. 53-61.
Hirtz, D., Ashwal, S., Berg, A., Bettis, D., Camfield, C., Cam-
field, P., Crumrine, P., Elterman, R., Schneider, S. and Shinnar,
S. (2000) Practice Parameter: Evaluating a first nonfebrile
seizure in children: report of the Quality Standards Subcom-
mittee of the American Academy of Neurology, the Child
233
Neurology Society and the American Epilepsy Society. Neu-
rology, 55: 616-623.
Hopkins, A., Garman, A. and Clarke, C. (1988) The first seizure
in adult life: value of clinical features electroencephalogra-
phy and computerized tomographic scanning in prediction of
seizure recurrence. Lancet, 1: 721-726.
Jeavons, P.M. and Livet, M.O. (1992) West syndrome: infantile
spasms. In: J. Roger, M. Bureau, C. Dravet et al. (Eds.),
Epileptic Syndromes in Infancy, Childhood and Adolescence,
2nd edn. John Libbey, London, pp. 53-65.
Kim, W.J., Park, S.C. and Lee, S.J. et al. (1999) The prognosis
for control of seizures with medications in patients with MRI
evidence for mesial temporal sclerosis. Epilepsia, 40: 290-
293.
Knudsen, EU. (2002) Treatment of febrile seizures: practi-
cal management approaches to simple and complex febrile
seizures. In: T.Z. Baram and S. Shinnar (Eds.), Febrile
Seizures. Academic Press, San Diego, CA, pp. 273-304.
Knudsen, EU. and Vestermark, S. (1985) Recurrence risk after
first febrile seizure and effect of short-term diazepam prophy-
laxis. Arch. Dis. Child., 60: 1045-1049.
Knudsen, EU., Paerregaard, A., Andersen, R. and Andresen, J.
(1996) Long term outcome of prophylaxis for febrile convul-
sions. Arch. Dis. Child., 74: 13-18.
Kobayashi, E., Lopes-Cendes, I., Guerreiro, C.A.M., Sousa, S.C.,
Guerreiro, M.M. and Cendes, E (2001) Seizure outcome and
hippocampal atrophy in familial mesial temporal lobe epilepsy.
Neurology, 56: 166-172.
Lerman, P. (1992) Benign partial epilepsy with centro-temporal
spikes. In: J. Roger, M. Bureau, C. Dravet et al. (Eds.),
Epileptic Syndromes in Infancy, Childhood and Adolescence.
2nd edn. John Libbey, London, pp. 189-200.
Lerman, P., Lerman-Sagie, T. and Kivity, S. (1991) Effect of
early steroid therapy for Landau-Kleffner syndrome. Dev.
Med. Child Neurol., 33: 257-266.
Loiseau, P. (1992) Childhood absence epilepsy. In: J. Roger,
M. Bureau, C. Dravet et al. (Eds.), Epileptic Syndromes in
Infancy, Childhood and Adolescence, 2nd edn. John Libbey,
London, pp. 135-150.
Ludvigsson, P., Olafsson, E., Siguroardottir, S. and Hauser, W.A.
(1994) Epidemiologic features of infantile spasms in Iceland.
Epilepsia, 35: 802-805.
MacDonald, B.K., Johnson, A.L., Goodridge, D.M., Cockrell,
O.C., Sander, J.W.A.S. and Shorvon, S.D. (2000) Factors pre-
dicting prognosis of epilepsy after presentation with seizures.
Ann. Neurol., 48: 833-841.
Marescaux, C., Hirsch, E. and Finck, S. et al. (1990) Landau-
Kleffner syndrome. A pharmacologic study of five cases.
Epilepsia, 31: 768-777.
Maytal, J. and Shinnar, S. (1990) Febrile status epilepticus.
Pediatrics, 86: 611-616.
Mitchell, T.V. and Lewis, D.V. (2002) Do prolonged febrile
seizures injure the hippocampus? Human MRI studies. In:
T.Z. Baram and S. Shinnar (Eds.), Febrile Seizures. Academic
Press, San Diego, CA, pp. 103-126.
Morrell, E, Whisler, W.W. and Smith, M.C. et al. (1995)
234
Landau-Kleffner syndrome: Treatment with subpial intracorti-
cal transection. Brain, 118: 1529-1546.
Moshe, S.L. and Shinnar, S. (1993) Early Intervention. In: J.
Engel Jr. (Ed.), Surgical Treatment of the Epilepsies, 2nd edn.
Raven Press, New York, NY, pp. 123-132.
Musicco, M., Beghi, E., Solari, A. and Viani, F. (1997) Treatment
of first tonic-clonic seizure does not improve the prognosis of
epilepsy. Neurology, 49: 991-998.
National Institutes of Health (1980) Febrile Seizures: Consensus
Development Conference Summary. Vol. 3, no. 2. National
Institutes of Health, Bethesda, MD.
Nelson, K.B. and Ellenberg, J.H. (1978) Prognosis in children
with febrile seizures. Pediatrics, 61: 720-727.
O'DeI1, C. and Shinnar, S. (2001) Initiation and discontinuation
of antiepileptic drugs. Neurol. Clin., 19: 289-311.
Offringa, M., Derksen-Lubsen, G., Bossuyt, P.M.M. and Lubsen,
J. (1992) Seizure recurrence after a first febrile seizure: a
multivariate approach. Dev. Med. Child Neurol., 34: 15-24.
Offringa, M., Bossuyt, P.M.M. and Lubsen, J. et al. (1994) Risk
factors for seizure recurrence in children with febrile seizures:
a pooled analysis of individual patient data from five studies.
J. Pediatr., 124: 574-584.
Ohtsuka, Y., Yoshinaga, H., Kobayashi, K., Murakami, N., Yam-
atogi, Y. Oka, E. and Tsuda, T. (2001) Predictors and un-
derlying causes of medically intractable localization-related
epilepsy in childhood. Pediatr. Neurol., 24:209-213.
Reynolds, E.H. (1995) Do anticonvulsants alter the natural
course of epilepsy? Treatment should be started as early as
possible. Br. Med. J,, 310: 176-177.
Reynolds, E.H., Elwes, R.D.C. and Shorvon, S. (1983) Why does
epilepsy become intractable? Prevention of chronic epilepsy.
Lancet, 2(356): 952-954.
Riikonen, R.S. (2000) Steroids or vigabatrin in the treatment of
infantile spasms?. Pediatr. Neurol., 23: 403-408.
Rintahaka, P.J., Chugani, H.T. and Sankar, R. (1995) Landau-
Kleffner syndrome with continuous spikes and waves during
slow-wave sleep. J. Child Neurol., 10: 127-133.
Rosman, N.P., Colton, T. and Labazzo, J. et al. (1993a) A con-
trolled trial of diazepam administered during febrile illnesses
to prevent recurrence of febrile seizures. New Engl. J. Med.,
329: 79-84.
Rosman, N.P., Labazzo, J.L. and Colton, T. (1993b) Factors
predisposing to afebrile seizures after febrile convulsions and
preventive treatment. Ann. Neurol., 34: 452.
Sander, J.W.A.S. (1993) Some aspects of prognosis in the epilep-
sies: a review. Epilepsia, 34: 1007-1016.
Sass, K., Sass, A. and Westerveld, M. et al. (1992) Specificity
in the correlation of verbal memory and hippocampal neuron
loss: dissociation of memory, language, and verbal intellectual
ability. J. Clin. Exp. Neuropsychol., 14: 662-672.
Shafer, S., Hauser, W.A., Annegers, J.E and Klass, D.W. (1988)
EEG and other early predictors of later epilepsy remission: a
community study. Epilepsia, 29: 590-600.
Shinnar, S. (1998) Prolonged febrile seizures and mesial tempo-
ral sclerosis. Ann. Neurol., 43:411-412.
Shinnar, S. and Berg, A.T. (1996) Does antiepileptic drug therapy
prevent the development of 'chronic' epilepsy. Epilepsia, 37:
701-708.
Shinnar, S., Berg, A.T., Moshe, S.L., Petix, M., Maytal, J., Kang,
H., Goldensohn, E.S. and Hauser, W.A. (1990) Risk of seizure
recurrence following a first unprovoked seizure in childhood:
a prospective study. Pediatrics, 85: 1076-1085.
Shinnar, S., Berg, A.T. and Moshe, S.L. (1995) The effect
of status epilepticus on the long term outcome of a cohort
of children prospectively followed from the time of their
first idiopathic unprovoked seizure. Dev. Med. Child Neurol.,
37(Suppl. 72): 116.
Shinnar, S., Berg, A.T., Moshe, S.L., O'Dell, C., Newstein, D.,
Kang, H., Goldensohn, H. and Hauser, W.A. (1996) The risk
of seizure recurrence following a first unprovoked afebrile
seizure in childhood: an extended follow-up. Pediatrics, 98:
216-225.
Shinnar, S., Berg, A.T,, O'Dell, C., Newstein, D., Moshe, S.L.
and Hauser, W.A. (2000) Predictors of multiple seizures in
a cohort of children prospectively followed from the time of
their first unprovoked seizure. Ann. Neurol., 48: 140-147.
Shinnar, S., Pellock, J.M., Berg, A.T., O'Dell, C., Driscoll,
S.M., Maytal, J., Moshe, S.L. and DeLorenzo, R.J. (2001a)
Short-term outcomes of children with febrile status epilepticus.
Epilepsia, 42: 47-53.
Shinnar, S., Berg, A.T., Moshe, S.L. and Shinnar, R. (2001b)
How long do new-onset seizures in children last?. Ann. Neu-
rol., 49: 659-664.
Shorvon, S.D. and Reynolds, E.H. (1982) Early prognosis of
epilepsy. Br. Med. J., 285: 1699-1701.
Sillanpaa, M., Jalava, M., Kaleva, O. and Shinnar, S. (1998a)
Long-term prognosis of seizures with onset in childhood. New
Engl. J. Med., 338: 1715-1722.
Sillanpaa, M., Jalava, M. and Shinnar, S. (1998b) Status epilepti-
cus in a population based cohort with childhood onset epilepsy
in Finland. Epilepsia, 39(Suppl. 6): 219-220.
Stroink, H., Brouwer, O.F., Arts, W.E, Geerts, A.T., Peters, A.C.
and van Donselaar, C.A. (1998) The first unprovoked seizure
in childhood: a hospital based study of the accuracy of the
diagnosis, rate of recurrence, and long term outcome after
recurrence. Dutch study of epilepsy in childhood. J. NeuroL
Neurosurg. Psychiatry, 64: 595-600.
Sutula, T.P. and Pitkanen, A. (2001) More evidence for seizure-
induced neuron loss: Is hippocampal sclerosis both cause and
effect of epilepsy?. Neurology, 57(2): 169-170.
Tassinari, C.A., Bureau, M., Dravet, C., Dallla Bernardina, B.
and Roger, J. (1992) Epilepsy with continuous spikes and
waves during slow wave sleep - - otherwise described as ESES
(epilepsy with electrical status epilepticus in slow wave sleep.
In: J. Roger, M. Bureau, C. Dravet et al. (Eds.), Epileptic
Syndromes in lnfano', Childhood and Adolescence, 2nd edn.
John Libbey, London, pp. 245-256.
Taylor, D.C. and Ounsted, C. (1971) Biological mechanisms
influencing the outcome of seizures in response to fever.
Epilepsia, 12: 33-45.
Temkin, N.R., Dikmen, S.S., Wilensky, A.J., Keihm, J., Chabal,
S. and Winn, H.R. (1990) A randomized, double-blind study

of phenytoin for the prevention of post-traumatic seizures.
New Engl. J. Med., 323: 497-502.
Toth, Z., Yah, X.X., Haftoglou, S., Ribak, C.E. and Baram,
T.Z. (1998) Seizure-induced neuronal injury: vulnerability to
febrile seizures in immature rat model. J. Neurosci., 18: 4285-
4294.
Van Donselaar, C.E., Schimsheimer, R.J., Geerts, A.T. and De-
clerck, A.C. (1992) Value of the electroencephalogram in adult
patients with untreated idiopathic first seizures. Arch. Neurol.,
49: 231-237.
Van Donselaar, C.A., Brouwer, O.F., Geerts, A.T., Arts, W.F.,
Stroink, H. and Peters, A.C. (1997) Clinical course of un-
treated tonic-clonic seizures in childhood: prospective, hospi-
tal based study. Br. Med. J., 314: 401-404.
VanLandingham, K.E., Heinz, E.R., Cavazos, J.E. and Lewis,
D.V. (1998) MRI evidence of hippocampal injury after pro-
longed, focal febrile convulsions. Ann. Neurol., 43: 413-426.
Verity, C.M. and Golding, J. (1991) Risk of epilepsy after febrile
convulsions: a national cohort study. Br. Med. J., 303: 1373-
1376.
Verity, C.M., Greenwood, R. and Golding, J. (1998) Long-term
intellectual and behavioral outcomes of children with febrile
convulsions. New Engl. J. Med., 338: 1723-1728.
Vining, E.EG., Mellits, E.D., Dorsen, M.M., Cataldo, M.E,
Quaskey, S.A., Spielberg, S.E and Freeman, J.M. (1987)
235
Psychologic and behavioral effects of antiepileptic drugs in
children: A double-blind comparison between phenobarbital
and valproic acid. Pediatrics, 80: 165-174.
Wallace, S.J. (1980) They don't do very well. Pediatrics, 65:
678-679.
Wiebe, S., Blume, W.T., Girvin, J.P. and Eliasziw, M. (2001)
Effectiveness and Efficiency of Surgery for Temporal Lobe
Epilepsy Study Group. A randomized, controlled trial of
surgery for temporal-lobe epilepsy. New Engl. J. Med., 345:
311-318.
Wirrell, E.C., Camfield, C.S., Camfield, P.R., Dooley, J.M., Gor-
don, K.E. and Smith, B. (1997) Long-term psychosocial out-
come in typical absence epilepsy. Sometimes a wolf in sheeps'
clothing. Arch. Pediatr. Adolesc. Med., 151: 152-158.
Wolf, P. (1992) Juvenile myoclonic epilepsy. In: J. Roger, M.
Bureau, C. Dravet et al. (Eds.), Epileptic Syndromes in Infancy,
Childhood and Adolescence, 2nd edn. John Libbey, London,
pp. 313-328.
Wolf, S.M. and Forsythe, A. (1989) Epilepsy and mental retar-
dation following febrile seizures in childhood. Acta Paediatr.
Scand., 78: 291-295.
Wolf, S.M., Carr, A. and Davis, D.C. et al. (1977) The value of
phenobarbital in the child who has had a single febrile seizure:
a controlled prospective study. Pediatrics, 59: 378-385.
T. Sutulaand A. Pitk~inen(Eds.)
Progress in Brain Research, Vol. 135
© 2002 ElsevierScienceB.V. All rightsreserved

CHAPTER 21

Hippocampal neuron damage in human epilepsy:

Meyer's hypothesis revisited

Gary W. Mathern 1,,, p. David Adelson 2, Leslie D. Cahan 3 and Joao R Leite 4

l Division of Neurosurgery, The Mental Retardation Research Center, and The Brain Research Institute, University of California,
Los Angeles, CA 90095-1769, USA
2 Department of Neurosurgery, University of Pittsburgh, Pittsburgh, PA 15260, USA
3 Neurosurgery, Southern California Permanente Medical Group, Los Angeles, CA, USA
4 Department of Neurology, Ribeirto Preto School of Medicine, University of Sat Paulo, Ribeir~o Preto, SA, Brazil

Abstract: Whether hippocampal neuron loss and/or hippocampal sclerosis is the 'cause' or 'consequence' of seizures has
been a fundamental question in human epilepsy studies for over a century. To address this question, this study examined
hippocampal specimens from temporal lobe epilepsy patients (TLE; n = 572) and those with extra-temporal seizures
and pathologies (n : 73) for qualitative signs of hippocampal sclerosis and quantitative neuron loss using cell counting
techniques. Patients were additionally classified based on pathological substrate, and history of an initial precipitating
injury (IPI). Results showed that: (1) Hippocampal sclerosis was strongly linked with an IPI in both TLE and extra-
temporal seizure patients. (2) In TLE cases, IPIs showed an early age preference and often involved seizures, but IPIs
were not age dependent and older IPI cases showed sclerosis that was indistinguishable from younger IPI patients. (3) In
TLE patients, longer seizure durations were associated with decreased neuronal densities in all hippocampal subfields. The
decrease was independent of the neuron loss linked with IPIs, it occurred in all pathological groups, it occurred over 30
years or more, and was not a consequence of aging. (4) Intractable seizures in the young human hippocampus were not
associated with neuronal damage, but were linked with decreased postnatal granule cell development and aberrant axon
sprouting. These results support the concept that hippocampal sclerosis is likely an acquired pathology, and most of the
neuronal loss occurs with the IPI. In addition, there is progressive hippocampal damage from intractable TLE regardless of
pathology. Hence, hippocampal neuron loss can be the 'consequence' of repeated limbic seizures over 30 years or more,
but is unlikely to 'cause' hippocampal sclerosis unless there is also an IPI.

Introduction answer is important not only in understanding the

Whether hippocampal neuron loss is the 'cause' or
'effect' of seizures has been an important c l i n i c a l -
pathological question for over 100 years, especially
in the syndrome of temporal lobe epilepsy (TLE) as-
sociated with hippocampal sclerosis. Elucidating the
* Correspondence to: G.W. Mathern, Division of Neuro-
surgery, Reed Neurological Research Center, 710 West-
wood, Plaza, Room 2123, Los Angeles, CA, 90095-1769,
USA. Tel.: + 1-310-206-8777; Fax: + 1-310-206-8461 ;
E-mail: gmathern@ucla.edu
pathogenic mechanisms of epilepsy, but also in de-
termining the best therapeutic goals for patients. For
example, if hippocampal sclerosis generates TLE
and is a result of a pre-epilepsy brain injury, then
preventing or augmenting the initial pathological
process m a y avert chronic epilepsy. Alternately, if
hippocampal neuron loss is the result of repeated
seizures, then stopping all seizures at any age be-
comes an important treatment goal. Unfortunately,
the medical literature is inconclusive and rife with
controversy regarding this question since the earli-
est descriptions of hippocampal pathology and its
238
relationship with epilepsy (for review see Babb and
Brown, 1987; Gloor, 1991; Mathern et al., 1997a).
For example, early autopsy studies from epilepsy
patients established that severe hippocampal damage
in a pattern termed 'Ammon's horn' or 'hippocam-
pal' sclerosis was strongly associated with complex
partial TLE, while minor hippocampal neuronal loss
in regions such as the end folium were associated
with other seizure types (Meynert, 1867; Pfleger,
1880; Sommer, 1880; Stauder, 1936; Margerison and
Corsellis, 1966). It was unclear from these post-
mortem studies, however, whether severe damage
(i.e. hippocampal sclerosis) was the 'cause' or 'con-
sequence' of TLE.
With the advent of pre-mortem surgical resec-
tion for TLE, it became possible to carry out more
detailed pathological studies and compare the sur-
gical findings with pre-operative clinical data. M.
Falconer and colleagues in London were one of the
first groups to perform these studies, and within a
few years Meyer et al. (1954) proposed that hip-
pocampal sclerosis was the result of early childhood
brain injuries such as febrile convulsions (see Fal-
coner, 1974; Meldrum, 1997). This concept has been
challenged by epidemiological studies showing that
the risk of TLE after febrile convulsions is very
low (Nelson and Ellenberg, 1976; Annegers et al.,
1979; Verity et al., 1993; Camfield et al., 1994). In
the early 1990s, our group re-addressed Meyer's hy-
pothesis in clinical-pathological studies of surgical
TLE and non-TLE patients with and without hip-
pocampal sclerosis (Mathern et al., 1995a,b, 1996a).
By expanding Meyer's concept of brain insult to in-
clude any significant medical event prior to habitual
seizure onset we found that events (termed initial
precipitating injuries; IPI) were strongly related to
finding hippocampal sclerosis at surgery. Further-
more, IPIs did not always occur at a young age and
did not require a febrile seizure to be associated with
hippocampal sclerosis. We also found that chronic
TLE was associated with progressive hippocampal
neuronal damage, but it was limited to CA1 and
prosubiculum subfields and required more than 15-
20 years of intractable seizures in order to detect.
In other words, we found that hippocampal neuron
loss can be both 'cause' and 'consequence' of limbic
epilepsy, but that severe neuron loss in the sclerosis
pattern was more strongly linked with IPIs than with
long-term seizures. In the current study, we have
up-dated our clinical data sets to include all TLE
patients regardless of pathology (the previous studies
concentrated on sclerosis patients), and expanded the
patient number to include cases operated during the
1990s. Our purpose was to determine when during
a patient's life hippocampal neuron loss occurred,
whether hippocampal sclerosis was the likely result
of an IPI, and if repeated seizures independently
produce hippocampal injury and/or sclerosis.
Methods
Clinical material
Two patient groups, surgically treated to control
seizures, were studied. The first were patients
with intractable complex partial TLE, and the sec-
ond were patients with generalized and/or partial
seizures from extra-temporal lesions in which the
hippocampus was removed as part of the planned re-
section (extra-temporal). The patients in both groups
were evaluated and treated at four collaborating med-
ical institutions. Most of the TLE patients were from
the University of California, Los Angeles, (UCLA;
n = 524) operated between 1961 and 2000. The
UCLA TLE cohort has been previously reviewed
in several publications (Babb et al., 1984a,b, 1987).
During the 1990s additional TLE cases were ob-
tained from the Ribeirao Preto School of Medicine
(n = 38); the University of Pittsburgh (n = 15);
and Southern California Permanente Medical Cen-
ter (n = 15). Most extra-temporal cases were also
treated at UCLA as part of the pediatric epilepsy
surgery program (n = 65) beginning in 1992 and
the remainder from the Ribeirao Preto School of
Medicine (n = 4) and the University of Pittsburgh
(n = 4). The clinical evaluation and treatment pro-
tocols for both patient groups have been previ-
ously published (Engel, 1993; Mathern et al., 1996b,
1999). Informed consent was obtained for medical
treatment and the use of any clinical-pathological
data for research purposes. For comparison purposes,
autopsy hippocampal tissue was obtained in individ-
uals without neurological disease collected at UCLA
and Ribeir~o Preto School of Medicine (n = 105).

Clinical data collection and patient classification
TLE and extra-temporal surgical cases were classi-
fied into pathological sub-groups based on review
of pathology specimens and neuroimaging studies
(MRI and PET). Prior to the MRI era this classifica-
tion was based at UCLA on complete histopathologi-
cal review of the en bloc surgical specimen (Crandall
and Mathern, 2000), and more recently by compar-
ing the pathology and neuroimaging reports. The
TLE cases were sub-classified into: hippocampal
sclerosis; lesion only; dual pathology; and crypto-
genic.
Hippocampal sclerosis
Patients with damage to the hippocampus as de-
termined by MRI/PET and by pathology shows a
distinctive qualitative pattern of neuron loss known
as hippocampal sclerosis, and no other significant
substrate was noted in the temporal lobe specimen.
By definition, sclerosis consisted of severe pyramidal
neuron loss and gliosis through out the hippocampus
that was especially severe in CA1 and prosubicu-
lum (Sommer's sector) and CA4 (end folium) com-
pared with the stratum granulosum and CA2 stratum
pyramidal (Bratz, 1899; Mathern et al., 1997a). By
comparison, subicular neurons were not destroyed,
and there was a transition between the damaged
hippocampus and subiculum.
Lesion only
These patients had extra-hippocampal macroscopic
mass lesions, such as a low-grade glioma, cortical
dysplasia, hamartoma, etc. and the hippocampus did
not show significant cell loss. The hippocampus may
or may not show some minor cell loss at pathological
examination, but the amount of damage was not
severe and not in the hippocampal sclerosis pattern.
Dual pathology
Surgical cases in which a mass lesion and hippocam-
pal sclerosis were found together were classified in
this category.
239
Cryptogenic
Patients with intractable TLE but who did not have
hippocampal sclerosis or a mass lesion were grouped
into the cryptogenic category. These patients are less
likely to be seizure free after temporal lobe resec-
tion compared with the previous TLE groups with
a known pathological substrate (Babb and Brown,
1987; Mathern et al., 1995a).
The extra-temporal surgical cases (n = 73) were
sub-classified based on their pathological substrate
into those with cortical dysplasia (CD; n = 41) or
those without dysplastic pathologies (non-CD) such
as cortical atrophy from stroke, infection (n = 21),
or Rasmussen's encephalitis (n = 10) (Mathern et
ai., 1994, 1996b). For the purposes of this study, the
pathological findings in the CD and non-CD were
similar and combined into a single extra-temporal
seizure group for comparison with the TLE group.
From the medical record, clinical data were col-
lected to discern if there was an IPI, the IPI type
(seizure versus non-seizure), IPI age, the age at ha-
bitual seizure onset, and age at surgery as previously
described (Mathern et al., 1995a). An IPI was de-
fined as any medical event or incident of probable
cerebral injury that was associated with unconscious-
ness for more than 30 min or alteration in cognition
for more than 4 h, and this information was col-
lected retrospectively from the various pre-surgery
patient interviews. The age of habitual seizure onset
was defined as the age when the patient's typical
seizure for which they were referred for surgical
treatment began. From these data, the latent period
was calculated as the time, in years, from the IPI to
habitual seizure onset, and the duration of seizures
as the interval between habitual seizure onset and
age at surgery. These data were collected in a uni-
form standardized format without knowledge of the
hippocampal pathology.
Hippocampal neuron densities
In addition to qualitative histopathological review,
hippocampal sections were stained with cresylecht
violet for cell counts (10 txm sections). Counts were
performed at 400× using grid morphometric tech-
niques with the corrections of Abercrombie (1946),
and the anatomical subfields were based on the clas-
240
sification of Lorente de No (1934) as previously pub-
lished (Mathern et al., 1995a). The subfields were the
granule cells of the fascia dentate, CA4, CA3, CA2,
CA1 stratum pyramidal, prosubicular and subicular
neurons. For this study, the subfield density mea-
sures were averaged into a single variable to rep-
resent overall hippocampal neuronal density. Cell
density measurements are estimates of packing den-
sity and are not a calculation of total neurons per
hippocampus. This is because the total volume of
the hippocampus cannot be reliably determined in
surgical specimens, and our method is an accepted
quantitative technique in surgical material.
Data analysis
Data were entered into a database on a personal
computer and analyzed using a statistical program
(Statview 5, SAS Institute Inc., Cary, NC). Statistical
tests included ANOVA, ANCOVA, X 2 a n d regres-
sion analysis comparing the pathology groups with
the other clinical variables. Results were plotted us-
ing the same software, and tests were considered
statistically different at a minimum confidence level
of P < 0.01.
Results
Analysis of the TLE clinical-pathological group
show that hippocampal sclerosis was strongly associ-
ated with an IPI compared with the other pathology
categories. IPIs showed a younger age preference,
but were not age dependent. Furthermore, prolonged
TLE seizure histories correlated with decreased hip-
pocampal neuronal densities in all pathology cate-
gories, but the progressive neuronal loss from limbic
seizures probably does not generate hippocampal
sclerosis. Patients with extra-temporal partial and
generalized seizures and pathologies do not show
hippocampal sclerosis unless there was an IPI his-
tory, even with multiple seizures per day in early
human life. Furthermore, the extra-temporal cohort
supports the concept that seizures during early hu-
man life negatively impact postnatal hippocampal
granule cell neurogenesis and mossy fiber axon de-
velopment. The findings that support these conclu-
sions from the two human clinical-pathological data
sets are discussed below.
TLE dataset
Of the 572 TLE surgical cases, 54.1% were clas-
sified as hippocampal sclerosis, 21.7% as lesion
only, 16.5% as dual pathology, and 7.6% as cryp-
togenic. The mean ages at surgery (years 4- SEM)
were not statistically different between hippocampal
sclerosis (30.3 4-0.6), lesion only (28.3 ± 1.1), dual
pathology (27.5 4- 1.3), and cryptogenic pathologies
(29.2 4-1.6; P = 0.126). However, the age at habitual
seizure onset for hippocampal sclerosis (12.3 4- 0.5),
lesion only (16.04- 1.0), dual pathology (13.8 4- 1.0)
and cryptogenic cases (13.74- 1.3) were different
(P = 0.0043), with sclerosis patients less than lesion
only (P = 0.0003). Further analysis of the TLE data
set disclosed.
IPIs were associated with hippocampal sclerosis and
seizures
In all TLE patients, 59.2% had an IPI history prior to
the onset of their habitual limbic seizures. The per-
centages of patients with IPI histories were differ-
ent between the surgical pathology groups (Table 1).
Most of the hippocampal sclerosis patients (87%) had
an IPI history compared to the other pathology sub-
groups (g2; P < 0.0001). Of note, within the UCLA
TLE surgical series (excluding the non-UCLA cases)
the percentage of hippocampal sclerosis patients with
IPI histories has not significantly changed between
1960 and 2000. This supports the notion that IPIs are
important in the pathogenesis of hippocampal sclero-
sis, and this association has been stable over time.
The IPI type (seizure versus non-seizure) was also
different between TLE pathology groups (Table 2).
Most of the hippocampal sclerosis patients had IPIs
that involved seizures (70.8%) compared with the
other pathology categories (X2; P < 0.0001). Typi-
cal non-seizure IPIs included head trauma, cerebral
hypoxia, systemic infection with coma, near drown-
TABLE 1
Initial precipitating injury by pathologyin temporal lobe epilepsy
IPI Hippocampal Lesion Dual Cryptogenic
sclerosis only pathology
Yes 87.0% 13.9% 54.4% 23.3%
No 13.0% 86.1% 45.6% 76.7%
 241

TABLE 2 during early human development were harmful to

Seizure versus no-seizure IPI by temporal lobe epilepsy the hippocampus. In other words, they speculated
pathology that the immature hippocampus was vulnerable to
seizure-induced injury that produced sclerosis. Care-
IPI type Hippocampal Lesion Dual Cryptogenic
sclerosis only pathology ful inspection of our TLE data set would be consis-
tent with this notion, but an alternative hypothesis
Seizures 70.8% 17.6% 49.0% 30.0%
No-seizures 29.2% 82.4% 51.0% 70.0% is also supported when our extra-temporal group is
considered. Fig. 1 shows IPI ages in TLE surgical
patients. IPIs occurred by age 4 years in 78.7% of
ing, etc. In TLE patients, therefore, IPIs involving cases with the greatest peak (23.3%) between 6 and
seizures were strongly associated with hippocampal 12 months. Notice, however, that Fig. 1 shows a very
sclerosis. This is similar to the findings of Meyer, long 'tail' with IPIs occurring up to age 23 years.
Falconer, and others more than 40 years ago (Meyer Review of the surgical specimens from older IPI pa-
et al., 1954; Falconer, 1974). tients (i.e. over age 10 years) c o m p a r e d with those
younger than age 5 years showed no significant dif-
IPI age and seizures: a reflection of brain maturity ference in the qualitative hippocampal sclerosis pat-
tern. Put another way, older IPIs produce hippocam-
IPIs involving seizures at a young age prompted pal sclerosis at surgery that is indistinguishable from
M e y e r et al. (1954) to hypothesize that seizures younger IPIs. W h a t is different is that IPIs associated

IPI a n d t h e a g e it o c c u r s in t e m p o r a l lobe epilepsy

I I l l l l l l l l l l l l l l l l I l l
25

22.5

20

17.5

t- 15

O
,t
12.5
13_
10

7.5

2.5

0
0 5 10 15 20 25

IPI AGE
Fig. 1. Frequency histogram showing the age at initial precipitating injury (IPI) in TLE (n = 352). Bar intervals equal 6 months of age.
Note that: (1) The plot does n o t show a normal distribution; (2) the greatest frequency is between 6 and 12 months of age (23.3%); and
(3) while most of the IPI ages are less than 5 years, there are a number of cases beyond that age up to 23 years. The mean (4- SEM) IP1
age was 3.74-0.3 years and the median was 1.5 years.
242

Relationship Between Latent Period and IPI Age

In Human Temporal Lobe Epilepsy
40 ' .... ' .... , .... , . . , , , , , , , i , , , , , .... i ....

30351101
• • •

kO •
1,.,.
25"J=, •
(1)
13._
.,,._, 20
E
,,i,.,,i
t'~ 15
._1 °Oo° •
,0 . . . . .

8 loll •
o8 °
O, -~
0 5 10 15 20 25 30 35 40

IPI AGE
Fig. 2. Scattergram displaying the latent period duration in years (y-axis) and IPI age (x-axis). IPls less than 7 years show variable but
often longer latent periods compared with IPIs over age 10 years. Linearregression analysis indicates a negative correlation (r = -0.162;
P = 0.0024).

with a seizure occurred at a younger age (years 4-
SEM; 2.28-4-0.27) compared with non-seizure IPIs
(5.89 + 0.67; P < 0.0001). This raises the question
about the role of seizure-related IPIs in the patho-
genesis of hippocampal sclerosis. If sclerosis was not
restricted to younger IPI patients with seizures, but
also occurred in older non-seizure IPI patients, then
another possible interpretation is that seizure IPIs
could be a surrogate marker of cerebral injury at a
young age. Experimental studies support the concept
that seizures are easier to provoke in the develop-
ing compared with the mature animal (Holmes and
Thompson, 1988; Moshe, 1993; Leite et al., 1996;
Holmes, 1997; Lado et al., 2000). Hence, the human
TLE data could be interpreted to indicate that IPIs at
a younger age are associated with seizures because
the immature brain responds to cerebral injury with
a seizure more frequently than IPIs in mature brains.
This interpretation is supported by our findings from
young surgical patients with frequent extra-temporal
seizures that rarely show hippocampal sclerosis (see
below).
IPI age influences the latent period
In the TLE group, the mean duration of the latent
period (years -4- SEM) was 8.8 ± 0.04 with a me-
dian of 7.0 years, and 67.8% of patients had latent
periods of 10 years or less (range few months to
38 years). Furthermore, the IPI age influenced the
latent period as shown in Fig. 2. IPIs occurring at
age 10 years or less were associated with variable
but often very long latent periods while IPIs over age
10 years were usually less than 10 years in duration.
This distribution was statistically significant with a
negative linear correlation (P = 0.0024). Therefore,
 243

Decreased CA4 Neuron Densities With Longer TLE Seizure Duration

25000 . . . . ' . . . . ' . . . . ' . . . . i , , • . . . . , ,

22500

20000

• • R= -0.394
~: 17500 • •
E •
15ooo- d • • •
qPO • _

,~ 12500 -
o
10000 -

7500 -

5000 -

2500 -

0 -
0 10 20 30 40 50 60

Seizure Duration In Y e a r s
Fig. 3. Scattergram showing CA4 neuron densities (y-axis) and total seizure duration (x-axis, in years) in TLE patients regardless of
pathology. The negativelinear regression is significant (r = -0.394; P < 0.0001). Notice very long seizure durations extending for more
than 40 years were necessary to discern the negativecorrelation.

the IPI age can impact the clinical TLE history by
influencing the latent period duration with younger
IPI ages associated with the longest latent periods.
Progressive hippocampal neuronal loss with longer
TLE seizure histories
TLE patients also showed that longer seizure dura-
tions were associated with decreased neuron densi-
ties in all hippocampal subfields. Our prior studies
had disclosed progressive loss in CA1 and pro-
snbiculum subfields only. The progressive neuronal
injury with longer limbic seizure durations occurred
in all TLE pathology groups, it was independent of
the neuronal loss associated with IPI histories, and
probably does not lead to hippocampal sclerosis by
itself.
A typical example for CA4 is shown in Fig. 3 for
all TLE pathology groups, and the negative linear
regression was statistically significant (P < 0.0001).
Re-analysis using analysis of covariance (ANCOVA)
controlling for pathology groups or age at surgery
found that the negative linear regressions were
still statistically significant (P < 0.0001). This in-
dicates that decreased CA4 neuron counts with
longer seizure histories occurred in all TLE pathol-
ogy types, and was independent of the underlying
substrate generating limbic seizures and any affect
of aging. The progressive cell loss from long limbic
seizure durations was also independent of the cell
damage associated with IPI histories, as shown in
Table 3 for averaged hippocampal neuron densities
for all subfields (ANCOVA). IPIs and seizure dura-
tion were statistically significant (P < 0.002) without
an interaction (P = 0.32). Notice in Fig. 3 that the
time required to demonstrate the negative correlation
was over several decades of seizures, and with an
r 2 of 0.155 the regression was not very predictive
of cell loss in any given specimen. Hence, cell loss
from repeated limbic seizures is not likely to produce
244
TABLE 3
IPI and seizure duration both influence hippocampal cell loss in
temporal lobe epilepsy patients
Hippocampalcell density
IPI P = 0.001
Seizure duration P = 0.002
Interaction P = 0.32
ANCOVA P-values; surgical TLE cases.
the significant damage associated with hippocampal
sclerosis (i.e. greater than 50% cell loss) unless there
are more than 30 years of limbic seizures. Given that
the average (4- SD) duration of habitual seizures for
all TLE patients was 15.9 + 9 . 7 years, most of the
neuron loss associated with hippocampal sclerosis
was more likely from the IPI and not uncontrolled
limbic seizures.
Extra-temporal data set
The patients with extra-temporal substrates and
seizures were not as large as the TLE data set,
and consisted of younger patients. However, this pa-
tient group addressed if seizures during early human
life injured the postnatal developing hippocampus
and/or produced hippocampal sclerosis. The extra-
temporal group consisted of 73 surgical patients with
a mean age at surgery of 5.86 4-0.83 years (youngest
6 weeks of age), and a mean age of seizure on-
set of 19.1 4- 3.7 months (41% by age 2 months).
These patients generally had many clinical behav-
ioral seizures per day, and electrographically often
had continuous ictal-like discharges. For purposes of
this paper, the hippocampal findings in the cortical
dysplasia (CD) and non-CD patients were the same,
and the two groups combined. The relevant findings
are given below:
Hippocampal sclerosis is rare and is associated with
an IPI
Hippocampal damage in a sclerosis pattern was
noted in three (4.1%) patients with extra-temporal
substrates and early seizure histories, and all cases
had an IPI history. The age at surgery for the
three hippocampal sclerosis cases were 12 months, 8
years, and 14.75 years. The first case started seizing
shortly after birth from a large multi-lobar cortical
dysplasia, and at 28 days of age the child was placed
into a drug induced coma in an attempt to stop or
decrease prolonged status-like clinical and electro-
graphic events. During the coma the child became
hypotensive requiring emergency surgery to resect
ischemic bowel. The seizures continued despite the
treatment and hemispherectomy at age 12 months
disclosed hippocampal sclerosis (see Mathem et al.,
1997a for illustration). The second case involved a
child who had prolonged status epilepticus at age 2
years, and thereafter had severe diffuse left cerebral
brain damage by MRI with hemiparesis, hemianop-
sia, etc. (Fig. 4; left panel). Hemispheric resection at
8 years of age disclosed hippocampal sclerosis with
aberrant supragranular mossy fiber sprouting (Fig. 4;
right panels). The third case was a young adult with
a known perinatal stroke involving the middle and
posterior cerebral arteries (i.e. mesial temporal struc-
tures were involved in the initial ischemic event),
seizures began at age 1 year, and surgery at nearly
15 years showed hippocampal sclerosis. These cases
illustrate that hippocampal sclerosis was rare in the
extra-temporal seizure group unless there was an IPI,
and that IPI often involved hypoxia/ischemia.
Seizures during early life adversely affected
postnatal granule cell development
The other hippocampal specimens from the extra-
temporal cohort did not consistently show signifi-
cant pyramidal neuron loss (Mathern et al., 1996b).
However, there were decreased granule cell den-
sities and aberrant mossy fiber sprouting, and it
was more severe in the youngest patients. Further-
more, in the extra-temporal cases we have recently
studied signs of postnatal granule cell develop by
staining for highly polysialylated neural cell ad-
hesion molecule (PSA-NCAM) that marks newly
formed and migrating neurons (Fig. 5) (Mathern et
al., 1994). This shows that postnatal PSA-NCAM
expression was decreased in children with frequent
extra-temporal seizures supporting the concept that
epilepsy in the young human brain negatively im-
pacts postnatal granule cell formation and migration.
In other words, our clinical-pathological analysis of
children with extra-temporal epilepsy shows that fre-
 245

Fig. 4. Example of hippocampal sclerosis in a patient with extra-temporal lobe epilepsy. This child had a prolonged episode of status
epilepticus at age 1 year with residual hemiparesis from the resulting left hemispheric damage as shown in the MRI (left panel). Habitual
seizures began within a few months consisting of partial motor events leading to secondary generalizations and further episodes of status.
Left hemispherectomy was performed at age 8.4 years and examination of the hippocampus showed severe cell loss in the hippocampal
sclerosis pattern (CV panel) with aberrant supragranular mossy fiber sprouting (Timm's panel).

quent seizures are not associated with hippocampal Discussion

sclerosis, but are linked with signs of reduced post-
natal granule cell development. In the extra-temporal
group, linear regression analyses showed no evi-
dence that seizures produce progressive hippocampal
neuron loss or sclerosis. It is important to empha-
size, however, that the issue of progressive neuronal
loss with long seizure histories is still unclear in the
extra-temporal cohort. Most of the extra-temporal
cases were operated under age 6 years, and the data
set consisted of 73 cases. Our experience with the
TLE data set did not find statistically significant
linear correlations until we had over 150 patients
with seizure durations of 15 years or more. Hence,
it is still possible that seizures will be associated
with progressive hippocampal neuronal loss in the
extra-temporal group, but if so it will probably be
with very long seizure durations as noted in TLE
patients.
Our clinical-pathological studies of TLE and extra-
temporal epilepsy patients indicate that hippocampal
neuronal damage depends on the epilepsy syndrome,
IPI history, and duration of intractable seizures.
Specifically:
(1) Hippocampal sclerosis was strongly associ-
ated with IPIs in TLE and extra-temporal patients.
This supports the concept that hippocampal sclerosis
is most likely an acquired pathology from an IPI
involving cerebral injury (Figs. 6 and 7). The IPI
associated with sclerosis may or may not involve
a seizure. Furthermore, based on our analysis of
children with extra-temporal epilepsy, it is likely that
IPI-induced hippocampal damage involves more than
one clinical mechanism such as hypoxia/ischemia
plus seizures (Mathern et al., 1998b; Katzir et al.,
2OOO).
246

Fig. 5. PSA-NCAM immunoreactivity (IR) was decreased in postnatal human hippocampi with seizures. The left panel shows a low
power view of the fascia dentata from a 2-month-old child with severe hemispheric cortical dysplasia whose clinical seizures were
first noted shortly after birth. Notice focal IR in the infragranular zone and individual IR fibers coursing through the hilus to CA3
stratum lucidum. The amount of IR in the epilepsy case is decreased compared with a 2-month-old autopsy hippocampus from a child
without seizures. In the autopsy case, notice the diffuse IR in the infragranular region. At higher power, the IR labels cell bodies, and
this is consistent with migrating newly formed granule cells. These findings are consistent with the notion that postnatal granule cell
development is decreased as a consequence of epilepsy in young children.

(2) IPIs generally occur at a young age and
very often involve seizures, but hippocampal damage
from IPIs was not age or seizure dependent. Fur-
thermore, repeated seizures at a young age were not
associated with severe hippocampal damage in our
patients with extra-temporal substrates. These find-
ings re-enforce the concept that IPIs seem to be an
important element to finding hippocampal sclerosis
at surgery, but likewise challenge the notion that
the immature hippocampus is vulnerable to seizure-
related injury. An alternate hypothesis, and one that
the authors favor, is that seizures during younger
IPIs probably reflect the propensity of the imma-
ture brain to seize with cerebral injury. Therefore,
seizure-related IPIs may be surrogate markers of
cerebral injury, and may not directly produce hip-
pocampal damage unless accompanied by additional
pathological processes at the time of the IPI.
(3) In TLE patients, prolonged seizure dura-
tions were associated with decreased hippocam-
pal neuronal densities. This finding occurred in all
hippocampal subfields and pathological sub-groups
(Fig. 7). This was the most direct evidence that re-
peated non-status limbic seizures may damage the
hippocampus. It is important to emphasize, however,
that the time course to detect damage was very long
(i.e. more than 30 years), does not preferentially af-
fect Sommer's sector or the end-folium, and only
partly accounts for the overall neuronal loss noted
in hippocampal sclerosis. In other words, repeated
TLE seizures most likely add to the damage in hip-
pocampal sclerosis patients, and only mildly affect
other TLE patient groups with mass lesions and
tumors (Fig. 7). Likewise, our data showed linear
correlations and cannot discern if seizures or fac-
tors linked with chronic seizures such as secondary
 247

Modification of Meyer's Hypothesis: Pathogenesis

of Ammon's Horn (Hippocampal) Sclerosis

Brain Insul~ Initial

One/More Than
One?
Precipitating
Injury
A g e Preference Latent Period
Genetic Not
Factors A g e Dependent

Short-Term
Anatomic
Changes

Early Hippocampal
Long-Term Anatomic
Changes Sclerosis
Cell Loss with
Seizures Increase and Axon/Synaptic
Plateau Reorganization
Early Brief Seizures

Final
Hippocampal Sclerosis
Secondary Cell Loss and Other
A n a t o m i c Changes

Fig. 6. Graphic illustration depicting a modification of Meyer's original hypothesis concerning Ammon's horn sclerosis pathogenesis.
From our analysis, sclerosis is most likely an acquired pathology as a consequence of an IPI. The IPI is generally at a young age,
but is not age dependent. Whether the hippocampal damage is from multiple brain insults and/or genetic factors plus a brain injury
is suggested from our retrospective analysis of human data. During the latent period, there are probably additional anatomical changes
to the hippocampus including synaptic reorganization of excitatory and inhibitory axon systems that probably promote and/or generate
spontaneous limbic seizures. Once limbic seizures become established, there are long-term anatomical changes including additional
neuronal loss. However, the time course of the long-term changes is over 30 or more years.

h y p o x i a / i s c h e m i a , hormonal changes, anti-epileptic
drugs, etc. were the critical factors responsible for
the progressive neuronal injury. Therefore, while it is
likely that limbic seizures over several decades 'dam-
age' the brain, it is unlikely that repeated seizures
over many years 'cause' hippocampal sclerosis based
on our c l i n i c a l - p a t h o l o g i c a l analysis. The only pos-
sible exception to this concept might be the TLE
cases with dual pathology (lesion plus sclerosis).
In this subgroup, 49% had IPIs and many of the
macroscopic lesions were located within the lim-
bic system (amygdala, parahippocampus, etc.). In
the dual pathology group, this raises the question
whether severe hippocampal damage can be the con-
sequence of seizure-induced damage from lesions
with direct connections to the hippocampus in the
248

Time Line of Hippocampal Damage In TLE

Normal IPI TLE Sz Onset Surgery
0 ~t

© 20-
Latent Period

40- HS Threshold

k..

60-
0

80-
* Hipp. Sclerosis Seizure Duration
- v- Tumor/Cryptogenic 20 to 40 Years
100
Fig. 7. Graphic depiction of a proposed hypothesis concerning hippocampal cell loss in patients with TLE. Time is the x-axis and greater
cell loss is shown on the y-axis. It is hypothesized that patients with hippocampal sclerosis (solid line) incur most of their cell loss
with the IPI. During the latent period, there may be additional anatomical changes that may include cell death, and once TLE seizures
begin, there is additional cell loss over many years. Patients with mass lesions or with cryptogenic TLE without hippocampal sclerosis
(dashed line) also show long-term progressive hippocampal cell loss, but in general do not reach the threshold of cell loss or the pattern
of damage consistent with hippocampal sclerosis unless their seizures continue for more than 30+ years.

one-half of patients without IPIs. This might be a
similar mechanism of injury to findings from rat
studies showing that kindling might generate hip-
pocampal neuronal loss if the stimulating electrode
was in the perforant path (Cavazos and Sutula, 1990;
Cavazos et al., 1991; Sutula et al., 1992; Sutula,
2001; but see Mathern et al., 1997b). Further ex-
perimental and human studies will be necessary to
validate this concept.
(4) Analysis to date shows that repeated brief
seizures that propagate into the young developing
human hippocampus were not linked with neuronal
damage, but were associated with improper postnatal
fascia dentata development. Granule cell neuronal
densities were reduced in children with severe re-
peated extra-temporal epilepsy, aberrant supragran-
ular mossy fiber sprouting was frequently observed,
and PSA-NCAM expression was reduced for newly
born granule cells (Fig. 4). These findings support
the idea that while seizures during early postnatal
development may not 'destroy' existing cells, they
probably adversely affect postnatal fascia dentate
neurogenesis, axon formation and other processes
that may have a negative impact on brain develop-
ment and maturation.
Based on these findings, we propose that Meyer's
original concept of hippocampal sclerosis pathogen-
esis be modified and updated (Figs. 6 and 7). We
concur with Meyer's original notion that most of
the hippocampal neuron loss is likely from some
initial brain injury, but would expand the hypothe-
sis in support of the idea that the injury is not age
dependent nor does it require a prolonged febrile
seizure. Instead, IPI-induced hippocampal damage
seems to show an age preference and likely results
from more than one pathogenic mechanism at the
time of injury. The injury factors may include ge-
netic susceptibility to hippocampal injury, and/or
more than one excitotoxic event occurring during the
IPI. We would also modify Meyer's concept to in-
clude the notion of progressive pathological changes
after the IPI to explain the latent phase. Specifically,

we suggest that anatomical changes occur in the hip-
pocampus and other limbic circuits after IPI-induced
neuronal damage that produce the necessary condi-
tions to promote or generate spontaneous seizures.
These pathological changes m a y include aberrant ex-
citatory and inhibitory axon sprouting and changes
in post-synaptic receptor subunit composition (Ka-
pur and Coulter, 1995; Mathern et al., 1997c, 1998a,
1999; Brooks-Kayal et al., 1998, 1999; Babb, 1999;
Coulter, 2001). Furthermore, limbic seizures over
many years were associated with additional long-
term anatomical changes, such as cell loss. The
neuronal loss from chronic seizures is probably a
secondary injury that adds to the substrate that is
hippocampal sclerosis. Therefore, the generation of
hippocampal sclerosis and repeated seizure-induce
brain injury likely reflect acute and chronic pro-
gressive anatomical and physiological changes, and
our pathogenic concepts should be modified to con-
sider this disease as an entity that evolves with time.
This concept has recently been supported by neu-
roimaging and neurocognitive studies (Theodore et
al., 1999, 2001; see relevant chapters in this book).
Our understanding o f the mechanisms of seizure-
related hippocampal neuronal damage in humans are
far from complete, and additional studies will be
necessary to confirm many of the concepts proposed
in this paper. At present, however, we can say that
hippocampal neuron loss can be the 'consequence'
of limbic seizures in TLE patients, but that scle-
rosis is probably related to IPIs and 'causes' TLE.
Just as importantly, there is still no substitute for
studying the human surgical material using c l i n i c a l -
pathological principals in order to define and test
concepts of pathogenesis in patients with epilepsy.
Acknowledgements
This work was supported at the U C L A epilepsy
laboratory by NIH grants P01 NS02808 and RO1
NS38992. The clinical work at Ribeir~o Preto was
supported by F A P E S P (Proc. #99/11729-2) and
CNPq. Thanks to the numerous investigators and
epilepsy fellows at U C L A who have contributed to
the collection of clinical and research pathological
data for over 40 years including Thomas L. Babb,
James K. Pretorius, Jann Brown, Harry V. Vinters,
Jerome Engel Jr., and Paul H. Crandall.
249
References
Abercrombie, M. (1946) Estimation of nuclear population from
microtome sections. Anat. Rec., 94: 239-247.
Annegers, J.E, Hauser, W.A., Elveback, L.R. and Kurland, L.T.
(1979) The risk of epilepsy following febrile convulsions.
Neurology, 29: 297-303.
Babb, T.L. (t999) Synaptic reorganizations in human and rat
hippocampal epilepsy. Adv. Neurol., 79: 763-779.
Babb, T.L. and Brown, W.J. (1987) Pathological findings in
epilepsy. In: J. Engel Jr. (Ed.), Surgical Treatment of the
Epilepsies. Raven Press, New York, pp. 511-540.
Babb, T.L., Brown, W.J., Pretorius, J., Davenport, C., Lieb,
J.E and Crandall, P.H. (1984a) Temporal lobe volumetric cell
densities in temporal lobe epilepsy. Epilepsia, 25: 729-740.
Babb, T.L., Lieb, J.P., Brown, W.J., Pretorius, J. and Crandall,
EH. (1984b) Distribution of pyramidal cell density and hy-
perexcitability in the epileptic human hippocampal formation.
Epilepsia, 25: 721-728.
Bratz, E. (1899) Ammonshornbefunde bei epileptikern. Arch.
Psychiatr. Nervenkr, 32: 820-835.
Brooks-Kayal, A.R., Shumate, M.D., Jin, H., Rikhter, T.Y.
and Coulter, D.A. (1998) Selective changes in single cell
GABA(A) receptor subunit expression and function in tempo-
ral lobe epilepsy. Nat. Med., 4: 1166-1172.
Brooks-Kayal, A.R., Shumate, M.D., Jin, H., Lin, D.D., Rikhter,
T.Y., Holloway, K.L. and Coulter, D.A. (1999) Human neu-
ronal gamma-aminobutyric acid(A) receptors: coordinated
subunit mRNA expression and functional correlates in indi-
vidual dentate granule cells. J. Neurosci., 19: 8312-8318.
Camfield, E, Camfield, C., Gordon, K. and Dooley, J. (1994)
What types of epilepsy are preceded by febrile seizures? A
population-based study of children. Dev. Med. Child Neurol.,
36:887 892.
Cavazos, J.E. and Sutula, T.E (1990) Progressive neuronal loss
induced by kindling: a possible mechanism for mossy fiber
synaptic reorganization and hippocampal sclerosis. Brain Res.,
527: 1-6.
Cavazos, J.E., Golarai, G. and Sutula, T.E (1991) Mossy fiber
synaptic reorganization induced by kindling: time course of
development, progression, and permanence. J, Neurosci., 11:
2795-2803.
Coulter, D.A. (2001) Epilepsy-associated plasticity in gamma-
aminobutyric acid receptor expression, function, and inhibitory
synaptic properties. Int. Rev. Neurobiol., 45: 237-252.
Crandall, EH. and Mathern, G.W. (2000) Surgery for lesional
temporal lobe epilepsy. In: H.O. Luders and Y.G. Comair
(Eds.), Epilepsy Surgery, 2rid edn. Lippincott Williams and
Wilkins, Philadelphia, PA, pp. 653-665.
Engel Jr., J. (1993) Update on surgical treatment of the epilep-
sies. Summary of the Second International Palm Desert Con-
ference on the Surgical Treatment of the Epilepsies (1992).
Neurology, 43: 1612-1617.
Falconer, M.A. (1974) Mesial temporal (Ammon's horn) sclero-
sis as a common cause of epilepsy. Aetiology, treatment, and
prevention. Lancet, 2: 767-770.
Gloor, P. (1991) Mesial temporal sclerosis: Historical back-
250
ground and an overview from a modern perspective. In: H.O.
Ltiders (Ed.), Epilepsy Surgery. Raven Press, New York, pp.
689-703.
Holmes, G.L. (1997) Epilepsy in the developing brain: lessons
from the laboratory and clinic. Epilepsia, 38: 12-30.
Holmes, G.L. and Thompson, J.L. (1988) Effects of kainic acid
on seizure susceptibility in the developing brain. Brain Res.,
467: 51-59.
Kapur, J. and Coulter, D.A. (1995) Experimental status epilepti-
cus alters gamma-aminobutyric acid type A receptor function
in CA1 pyramidal neurons. Ann. Neurol., 38: 893-900.
Katzir, H., Mendoza, D. and Mathern, G.W. (2000) Effect
of theophylline and trimethobenzamide when given during
kainate-induced status epilepticus: an improved histopatho-
logic rat model of human hippocampal sclerosis. Epilepsia,
41: 1390-1399.
Lado, F.A., Sankar, R., Lowenstein, D. and Moshe, S.L.
(2000) Age-dependent consequences of seizures: relationship
to seizure frequency, brain damage, and circuitry reorganiza-
tion. Ment. Retard. Dev. Disabil. Res. Rev., 6: 242-252.
Leite, J.P., Babb, T.L., Pretorius, J.K., Kuhlman, P.A., Yeoman,
K.M. and Mathern, G.W. (1996) Neuron loss, mossy fiber
sprouting, and interictal spikes after intrahippocampal kainate
in developing rats. Epilepsy Res., 26: 219-231.
Lorente de No, R. (1934) Studies on the structure of the cerebral
cortex. II. Continuation of the study of the ammonic system.
J. PsychoL Neurol., 45:113-177.
Margerison, J.H. and Corsellis, J.A. (1966) Epilepsy and the
temporal lobes. A clinical, electroencephalographic and neu-
ropathological study of the brain in epilepsy, with particular
reference to the temporal lobes. Brain, 89: 499-530.
Mathern, G.W., Leite, J.P., Pretorius, J.K., Quinn, B., Peacock,
W.J. and Babb, T.L. (1994) Children with severe epilepsy:
evidence of hippocampal neuron losses and aberrant mossy
fiber sprouting during postnatal granule cell migration and
differentiation. Dev. Brain Res., 78: 70-80.
Mathern, G.W., Babb, T.L., Vickrey, B.G., Melendez, M. and
Pretorius, J.K. (1995a) The clinical-pathogenic mechanisms
of hippocampal neuron loss and surgical outcomes in temporal
lobe epilepsy. Brain, 118: 105-118.
Mathern, G.W., Pretoflus, J.K. and Babb, T.L. (1995b) Influence
of the type of initial precipitating injury and at what age it
occurs on course and outcome in patients with temporal lobe
seizures. J. Neurosurg., 82: 220-227.
Mathern, G.W., Babb, T.L., Leite, J.P., Pretorius, K., Yeoman,
K.M. and Kuhlman, P.A. (1996a) The pathogenic and progres-
sive features of chronic human hippocampal epilepsy. Epilepsy
Res., 26: 151-161.
Mathern, G.W., Babb, T.L., Mischel, P.S., Vinters, H.V., Preto-
flus, J.K., Leite, J.P. and Peacock, W.J. (1996b) Childhood
generalized and mesial temporal epilepsies demonstrate dif-
ferent amounts and patterns of hippocampal neuron loss and
mossy fibre synaptic reorganization. Brain, 119: 965-987.
Mathern, G.W., Babb, T.L. and Armstrong, D.L. (1997a) Hip-
pocampal sclerosis. In: J. Engel Jr. and T.A. Pedley (Eds.),
Epilepsy: A Comprehensive Textbook, Vol. 1. Lippincott-
Raven, Philadelphia, PA, pp. 133-155.
Mathern, G.W., Bertram III, E.H., Babb, T.L., Pretorius, J.K.,
Kuhlman, P.A., Spradlin, S. and Mendoza, D. (1997b) In
contrast to kindled seizures, the frequency of spontaneous
epilepsy in the limbic status model correlates with greater
aberrant fascia dentata excitatory and inhibitory axon sprout-
ing, and increased staining for N-methyl-D-aspartate, AMPA
and GABA(A) receptors. Neuroscience, 77: 1003-1019.
Mathern, G.W., Pretorius, J.K., Kornblum, H.I., Mendoza, D.,
Lozada, A., Leite, J.P., Chimelli, L.M., Fried, I., Sakamoto,
A.C., Assirati, J.A., Levesque, M.E, Adelson, P.D. and Pea-
cock, W.J. (1997c) Human hippocampal AMPA and NMDA
mRNA levels in temporal lobe epilepsy patients. Brain, 120:
1937-1959.
Mathern, G.W., Pretorius, J.K., Mendoza, D., Lozada, A. and
Kornblum, H.I. (1998a) Hippocampal AMPA and NMDA
mRNA levels correlate with aberrant fascia dentata mossy
fiber sprouting in the pilocarpine model of spontaneous limbic
epilepsy. J. Neurosci. Res., 54: 734-753.
Mathern, G.W., Price, G., Rosales, C., Pretoflus, J.K., Lozada,
A. and Mendoza, D. (1998b) Anoxia during kainate status
epilepficus shortens behavioral convulsions but generates hip-
pocampal neuron loss and supragranular mossy fiber sprout-
ing. Epilepsy Res., 30: 133-151.
Mathern, G.W., Pretorius, J.K., Mendoza, D., Leite, J.P.,
Chimelli, L., Born, D.E., Fried, I., Assirati, J.A., Ojemann,
G.A., Adelson, P.D., Cahan, L.D. and Kornblum, H.I. (1999)
Hippocampal N-methyl-D-aspartate receptor subunit mRNA
levels in temporal lobe epilepsy patients. Ann. Neurol., 46:
343-358.
Meldrum, B.S. (1997) First Alfred Meyer Memorial Lecture.
Epileptic brain damage: a consequence and a cause of seizures.
Neuropathol. Appl. Neurobiol., 23: 185-201; discussion 201-
202.
Meyer, A., Falconer, M.A. and Beck, E. (1954) Pathological
findings in temporal lobe epilepsy. J. Neurol. Neurosurg. Psy-
chiatry, 17: 276-285.
Meynert, T. (1867) Studien uber das pathologisch-anatomissche
material der Wiener Irren-Anstalt. Vieteljahrssch., 3: 381-402.
Moshe, S.L. (1993) Seizures in the developing brain. Neurology,
43: $3-$7.
Nelson, K.B. and Ellenberg, J.H. (1976) Predictors of epilepsy in
children who have experienced febrile seizures. New Engl. J.
Med., 295: 1029-1033.
Pfleger, L. (1880) Beobachtungen uber schrumpfung und
skierose des ammonshorns bei epilepsie. Allg. Z. Psychiatr.,
36: 359-365.
Sommer, W. (1880) Erkrankung des ammonshorns als aetiolo-
gisches moment der epilepsie. Arch. Psychiatr. Nervenkr., 10:
631-675.
Stander, K.H. (1936) Epilepsie und schlafenlappen. Arch. Psy-
chiatr. Nervenkr., 104: 181-211.
Sutula, T.P. (2001) Secondary epileptogenesis, kindling, and in-
tractable epilepsy: a reappraisal from the perspective of neural
plasticity. Int. Rev. Neurobiol., 45: 355-386.
Sutula, T., Cavazos, J. and Golarai, G. (1992) Alteration of
long-lasting structural and functional effects of kainic acid

in the hippocampus by brief treatment with phenobarbital. J.
Neurosci., 12: 4173-4187.
Theodore, W.H., Bhatia, S., Hatta, J., Fazilat, S., DeCarli, C.,
Bookheimer, S.Y. and Gaillard, W.D. (1999) Hippocampal
atrophy, epilepsy duration, and febrile seizures in patients with
partial seizures. Neurology, 52:132-136.
251
Theodore, W.H., Gaillard, W.D., De Carli, C., Bhatia, S. and
Hatta, J. (2001) Hippocampal volume and glucose metabolism
in temporal lobe epileptic foci. Epilepsia, 42: 130-132.
Verity, C.M., Ross, E.M. and Golding, J. (1993) Outcome of
childhood status epilepticus and lengthy febrile convulsions:
findings of national cohort study. Br. Med. J., 307: 225-228.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 22

MRI studies. Do seizures damage the brain?

John S. Duncan 1,2,*

1 University College London, London, UK

2 National Society for Epilepsy, Chalfont St. Peter, Buckinghamshire SL90LR, UK

Abstract: Methods to assess the development of cerebral damage need to be quantitative, reliable, reproducible and safe.
They must be acceptable to patients and to a healthy control group, for repeated use and the acquisition and analytical
methods must be stable over years. Longitudinal studies are necessary to determine whether secondary cerebral damage
occurs as a consequence to the epilepsies. The principal aim of longitudinal studies is to detect physical evidence of brain
damage when it occurs. Patient groups will be heterogeneous in this regard and analysis will need to be not only of changes
in group means, but also of the number of patients who show significant changes in imaging parameters, that exceed the
limits of test-retest reliability. MRI is attractive as a tool to evaluate the presence and development of cerebral damage
in patients with epilepsy. MRI is readily available and non-invasive, making it acceptable to patients and controls. MRI
volumetry is reliable and reproducible, but the sensitivity of the method to detect subtle abnormalities has not yet been
established. Longitudinal studies are ongoing in patients with newly diagnosed and chronic epilepsy, with an inter-scan
interval of 3.5 years, using complementary voxel-based and region-based methods that can detect changes in hippocampal
and cerebellar volumes of 3% and neocortical volume changes of 1.6%. MR spectroscopy may be more sensitive for
detecting abnormalities, but the test-retest reliability is less good. Other MRI tools, such as diffusion tensor imaging, may
be useful methods for evaluating secondary cerebral damage acutely and chronically.

Introduction damage? Furthermore, by virtue of genetic predis-

A superficially straightforward central question in
clinical epileptology is "do seizures cause brain dam-
age?" On further inspection, this leads to a range of
questions and appreciation of the complexity of the
situation. The epilepsies are a very heterogeneous
range of conditions of which overt seizures are but
one manifestation. Apparently similar seizures may
result in cerebral damage in the context of one form
of epilepsy but not in another. Subclinical seizures
and interictal epileptiform activity might also re-
sult in cerebral damage. May some medications in-
crease or decrease the risk of secondary cerebral
* Correspondence to: J.S. Duncan, National Society for
Epilepsy, Chalfont St. Peter, Buckinghamshire SL9 0LR,
UK. Tel.: -I-44-14-9460-1341; Fax: +44-14-9487-6294;
E-mail: j.duncan @ion.ucl.ac.uk
position, may some individuals be more at risk than
others?
It is necessary to be able to identify which patients
are at risk of secondary cerebral damage. If thera-
pies can be designed to prevent or ameliorate these
effects, methods to determine whether the therapies
are effective will be crucial.
The assessment of physical status and cognitive
function will measure the consequences of cerebral
damage. Serial EEG studies have not been shown to
be a sensitive indicator in this regard.
The need is for more sensitive in vivo assessment
methods. The requirements are that: The techniques
have to be quantitative, reliable, reproducible and
safe. They must be acceptable to patients and to a
healthy control group, for repeated use over a period
of years. Furthermore, the acquisition and analytical
methods must be stable over years. If large numbers
254
of patients are to be evaluated it is beneficial if the
methods can be reliably applied in multiple sites.
Study design
Longitudinal studies need to be large enough to have
adequate power to detect changes of clinical signif-
icance, and also need to be of sufficient duration
to identify differences between healthy controls and
patients and between active treatment and placebo-
treated groups of patients.
The objectives of longitudinal imaging studies
are:
First, to detect physical evidence of brain damage
when it occurs. It must be recognized that patient
groups will be heterogeneous in this regard and that
analysis will need to be not only of changes in
group means, but also of the number of patients who
show significant changes in imaging parameters, that
exceed the limits of test-retest reliability.
Second, in an interventional study, to show that
treatment is associated with absence of damage,
which occurs in the non-treated parallel group.
Study populations will need to be stratified ac-
cording to age, epilepsy and seizure types, and for
partial seizures, the localization of seizure onset.
The optimal duration of longitudinal studies needs
careful consideration. A longer study increases the
chance of cerebral changes and differences becoming
evident, but is more costly and there is likely to be
increased difficulty with subject dropout and with
variation of the imaging acquisition and analysis
equipment and protocols.
The range of potential imaging tools in evaluating
cerebral damage in epilepsy
In vivo imaging studies have the potential to iden-
tify and to quantify secondary cerebral damage as
a result of epilepsy, before there is any clinical ac-
companiment, and to act as a surrogate endpoint for
intervention and preventative strategies.
MRI has a number of advantages that make it
attractive as a tool to evaluate the presence and
development of cerebral damage in patients with
epilepsy. MRI testing is more readily available and
comparatively less expensive than either positron
emission tomography (PET) or single photon emis-
sion computed tomography (SPECT). Additionally,
its non-invasive nature, and absence of ionizing ra-
diation make it more acceptable to patients and
controls participating in long-term studies.
Single photon emission computed tomography
Single photon emission computed tomography is
widely available, with tracers that are sensitive to
cerebral blood flow, and there are specific tracers
for the central benzodiazepine receptor. When com-
bined with co-registration techniques, SPECT allows
the mapping of the area of brain involved in the
generation of seizures (O'Brien et al., 1999a). The
limitations of temporal resolution result in the pos-
sibility of imaging secondary spread rather than the
site of seizure onset. SPECT is more widely available
than PET and is relatively inexpensive. However, the
technique is only semi-quantifiable, with the use of
an internal reference region and radiation exposure
is a concern as it is with PET, and the test-retest
coefficient of reliability is 15% at best (Varrone et
al., 2000).
Positron emission tomography
There are a variety of PET ligands available. These
ligands allow the measurement of glucose metabo-
lism, central benzodiazepine receptors, various opi-
oid receptor subtypes, and dopamine receptors. PET
produces data that may be analyzed quantitatively.
Arterial cannulation is often necessary for accu-
rate quantification of cerebral PET data. 18F-Fluoro-
deoxyglucose PET may give rise to parametric im-
ages of regional cerebral glucose utilization that
is sensitive but non-specific to a range of cerebral
pathologies. Hypometabolism is a sensitive but non-
specific marker of cerebral dysfunction. Regional hy-
pometabolism occurs in about 90% of patients with
medial temporal lobe epilepsy (TLE) (Gaillard et
al., 1995). Focal or diffuse regional hypometabolism
occurs in about 70% of patients with neocortical
epilepsy (Engel et al., 1995). Hypometabolism is
not only caused by neuronal loss. There is an addi-
tional metabolic disturbance. This is in contrast to
MRI volume loss and neuronal loss that are very
well correlated. The degree of medial temporal lobe
hypometabolism correlated well with post-operative

outcome (Radtke et al., 1993). Limitations of PET
for longitudinal studies include concerns with radia-
tion exposure, lack of availability, high cost, the semi-
invasive nature of the test, and a test-retest reliability
of only 10% at best (e.g. Vilkman et al., 2000).
Magnetic resonance spectroscopy
Magnetic resonance spectroscopy (MRS) is consid-
ered in Bernasconi et al. (2002, Chapter 25, this
volume). This shares the advantages of MRI of be-
ing non-invasive and well-tolerated. The use of MRS
allows the evaluation of both the integrity and func-
tion of the neurones by measuring N-acetylaspartate
(NAA), a normal byproduct of neuronal cellular
metabolism. NAA is a marker of neuronal cell dys-
function, not just volume loss. Other metabolites that
can be measured with this technique include choline,
creatine, lactate, GABA, glutamate, and glutamine.
Abnormalities of metabolite profiles may be found
in temporal lobes with normal MR/(Knowlton et al.,
1997; Connelly et al., 1998) and bilateral abnormal-
ities have been noted in up to 50% of patients with
apparently unilateral structural abnormality (Ende et
al., 1997), indicating that MRS may be more sensi-
tive for detecting pathology.
MRS may be more helpful in lateralizing the
epileptic temporal lobe in patients with bilateral
hippocampal atrophy than volumetric studies. The
ability of MRS to detect abnormalities (83%) is
similar to the ability of structural M R / t o detect hip-
pocampal volume loss (Cendes et al., 1995). When
these two methods are combined, the ability to de-
tect abnormalities increases to 93%. (Cendes et al.,
1995). The sensitivity to abnormality may be greater
than MRI, but changes are non-specific and the test-
retest coefficient of reliability for the measurement
of NAA using MRS is approximately 15-20%, and
the reliability is less good for the other metabolites
(Woermann et al., 1999a).
Volumetric MRI
Volumetric 3D Tl-weighted MRI produces scans of
good anatomical definition, with voxels typically of
0.9 mm 3. The technique of hippocampal volumetry
has been established for a decade (Jack et al., 1990;
Cook et al., 1992), using an interactive process. This
255
has been used to demonstrate the spectrum of sever-
ity of hippocampal sclerosis. Hippocampal atrophy
is identified with hippocampal volume measures and
this correlates well with hippocampal neurone loss,
particularly in the CA1 sub-region (Van Paesschen et
al., 1997a,b).
Amygdala volumes may be similarly determined
(Cendes et al., 1993a; Van Elst et al., 2000). Grey
and white matter may be segmented, with operator
dependent (Sisodiya et al., 1995) and automated pro-
cedures (Lemieux et al., 2000) so that measures may
be derived of cerebral hemisphere grey matter and
subcortical volumes. Furthermore, the distributions
of grey and white matter may be compared between
groups of subjects, and between a single subject and
a group using regional measures (Sisodiya et al.,
1995) and voxel-based morphometry (Richardson et
al., 1997; Woermann et al., 1999b). The test-retest
reliability of MRI-measured hippocampal volumes,
cerebral volumes is 3% (Lemieux et al., 2000).
The severity of hippocampal atrophy on the side
of the language-dominant hemisphere is an impor-
tant determinant of impairment of verbal memory
following hippocampal resection. The more severe
the atrophy pre-operatively, the less likely it is that
there will be a significant decline of verbal memory
after surgery (Trenerry et al., 1993).
T2 relaxometry allows a quantitative determina-
tion of the T2-signal changes. An approximation of
the T2-relaxation time may be obtained by a variety
of methods, for example using 16-echo times (Jack-
son et al., 1993) or 2-echoes (Duncan et al., 1996).
The latter had the advantage of compete brain cover-
age in 5-mm-thick slices. Partial volume effect with
CSF is a confound that needs to be avoided with T2
relaxometry, in view of the long T2 of CSE Reliable
T2-measures may be obtained in the hippocampus
(Jackson et al., 1993; Duncan et al., 1996) and the
amygdala (Van Paesschen et al., 1996) as boundaries
with CSF may be avoided by careful region defi-
nition. Increases in hippocampal T2 relaxation time
correlate with the glial/neurone ratio, particularly in
the CA1 subregion (Van Paesschen et al., 1997a,b).
The T2-relaxation time may be measured along the
length of the hippocampus, giving a profile of abnor-
mality (Woermann et al., 1998). Abnormalities are
also seen contralaterally in about 30% of cases with
clear cut HS (Jackson et al., 1993).
256
Diffusion tensor imaging
Diffusion tensor imaging (DTI) holds promise for
detecting areas of neuronal damage. DTI is an MR
method for identifying the motion of water in the
brain, that can be quantified by both voxel-based
and region-based methods. The two main parameters
determined by DTI are diffusivity and fractional an-
isotropy (Eriksson et al., 2001). Increased diffusivity
is likely to correlate with neurone loss and glio-
sis, but formal correlative studies have not yet been
performed. Fractional anisotropy reflects the asym-
metry of the motion of the fluid. Motion of fluid
within the brain is normally restricted to movement
in the same axis as the axon or myelin sheath. When
there is damage to neurones or myelin sheaths, the
fractional anisotropy decreases because the fluid can
move freely in various axes (Eriksson et al., 2001;
Rugg-Gunn et al., 2001). The methods may identify
abnormalities in patients with epilepsy that are not
evident in vivo using conventional MRI (Rugg-Gunn
et al., 2001). It is possible that serial DTI would be a
sensitive indicator of developing cerebral damage.
Functional MRI (fMRI)
At present, fMRI may lateralize language function
(Detre et al., 1998). Attempts to reliably localize
the parts of the brain that are involved in language
and memory function are being made (Binder et
al., 2000; Dupont et al., 2000). There are important
caveats. First, the involvement of a part of brain in
a task does not mean that that area is crucial for
the task. Second, if an area is not activated with a
particular fMRI paradigm it does not mean that that
area is not involved in the task. Third, the extent and
height of the activation in a task, found using fMRI,
may bear no relation to the competence with which
that task is performed.
MR studies of disease progression in other
neurological conditions
Alzheimer's disease
The association of cerebral atrophy with Alzheimer's
disease (AD) and other dementias is well estab-
lished and there is reasonable correlation between
the severity of atrophy and cognitive impairment.
The progression of AD may also be followed in vivo
with serial quantitative MRI (Fox et al., 1996, 2000).
This particular study found that the mean (SD) rate
of brain atrophy for patients with AD was 2.37%
(1.11%) per year, while in the control group it was
0.41% (0.47%) per year. From these figures, in order
to have 90% power to detect a drug effect equiva-
lent to a 20% reduction in the rate of atrophy, 207
patients would be needed in each treatment arm in
a 1-year placebo-controlled trial with a 10% patient
dropout rate, and if 10% of scan pairs were unusable.
Methodologies need to be precise, to minimize
the noise of the measurements. In a study of hip-
pocampal volumes over 3 years in 27 patients with
AD, the range of hippocampal volume loss was - 2 . 3
to -15.6%, compared to - 2 . 2 to - 5 . 8 % in control
subjects (Laakso et al., 2000). The observed changes
in individual subjects were small, and within the
accuracy range of the measurements.
Multiple sclerosis
In multiple sclerosis, cerebral atrophy reflects
parenchymal destruction and in some studies, corre-
lates with disability (Fisher et al., 2000). A reduction
of cerebral volume in those treated with interferon-
~31b and those receiving placebo of 2.9 and 3.9%,
respectively, was noted in a recent multicentre trial
(Molyneux et al., 2000), but the finding that there
was no correlation between disability and change
in cerebral volume raises the query of the signif-
icance of atrophy. Other clinical-MRI correlations
were also not as clear as might have been imagined,
such as the absence of correlation between suppres-
sion of T2-1esion load with absence of progression
of disability (Ebers, 2000).
MRI studies in epilepsy
Most attention has focussed on the hippocampus
because:
• The techniques of hippocampal measurements
have been established for many years.
• There is a clear association between hippocampal
sclerosis with temporal lobe epilepsy.
• Temporal lobe epilepsy is associated with cogni-
tive impairment, particularly memory.

• Temporal lobe epilepsy is one of the more com-
mon homogenous forms of epilepsy, so adequate
numbers of patients are available for studies.
Cross-sectional studies of the association be-
tween the severity of hippocampal sclerosis (HS),
and seizure frequency and duration have produced
conflicting results (Cendes et al., 1993b; Van Paess-
chen et al., 1997a; K~ilvi~iinen et al., 1998; Theodore
et al., 1999; Salmenper~i et al., 2001). In a cross-
sectional analysis of a community-based cohort, the
mean hippocampal volume (HV), corrected for in-
tracranial volume (ICV), in patients with chronic
localization-related epilepsy was 6% less than in
those with newly diagnosed partial seizures and 10%
less than the control group (Everitt et al., 1998). In
a separate population, there was an 18% and 14%
reduction of the left and right HV, respectively, on
the side ipsilateral to the seizure focus in patients
with chronic drug-resistant epilepsy (K~ilvi~iinen et
al., 1998; Salmenper~i et al., 2001). In 82 patients
with refractory TLE, hippocampal volumes were in-
versely related to duration of epilepsy, ipsilateral to
the epileptic focus, but not contralaterally (Tasch et
al., 1999). Complex partial seizure frequency was not
related, but patients with frequent secondarily gener-
alize seizures had smaller ipsilateral hippocampi.
The conclusions that can be drawn on disease
progression from cross-sectional studies, however,
are very limited, because: (1) small changes in struc-
ture over time are often masked by large biological
variability across subjects; and (2) cross-sectional
studies are unable to give direct information on the
causal relationship between seizures and structural
brain damage.
The question of whether chronic epilepsy results
in smaller hippocampi, or whether a reduction in
hippocampal volume determines intractability can
only be addressed by longitudinal studies.
There have been case reports of progressive hip-
pocampal sclerosis in patients suffering from re-
current partial and secondarily generalized seizures
(O'Brien et al., 1999b), and status epilepticus (e.g.
Nohria et al., 1994; Wieshmann et al., 1997; Van
Landingham et al., 1998). Van Paesschen et al. re-
ported significant reductions of hippocampal volume
in 8% of patients with partial seizures scanned 1 year
apart (Van Paesschen et al., 1998). The changes were
considered to be either the result of frequent seizures
257
or the resolution of oedema after initial seizures.
It is likely that recurrent seizures, especially sec-
ondarily generalized seizures, can induce secondary
hippocampal changes in some patients, but this is not
universal. Only 50-75% of hippocampal resections
for intractable temporal lobe epilepsy show neuronal
loss in the dentate gyrus and hippocampus proper
(Margerison and Corsellis, 1966; Honovar and Mel-
drum, 1991). This leads to the question - - what
factors make an individual susceptible to secondary
hippocampal and extra-temporal atrophy?
In order to address these questions, in 1995, a
prospective, community-based longitudinal follow-
up study of patients with newly diagnosed seizures
and chronic active epilepsy was established at the
Chalfont Centre for Epilepsy, funded by the Well-
come Trust. Ninety patients with newly diagnosed
seizures, 154 with chronic active epilepsy (defined
as epilepsy for more than 4 years and a seizure in the
last year) and 80 control subjects had baseline MRI
scans between June 1995 and May 1997, and follow
up scans 3.5 years later.
As epilepsy might result in damage not only to the
hippocampus, but also to the cerebral neocortex and
the cerebellum, it was decided to make a quantitative
assessment of all of these structures. This investiga-
tion required the establishment and implementation
of optimal techniques for quantitative MRI and for
serial measures using region-based hippocampal vol-
umetry, hippocampal T2-relaxation times, automated
measures of cerebral hemisphere volumes, cerebral
grey matter, CSF and intracranial volumes and semi-
automated cerebellar volumes.
Prior to volumetry, a series of automatic pro-
cessing steps were carried out on the Tl-weighted
volume datasets. After an initial automatic brain seg-
mentation of the baseline and repeat scan using a
2D version of our segmentation software Exbrain
(Lemieux et al., 2000) non-uniformity correction
was performed, using the automatic method, N3
(Sled et al., 1998; http://www.bic.mni.mcgill.ca/
brainweb/). Automatic brain segmentation of the
non-uniformity corrected baseline scan was then per-
formed using the 3D version of Exbrain, resulting
in an accurate delineation of the brain (Lemieux et
al., 2000) and CSF (Lemieux, 2001). In the seg-
mented scans, all voxels outside the brain are set
to zero intensity. The repeat scan was then co-
258
registered and intensity matched to the segmented
baseline scan using our software MRreg (Lemieux et
al., 1998), (Lemieux and Barker, 1998). In MRreg,
a 9-parameter rigid body transformation (three rota-
tion, three translation and three scaling), was used
to register images with an accuracy of <0.06 mm in
each linear dimension and correct for variations in
voxel dimensions.
The matched repeat scan was then resampled us-
ing sinc-based interpolation, with a kernel radius
of 5 voxels. A final automatic segmentation of the
brain and CSF in the matched repeat scan was then
performed using Exbrain. These methods reliably
detect individual hippocampal and cerebellar vol-
ume changes greater than 3.1 and 3%, respectively
(Lemieux et al., 2000). Preliminary results from
the first 53 subjects who have been rescanned (24
with chronic active epilepsy, 9 with newly diagnosed
seizures and 20 healthy controls) has shown sig-
nificant reduction of hippocampal volume in four
individuals (three with chronic epilepsy and one con-
trol), and significant reductions of cerebellar volume,
total brain volume and grey matter volume in two
(chronic epilepsy), three and one subject, respec-
tively (Liu et al., 2001).
One patient with newly diagnosed seizures, who
ceased a previously excessive alcohol intake after
the baseline scan, showed a significant increase in
hippocampal volumes of 6.6 and 8.8%, and similar
increases in cerebellar and total brain volumes (Liu
et al., 2000). Rescanning of the whole cohort will be
complete in September 2001, and the data then ana-
lyzed and the identity of risk factors and associations
with cerebral damage will be sought.
Complementary voxel-based analysis of T1-
weighted volumetric images comprises co-registra-
tion and subtraction of the follow-up scan from the
baseline image. The difference images display those
voxels that change in signal intensity, i.e. grey matter
to CSF, white matter to CSF. The raw difference
images are then filtered to remove the noise of the
serial imaging and co-registration process by ignor-
ing those voxels which showed signal change in any
one of 40 pairs of scans obtained in a prior group of
control subjects (Lemieux et al., 1998).
In subsequent analyses, to give anatomic local-
ization to the findings, both the segmented neocor-
tical images and the voxel-based subtraction images
are divided up into a series of anatomical subre-
gions using an anatomical MRI-template that may
be co-registered to individual subjects' MRI scans
(Hammers et al., 2000).
Other possible MR tools for longitudinal studies
A potential criticism of serial volumetric studies of
cerebral structure is that although the results are reli-
able and reproducible, they may be insensitive to the
initial development of secondary cerebral damage.
It is a possibility that acute post-ictal imaging
of cerebral perfusion and diffusion may identify ab-
normalities that are associated with the development
of secondary cerebral damage. Neuronal loss results
in increased diffusivity, and ictal diffusion-weighted
imaging has shown reduced diffusivity at an epileptic
focus, most likely due to cell swelling.
The development of neuroprotective strategies to
limit neuronal damage resulting from seizures is
an important area of current interest. Non-invasive
methods to assess secondary neuronal damage and
which may be used as a measure of treatment effi-
cacy could provide a surrogate marker for the acute
evaluation of neuroprotective agents.
Conclusion
Quantitative MRI techniques have the advantage of
being flexible, reliable, reproducible and well toler-
ated by patients and controls. The need for consis-
tency and great attention to detail will limit their
application to dedicated centres.
Quantitative analysis of Tl-weighted volumetric
MRI can reliably detect changes in volume of cere-
bral structure of 3%. Ongoing longitudinal studies
will determine whether changes of this magnitude in
hippocampi, cerebral neocortex and cerebellum are
common or exceptional over a 3.5-year interval in
patients with newly diagnosed seizures and chronic
epilepsy. These measures could find application as
surrogate endpoints in the evaluation of neuropro-
tectant agents, but their sensitivity in relation to
the development of functional impairment is not yet
clear. Other quantitative MRI methods, such as the
mean diffusivity of water as assessed using DTI and
acute post-ictal imaging studies, may prove to be
useful and sensitive measures of cerebral damage.

Acknowledgements
I a m v e r y grateful to m y c o l l e a g u e s in the E p i l e p s y
I m a g i n g G r o u p and for the support o f the N a t i o n a l
S o c i e t y for Epilepsy, W e l l c o m e Trust, M e d i c a l Re-
search C o u n c i l and A c t i o n R e s e a r c h .
References
Binder, J.R., Frost, J.A., Hammeke, T.A., Bellgowan, ES.,
Springer, J.A., Kaufman, J.N. and Possing, E.T. (2000) Human
temporal lobe activation by speech and nonspeech sounds.
Cereb. Cortex, 10: 512-528.
Bernasconi, A., Tasch, E., Cendes, E, Li, L.M. and Arnold,
D.L. (2002) Proton magnetic resonance spectroscopic imaging
suggests progressive neuronal damage in human temporal lobe
epilepsy. In: T. Sutula and A. Pitk~nen (Eds.), Do Seizures
Damage the Brain. Progress in Brain Research, Vol. 135.
Elsevier, Amsterdam, pp. 297-304.
Cendes, E, Andermann, F., Gloor, P., Evans, A., Jones-Gotman,
M., Watson, C., Melanson, D., Olivier, A., Peters, T. and
Lopes-Cendes, I. et al. (1993a) MRI volumetric measurement
of amygdala and hippocampus in temporal lobe epilepsy.
Neurology, 43: 719-725.
Cendes, E, Andermann, F., Gloor, P., Lopes-Cendes, I., Ander-
mann, E., Melanson, D., Jones-Gotman, M., Robitaille, Y.,
Evans, A. and Peters, T. (1993b) Atrophy of mesial structures
in patients with temporal lobe epilepsy: cause or consequence
of repeated seizures?. Ann. NeuroL, 34: 795-801.
Cendes, F., Andermann, E, Dubeau, E and Arnold, D.L. (1995)
Proton magnetic resonance spectroscopic images and MRI
volumetric studies for lateralization of temporal lobe epilepsy.
Magn. Reson. Imaging, 13:1187-1191.
Connelly, A., Van Paesschen, W., Porter, D.A., Johnson, C.L.,
Duncan, J.S. and Gadian, D.G. (1998) Proton magnetic res-
onance spectroscopy in MRI-negative temporal lobe epilepsy.
Neurology, 51: 61-66.
Cook, M.J., Fish, D.R., Shorvon, S.D., Straughan, K, and
Stevens, J.M. (1992) Hippocampal volumetric and morpho-
metric studies in frontal and temporal lobe epilepsy. Brain,
115: 1001-1015.
Detre, J.A., Maccotta, L., King, D., Alsop, D.C., Glosser, G.,
D'Esposito, M., Zarahn, E., Aguirre, G.K. and French, J.A.
(1998) Functional MRI lateralization of memory in temporal
lobe epilepsy. Neurology, 50: 926-932.
Duncan, J.S., Bartlett, P. and Barker, G.J. (1996) Technique for
measuring hippocampal T2 relaxation time. Am. J. Neurora-
dioI., 17: 1805-1810.
Dupont, S., Van de Moortele, P.E, Samson, S., Hasboun, D.,
Poline, J.B., Adam, C., Lehericy, S., Le Bihan, D., Samson, Y.
and Baulac, M. (2000) Episodic memory in left temporal lobe
epilepsy: a functional MRI study. Brain, 123: 1722-1732.
Ebers, G. (2000) MRI: measure of efficacy. Brain, 123: 2187-
2188.
Ende, G.R., Laxer, K.D., Knowlton, R.C., Matson, G.B., Schuff,
N., Fein, G. and Weiner, M.W. (1997) Temporal lobe epilepsy:
259
bilateral hippocampal metabolite changes revealed at proton
MR spectroscopic imaging. Radiology, 202: 809-817.
Engel, J., Henry, T.R. and Swartz, B.E. (1995) Positron emission
tomography in frontal lobe epilepsy. In: H.H. Jasper, S. Riggio
and P.S. Goldman-Rakic (Eds.), Epilepsy and the Functional
Anatomy of the Frontal Lobe. Raven Press, New York, pp.
223-238.
Eriksson, S.H., Symms, M.R., Rugg-Gunn, EJ., Barker, G.J. and
Duncan, J.S. (2001) Diffusion tensor imaging in patients with
epilepsy and malformations of cortical development. Brain,
124: 617-626.
Everitt, A.D., Birnie, K.D., Stevens, J.M., Sander, J.W., Duncan,
J.S. and Shorvon, S.D. (1998) The NSE MRI study: structural
brain abnormalities in adult epilepsy patients and healthy
controls. Epilepsia, 39(Suppl. 6): 140.
Fisher, E., Rudick, R.A., Cutter, G., Baier, M., Miller, D.,
Weinstock-Guttman, B., Mass, M.K., Dougherty, D.S. and
Simonian, N.A. (2000) Relationship between brain atrophy
and disability: an 8-year follow-up study of multiple sclerosis
patients. Mult. Scler., 6: 373-377.
Fox, N.C., Freeborough, P.A. and Rossor, M.N. (1996) Visual-
isation and quantification of rates of atrophy in Alzheimer's
disease. Lancet, 348(9020): 94-97.
Fox, N.C., Cousens, S., Scahill, R., Harvey, R.J. and Rossor,
M.N. (2000) Using serial registered brain magnetic resonance
imaging to measure disease progression in Alzheimer disease:
power calculations and estimates of sample size to detect
treatment effects. Arch. Neurol., 57: 339-344.
Gaillard, W.D., Bhatia, S., Bookheimer, S.Y., Fazilat, S., Sato, S.
and Theodore, W.H. (1995) FDG-PET and volumetric MRI in
the evaluation of patients with partial epilepsy. Neurology, 45:
123-126.
Hammers, A., Koepp, M.J., Free, S.L., Labbe, C., Brooks, D.J.,
Cunningham, V.J. and Duncan, J.S. (2000) Implementation
and application of a new brain template for multiple volumes
of interest. Neurolmage, 11 : $61.
Honovar, M. and Meldrum, B.S. (1991) In: D.I. Graham and P.L.
Arnold (Eds.), Greenfield's Neuropathology. Arnold, London,
pp. 931-971.
Jack Jr., C.R., Sharbrough, F.W., Twomey, C.K., Cascino, G.D.,
Hirschorn, K.A., Marsh, W.R., Zinsmeister, A.R. and Schei-
thauer, B. (1990) Temporal lobe seizures: lateralization with
MR volume measurements of the hippocampal formation. Ra-
diology, 175: 423-429.
Jackson, G.D., Connelly, A., Duncan, J.S., Grunewald, R.A. and
Gadian, D.G. (1993) Detection of hippocampal pathology in
intractable partial epilepsy: increased sensitivity with quan-
titative magnetic resonance T2 relaxometry. Neurology, 43:
1793-1799.
K~lvi~iinen, R., Salmenper~i, T., Partanen, K., Vainio, P., Riekki-
nen, P. and Pitkanen, A. (1998) Recurrent seizures may cause
hippocampal damage in temporal lobe epilepsy. Neurology,
50: 1377-1382.
Knowlton, R.C., Laxer, K.D., Ende, G., Hawkins, R.A., Wong,
S.T., Matson, G.B., Rowley, H.A., Fein, G. and Weiner, M.W.
(1997) Presurgical multimodality neuroimaging in electroen-
260
cephalographic lateralized temporal lobe epilepsy. Ann. Neu-
roL, 42: 829-837.
Laakso, M.P., Lehtovirta, M., Partanen, K., Riekkinen, P.J. and
Soininen, H. (2000) Hippocampus in Alzheimer's disease: a
3-year follow-up MRI study. Biol. Psychiatry, 47: 557-561.
Lemieux, L. (2001) Automatic, segmentation of grey and white
matter and cerebrospinal fluid in serial Tl-weighted volume
MRI data. Proceedings of SPIE Medical Imaging Conference,
Vol. 4322, in press.
Lemieux, L. and Barker, G.J. (1998) Measurement of small inter-
scan fluctuations in voxel dimensions in magnetic resonance
images using registration. Med. Phys., 25: 1049-1054.
Lemieux, L., Wieshmann, U.C., Moran, N.E, Fish, D.R. and
Shorvon, S.D. (1998) The detection and significance of subtle
changes in mixed-signal brain lesions by serial MRI scan
matching and spatial normalization. Med. Image AnaL, 2:
227-242.
Lemieux, L., Liu, R.S.N. and Duncan, J.S. (2000) Hippocampal
and cerebellar volumetry in serially acquired MRI volume
scans. Magn. Reson. Imaging, 18: 1027-1033.
Liu, R.S.N., Lemieux, L., Shorvon, S.D., Sisodiya, S.M. and
Duncan, J.S. (2000) Association between brain size with ab-
stinence from alcohol. Lancet, 355: 1969-1970.
Liu, R.S.N., Lemieux, L., Bell, G.S., Bartlett, P.A., Sander,
J.W.A.S., Sisodiya, S.M., Shorvon, S.D. and Duncan, J.S.
(2001) A longitudinal quantitative MRI study of community-
based patients with chronic epilepsy and newly diagnosed
seizures: methodology and preliminary findings. Neurolmage,
14: 231-243.
Margerison, J.H. and Corsellis, J.A. (1966) Epilepsy and the
temporal lobes. A clinical, electroencephalographic and neu-
ropathological study of the brain in epilepsy, with particular
reference to the temporal lobes. Brain, 89: 499-530.
Molyneux, P.D., Kappos, L., Polman, C., Pozzilli, C., Barkhof,
E, Filippi, M., Yousry, T., Hahn, D., Wagner, K., Ghazi,
M., Beckmann, K., Dahlke, E, Losseff, N., Barker, G.J.,
Thompson, A.J. and Miller, D.H. (2000) The effect of inter-
feron beta-lb treatment on MRI measures of cerebral atrophy
in secondary progressive multiple sclerosis. European Study
Group on Interferon beta-lb in secondary progressive multiple
sclerosis. Brain, 123: 2256-2263.
Nohria, V., Lee, N., Tien, R.D., Heinz, E.R., Smith, J.S., De-
Long, G.R., Skeen, M.B., Resnick, T.J., Crain, B. and Lewis,
D.V. (1994) Magnetic resonance imaging evidence of hip-
pocampal sclerosis in progression: a case report. Epilepsia,
35: 1332-1336.
O'Brien, T.J., So, E.L., Mullan, B.E, Hauser, M.E, Brinkmann,
B.H., Jack Jr., C.R., Cascino, G.D., Meyer, EB. and Shar-
brough, EW. (1999a) Subtraction SPECT co-registered to
MRI improves postictal SPECT localization of seizure foci.
Neurology, 52: 137-146.
O'Brien, T.J., So, E.L., Meyer, EB., Parisi, J.E. and Jack,
C.R. (1999b) Progressive hippocampal atrophy in chronic in-
tractable temporal lobe epilepsy. Ann. Neurol., 45: 526-529.
Radtke, R.A., Hanson, M.W., Hoffman, J.M., Crain, B.J., Wal-
czak, T.S., Lewis, D.V., Beam, C., Coleman, R.E. and Fried-
man, A.H. (1993) Temporal lobe hypometaholism on PET:
predictor of seizure control after temporal lobectomy. Neurol-
ogy, 43: 1088-1092.
Richardson, M.E, Friston, K.J., Sisodiya, S.M., Koepp, M.J.,
Ashburner, J., Free, S.L., Brooks, D.J. and Duncan, J.S. (1997)
Benzodiazepine receptors in malformations of cortical devel-
opment: a voxel-based comparison of structural and functional
data: in cortical grey matter. Brain, 120: 1961-1974.
Rugg-Gunn, EJ., Eriksson, S.H., Symms, M.R., Barker, G.J. and
Duncan, J.S. (2001) Diffusion tensor imaging of cryptogenic
and acquired partial epilepsies. Brain, 124: 627-636.
SalmenperK T., K~ilvi~iinen, R., Partanen, K. and Pitk~inen,
A. (2001) Hippocampal and amygdaloid damage in partial
epilepsy: a cross-sectional MRI study of 241 patients. Epilepsy
Res., 46: 69-82.
Sisodiya, S.M., Free, S.L., Stevens, J.M., Fish, D.R. and
Shorvon, S.D. (1995) Widespread cerebral structural changes
in patients with cortical dysgenesis and epilepsy. Brain, 118:
1039-1050.
Sled, J.G., Zijdenbos, A.P. and Evans, A.C. (1998) A non para-
metric method for automatic correction of intensity non uni-
formity in MRI data. IEEE Trans. Med. Imaging, 17: 87-
97.
Tasch, E., Cendes, E, Li, L.M., Dubeau, E, Andermann, E and
Arnold, D.L. (1999) Neuroimaging evidence of progressive
neuronal loss and dysfunction in temporal lobe epilepsy. Ann.
NeuroL, 45: 568-576.
Theodore, W.H., Bhatia, S., Hatta, J., Fazilat, S., DeCarli, C.,
Bookheimer, S.Y. and Galliard, W.D. (1999) Hippocampal
atrophy, epilepsy duration, and febrile seizures in patients with
partial seizures. Neurology, 52: 132-136.
Trenerry, M.R., Jack Jr., C.R., Ivnik, R.J., Sharbrough, EW.,
Cascino, G.D., Hirschorn, K.A., Marsh, W.R., Kelly, EJ. and
Meyer, EB. (1993) MRI hippocampal volumes and memory
function before and after temporal lobectomy. Neurology, 43:
1800-1805.
Van Elst, L.T., Woermann, EG., Lemieux, L., Thompson, P.J.
and Trimble, M.R. (2000) Affective aggression in patients
with temporal lobe epilepsy: a quantitative MRI study of the
amygdala. Brain, 123: 234-243.
Van Landingham, K.E., Heinz, E.R., Cavazos, J.E. and Lewis,
D.V. (1998) Magnetic resonance imaging evidence of hip-
pocampal injury after prolonged febrile convulsions. Ann.
Neurol., 43: 413-426.
Van Paesschen, W., Connelly, A. and Duncan, J.S. (1996) The
amygdala and intractable temporal lobe epilepsy: a quantita-
tive magnetic resonance imaging study. Neurology, 47: 1021-
1031.
Van Paesschen, W., Connelly, A., Jackson, G.D., King, M. and
Duncan, J.S. (1997a) The spectrum of hippocampal sclerosis.
A quantitative MRI study. Ann. Neurol., 41 : 41-51.
Van Paesschen, W., Revesz, T., Duncan, J.S., King, M.D. and
Connelly, A. (1997b) Quantitative neuropathology and quan-
titative MRI of hippocampus in temporal lobe epilepsy. Ann.
Neurol., 42: 756-766.
Van Paesschen, W., Duncan, J.S., Stevens, J.M. and Connelly, A.
(1998) Longitudinal quantitative hippocampal magnetic reso-

nance imaging study of adults with newly diagnosed partial
seizures: one-year follow-up results. Epilepsia, 39: 633-639.
Varrone, A., Fujita, M., Verhoeff, N,P., Zoghbi, S.S., Baldwin,
R.M., Rajeevan, N., Charney, D.S., Seibyl, J.P. and Innis, R.B.
(2000) Test-retest reproducibility of extrastriatal dopamine D2
receptor imaging with [123I]epidepride SPECT in humans. J.
Nucl. Med., 41: 1343-1351.
Vilkman, H., Kajander, J., Nagren, K., Oikonen, V., Syvalahti,
E. and Hietala, J. (2000) Measurement of extrastriatal D2-1ike
receptor binding with [11C]FLB 457 - - a test-retest analysis.
Eur. J. Nucl. Med., 27: 1666-1673.
Wieshmann, U.C., Woermann, EG., Lemieux, L., Free, S.L.,
Bartlett, P.A., Smith, S.J., Duncan, J.S., Stevens, J.M. and
Shorvon, S.D. (1997) Development of hippocampal atrophy:
a serial magnetic resonance imaging study in a patient who
developed epilepsy after generalized status epilepticus. Epilep-
261
sia, 38: 1238-1241.
Woermann, EG., Barker, G.J., Birnie, K.D., Meencke, H.J. and
Duncan, J.S. (1998) Regional changes in hippocampal T2-
relaxation time - - a quantitative magnetic resonance imaging
study of hippocampal sclerosis. J. Neurol. Neurosurg. Psy-
chiat., 65: 656-664.
Woermann, F.G., Maclean, M.A., Bartlett, P.A., Parker, G.,
Barker, G.J. and Duncan, J.S. (1999a) Short echo time sin-
gle voxel MRS of hippocampal sclerosis and temporal lobe
epilepsy. Ann. Neurol., 45: 369-375.
Woermann, F.G., Free, S.L., Koepp, M.J., Ashburner, J. and
Duncan, J.S. (1999b) Voxel-by-voxel comparison of automat-
ically segmented cerebral grey matter - - a rater-independent
comparison of structural MRI in patients with epilepsy. Neu-
rolrnage, 10: 373-384.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Published by Elsevier Science B.V.

CHAPTER 23

Do prolonged febrile seizures produce medial temporal

sclerosis? Hypotheses, MRI evidence
and unanswered questions

Darrell V. Lewis 1,,, Daniel E Barboriak 2, James R. MacFall 2, James M. Provenzale 2,

Teresa V. Mitchell 2 and Kevan E. VanLandingham 3

1 Department of Pediatrics (Neurology), 2 Department of Radiology and 3 Department of Medicine (Neurology),

Duke University Medical Center, Durham, NC 27710, USA

Abstract: Whether or not severe febrile seizures in infancy cause hippocampal injury and subsequent medial temporal
sclerosis is an often debated question in epilepsy. Recent magnetic resonance imaging (MRI) of infants suffering from
febrile seizures has provided preliminary evidence that abnormally increased T2 signal intensity can be seen in the
hippocampi of infants following prolonged and focal febrile seizures. Follow-up MRIs in a few of these infants have
confirmed that medial temporal sclerosis can develop following these acute MRI signal changes. In this article, we
review the hypotheses and MRI evidence relating to hippocampal injury during prolonged febrile seizures and the later
development of medial temporal sclerosis.

Introduction This chapter will examine the evidence for the

Medial temporal sclerosis (MTS) is the most
frequent pathological substrate of temporal lobe
epilepsy (TLE) and is characterized by neuronal loss
and gliosis in the hippocampal formation. In various
series, from 30% (Cendes et al., 1993a; Mathern
et al., 1995a; Harvey et al., 1997) to as high as
70% (Davidson and Falconer, 1975; Williamson et
al., 1993) of patients with TLE due to MTS have
histories of prolonged febrile convulsions in early
childhood. Therefore, it has been hypothesized that
prolonged febrile seizures may acutely damage the
temporal lobe leading to MTS (Cavanagh and Meyer,
1956; Falconer et al., 1964; Ounsted et al., 1966).
*Correspondence to: D.V. Lewis, Department of Pe-
diatrics (Neurology), Duke University Medical Center,
Durham, NC 27710, USA. Tel.: +1-919-684-3219, ext. 2;
Fax: +1 919 681-8943; E-mail: lewis013@mc.duke.edu
hypothesis that prolonged febrile seizures produce
hippocampal injury and MTS. After first defining
febrile seizure types and describing the link between
febrile seizures and epilepsy, we will examine sev-
eral hypotheses regarding the relationship between
prolonged or focal febrile seizures, hippocampal in-
jury and later temporal lobe epilepsy and the MRI
evidence that bears on these hypotheses. Finally,
questions regarding mechanisms and consequences
of hippocampal injury will be discussed.
Febrile convulsions
Febrile convulsions are defined as seizures occurring
in childhood after age 1 month, associated with a
febrile illness in the absence of an infection of the
CNS or other acute cause and with no history of
previous afebrile seizures (Commission on Epidemi-
ology and Prognosis, International League against
264
Epilepsy, 1993). Simple febrile convulsions are less
than 15 rain in duration and non-focal and probably
do not produce any brain injury (Shinnar, 1999). It is
probable that any association of simple febrile con-
vulsions with later epilepsy is due to a genetically
determined predilection for both the febrile seizures
and epilepsy (Shinnar, 1999).
This discussion will focus on febrile seizures that
are prolonged and/or focal. Any febrile seizure that
is focal, greater than 15 min duration or occurs more
than once in 24 h is termed a complex febrile seizure.
A febrile seizure or a series of febrile seizures lasting
longer than 30 min without recovery in between
constitutes febrile status epilepticus or FSE (Maytal
and Shinnar, 1990). In this discussion all the febrile
seizures we are concerned with will be complex and
most will be in the category of FSE.
Two to 5% of children will have one or more
febrile convulsions by the time they reach 5 years,
and 30% of these will experience at least one com-
plex febrile seizure. Approximately 5% of febrile
convulsions are sufficiently prolonged to be classi-
fied as FSE (Shinnar, 1999). Given these figures and
a population at risk of approximately 19 million chil-
dren under 5 years of age, one can estimate 25,000-
60,000 children affected by complex febrile seizures
and 4,000-10,000 children affected by FSE per year
in the United States alone.
The association of prolonged and focal febrile
seizures and subsequent epilepsy
The cumulative later incidence of partial complex
seizure disorders in infants who have had complex
febrile seizures correlates with the number and sever-
ity of the complex features characterizing the febrile
seizures (i.e. focality, prolonged duration and mul-
tiple events in 24 h). Because the average latency
between febrile seizures and onset of later epilepsy
may be from 8 (French et al., 1993) to 11 (Mathern
et al., 1995b) years, long follow-up is essential to
determine cumulative risk of developing epilepsy. In
infants who have had febrile seizures with a single
complex feature, population studies have shown that
the cumulative risk of later epilepsy with 7 years
follow-up (Nelson and Ellenberg, 1976) was 4%,
whereas with 25 years follow-up (Annegers et al.,
1987) it was 8%. Annegers et al. (1987) found dura-
tion >30 min, focality and repetitive seizures within
24 h all clearly increased the risk of unprovoked
complex partial seizures (CPSs) by age 25 years.
Focal features produced the highest relative risk in
both studies (Nelson and Ellenberg, 1976; Annegers
et al., 1987). Annegers et al. (1987) found the prob-
ability of later CPSs due to each of these risk factors
to be additive and 50% of children with all three
risk factors had CPSs by age 25 years. However,
Berg and Shinnar (1996b) did not find the risks due
to each complex feature to be additive. Verity and
Golding (1991) using a 10-year follow-up, found
after focal febrile seizures, 5 of 17 (29%) infants
developed CPSs and concluded that risk of epilepsy
was highest in those with focal febrile seizures. In
the same cohort, of 19 infants with FSE, 3 (16%)
had later afebrile CPSs (Verity et al., 1993). In a
follow-up study of 48 children with complex febrile
seizures, Sapir et al. (2000) found 13 or 27% with
epilepsy (mean follow-up period 43 months), and al-
though insufficient numbers prevented determination
of the relative significance of each complex feature,
those with focal seizures showed a trend for a greater
risk of epilepsy. Sixty-one percent of the infants who
developed epilepsy had a partial seizure disorder.
In the above studies, partial seizures and complex
partial seizures were not classified as to the lobe
of origin. In a study directed specifically at TLE,
Maher and McLachlan (1995), studied families with
apparent genetic predisposition to febrile seizures
and found TLE, diagnosed by seizure history and
electroencephalography, in 8 of 59 family members
with febrile seizures and in only 1 of 213 members
without febrile seizures. Average febrile seizure du-
ration in those who developed TLE was 100 min and
in those without TLE was 9 min.
In summary, there is a high association of fo-
cal and prolonged febrile seizures and later partial
seizure disorders. It is unclear if focality and dura-
tion are independent risk factors. The strong associa-
tion of focal prolonged febrile seizures and complex
partial seizure disorders suggests that both the pro-
longed febrile seizure and the later epilepsy arise
from the same brain region, which was either abnor-
mal from the start or suffered an acute epileptogenic
insult during the febrile seizure.

Hypotheses proposed to explain the association of
prolonged febrile seizures, MTS and TLE
These data support an association between complex
febrile seizures and later CPSs, or more accurately
between FSE and CPSs given the recurring theme
of febrile seizures more than 30 min in duration.
Several hypotheses have suggested different causal
relationships. Perhaps the oldest hypothesis is that
FSE occurs in a previously normal brain producing
acute hippocampal injury sufficient to produce MTS
causing later TLE (Ounsted et al., 1966; Davidson
and Falconer, 1975). This scenario requires no pre-
existing brain abnormality and posits that the acute
injury during the FSE is sufficient to produce clas-
sical MTS causing TLE. However, Ounsted et al.
(1966) suggested also that the families of infants
with prolonged seizures have a genetic tendency
for simple febrile seizures, but for some reason the
probands with TLE had very prolonged events. How-
ever, it is not clear why a 'normal brain', or even a
brain predisposed to simple febrile seizures, would
respond to a febrile illness with focal and prolonged
seizure activity rather than with a brief generalized
febrile seizure.
Alternatively, it has been suggested that MTS pre-
dates and causes the complex febrile seizures (An-
negers et al., 1987; Cendes et al., 1993b; Davies et
al., 1996; Bower et al., 2000). In this hypothesis, the
complex febrile seizures would be the first clinical
manifestation of the MTS which at a later age would
also cause TLE. Implicit in this hypothesis would be
a prior insult producing the MTS, such as prenatal or
perinatal injury (Earle et al., 1953), meningitis, en-
cephalitis, or head trauma. Since approximately 20%
of children with FSE have pre-existing neurologi-
cal abnormalities (Shinnar et al., 2001), it is likely
that previous neurological insults have occurred in
many of these children which would be in favor of a
hypothesis positing a pre-existing lesion.
With additional clinical and basic research, it is
becoming apparent that the pathogenesis of MTS
might be a multifactorial and multistage process.
Thus, it may often require the synergistic effects of
acquired insults and genetic predisposition together
to result in MTS of sufficient epileptogenicity to
lead to the clinical expression of TLE. The sequence
and types of insults and the modulating genetic
265
traits culminating in MTS and TLE are multiple
and therefore there are probably several different
pathways to the final common pathology. It has been
well documented that many patients with TLE and
MTS have a variety of initial precipitating injuries,
whereas some have no history of precipitating events
(Mathern et al., 1995b).
We propose that prolonged febrile seizures could
initiate or augment the causal pathogenic sequence
of MTS evolution in several different ways. First,
pre-existing hippocampal or temporal lobe abnor-
malities could lower the seizure threshold of the
limbic system so that a febrile illness could trig-
ger limbic seizure activity clinically expressed as
a prolonged focal febrile seizure. The pre-existing
hippocampal abnormalities could be prenatal, such
as localized dysgenesis or acquired such as infec-
tion, hypoxic-ischemic injury or trauma. The pro-
longed febrile seizure itself then produces addi-
tional seizure-induced injury to the hippocampus.
This seizure-induced injury, if severe, could produce
acute edema with subsequent loss of volume, gliosis
and neuronal death characteristic of MTS (VanLand-
ingham et al., 1998).
Second, prolonged febrile seizures might pro-
duce more subtle hippocampal injury not detectable
by conventional imaging techniques. Animal studies
have shown that seizures induced by hyperthermia
in infant rats may produce subtle changes resulting
in hyperexcitability of hippocampal circuitry without
cell death or morphological features of MTS (Dube
et al., 2000). If this can occur in human infants as
well during febrile seizures, later evolution to MTS
could be triggered by chronic repetitive subclinical
hippocampal seizure activity or by additional insults
triggering further seizure activity, with resultant exci-
totoxic injury ultimately generating fully developed
MTS.
Finally, evidence is accumulating that common
childhood viral illnesses that can trigger febrile
seizures may also be accompanied by viral inva-
sion of the CNS. For example, human herpes virus
6, an agent that causes roseola, is commonly found
as a primary infection in infants with febrile seizures
(Hall et al., 1994) and may also be found in the cere-
brospinal fluid in that setting (Yoshikawa and Asano,
2000). More research will be needed to determine if
limited focal inflammation due to CNS viral invasion
266
has any role in hippocampal injury during febrile
seizures.
Superimposed on all of these factors are ge-
netic influences that may modulate seizure duration
(Corey et al., 1998), influence local neuronal mi-
gration (Fernandez et al., 1998) and modulate glial
and neuronal responses to excessive excitation or
inflammation (Kanemoto et al., 2000).
Experimental animal models of hyperthermia-
induced seizures have already provided examples
of some of the above mechanisms. Germano et al.
(1996) produced cortical and hippocampal dysgene-
sis in rats by exposure in utero to an alkylating agent.
The rat pups with dysgenesis were more susceptible
to hypertherrnia-induced seizures and hyperthermia-
induced neuronal dropout than the controls. In addi-
tion, the rats with dysgenesis were more susceptible
to hippocampal kindled seizures and showed evi-
dence of neuronal injury in the kindled hippocampi
that was absent from the hippocampi of control kin-
dled rats (Germano et al., 1998). Dube et al. (2000)
have shown that 20-min-long hyperthermic seizures
in infant rats can permanently lower limbic seizure
thresholds without gross morphological change or
neuronal death. However, these rats did not develop
spontaneous limbic seizures suggesting that in this
model additional limbic injury would be needed to
develop epilepsy. It seems that hyperthermia-induced
seizures in infant rats do not typically produce gross
cell death even when prolonged. Sarkisian et al.
(1999) used hyperthermia and continuous hippocam-
pal electrical stimulation for 45 min and did not
see gross cell death. These animal studies argue that
other factors in synergism with the seizure activity
may be involved in those instances where severe
febrile seizures appear to be associated with gross
hippocampal injury.
In the following discussion, we will focus on the
MRI studies of children that provide some insight
into the role of prolonged febrile seizures in the
pathogenesis of MTS. Although, there are also stud-
ies of adult TLE patients that bear on this question,
these will not be discussed in this chapter.
MRI studies of the pathogenesis of MTS
Based on MRI studies of children with TLE, com-
plex febrile seizures and afebrile status epilepticus,
some tentative statements can be made that provide
clues about the role of complex febrile seizures in
the pathogenesis of MTS.
MRI evidence of acute hippocampal injury following
complex febrile seizures correlates with duration
and focality of seizures
In agreement with long-term follow-up studies of
children with febrile seizures, the imaging data avail-
able show that the duration and focality of febrile
seizures correlate with hippocampal abnormality on
postictal imaging. Szabo et al. (1999) measured hip-
pocampal volumes in controls and in five infants
with relatively brief complex febrile seizures no
more than 20 min in duration and found no statisti-
cally significant hippocampal volume abnormalities.
Nohria et al. (1994) performed MRI scans on an
infant after one 45-50-min-long left-body seizure,
again 6 weeks later after a second identical seizure
and then 13 months later. The scans documented pro-
gressive loss of fight hippocampal volume reflected
in the ratio of fight to left hippocampal volumes of
0.94, 0.87 and 0.72 on the first, second and third
scans, respectively. Right MTS was clear by the last
scan.
VanLandingham et al. (1998) described 27 infants
between 8 and 24 months of age who were im-
aged following complex febrile seizures and found
definite MRI abnormalities in six of the 15 infants
with focal or lateralized prolonged febrile seizures,
and in none of the 12 infants with generalized pro-
longed febrile seizures. In two of the six infants with
lateralized prolonged febrile seizures and abnormal
MRIs, the MRIs showed pre-existing hippocampal
atrophy consistent with the history of perinatal in-
sults in these infants. However, the remaining four
infants had severe acute changes in the affected hip-
pocampi and these infants had suffered significantly
(P < 0.05) longer (mean 99 min) seizures than both
the remaining infants with lateralized seizures (mean
41 min) and those with generalized seizures (mean
46 min).
The cohort of infants followed for complex febrile
seizures at our institution has increased since the
original study (VanLandingham et al., 1998) was
published. We have recently re-evaluated a subgroup
of these infants limited to those subjects who were:

(1) recruited prospectively, i.e. at the time of pre-
sentation; and (2) imaged within 72 h of the initial
seizure. All imaging was performed using a 1.5-
T GE Signa unit and included conventional clin-
ical protocols plus a fast-spin echo T2-weighted
sequence (TR/TE/NEX, 4000/100/4) with contigu-
ous 3-mm-thick slices through the hippocampi with
the plane of the slices perpendicular to the long axis
of the left hippocampus. Hippocampal images were
visually reviewed by a neuroradiologist blinded to
the clinical history who graded abnormalities us-
ing the following three measures: (1) anatomical
extent of the abnormality (body, head or total ex-
tent of hippocampus); (2) intensity of T2 signal
(T2Score) on a numerical scale from 0 (normal) to
+ 4 (markedly increased); and (3) the hippocampal
volume (VolScore) from - 3 (markedly decreased)
through 0 (normal) to +3 (markedly increased). The
hippocampal abnormalities were then classified into
four categories: (1) normal = T2Score and VolScore
both are zero; (2) mildly abnormal = T2Score is zero
and VolScore not zero; (3) moderately abnormal =
T2Score is greater than zero and less than three; (4)
severely abnormal = T2Score greater than or equal
to three. Quantitative hippocampal volumes (HVs)
were also measured by a blinded observer. Control
HVs were obtained from MRIs done on children
who had no developmental delay, seizures or brain
structural abnormalities. Interobserver reliability of
measures as well as intraobserver reliablity were
verified using repeated measures in 10 subjects and
ranged from 3 to 4%.
Twenty-four of the 30 subjects presented with
FSE, 11 generalized and 13 lateralized. Six of the
30 presented with complex febrile seizures, two gen-
eralized and four lateralized. Twenty-six of 30 had
normal development by history and four were de-
layed upon presentation.
There were 18 normal scans, 4 mildly abnormal,
4 moderately abnormal and 4 severely abnormal.
Therefore, in total, 12 (40%) of the 30 subjects were
judged to have hippocampal abnormalities by visual
inspection. All abnormalities were unilateral and lo-
cated in the hemisphere of seizure origin based on
clinical localizing signs. Seizure duration in the four
subjects with severely abnormal hippocampi aver-
aged 103 min compared to 49 min for the other 26
subjects (P < 0.05). Abnormalities were more fre-
267
quent in lateralized FSE (8 of 13 subjects) than in
generalized FSE (2 of 11 subjects) (P < 0.05). Two
children had extrahippocampal abnormalities on the
initial MRIs consisting of periventricular leukoma-
lacia and these infants had histories of perinatal
insults.
Clinical parameters were correlated with the
severity scores of the initial hippocampal MRI ab-
normalities (T2Scores and VolScores). Total seizure
duration (r = 0.42, P = 0.02) and age at seizure
(r = 0.53, P = 0.002) correlated positively with
T2Scores using Spearman rank order correlation
coefficients. There was a suggestive but nonsignif-
icant inverse correlation between rectal temperature
at presentation and T2Score. There was no cor-
relation between T2Score and gender or number
of seizures. VolScores, which are more difficult to
determine visually, did not correlate as well with
clinical parameters. Only temperature correlated in-
versely (r = -0.57, P = 0.008) with VolScore. No
significant correlations between age or seizure dura-
tion and VolScore were found.
We tentatively propose, therefore, that acute hip-
pocampal injury manifest as T2 hyperintensity in
postictal scans correlates with prolonged seizures
and focal seizures. This is in agreement with ret-
rospective and prospective cohort studies suggesting
CPSs may follow febrile seizures that are prolonged
and focal. Together, these data argue that prolonged
and focal seizures can sometimes cause acute hip-
pocampal injury leading to MTS and TLE.
The definition of 'acute hippocampal injury' in
these patients is admittedly tenuous. The initial MRI
scans clearly demonstrate that hippocampal T2 sig-
nal can be increased shortly following a prolonged
febrile seizure. In addition, hippocampal volume can
be increased slightly, but this is less consistent. Sev-
eral months later, follow-up scans definitely show
the volume of an affected hippocampus may de-
crease markedly (see below) and the T2 signal may
remain abnormal. The ensuing rapid loss of vol-
ume argues that some acute injury had occurred.
However, one cannot determine whether or not hip-
pocampal volume and signal were normal prior to
the prolonged febrile seizure. It remains possible that
previously sclerotic hippocampi could briefly swell
after a seizure, masking pre-existing atrophy. Nev-
ertheless, the most parsimonious interpretation of
268
Fig. 1. Fast spin echo oblique coronal sections through the head of the hippocampi of a subject with severe initial hippocampalT2 signal
abnormality. (A) MRI done 2 days after the patient had a 72-rain-long complex febrile convulsion with focal left-sidedjerking. Note the
increased size and signal in the right hippocampal head (under arrow, on the left side of the MRI). (B) Follow-up MRI done 9 months
later showing the subsequent decrease in size of the right hippocampus (arrow) but remaining increased signal.
the MRI data is that hippocampal edema and subse-
quent volume loss can occur after a prolonged febrile
seizure suggesting an acute insult did occur, whether
or not it was superimposed on a previously normal
substrate.
Initial MRI abnormalities seen after severe febrile
seizures can be followed by rapid development of
MTS
In the last decade, there have been scattered MRI
reports of acute increases of T2 signal or volume
in hippocampus shortly following status epilepticus
(DeCarolis et al., 1991; Nohria et al., 1994; Tien
and Felsberg, 1995; Chan et al., 1996; Stafstrom et
al., 1996). However, resultant MTS was documented
in only a few cases (Nohria et al., 1994; Tien and
Felsberg, 1995; Stafstrom et al., 1996) whereas in
others the MRI changes were reversible (Lee et al.,
1992; Cox et al., 1995; Chan et al., 1996). In these
reports hippocampal volume measurements were not
uniformly done, follow-up intervals were variable,
and often pre-existing epilepsy complicated the in-
terpretation of the T2 signal changes as acute versus
chronic. Therefore, it was unclear from these reports
how often and at what rate MTS developed after
an acute insult, such as a prolonged febrile seizure.
VanLandingham et al. (1998), using hippocampal
volumetry, performed follow-up MRIs in two of the
four infants with acute hippocampal abnormalities
on their initial images and found in both that marked
hippocampal atrophy with persistent increased T2
had developed by 8-10 months after the prolonged
febrile seizures. The patient of Nohria et al. (1994)
developed MTS over 13 months and two patients of
Perez et al. (2000) developed bilateral MTS over 8
months and 4 months following afebrile and febrile
prolonged focal seizures, respectively.
Our reanalysis of 30 prospectively identified in-
fants included 8 who have had follow-up MRIs done
from 6 to 30 months after the initial scans. Four
of these subjects had normal or mildly abnormal
hippocampi in the initial MRIs and in the follow-up
scans, their hippocampi showed normal and symmet-
rical rates of growth. Four other subjects had severely
abnormal hippocampi in the initial MRIs, and in the
follow-up scans 3 of these 4 showed asymmetric and
abnormal growth rates with atrophy of the severely
injured hippocampi and persistent increased signal
compatible with MTS. Fig. 1 illustrates the MRI
slices from the anterior hippocampi of one of the
infants with severe initial hippocampal abnormality.
The initial study was performed at 48 h (Fig. 1A) and
the follow-up at 9 months (Fig. 1B) after the initial
prolonged seizure. In Fig. IA, increased T2 intensity
and swelling of the head of the fight hippocampus
can be seen (on the left in the MRI section). In
Fig. 1B, at 9 months after presentation, the T2 hy-
perintensity persists, but the size is now clearly less
than the contralateral side. Fig. 2 illustrates serial
hippocampal volume measurements on this infant.
The solid center line is a best fit to a growth curve
for 32 normal control fight hippocampal volumes
and the dashed lines represent calculated 95% con-
fidence limits for the normal control volumes. On
the initial scan, the volume of the fight hippocampus
was greater than that of the left hippocampus. By
the time of the first follow-up, the fight hippocam-
pus had lost volume and was now much smaller
than the left. On subsequent follow-ups, both hip-
 269

5500
5000

¢~11= 4500
E 4000

3000

:F 250o f ................
2000
15001_.,'1,",," - - - Right Hippocampus
1000 - o - Left Hippocampus
500 , n

0 1
I I I I I I I I I

2 3 4 5 6 7 8 9 10
Age Years
Fig. 2. Sequential total hippocampal volumes of Subject 8 from 32 months, the time of the complex febrile convulsion, to 79 months
taken from four sequential MRIs. Although the right hippocampus (RH) was initially larger than the left (LH), the relative volumes are
reversed by the time of the first follow-up MRI. Note that there was subsequent growth of both hippocampi on follow-up. There was also
a slight initial decline in the volume of the left hippocampus suggesting that although the predominant insult was on the right, there may
have been some injury to the left as well. The solid line is a growth curve regression equation fitted to the hippocampi of 31 control
infants with the dotted lines giving the 95% confidence intervals for the normal volumes.

pocampi showed growth at slightly higher rates than
controls, but compared to the left hippocampus, the
right remained clearly smaller and continued to have
increased T2 signal compatible with MTS. Simi-
lar growth curve deviations have been seen in the
follow-up scans of two of the other three infants with
severe initial hippocampal abnormality, whereas the
fourth infant showed normal symmetrical hippocam-
pal growth on follow-up.
These cases suggested that the severity of the ini-
tial hippocampal T2 signal abnormality in the MRI
scans of infants with severe febrile seizures can pre-
dict the development of MTS on follow-up scans. To
examine this relationship, we compared the magni-
tude of initial T2Scores with changes in hippocampal
size on follow-up. The change in HVR (hippocampal
volume ratio = right HV/left HV) between the initial
scan and the first follow-up was calculated as: (Initial
HVR) - (Follow-up HVR) and serves as a measure
of the asymmetry in growth of the hippocampi after
the FSE. The severity and lateralization of the initial
T2 abnormality was expressed as the T2 asymmetry
= (Right T2Score) - (Left T2Score). Even with our
small sample (n = 8), the correlation between the T2
asymmetry and the change in HVR was significant
(r ----0.798, P = 0.017), indicating that hippocampi
with high T2Scores were likely to become atrophic.
Thus, marked and diffuse changes in hippocampal
T2 signal following severe febrile seizures or FSE
may be reliable predictor of subsequent evolution to
MTS and the typical MRI appearance of MTS in
these infants can develop within several months to a
year following the insult. These examples probably
give a lower limit to the time interval required and
represent unusually severe insults.
Apparently unilateral initial injury can lead to
bilateral volume loss
Close inspection of Fig. 2 shows that both hip-
pocampi showed a decrease in volume on the first
follow-up MRI in this infant. This pattern has been
seen in other patients in our series who have de-
veloped MTS (unpublished data) and is consistent
270
with the observations that TLE patients frequently
have bilateral hippocampal abnormalities (Margeri-
son and Corsellis, 1966; Tasch et al., 1999) and this
may be particularly true in patients with histories of
complex febrile seizures (Barr et al., 1997). Thus
even though the MRI abnormalities were initially
thought to be unilateral in the patients reported by
VanLandingham et al. (1998), the occurrence of bi-
lateral asymmetric volume loss on follow-up studies
in several of these infants suggests that the initial
injury may have actually involved both hippocampi.
Alternative mechanisms for the contralateral volume
loss could be the resolution of transient reversible
edema without obvious T2 changes or transneuronal
or transsynaptic degeneration due to loss of afferent
input from the severely injured hippocampus. Chil-
dren with TLE have been found to have progressive
alterations in N-acetylaspartate in both hippocampi
(Tasch et al., 1999). This observation has raised the
question of whether bilateral hippocampal abnormal-
ity in TLE is present before or after the TLE begins
(Sutula and Hermann, 1999). The MRI data on our
patients suggest that the bilateral abnormality can be
present before the TLE appears.
Evidence of pre-existing chronic abnormality often
accompanies acute MRI abnormalities
The patient reported by Nohria et al. (1994) with ac-
quired right MTS underwent a right temporal lobec-
tomy for intractable complex partial seizures at 51
months of age and surgical specimens of tempo-
ral lobe neocortex showed microdysgenesis with in-
creased numbers of neurons in the white matter and
occasional clustering of large neurons in the deep
cortical layers. Hippocampal tissue was not available
for examination. Perhaps the dysgenesis rendered the
hippocampus more susceptible to injury during the
prolonged seizures, as suggested by animal models
(Germano et al., 1996). Of the four patients reported
by VanLandingham et al. (1998) with acute hip-
pocampal injury, Patient 8 had a choroid fissure cyst
with definite mass effect displacing and distorting
the body of the hippocampus. Patient 10 had under-
gone open heart surgery 6 months prior to the febrile
convulsion and during our recent recalculation of
hippocampal volumes using more sophisticated mea-
surements, her most severely affected hippocampus
appears to have had smaller total volume initially
suggesting that there may have been preceding in-
jury. One of the two patients with MRI documented
acquired MTS reported by Perez et al. (2000) had
microcephaly and developmental delay raising the
possibility of subtle cerebral dysgenesis.
These clinical and MRI observations are com-
patible with hypothesis that pre-existing pathology,
e.g. dysgenesis or acquired injury sets the stage for
hippocampal onset complex febrile seizures and sub-
sequent MTS.
Significant recovery of hippocampal volume can
occur following severe subacute atrophy in children
Fig. 2 shows that although both hippocampi lost
volume after the acute event, both also showed a
recovery phase in which they grew at a normal or
accelerated rate and recovered some lost volume.
The most severely affected right hippocampus grew
although it also remained clearly smaller than the
left with abnormal signal characteristic of MTS. It
is interesting that this patient also developed what
appeared on video EEG monitoring to be right tem-
poral lobe seizures at age 4 years and 3 months,
about 6 months after the first follow-up MRI was
done and 20 months after the initial prolonged febrile
seizure and right hippocampal insult. Thus much of
the recovery growth in this patient occurred during a
period when she was having complex partial seizures
several times a month.
These observations will need to be replicated in
more infants and our study is ongoing. However, if
this is a consistent pattern, it suggests that during
infancy, MTS can not only develop rapidly, but that
some recovery of hippocampal volume can occur,
even if TLE is clinically manifest. On the other
hand, in adults one can see evidence of progressive
volume loss during chronic TLE (K~ilvi~iinen et al.,
1998; Tasch et al., 1999). Perhaps the hippocampus
in children has the ability to increase its volume in
spite of ongoing seizure activity. It is possible that
the increased hippocampal growth could actually be
stimulated by prolonged seizures given the evidence
that limbic seizures in rodents stimulate granule cell
proliferation (Parent et al., 1997). In humans, there
is evidence that many dentate gyrus granule cells
are generated (Seress, 1992; Mathern et al., 1996)

in the first year of life and newborn granule cells
may continue to be generated through old age in
humans and non-human primates as well (Eriksson
et al., 1998; Kornack and Rakic, 1999). The pe-
riod of most rapid postnatal hippocampal growth is
between birth and 24-36 months of age (Lange et
al., 1997; Utsunomiya et al., 1999) and some neu-
rons, e.g. the mossy cells of the dentate hilus may
not mature until 4-5 years (Seress, 1992). However,
while this growth and synaptogenesis is ongoing,
the new circuitry developing after an injury could
presumably develop either pro- or anti-epileptogenic
properties. In any event, the continuing growth sug-
gests an underlying potential for plasticity. Perhaps
this plasticity could be an opportunity for induction
of anti-epileptogenic neuronal properties in these
young children if a means can be developed to influ-
ence the growth potential in that direction.
Unanswered questions
How frequently are complex febrile seizures
accompanied by hippocampal injury ?
The occurrence of hippocampal edema with sub-
sequent atrophy and signal abnormality following
complex febrile seizures at present seems to occur
only during focal and prolonged seizures. If this
initial impression is accurate then the population at
risk is clearly limited. Of the 19 million children in
the United States under 5 years of age, only 2,000
per year will have prolonged febrile seizures of 1-
2 h duration and half will be focal. Nevertheless,
if in this severely affected category, hippocampal
injury were frequent, it could account for a substan-
tial fraction of intractable TLE as is suggested by
retrospective studies from epilepsy surgery centers.
At this point, only a small fraction of the infants
in our cohort have had follow-up MRIs and there
may be more who will have abnormal hippocampal
growth than is now apparent. We cannot rule out at
this stage the possibility that MTS might develop
in a number of children with less severe seizures.
For example, perhaps many brief febrile seizures, if
they arise in the hippocampus, or particularly in a
malformed hippocampus, can also cause MTS (Fer-
nandez et al., 1998). In addition, there may be subtle
hippocampal injury that is not detectable as abnor-
271
mal growth or signal, but which could predispose
these infants to later limbic seizures (Dube et al.,
2000). Only lengthy follow-up of these children will
determine who develops MTS and TLE versus other
forms of epilepsy, enabling us to make a final as-
sessment of the correlation between MRI findings,
hippocampal injury and subsequent epilepsy clas-
sification. Determination of risk factors, incidence
and outcome of hippocampal injury in severe febrile
seizures will require a multicenter prospective study
using acute and follow-up imaging and long-term
clinical follow-up.
What is the mechanism of acute hippocampal injury?
Although the MRI data suggest that acute injury can
occur and evolve into MTS, they do not reveal the
mechanism of the acute injury. The correlation of
injury and duration suggest that excitotoxic mech-
anisms might play a role, such as are postulated
to cause cell death in animal models of limbic sta-
tus epilepticus where degree of hippocampal injury
correlates with seizure duration (Vicedomini and
Nadler, 1987; Williamson et al., 1992; Meldrum,
1997; Gruenthal, 1998). In our current cohort, we
have preliminary evidence of an inverse correlation
between rectal temperature on presentation and hip-
pocampal injury, arguing that hyperthermia is not a
critical factor in the hippocampal injury, even though
it has been shown to exacerbate seizure-induced neu-
ronal injury (Liu et al., 1993; Lundgren et al., 1994).
Also, in the preliminary analysis of our data there is a
correlation between hippocampal T2 hyperintensity
and age, i.e. older children may be more suscepti-
ble to injury. This finding is interesting in view of
the animal data that suggests younger animals may
be relatively resistant to hippocampal injury during
status epilepticus (Sperber et al., 1991; Sarkisian
et al., 1999). Hypoxia has been shown to increase
hippocampal cell loss and mossy fiber sprouting in
a kainic acid model of limbic status (Mathern et
al., 1998) and in the typical emergent and often
poorly documented settings that these children expe-
rience their seizures in, transient hypoxia cannot be
excluded as a contributing factor.
272
What is the role of the infectious process and
immunological response in hippocampal injury
during prolonged febrile seizures ?
Recent studies of human herpes virus (HHV) infec-
tions in infants have found that HHV6, which causes
roseola, is frequently associated with febrile seizures
(Hall et al., 1994) and some of these children have
detectable HHV6 DNA in their cerebrospinal fluid
(Caserta et al., 1994). HHV7 has also been associ-
ated with febrile convulsions, roseola, and neurolog-
ical dysfunction (van den Berg et al., 1999). One
report even suggests that febrile convulsions during
HHV6 primary infections may be more likely to
be complex than with other etiologies (Suga et al.,
2000). Perez et al. (2000) reported a case of severe
febrile seizures with acquired MTS that might have
been due to HHV6. Patient 7 of VanLandingham et
al. (1998) had elevated cerebrospinal fluid protein
with no inflammatory cells and normal glucose on
day 1 that normalized by day 3 and an EEG on day 1
showing right temporal electrographic seizures and a
repeat on day 2 showing right temporal slowing and
sharp waves, all suggestive of a possible encephali-
tis which by MRI appearance was localized to the
hippocampus. We have observed a syndrome in bone
marrow transplant patients that suggests HHV6 re-
activation may produce an encephalitis limited to
the hippocampus with hippocampal seizures, acute
hippocampal edema and resultant MTS (Wainwright
et al., 2001). These related but limited observations
raise the possibility that in some cases of severe
febrile seizures and resultant MTS, a very localized
viral encephalitis might be the mechanism.
Children experience febrile seizures during in-
fectious illnesses and therefore one must ask if the
concurrent activation of the immune system might
modulate brain injury during the seizures. Although
kainic acid-induced limbic seizures in infant rats
normally do not produce hippocampal cell death,
a recent report using 17-day-old rat pups demon-
strated that administration of lipopolysaccharide 3 h
prior to kainic acid-induced seizures does result in
hippocampal neuronal death and mossy fiber sprout-
ing (Lee et al., 2000). The lipopolysaccharide alone
and kainic acid alone did not produce neuronal loss,
although the lipopolysaccharide did produce an el-
evation of body temperature and presumably acted
as an immune stimulus. Although lipopolysaccha-
ride alone did not produce seizures, rats receiving
both lipopolysaccharide and kainic acid had more
severe seizures than those receiving only kainic
acid. The authors hypothesize that inflammatory
cytokines produced in response to lipopolysaccha-
ride administration might have played a role in
the seizure-induced damage. There have been sev-
eral studies of cytokine production in children who
have had febrile seizures to investigate the hypoth-
esis that these cytokines might play some role in
the seizures themselves. Transient enhanced produc-
tion of interleukin- 1 by peripheral mononuclear cells
following febrile illnesses with febrile seizures vs.
febrile illnesses without febrile seizures has been
described (Helminen and Vesikari, 1990). Another
group reported enhanced production of interleukin-6
and tumor necrosis factor-c~ as well as elevated levels
of interleukin-10 in children with recurrent febrile
seizures in assays done 2 weeks following the most
recent febrile seizure (Straussberg et al., 2001). It
will be important to follow up on these leads that
immune system responses might different in chil-
dren with febrile seizures and that altered immune
responses could play a role in altering seizure thresh-
old and in modulating seizure-induced neuronal in-
jury. In this regard, it was recently demonstrated that
patients with TLE and MTS have an increased oc-
currence of homozygosity for a polymorphism of the
intedeukin-l~ gene that is associated with elevated
production of interleukin- 1[~ (Kanemoto et al., 2000).
This polymorphism was significantly more frequent
in TLE patients with MTS compared to non-disease
controls and to TLE patients without MTS. The au-
thors suggested that given this genetic predilection
to be high producers of interleukin-11~, these individ-
uals may have been more prone to seizure-induced
damage, such as MTS than others.
Where do complex febrile seizures originate ?
If the febrile seizures associated with hippocampal
injury originated in the hippocampi, the presence of
hippocampal injury would be easier to understand.
Many repeated neocortical seizures can over time
in children produce moderate hippocampal cell loss
and mossy fiber sprouting although these patholog-
ical changes are not nearly as severe as those seen

in childhood MTS associated with TLE (Mathern et
al., 1996). Therefore, it seems unlikely that a single
prolonged febrile seizure originating in the neocor-
tex could produce full-blown MTS. Febrile seizures
evoked in infant rats by induced hyperthermia may
actually originate in the amygdala or hippocampus
(Baram et al., 1997). Familial isolated unilateral hip-
pocampal dysgenesis may cause febrile convulsions
suggesting that the hippocampi may be the trigger
zones for the febrile convulsions in these individuals
(Fernandez et al., 1998). One infant who developed
hippocampal edema and MTS after prolonged febrile
seizures (VanLandingham et al., 1998) had electro-
graphic seizures recorded from the affected temporal
lobe during her episode of FSE. We suggest that in
many cases of focal prolonged febrile seizures the
hippocampus may be the primary epileptogenic zone
thus helping to explain the hippocampal edema and
lateralized nature of the seizure manifestations.
What roles do genetic influences play in the genesis
of mTS ?
The recent description of familial unilateral hip-
pocampal dysgenesis in families with febrile seizures
and TLE suggests that genetically programmed hip-
pocampal structural abnormalities may cause repet-
itive febrile seizures that in occasional cases can
lead to MTS and TLE (Fernandez et al., 1998). It
has been clear that many patients with TLE may
have dual pathology of temporal lobe dysgenesis and
MTS. Raymond et al. (1994) reported focal corti-
cal dysgenesis in 15 of 100 patients with CPSs and
MTS. Ten of the 15 had TLE, and two of these
had a history of childhood febrile seizures. Ho et al.
(1998) investigated 30 patients with dual pathology
of unilateral temporal lobe focal cortical dysgenesis
and MTS diagnosed by MRI. Nine had a history of
febrile seizures, and two of these had status. Perhaps
the febrile seizures in these patients are early mani-
festations of the epileptogenicity of the focal cortical
dysgenesis (Gtinay and Aysun, 1996).
Heredity may also influence the length of pro-
longed febrile seizures. Children who have had FSE
have the same seizure recurrence risk as those with
short febrile seizures, but when they have a recur-
rent seizure it is more likely to be prolonged (Berg
and Shinnar, 1996a). A genetically determined pre-
273
disposition for status epilepticus has also been sug-
gested by Corey et al. (1998). Additionally, genetic
polymorphisms that might increase susceptibility to
seizure-induced injury (Kanemoto et al., 2000) have
been described. This suggests that those children
who do suffer prolonged febrile seizures and develop
later epilepsy could possess various combinations
of susceptibility genes determining both the dura-
tion of the febrile seizure and the response to the
seizure-induced injury.
There is also evidence that MTS expression may
be discordant in identical twin pairs indicating that
environmental or acquired insults can operate inde-
pendently from hereditary influences. Jackson et al.
(1998) described three pairs of adult monozygotic
twins in which only one twin of each pair had TLE
and MRI-diagnosed MTS. In two of the twin pairs,
although both sibs had had febrile seizures as infants,
only the sib with MTS and TLE had documented
prolonged (45-60 min) febrile convulsions. In the
third pair, the affected sib had had febrile seizures
but the unaffected sib had no history of febrile
convulsions. None of the twins had MRI evidence
of cortical or hippocampal dysgenesis. Histories of
perinatal difficulties were actually more common in
the unaffected sibs and no other insults were known.
The evidence clearly favored an acquired injury from
prolonged febrile seizures rather than a genetic basis
for MTS in these identical twins.
What is the time course of development of MTS?
The evidence that severe febrile seizures can pro-
duce subacute development of MTS defined by MRI
(VanLandingham et al., 1998) combined with the
notion that MTS may progress during the course
of TLE (Mathern et al., 1995a; Salmenper~i et al.,
1998; Tasch et al., 1999) suggests that MTS may be
a multistage and progressive condition. One could
hypothesize that there are several stages in the de-
velopment of MTS and resultant TLE, and by using
longitudinal MRI studies these hypotheses might be
tested.
The first stage might be a subtle lesion or dys-
genesis of the hippocampal formation or an inter-
connected limbic structure thus lowering the local
seizure threshold. The second stage could be trig-
gered by a febrile illness or other stress causing a
274
seizure to arise in the compromised limbic circuitry.
If the seizure were prolonged, it could cause sig-
nificant excitotoxic injury, possibly accompanied by
hypoxic injury as well, and produce atrophy with
persistent increased T2 signal characteristic of MTS
(VanLandingham et al., 1998). If the seizure were
less severe, it could result in changes in the lim-
bic circuitry that enhance epileptogenicity without
producing gross morphological change (Dube et al.,
2OOO).
A third stage could be imagined during which
localized subclinical seizures occur and act as kin-
dling stimuli to gradually enhance the duration and
propagation of hippocampal seizure activity. If gross
morphologically detectable MTS had not developed
in the second stage, it might become evident during
this phase of subclinical seizures.
In the fourth stage, the seizures would become
sufficiently long and widely propagated to become
manifest clinically as TLE. If the TLE was in-
tractable and of sufficient duration, the fifth stage of
MTS would be entered of slow cumulative damage
manifest as additional neuronal death in the limbic
system and its projections (Mathern et al., 1995a;
Salmenper~i et al., 1998; Sutula and Hermann, 1999;
Tasch et al., 1999).
These hypotheses suggest several investigational
approaches. First, it will be necessary to study,
prospectively and longitudinally, infants having com-
plex febrile seizures using state of the art imaging
techniques. Evidence of pre-existing abnormalities,
acute injury and subsequent abnormalities in brain
and hippocampal growth must be assessed and mea-
sured. Risk factors for pre-existing as well as for
acute hippocampal abnormalities could be deter-
mined. Long-term clinical and MRI follow-up would
be essential to determine what types of epilepsy de-
veloped in these children and how it correlated with
the initial and follow-up MRI findings. Whether or
not TLE could be predicted based on the MRI data
would be a key question to be answered. In addition,
such a study could determine whether or not the
morphological parameters of MTS could progress in
severity in the absence of clinically evident seizures,
prior to the onset of TLE. These insights might pro-
vide a rationale for a preventive approach to TLE
using drugs that could inhibit epileptogenesis.
Longitudinal MRI studies of children with TLE
also need to be done to determine whether or not
MTS can develop de novo during childhood TLE.
Some investigators have reported that MTS is much
less common in childhood TLE than in adults with
long-standing TLE. Surgical series of childhood TLE
have reported incidence figures for MTS varying
from 25% or less (Duchowny et al., 1992; Wyllie et
al., 1998) to 60% or more (Davidson and Falconer,
1975; Gratten-Smith et al., 1993; Cross et al., 1996)
with the latter figures approximately the same as in
adult series (Babb and Brown, 1987). The studies
finding a low incidence of MTS generally had higher
incidences of tumor and dysgenesis. The explanation
for these differences in etiology of childhood TLE
in different studies is unknown, but it is likely that
referral bias differs considerably at different cen-
ters and at different times. Nevertheless, the studies
showing a low incidence of MTS have raised the
question whether or not MTS can develop during
the course of TLE in children even though it was
not present by MRI criteria at onset. In this regard,
perhaps studies of new onset TLE in children would
be more informative than surgical series. Harvey et
al. (1997) studied 63 children aged 3 months to 15
years (mean age 7.5 years) with onset of temporal
lobe seizures whose mean duration of TLE upon
entry was only 1.2 years. Of this group, only 21%
had MTS, 16% had temporal malformations or be-
nign lesions, and 57% had normal MRIs. Of the
13 with MTS, 12 had antecedent insults, including
five with focal or prolonged febrile seizures. Only
longitudinal follow-up of the children with normal
MRIs will determine whether they remit, continue to
have intractable TLE with persistently normal MRIs
or ultimately develop MTS during the course of the
TLE.
What are the implications of subclinical MTS ?
Of our 30 prospectively recruited subjects described
above with mean follow-up of 2.4 years (range: 0.7-
5.7 years), three children all of whom had FSE have
developed epilepsy. Subject 8 of VanLandingham
et al. (1998) is the only infant in our cohort with
known MTS who has ictal events clinically and
electrographically consistent with TLE. The other
two subjects with MTS followed for 4 and 3 years,
respectively, have not developed epilepsy to date and
276
References
Annegers, J.E, Hauser, W.A., Shirts, S.B. and Kurland, L.T.
(1987) Factors prognostic of unprovoked seizures after febrile
convulsions. New Engl. J. Med., 316: 493-498.
Babb, T.L. and Brown, WJ. (1987) Pathological findings
epilepsy. In: J. Engel Jr. (Ed.), Surgical Treatment of the
Epilepsies. Raven Press, New York, pp. 511-540.
Baram, T.Z., Gerth, A. and Schultz, L. (1997) Febrile seizures:
an appropriate-aged model suitable for long term studies. Dev.
Brain Res., 98: 265-270.
Barr, W.B., Ashtari, M. and Schaul, N. (1997) Bilateral reduc-
tions in hippocampal volume in adults with epilepsy and a
history of febrile seizures. J. Neurol. Neurosurg. Psychiatry,
63: 461-467.
Berg, A.T. and Shinnar, S. (1996a) Complex febrile seizures.
Epilepsia, 37: 126-133.
Berg, A.T. and Shinnar, S. (1996b) Unprovoked seizures in
children with febrile seizures: Short term outcome. Neurology,
47: 562-568.
Bower, S.EC., Kilpatrick, C.J., Vogrin, S.J., Morris, K. and
Cook, M.J. (2000) Degree of hippocampal atrophy is not
related to a history of febrile seizures in patients with proved
hippocampal sclerosis. J. Neurol. Neurosurg. Psychiatry, 69:
733-738.
Caserta, M.T., Hall, C.B., Schnabel, K., McIntyre, K., Long,
C., Costanzo, M., Dewhurst, S., Insel, R. and Epstein, L.G.
(1994) Neuroinvasion and persistence of human herpesvirus 6
in children. J. Infect. Dis., 170: 1586-1589.
Cavanagh, J.B. and Meyer, A. (1956) Aetiological aspects
of Ammon's horn sclerosis associated with temporal lobe
epilepsy. Br. Med. J., 2: 1403-1407.
Cendes, E, Andermann, E, Dubeau, E, Gloor, E, Evans, A.,
Jones-Gotman, M., Olivier, A., Andermann, E., Robitaille, Y.,
Lopes-Cendes, I., Peters, T. and Melanson, D. (1993a) Early
childhood prolonged febrile convulsions, atrophy and sclerosis
of mesial structures, and temporal lobe epilepsy: An MRI
volumetric study. Neurology, 43: 1083-1087.
Cendes, E, Andermann, F., Gloor, E, Lopes-Cendes, I., Ander-
mann, E., Melanson, D., Jones-Gotman, M., Robitaille, Y.,
Evans, A. and Peters, T. (1993b) Atrophy of mesial tempo-
ral structures in patients with temporal lobe epilepsy: cause or
consequence of repeated seizures?. Ann. Neurol., 34: 795-801.
Chan, S., Chin, S.S.M., Kartha, K., Nordi, D.R., Goodman, R.R.,
Pedley, T.A. and Hilal, S.K. (1996) Reversible signal abnor-
malities in the hippocampus and neocortex after prolonged
seizure. Am. J. Neuroradiol., 17: 1725-1731.
Commission on Epidemiology and Prognosis, International
League against Epilepsy (1993) Guidelines for epidemiologic
studies on epilepsy. Epilepsia, 34: 592-596.
Corey, L.A., Pellock, J.M., Boggs, J.G., Miller, L.L. and De-
Lorenzo, R.J. (1998) Evidence for a genetic predisposition for
status epilepticus. Neurology, 50: 558-560.
Cox, J.E., Mathews, V.E, Santos, C.C. and Elster, A.D. (1995)
Seizure induced transient hippocampal abnormalities on MR:
Correlation with positron emission tomography and electroen-
cephalography. Am. J. NeuroradioL, 16: 1736-1738.
Cross, J.H., Connelly, A., Jackson, G.D., Johnson, C.L., Neville,
B.G.R. and Gadian, D.G. (1996) Proton magnetic resonance
spectroscopy in children with temporal lobe epilepsy. Ann.
Neurol., 39: 107-113.
Davidson, S. and Falconer, M.A. (1975) Outcome of surgery
in 40 children with temporal-lobe epilepsy. Lancet, 1: 1260-
1263.
Davies, K.G., Hermann, B.E, Dohan Jr., EC., Foley, K.T., Bush,
A.J. and Wyler, A.R. (1996) Relationship of hippocampal scle-
rosis to duration and age of onset of epilepsy and childhood
febrile seizures in temporal lobectomy patients. Epilepsy Res.,
24:119-126.
DeCarolis, E, Crisci, M., Laudadio, S., Baldrati, A. and Sac-
quegna, T. (1991) Transient abnormalities on magnetic reso-
nance imaging after partial status epilepticus, ltal. J. Neurol.
Sci., 13: 267-269.
Dube, C., Chen, K., Eghbal-Ahmadi, M., Brunson, K., Soltesz,
I. and Baram, T.Z. (2000) Prolonged febrile seizures in the
immature rat model enhance hippocampal excitability long
term. Ann. Neurol., 47: 336-344.
Duchowny, M., Levin, B., Prasanna, J., Resnick, T., Alvarez, L.,
Morrison, G. and Dean, E (1992) Temporal lobectomy in early
childhood. Epilepsia, 33: 298-303.
Earle, K.M., Baldwin, M. and Penfield, W. (1953) Incisural
sclerosis and temporal lobe seizures produced by hippocampal
herniation at birth. Arch. Neurol. Psychiatry, 69: 27-51.
Eriksson, ES., Perfilieva, E., BjOrk-Eriksson, T., Alborn, A.M.,
Nordborg, C., Peterson, D.A. and Gage, EH. (1998) Neuroge-
nesis in the adult human hippocampus. Nat. Med., 4: 1313-
1317.
Falconer, M.A., Serafetinides, E.A. and Corsellis, J.A.N. (1964)
Etiology and pathogenesis of temporal lobe epilepsy. Arch.
Neurol., 10: 233-248.
Fernandez, G., Effenberger, O., Vinz, B., Steinlein, O., Elger,
C.E., Dohring, W. and Heinze, H.H. (1998) Hippocampal
malformation as a cause of familial febrile convulsions and
subsequent hippocampal sclerosis. Neurology, 50: 909-917.
French, J.A., Williamson, ED., Thadani, V.M., Darcey, T.M.,
Mattson, R.H., Spencer, S.S. and Spencer, D.D. (1993) Char-
acteristics of medial temporal lobe epilepsy: I. Results of
history and physical examination. Ann. Neurol., 34: 774-780.
Germano, I.M., Zhang, Y.E, Sperber, E. and Moshe, S. (1996)
Neuronal migration disorders increase susceptibility to hyper-
thermia induced seizures in developing rats. Epilepsia, 37:
902-910.
Germano, I.M., Sperber, E.E, Ahuja, S. and Moshe, S.L. (1998)
Evidence of enhanced kindling and hippocampal neuronal
injury in immature rats with neuronal migration disorders.
Epilepsia, 39: 1253-1260.
Gratten-Smith, J.D., Harvey, A.S., Desmond, EM. and Chow,
C.W. (1993) Hippocampal sclerosis in children with in-
tractable temporal lobe epilepsy: detection with MR imaging.
Am. J. Roentgenol., 161: 1045-1048.
Gruenthal, M. (1998) Electroencephalographic and histological
characteristics of a model of limbic status epilepticus permit-
ting direct control over seizure duration. Epilepsy Res., 29:
221-232.

are developmentally normal. Two infants without
MTS, one with developmental delay one with no
other risk factors developed partial epilepsy that
appears to not be TLE.
Although patients with TLE have a high incidence
of MTS on imaging studies, the likelihood of devel-
oping TLE or medically refractory TLE given the
presence of MTS is unknown. Recent imaging data
indicate that MTS can be seen in well-controlled
seizure disorders (Kim et al., 1999). In certain fam-
ilies expressing familial TLE, MTS can be seen in
patients with refractory TLE, well controlled TLE
and in individuals without apparent temporal lobe
seizures (Kobayashi et al., 2001). Autopsy studies
(Meencke and Veith, 1991) report that MTS can be
found in patients without epilepsy, indicating that
not all cases of MTS result in medically refractory
TLE. By recruiting and following a larger group of
children with acquired, subclinical MTS, we can de-
termine the incidence, type and severity of epilepsy
syndromes resulting from this lesion.
Can epileptogenesis afier prolongedfebrile seizures
be prevented?
If it becomes clear that children with hippocampal
edema after prolonged febrile seizures have a high
likelihood of developing MTS and TLE, medical
intervention to prevent epileptogenesis could be jus-
tified and attempted. Drugs may well be developed
that will be capable of preventing epileptogenesis
following insults such as prolonged febrile seizures
or traumatic injury. If the risk factors for MTS
and the likelihood of developing TLE after severe
seizures were known, trials could be conducted to
see if potentially anti-epileptogenic drugs could alter
outcome. This is a critical reason why more basic
science and clinical research in this area is indicated
and the results may have therapeutic implications in
the future.
Conclusions
An association of prolonged and focal febrile
seizures and later onset of partial complex seizures
has been demonstrated in epidemiological cohort
studies with prolonged follow-up. By employing
MRI imaging, we are learning more about the signif-
275
icance of this association and evidence is accumulat-
ing that acute hippocampal injury and resultant MTS
can occasionally result from severe febrile seizures.
The MRI studies have shown that: (1) Visual anal-
ysis of MRIs performed soon after severe febrile
seizures shows a high incidence of hippocampal ab-
normalities ranging from mild to severe; (2) acute
postictal hippocampal MRI abnormalities seem to
be more common when seizures are very prolonged
and focal; (3) the severity of the T2 hyperintensity
may correlate with seizure focality, seizure duration,
older age and perhaps lower temperatures; (4) chil-
dren with initial severe hippocampal T2 abnormality
are more likely to develop MTS; and (5) initial post
ictal MRIs may provide evidence for both acute and
pre-exiting abnormalities.
Many questions remain regarding the mechanisms
of injury during severe febrile seizures. The clinical
and imaging findings raise the possibility that ther-
apeutic intervention to prevent post injury epilep-
togenesis may someday be a possibility. However,
more prospective studies of severe infantile febrile
convulsions will be needed to clearly define the risk
factors and sequelae before reaching any conclusions
about mechanisms of injury and before undertaking
anti-epileptogenic therapy. At this point, given the
evidence that prolonged duration may be a key factor
in hippocampal injury, a strong emphasis on improv-
ing the availability of early and effective treatment
for febrile status epilepticus is crucial.
Acknowledgements
We thank Gregory McCarthy, Ph.D. for valuable ad-
vice and criticism during this project and his staff in
the Brain Imaging and Analysis Center for their
assistance and we thank Elizabeth Rende, R.N.,
M.S.N., EN.E for assistance in telephone follow-
up of study subjects. We also acknowledge the staff
of the Division of Neuroradiology, Department of
Radiology, Duke University Medical Center for their
invaluable assistance in the difficult task of obtain-
ing MRIs on the infants in this study. This research
was supported by grants from the American Epilepsy
Society (DVL) and the Charles A. Dana Foundation
(DVL).

Giinay, M. and Aysun, S. (1996) Neuronal migration disorders
presenting with mild clinical symptoms. Pediatr. Neurol., 14:
153-154.
Hall, C.B., Long, C.E., Schnabel, K.C., Caserta, M.T., Mclntyre,
K.M., Costanzo, M.A., Knott, A., Dewhurst, S., Insel, R.A.
and Epstein, L.G. (1994) Human herpesvirus-6 infection in
children. New Engl. J. Med., 331: 432-438.
Harvey, A.S., Berkovic, S.F., Wrennall, J.A. and Hopkins, I.J.
(1997) Temporal lobe epilepsy in childhood: Clinical, EEG
and neuroimaging findings and syndrome classification in a
cohort with new onset seizures. Neurology, 49: 960-968.
Helminen, M. and Vesikari, T. (1990) Increased interleukin-
1 (IL-I) production from LPS stimulated peripheral blood
monocytes in children with febrile convulsions. Acta Pediatr.
Scand., 79: 810-816.
Ho, S.S., Kuzniecky, R., Gilliam, E, Faught, E. and Morawetz,
R.B. (1998) Temporal lobe developmental malformations and
epilepsy. Neurology, 50: 748-754.
Jackson, G.D., McIntosh, A.M., Briellmann, R.S. and Berkovic,
S.E (1998) Hippocampal sclerosis studied in identical twins.
Neurology, 51 : 78-84.
Kanemoto, K., Kawasaki, J., Miyamoto, T., Obayashi, H. and
Nishimura, M. (2000) Interleukin (IL)-ll3, IL-lc~, and IL-
l receptor antagonist gene polymorphisms in patients with
temporal lobe epilepsy. Ann. Neurol., 47: 571-574.
Kfilvi~inen, R., Salmenper~i, T., Partanen, K., Vainio, P., Riekki-
nen, E and Pitkfinen, A. (1998) Recurrent seizures may cause
hippocampal damage in temporal lobe epilepsy. Neurology,
50: 1377-1382.
Kim, W.J., Park, S.C., Lee, S.J., Lee, J.H., Kim, J.Y., Lee, B.I.
and Kim, D.I. (1999) The prognosis for control of seizures
with medications in patients with MRI evidence for mesial
temporal sclerosis. Epilepsia, 40: 290-293.
Kobayashi, E., Lopes-Cendes, I., Guerreiro, C.A.M., Sousa, S.C.,
Guerreiro, M.M. and Cendes, E (2001) Seizure outcome and
hippocampal atrophy in familial mesial temporal lobe epilepsy.
Neurology, 56: 166-172.
Kornack, D.R. and Rakic, E (1999) Continuation of neurogenesis
in the hippocampus of the adult macaque monkey. Proc. Natl.
Acad. Sci. USA, 96: 5768-5773.
Lange, N., Giedd, J.N., Castellonos, EX., Vaituzis, A.C. and
Rapoport, J.L. (1997) Variability of human brain structure
size: ages 4-20 years. Psychiatry Res., 74: 1-12.
Lee, B.I., Lee, B.C. and Hwang, Y.M. (1992) Prolonged ictal am-
nesia with transient focal abnormalities on magnetic resonance
imaging. Epilepsia, 33: 1042-1046.
Lee, S., Han, S. and Lee, K. (2000) Kainic acid induced seizures
cause neuronal death in infant rats pretreated with lipopolysac-
charide. NeuroReport, 11: 507-510.
Liu, Z., Gatt, A., Mikati, M. and Holmes, G.L. (1993) Effect of
temperature on kainic acid induced seizures. Brain Res., 631:
51-58.
Lundgren, J., Smith, M.-L., Blennow, G. and Siesjo, B.K. (1994)
Hyperthermia aggravates and hypothermia ameliorates epilep-
tic brain damage. Exp. Brain Res., 99: 43-55.
Maher, J. and McLachlan, R.S. (1995) Febrile convulsions: Is
277
seizure duration the most important predictor of temporal lobe
epilepsy?. Brain, 118: 1521-1528.
Margerison, J.H. and Corsellis, J.A.N. (1966) Epilepsy and the
temporal lobes: a clinical, electroencephalographic and neu-
ropathological study of the brain in epilepsy, with particular
reference to the temporal lobes. Brain, 89: 499-530.
Mathern, G.W., Babb, T.L., Vickrey, B.G., Melendez, M. and
Pretorius, J. (1995a) The clinical pathogenic mechanisms of
hippocampal neuron loss and surgical outcome in temporal
lobe epilepsy. Brain, 118:105-118.
Mathern, G.W., Pretorius, J. and Babb, T.L. (1995b) Influence
of the type of initial precipitating injury and at what age it
occurs on the course and outcome in patients with temporal
lobe seizures. J. Neurosurg., 82: 220-227.
Mathern, G.W., Babb, T.L., Mischel, P.S., Vinters, H.V., Pre-
torius, J.K., Leite, J.P. and Peacock, W.J. (1996) Childhood
generalized and mesial temporal epilepsies demonstrate dif-
ferent amounts and patterns of hippocampal neuron loss and
mossy fibre synaptic reorganization. Brain, 119: 965-987.
Mathern, G.W., Price, G.W., Rosales, C., Pretorius, J.K., Lozada,
A. and Mendoza, D. (1998) Anoxia during kainate status
epilepticus shortens behavioral convulsions but generates hip-
pocampal neuron loss and supragranular mossy fiber sprout-
ing. Epilepsy Res., 30: 133-151.
Maytal, J. and Shinnar, S. (1990) Febrile status epilepticus.
Pediatrics, 86:611-616.
Meldrum, B. (1997) First Alfred Meyer Memorial Lecture:
Epileptic brain damage: a consequence and cause of seizures.
Neuropathol. Appl. Neurobiol., 23: 185-202.
Meencke, H.J. and Veith, G. (1991) Hippocampal sclerosis in
epilepsy. In: H. Luders (Ed.), Epilepsy Surgery. Raven Press,
New York, pp. 705-715.
Nelson, K.B. and Ellenberg, J.H. (1976) Predictors of epilepsy in
children who have experienced febrile seizures. New Engl. J.
Med., 295: 1029-1033.
Nohria, V., Tien, R.D., Lee, N., Heinz, E.R., Smith, J.S., De-
Long, G.R., Skeen, M.B. and Lewis, D.V. (1994) MR[ evi-
dence of hippocampal sclerosis in progression: a case report.
Epilepsia, 35: 1332-1336.
Ounsted, C., Lindsay, J. and Norman, R. (1966) Biological
factors in temporal lobe epilepsy. Clinics in Developmental
Medicine, No. 22. The Spastics Society Medical Education
and Information Unit and William Heineman Medical Books,
London.
Parent, J.M., Yu, T.W., Leibowitz, R.T., Geschwind, D.H.,
Sloviter, R.S. and Lowenstein, D.H. (1997) Dentate granule
cell neurogenesis is increased by seizures and contributes to
aberrant network reorganization in the adult rat hippocampus.
J. Neurosci., 17: 3727-3738.
Perez, E.R., Maeder, P., Villemure, K.M., Vischer, V.C., Ville-
mure, J.G. and Deonna, T. (2000) Acquired hippocampal dam-
age after temporal lobe seizures in 2 infants. Ann. Neurol., 48:
384-387.
Raymond, A.A., Fish, D.R., Stevens, J.M., Cook, M.J., Sisodiya,
S.M. and Shorvon, S.D. (1994) Association of hippocampal
sclerosis with cortical dysgenesis in patients with epilepsy.
Neurology, 44: 1841-1843.
278
Salmenpera, T., K~ilvi~iinen, R., Partanen, K. and Pitk~inen, A.
(1998) Hippocampal damage caused by seizures in temporal
lobe epilepsy. Lancet, 351: 35-35.
Sapir, D., Leitner, Y., Harel, S. and Kramer, U. (2000) Unpro-
voked seizures after complex febrile convulsions. Brain Dev.,
22: 484-486.
Sarkisian, M.R., Holmes, G.L., Carmant, L., Liu, Z., Yang,
Y. and Stafstrom, C.E. (1999) Effects of hyperthermia and
continuous hippocampal stimulation of the immature and adult
brain. Brain Dev., 21: 318-325.
Seress, L. (1992) Morphological variability and developmental
aspects of monkey and human granule cells: differences be-
tween the rodent and primate dentate gyms. In: C.E. Ribak,
C.M. Gall and I. Mody (Eds.), The Dentate Gyrus and Its Role
in Seizures. Elsevier, Amsterdam, London, pp. 3-28.
Shinnar, S. (1999) Febrile seizures. In: K.E. Swaiman and S.
Ashwal (Eds.), Pediatric Neurology: Principles and Practice,
3 edn., Mosby, St. Louis, MO, pp. 676-682.
Shinnar, S., Pellock, J.M., Berg, A.T., O'DeI1, C., Driscoll, S.M.,
Maytal, J., Moshe, S.L. and DeLorenzo, R.J. (2001) Short term
outcomes of children with febrile status epilepticus. Epilepsia,
42: 47-53.
Sperber, E.E, Haas, K.Z., Stanton, P.K. and Moshe, S.L. (1991)
Resistance of the immature hippocampus to seizure-induced
synaptic reorganization. Dev. Brain Res., 60: 88-93.
Stafstrom, C.E., Tien, R.D., Montine, T.J. and Boustany, R.M.
(1996) Refractory status epilepticus associated with progres-
sive magnetic resonance imaging signal change and hippocam-
pal neuronal loss. J. Epilepsy, 9: 253-258.
Straussberg, R., Amir, J., Harel, L., Punsky, I. and Bessler, H.
(2001) Pro- and anti-inflammatory cytokines in children with
febrile convulsions. Pediatr. Neurol., 24: 49-53.
Suga, S., Suzuki, K., Ihira, M., Yoshikawa, T., Kajita, Y., Ozaki,
T., Iida, K., Saito, Y. and Asano, Y. (2000) Clinical character-
istics of febrile convulsions during primary HHV-6 infection.
Arch. Disease Childhood, 82: 62-66.
Sutula, T.P. and Hermann, B. (1999) Progression in mesial tem-
porai lobe epilepsy. Ann. Neurol., 45: 553-556.
Szabo, C.A., Wyllie, E., Siavalas, E.L., Najm, I., Ruggieri, P.,
Kotogal, P. and Luders, H. (1999) Hippocampal volumetry in
children 6 years or younger: assessment of children with and
without complex febrile seizures. Epilepsy Res., 33: 1-9.
Tasch, E., Cendes, E, Li, L.M., Dubeau, E, Andermann, E and
Arnold, D.L. (1999) Neuroimaging evidence of progressive
neuronal loss and dysfunction in temporal lobe epilepsy. Ann.
Neurol., 45: 568-576.
Tien, R.D. and Felsberg, G.J. (1995) The hippocampus in status
epilepticus: demonstration of signal intensity and morphologic
changes with sequential fast spin echo MR imaging. Radiol-
ogy, 194: 249-256.
Utsunomiya, H., Takano, K., Okazaki, M. and Mitsudome, A.
(1999) Development of the temporal lobe in infants and chil-
dren: analysis by MR based volumetry. Am. J. Neuroradiol.,
20: 717-723.
van den Berg, J.S.P., van Zeijl, J.H., Rotteveel, J.J., Melchers,
W.J.G., Gabreels, EJ.M. and Galema, J. (1999) Neuroinvasion
by human herpesvirus type 7 in a case of exanthum subitum
with severe neurologic manifestations. Neurology, 52: 1077-
1079.
VanLandingham, K.E., Heinz, E.R., Cavazos, J.E. and Lewis,
D.V. (1998) MRI evidence of hippocampal injury after pro-
longed, focal febrile convulsions. Ann. Neurol., 43: 413-426.
Verity, C.M. and Golding, J. (1991) Risk of epilepsy after febrile
convulsions: a national cohort study. Br. Med. J., 303: 1373-
1376.
Verity, C.M., Ross, E.M. and Golding, J. (1993) Outcome of
childhood status epilepticus and lengthy febrile convulsions:
findings of a national cohort study. Br. Med. J., 307: 225-228.
Vicedomini, J.P. and Nadler, J.V. (1987) A model of status
epilepticus based on electrical stimulation of hippocampal
afferent pathways. Exp. Neurol., 96: 681-691.
Wainwright, M.A., Martin, P.L., Morse, R.P., Lacaze, M.,
Provenzale, J.M., Coleman, E.R., Morgan, M.A., Hulette,
C., Kurtzberg, J., Bushnell, C., Epstein, L. and Lewis, D.V.
(2001), Human herpesvirus 6 limbic encephalitis after stem
cell transplant. Ann. Neurol., 50: 612~519.
Williamson, P.D., Thadani, V.M., Darcey, T.M., Spencer, D.D.,
Spencer, S.S. and Mattson, R.H. (1992) Occipital lobe
epilepsy: clinical characteristics, seizure spread patterns, and
results of surgery. Ann. Neurol., 31: 3-13.
Williamson, P.D., French, J.A., Thadani, V.M., Kim, J.H., Nov-
elly, R.A., Spencer, S.S., Spencer, D.D. and Mattson, R.H.
(1993) Characteristics of medial temporal lobe epilepsy: II.
Interictal and ictal scalp electroencephalography, neuropsycho-
logical testing, neuroimaging, surgical results and pathology.
Ann. Neurol., 34: 781-787.
Wyllie, E., Comair, Y., Kotogal, P., Bulacio, J., Bingaham, W.
and Ruggieri, P. (1998) Seizure outcome after epilepsy surgery
in children and adolescents. Ann. NeuroL, 44: 740-748.
Yoshikawa, T. and Asano, Y. (2000) Central nervous system
complications in human herpesvirus-6 infection. Brain Dev.,
22: 307-314.
T. Sutula and A. Pitkanen (Eds.)
Progressin BrainResearch,Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 24

Do recurrent seizures cause neuronal damage?

A series of studies with MRI volumetry in adults with
partial epilepsy

Reetta K~ilvi~iinen * and Tuuli Salmenper~i

Department of Neurology, Kuopio University Hospital and University of Kuopio, Kuopio, Finland

Abstract: Despite optimal treatment, 30% of epilepsy patients develop intractable epilepsy and continue to have recurrent
seizures or other symptoms of epileptic syndrome restricting their ability to lead a full life. Hippocampal sclerosis is
found in 60-70% of patients with intractable temporal lobe epilepsy (TLE). However, it is not known whether the
damage in the hippocampus is the cause or the consequence of TLE. The purpose of the present series of studies was
to investigate with magnetic resonance imaging (MRI) the appearance of medial temporal lobe damage during the course
of partial epilepsy, and, particularly, to determine whether recurrent or prolonged seizures contribute to the damage.
Altogether 259 partial epilepsy patients were investigated with quantitative MRI. High lifetime seizure number, complex
febrile convulsions in the medical history, and early age at the onset of spontaneous seizures contributed to hippocampal
damage in patients with TLE. The risk factors that predicted amygdaloid volume reduction were intracranial infection and
complex febrile convulsions. Damage in the hippocampus or in the amygdala was rare at the time of first spontaneous
seizures in TLE. In contrast, hippocampal damage was apparent in chronic TLE patients with years of frequent seizures.
Chronic cryptogenic drug-resistant TLE patients had smaller mean hippocampal volumes ipsilateral to the seizure focus
than controls. In all TLE patients, ipsilateral hippocampal volume correlated negatively with the lifetime seizure number.
The mean amygdaloid volumes in chronic TLE patients did not differ from those in controls. However, about 20% of
chronic patients had >20% volume reduction in the amygdala. The mean volumes of the entorhinal cortex ipsilateral
to the epileptic focus in cryptogenic TLE patients did not differ from those in controls. However, the entorhinal cortex
was damaged in a subpopulation of TLE patients with associated hippocampal damage TLE. The findings of the present
series of studies support the hypothesis that damage in the medial temporal lobe structures may be both the cause and
consequence of TLE. The data provide evidence that in some patients hippocampal damage may progress as a function of
repeated seizures, and argue for efficient drug therapy or early surgery to reach complete seizure control. Future research
should address strategies for disease-modifying therapies and ultimately remission of the epileptic process.

Introduction recurrent seizures or other symptoms of epileptic

Despite optimal treatment, 30% of epilepsy patients
develop intractable epilepsy and continue to have
* Correspondence to: R. K~ilviainen, Department of Neu-
rology, Kuopio University Hospital, P.O. Box 1777, 70211
Kuopio, Finland. Tel.: +358-17-173311; Fax: +358-17-
173031; E-mail: reetta.kalviainen@kuh.fi
syndrome restricting their ability to lead a full life
(Hauser and Hesdorffer, 2001). Most commonly, the
origin of recurrent focal seizures is in the temporal
lobe. Furthermore, a distinctive pattern of structural
damage is frequently found in the medial tempo-
ral lobe structures of temporal lobe epilepsy (TLE)
patients.
Neuropathological studies indicate that 70% of
intractable TLE patients have hippocampal dam-
280
age characterized by neuronal loss and gliosis in
the dentate hilus and in Ammon's horn (Bruton,
1988). The structural damage often extends beyond
the confines of the hippocampus to the amygdala
and the adjacent cortex (Margerison and Corsellis,
1966; Bruton, 1988). The etiology and pathogenesis
of structural damage in the medial temporal lobe of
epilepsy patients has been the subject of controversy
and debate for years in epilepsy research. Clinically,
TLE often starts as an isolated, prolonged convul-
sion in early life followed by a period of remission,
after which seizures re-emerge and may become in-
tractable (Wieser et al., 1993). Several studies have
reported a correlation between severe childhood ill-
ness (infection, febrile convulsions, status epilepti-
cus) and hippocampal atrophy in TLE (Cavanagh
and Meyer, 1956; Falconer et al., 1964; Margerison
and Corsellis, 1966; Bruton, 1988).
Since the time of Gowers (1881), clinical, patho-
logical and experimental studies of epilepsy have,
however, enquired whether seizures beget more
seizures, i.e. whether epilepsy is a progressive dis-
ease. Although structural damage in the hippocam-
pus precedes the appearance of TLE in many pa-
tients, not all the cases with hippocampal sclerosis
have a history of initial insult. Some experimental
and human data suggest that recurrent seizures may
cause progressive damage to the medial temporal
lobe structures (Sloviter, 1983; Cavazos et al., 1994;
Mathern et al., 1995).
MRI studies of the causes of medial temporal
lobe damage
Initial insult
Several MRI studies have shown a significant re-
lationship between hippocampal and amygdaloid
damage and a history of febrile convulsions in
early childhood (Cendes et al., 1993b; Kuks et al.,
1993; Trenerry et al., 1993; Harvey et al., 1995).
In a series of drug-resistant epilepsy patients with
a history of febrile seizures, hippocampal atrophy
was diffuse and located ipsilateral to seizure fo-
cus (Kuks et al., 1993; Free et al., 1996; BaIT et
al., 1997; Van Paesschen et al., 1997a; Theodore
et al., 1999). As diffuse hippocampal volume loss
is more strongly associated with febrile convulsions
than focal volume loss, recent imaging studies have
hypothesized that pre-existing hippocampal focal ab-
normality may facilitate febrile convulsions and con-
tribute to the development of subsequent widespread
sclerotic changes in the hippocampus (Kuks et al.,
1993; Fernandez et al., 1998). VanLandingham et al.
(1998) demonstrated, for the first time, the develop-
ment of structural damage in the hippocampus after
complex febrile convulsions in a prospective follow-
up MRI study. They showed that prolonged, focal
febrile convulsions in four infants resulted in acute
hippocampal injury and swelling, and this evolved
into hippocampal atrophy in two of them (VanLand-
ingham et al., 1998).
It is likely that many other etiological factors
in addition to febrile convulsions play a part in
the development of hippocampal sclerosis. Bigler et
al. (1997) showed with quantitative MRI that head
trauma produced hippocampal atrophy. Furthermore,
75% of TLE patients with a history of meningitis
or encephalitis had bilateral hippocampal volume re-
ductions (Free et al., 1996). Progressive hippocampal
damage has also been reported after status epilepti-
cus associated with encephalitis both with and with-
out persistent seizures, even when acute increases in
T2 signal resolve (Nohria et al., 1994; Tien and Fels-
berg, 1995; Wieshmann et al., 1997). In a case study
by Wieshmann et al. (1997), the progression of hip-
pocampal atrophy continued up to 58 months after
onset of status epilepticus due to herpes encephalitis.
Quantitative imaging studies investigating the ef-
fect of age at seizure onset on hippocampal damage
show contradictory results. Trenerry et al. (1993) ob-
served that the younger the left temporal lobectomy
patients were when spontaneous seizures began, the
smaller were the left hippocampal volumes. Hip-
pocampal damage was also related to early onset of
habitual epilepsy in a large study of 100 intractable
TLE patients (Van Paesschen et al., 1997a). How-
ever, even in children with new-onset TLE, there was
a strong association between hippocampal damage
and a history of significant illness/event prior to
the onset of seizure disorder (Harvey et al., 1997).
Recently, in an MRI study of patients with uncon-
trolled TLE, the effect of age at seizure onset was
not a significant factor in predicting the severity of
hippocampal atrophy (Theodore et al., 1999).

Recurrent seizures
Several previous imaging studies have failed to find
a correlation between MRI-determined hippocampal
atrophy and either the estimated severity or the du-
ration of the seizure disorder (Cendes et al., 1993d;
Kuks et al., 1993; Trenerry et al., 1993; Grunewald
et al., 1994; Kuzniecky et al., 1996; Van Paesschen
et al., 1996; Barr et al., 1997). In a retrospective
MRI report of 50 patients with intractable TLE,
neither hippocampal nor amygdaloid volumes corre-
lated with duration of epilepsy, seizure frequency, or
the occurrence of generalized seizures (Cendes et al.,
1993a). The study concluded that habitual seizures
do not lead to progressive hippocampal damage.
In contrast to other imaging studies, Spencer et al.
(1993) reported that hippocampal atrophy in quanti-
tative MRI was significantly correlated with longer
duration of epilepsy. More recent imaging studies
have produced evidence that epilepsy duration has
a significant effect on the severity of hippocampal
damage in intractable TLE patients (Jokeit et al.,
1999; Tasch et al., 1999; Theodore et al., 1999). As
long duration of drug-resistant TLE is related to a
considerable number of focal or secondarily gener-
alized seizures, both hippocampal and hemispheric
volume reductions were associated with high seizure
frequency in an MRI series of TLE patients (Barr
et al., 1997; Marsh et al., 1997). Van Paesschen et
al. (1997a,c) reported that the extent of hippocampal
damage correlated with the number of secondarily
generalized seizures in both newly diagnosed and
chronic TLE patients.
In addition to correlational approaches, one can
compare patient groups with different duration and
severity of epilepsy, or follow cohorts of patients
longitudinally to examine the progression of dis-
ease. Quantitative MRI studies have shown that
while hippocampal damage is found in 73% of in-
tractable TLE patients (Van Paesschen et al., 1997b),
only 10% of newly diagnosed patients with partial
seizures have volume reduction and T2 time pro-
longation in the hippocampus (Van Paesschen et
al., 1997c). Saukkonen et al. (1994) compared hip-
pocampal volumes in newly diagnosed and chronic
patients with TLE, and found that those patients with
a long history of recurrent seizures had more severe
hippocampal damage. The first follow-up MRI study
281
demonstrated that subtle changes in hippocampi may
occur during 1 year in association with frequent and
daily seizures in adults with newly diagnosed partial
epilepsy (Van Paesschen et al., 1998).
Recently, O'Brien et al. (1999) provided the first
prospective MRI evidence that progressive atrophy
of the hippocampus may develop in the absence of
initial insult, such as status epilepticus, due to uncon-
trolled temporal lobe seizures. This case report adds
a link to the theory uniting data from experimen-
tal and clinical studies indicating that hippocampal
damage is both the cause and effect of seizures.
Aims of the study
The purpose of the present series of studies (K~ilviiii-
nen et al., 1997b, 1998; Salmenper~i et al., 1999,
2001) was to investigate with MRI the appearance
of medial temporal lobe damage during the course
of focal epilepsy, and, particularly, to determine
whether recurrent seizures contribute to the dam-
age. The determination of the factors predictive of
damage in the medial temporal lobe will contribute
to a better understanding of the epileptic process and
the care of patients having frequent seizures.
Materials and methods
Controls
The control group in the series of studies comprised
29 healthy students or staff members (14 males, 15
females) with a mean age of 3 3 i 11 (range 21-
64) years who had volunteered for the study. All
controls were interviewed in order to exclude those
with neurological diseases.
Patients
Altogether, 259 (132 males, 127 females; age 33 + 12
years, range 15-68 years) consecutive focal epilepsy
patients of the Department of Neurology in Kuopio
University Hospital were included (Table 1) and
investigated with quantitative MRI from 1993 to
1996.
The patients were divided into two groups ac-
cording to the localization of the seizure focus: pa-
tients with TLE, and patients with extratemporal/
282

TABLE 1
Patients in studies

Study Etiology No. of Patient groups Median seizure

patients number (range)
K~ilviginen et al., 1 9 9 8 Cryptogenic 64 TLE Newly diagnosed (18) 3 (1-482)
TLE Chronic (46)
Well-controlled (14) 10 (4-401 )
Drug-resistant (32) 1128 (38-6912)
KNviNnen et al., 1 9 9 7 b Cryptogenic/ 84 TLE Newly diagnosed (29)
symptomatic Cryptogenic (18) 3 (1-482)
Symptomatic (11) 8 (2-723)
TLE Chronic (54)
Cryptogenic (31) 1128 (38-6912)
Symptomatic (23) 1830 (121-9600)
Salmenper~i et al., 2 0 0 1 Cryptogenic/ 259 TLE (167) ETE/UC (92) 250 (2-16,625)
symptomatic Cryptogenic Cryptogenic
Symptomatic Symptomatic
< 1 year < 1 year
2-10 years 2-10 years
11-20 years 11-20 years
>21 years >21 years
<2 seizures/year <2 seizures/year
>2 seizures/year >2 seizures/year
Salmenper~i et al., 1 9 9 9 Cryptogenic 36 TLE 4- HC damage 978 (3~5909)
Without damage (20)
With damage (16)
The number of patients in different patient groups is in parentheses. ETE/UC, extratemporal/unclassified partial epilepsy; HC,
hippocampal; TLE, temporal lobe epilepsy.

unclassified partial epilepsy (ETE/UC). There were
167 patients with clinical symptoms, interictal tem-
poral EEG discharges, or a temporal lobe lesion
determined by MRI consistent with the diagnosis
of TLE. Furthermore, TLE patients were divided
into subgroups based on their seizure lateralization.
The group of patients with ETE/UC consisted of
92 patients whose seizure foci were either outside
the temporal lobe or could not be localized. Ictal
EEG recordings were available for analysis from 54
patients included in the study. In three of the studies,
only TLE patients were included (KNvi~iinen et al.,
1997b, 1998; Salmenpera et al., 1999).
Patients with both cryptogenic and symptomatic
etiology of seizures were included. In all remote
symptomatic patients, the underlying causes for
seizures were head trauma (n = 22), disorder of
neuronal migration and organization (n = 21), other
developmental disorder (n = 14), CNS infection
(n = 18), perinatal insult (n = 20), brain tumor (ini-
tial symptom or postoperatively, n = 9), and others
(n = 8).
Patients with a medical history of complex febrile
convulsions (n = 10) were also classified as symp-
tomatic. However, if only hippocampal atrophy
and/or change in the T2-signal intensity was ob-
served in MRI, the epilepsy was classified as cryp-
togenic because it is unclear whether hippocampal
damage is the cause or the consequence of TLE and
this was the main question asked in the present series
of studies. Also, if there were no other potential etio-
logic factors in the medical history or the MRI study
of the patients, they were classified as cryptogenic.
In order to calculate the number of partial and
secondarily generalized seizures each patient had ex-
perienced, and to verify the cryptogenic etiology of
seizures, an extensive search for the lifetime hospital
records of the patients was performed.

Both TLE and ETE/UC patients included in the
study by Salmenper~i et al., 2001 were further di-
vided into patient groups based on the duration of
epilepsy (< 1 year, 2-10 years, 11-20 years, and >21
years). Mean seizure frequency determined whether
the patient was assigned to a subgroup with rare
seizures (<2 seizures per year) or frequent seizures
(>2 seizures per year). The TLE patients in studies
by K~ilvi~iinen et al. (1997b, 1998) were divided into
two categories based on the duration of the seizure
disorder: newly diagnosed and chronic (Table 1).
All newly diagnosed patients were imaged at the
time of the diagnosis before any antiepileptic med-
ication was started. Chronic TLE patients had had
symptoms of epilepsy for at least 2 years. Chronic
patients were further divided into two groups based
on the level of seizure control: well-controlled and
chronic drug-resistant. The duration of epilepsy and
the lifetime number of seizures differed significantly
between chronic TLE patients and newly diagnosed
patients with TLE.
Magnetic resonance imaging
The patients and controls were scanned with a 1.5-
Tesla imager (Siemens Magnetom) using a standard
head coil and a tilted coronal 3-D magnetization-pre-
pared rapid acquisition gradient-echo (MP-RAGE)
sequence with parameters: time of repetition (TR)
10 ms, time of echo (TE) 4 ms, inversion time 250
ms, flip angle 12 °, field of view (FOV) 250 ram,
matrix 256 × 192. This resulted in 128 contiguous
Tl-weighted images with a slice thickness of 1.5-2
mm which were oriented at fight angles to the long
axis of the hippocampus.
The hippocampal and amygdaloid volumes were
measured according to the method described by
Soininen et al. (1994). The intra-observer variability
expressed as mean of the coefficient of variation of
each control was 6.8% for the hippocampal volumes
and 8.9% for the amygdaloid volumes. The vol-
umes of all entorhinal and perirhinal cortices were
measured using a recently described histology-based
method (Insausti et al., 1998). The intraobserver vari-
ability was 4.9% for entorhinal volumes and 4.0%
for perirhinal volumes.
283
Statistical analysis
A ratio was used to correct the volumes of the hip-
pocampi, amygdala, entorhinal and perirhinal cor-
tices for interindividual differences in head size ac-
cording to Cendes et al. (1994) with a modification.
Instead of brain volume, the area of brain which cor-
relates with the brain volume (r = 0.67, P < 0.001,
n = 20) was used. The mean brain area (obtained at
the level of the anterior commissure) of the controls
was divided by the corresponding brain area of the
patient, and then this ratio was multiplied by the
measured volume of the hippocampus, amygdala,
entorhinal or perirhinal cortex.
The data were analyzed with SPSS/PC+ V 4.1
and SPSS Win V 7.5 and V 8.0 software (Chicago,
IL). The mean hippocampal and amygdaloid vol-
umes were compared between the unilateral TLE pa-
tient groups and controls using the ANOVA test with
Duncan's post hoc analysis in studies by K~ilvi~iinen
et al. (1997b, 1998). Hemispheric differences for the
amygdaloid volumes (AAMY) were calculated as
the volume of the structure in the fight minus the
volume in the left hemisphere (study II). The hemi-
spheric ratio (rAMY) was calculated as the volume
of the structure in the right/volume in the left hemi-
sphere. Student's paired t-test was used to analyze
hemispheric differences of the amygdaloid volumes
within a group.
In the study by Salmenper~i et al., 2001, the
volumes of the hippocampus and amygdala were
compared between the patient groups and controls.
The analyses were conducted separately in unilateral
TLE and ETE/UC patients. Nonparametric analyses
with the Bonferroni correction were used to compare
the means over the study groups and to determine
the differences between the groups. The number of
all TLE and ETE/UC patients with marked volume
reduction (i.e., volume of the structure was _>2 SD
below the mean volume in controls) were compared
using the X2-test and Fisher's exact test. Logistic
regression analysis was used to analyze predictive
factors of the hippocampal and the amygdaloid vol-
ume reduction of >_2 SD in TLE patients. Odds
ratios (OR) with 95% limits of confidence intervals
(95% CI) were calculated from the logistic regres-
sion model.
The volumes of the entorhinal cortex, hippocam-
284
pus and amygdala were compared between the pa-
tient groups and controls in cryptogenic chronic
unilateral TLE (Salmenpera et al., 1999). Degree of
asymmetry between the volumes of the left (L) and
fight (R) entorhinal cortex, hippocampus and amyg-
dala were examined by calculating asymmetry ratios
according to Bernasconi et al. (1999) as follows:
asymmetry % = [100 x (R - L]/[(R + L)/2].
The Kruskal-Wallis test was used to compare the
mean volumes and the asymmetry ratios over the
study groups. Differences between the groups were
determined using the Mann-Whitney U-test with the
Bonferroni correction.
The correlations were calculated using the two-
tailed Pearson's correlation test. To reduce the effect
of outlying values on correlation analysis, a logarith-
mic transformation of the hippocampal and amyg-
daloid volumes was performed before the calculation
of correlation.
The level of statistical significance was set at
P < 0.05 in all studies.
Results
Hippocampal damage in cryptogenic TLE
(Kiilvidinen et al., 1998)
Damage at the different stages of cryptogenic TLE
The mean hippocampal volume in patients with
newly diagnosed TLE did not differ from that in con-
trois. The mean hippocampal volume in patients with
chronic well-controlled epilepsy did not differ from
that in controls. In all chronic drug-resistant TLE pa-
tients, the volumes of the left and right hippocampi
did not differ from those in controls. However, in the
group of patients with left TLE the left hippocampus
was 18% smaller than in the control group. Corre-
spondingly, in chronic drug-resistant patients with
seizure focus on the right, the right hippocampal vol-
ume was 14% smaller than in controls (P < 0.05).
Correlation of damage with seizure number or
duration of cryptogenic TLE
In all patients with a left seizure focus, the left hip-
pocampal volume correlated inversely with the esti-
mated total number of partial (r = -0.391, P < 0.01)
and generalized (r = -0.312, P < 0.05) seizures the
patient had experienced.
Amygdaloid damage in TLE (Kdlvidinen et al.,
1997b)
Damage at different stages of TLE
The mean amygdaloid volumes in newly diagnosed
TLE patients did not differ from those in controls. No
hemispheric differences in the amygdaloid volumes
were observed between the study groups. Only one
symptomatic case (4%, 1/27) of newly diagnosed
patients had an amygdaloid volume reduction of at
least 20%.
The mean amygdaloid volumes in chronic TLE
patients did not differ from those in controls. No
hemispheric differences in the amygdaloid volumes
were observed between the study groups. However,
in 19% (8/45; 4 cryptogenic, 4 symptomatic) of the
chronic patients the amygdaloid volume was reduced
by at least 20%.
Correlation of damage with seizure number and
duration of TLE
In all TLE patients with seizure focus on the left,
the volume of the left amygdala correlated nega-
tively with the lifetime seizure number (r = -0.371,
P < 0.01) and the duration of epilepsy (r = -0.327,
P < 0.01). When the different seizure types were an-
alyzed separately, the amygdaloid volume was nega-
tively correlated with the number of partial seizures
(r = -0.426, P < 0.01). In all TLE patients with
focus on the right side, the volume of the right
amygdala was negatively correlated with the lifetime
seizure number (r = -0.348, P < 0.05), but not with
the duration of epilepsy. When different seizure types
were analyzed separately, the amygdaloid volume
was negatively correlated with the number of gener-
alized seizures (r = -0.418, P < 0.05). In right TLE
patients, the volume of the left amygdala correlated
with the duration of seizure disorder (r = -0.536,
P < 0.01).
 285

Hippocampal and amygdaloid damage in focal TABLE 3

epilepsy (Salmenperii et al., 2001) Predictors of _>2 SD amygdaloid volume reduction in TLE
patients
Risk factors for hippocampal and amygdaloid Predictor of amygdaloid P-value OR 95% CI
damage in TLE volume reduction
Complex febrile convulsions 0.025 12 1.4-100
Logistic regression analysis was used to identify lntracranial infection 0.014 14 1.7-115
predictors of volume reduction of _>2 SD in the hip- Age at onset (_<5 years) 0.60 1.6 0.28-8.8
pocampus and the amygdala. Six clinical variables, EEG (epileptiform) 0.37 2.3 0.38-13
one demographic variable, and one variable from the Gender (female) 0.06 6.1 0.91-42
Seizure number (_>1461) 0.66 a 0.56 0.051-6.2
EEG data were included in the analyses. Risk fac-
Status epilepticus 0.81 1.3 0.18-8.8
tors found to be significant predictors of hippocam-
pal volume reduction of >2 SD were high lifetime Odds ratios with 95% limits of confidence intervals were cal-
seizure number, medical history of complex febrile culated from logistic regression model. For the purpose of the
analysis the lifetime seizure number was divided into quartiles,
convulsions, and age <5 years at the time of the otherwise the factors were dichotomous. OR, odds ratio; CI, con-
first spontaneous seizure (Table 2). Patients grouped fidence interval of OR; TLE, temporal lobe epilepsy.
in the quartile with the highest number of seizures a Test over all quartiles.
experienced during lifetime were more likely to have
a hippocampal volume reduction of >2 SD than
those grouped in the quartile with the lowest num- fold (P < 0.05). On the other hand, gender, epilep-
ber of seizures. There was a 16-fold increased risk tiform activity in the EEG, intracranial infection or
of hippocampal damage in patients with a lifetime status epilepticus in the medical history did not pre-
seizure number of >1461 compared with the pa- dict hippocampal atrophy. The patients with seizure
tients with <13 seizures (P < 0.05). Furthermore, onset <5 years did not differ regarding their early
patients with a medical history of complex febrile development, frequency of complex febrile seizures
convulsions were 16 times more likely to have hip- or frequency of intracranial infections from the other
pocampal damage than those without (P < 0.01). patients.
When age of seizure onset was <5 years, the risk of Patients who had suffered from intracranial in-
volume reduction in the hippocampus increased 5.3- fection or had had complex febrile seizures in early
childhood were more likely to have an amygdaloid
volume reduction of _>2 SD than those who did not
TABLE 2 have these etiologic factors in their medical history
Predictors of _>2 SD hippocampal volume reduction in TLE (Table 3).
patients

Predictor of HC volume reduction P-value OR 95% CI Damage relative to the duration of TLE
Age at onset (_<5 years) 0.0028 5.3 1.8-16
The mean hippocampal (Table 4) or amygdaloid
Complex febrile convulsions 0.0036 16 2.5-105
Seizure number (_>1461) 0.014 a 16 2.3-117 volumes in patients with duration of < 1 year of TLE
EEG (epileptiform) 0.86 0.91 0.33-2.5 with seizure focus on the left or right did not differ
Gender (female) 0.27 1.7 0.65-4.5 from those in controls.
Intracranial infection 0.11 4.8 0.69-34 There was a significant difference in the mean vol-
Status epilepticus 0.76 1.2 0.34-4.3
umes of the fight hippocampus when analysis was
Odds ratios with 95% limits of confidence intervals were cal- performed on controls and patients with different
culated from logistic regression model. For the purpose of the durations of right TLE (P < 0.001) (Table 5). The
analysis, the lifetime seizure number was divided into quartiles, right hippocampus was 29% smaller in patients with
otherwise the factors were dichotomous. HC, hippocampal; OR,
odds ratio; CI, confidence interval of OR; TLE, temporal lobe
>21 years of fight TLE than in controls (P < 0.01).
epilepsy. The difference in the mean fight hippocampal vol-
a Test over all quartiles. ume was also significant when patients with >21
 286

TABLE 4
Volumes (mm3) of the left and right hippocampus (HC) in patients with temporal lobe epilepsy

Left HC Damage % Right HC Damage %

Controls (25) 3348 4- 424 3589 4- 436
Patients with focus on the left (90)
<1 year (13) 3163-t-656 6 36794-333 0
With rare seizures (7) 3062 4- 875 9 3813 q- 266 0
With frequent seizures (6) 3282 4- 285 2 3522 4- 357 2
2-10 years (19) 3114-t-607 7 3654-4-321 0
With rare seizures (5) 3285 4- 345 2 3736 4- 304 0
With frequent seizures (14) 3054 q- 677 9 3625 4- 333 0
11-20 years (27) 3226 4- 666 4 3527 ± 577 2
With rare seizures (9) 3287 4- 366 2 3531 4- 402 2
With frequent seizures (18) 3195 -4-782 5 3525 4- 658 2
>21 years (31) 2853 ±717 14 34604-524 4
With rare seizures (2) 3131 4-49 6 3635 4-191 0
With frequent seizures (29) 2834 4- 738 15 3448 4- 539 4

Patients with focus on the right (55)

<1 year (5) 36924-590 0 4051 4-602 0
With rare seizures (1) 4315 0 4459 0
With frequent seizures (4) 3536 4- 549 0 3949 ± 644 0
2-10 years (16) 3249 4- 526 3 3463 4- 656 4
With rare seizures (3) 3355 4- 120 0 3589 4- 344 0
With frequent seizures (13) 3224 4- 583 4 3434 4- 716 4
11-20 years (12) 3257 4- 533 3 3085 4- 856 14
With rare seizures (1) 3809 0 2259 37
With frequent seizures (11) 3206 4- 528 4 3160 + 856 12
>21 years (22) 3124 4- 541 7 2555 -4-977 a,c,a 29
With rare seizures (4) 3461 4- 555 0 3469 4- 1033 3
With frequent seizures (18) 3049 4- 524 9 2351 4- 866 b,c,a 34

HC volumes are shown as mean 4- standard deviation of the mean. Damage % shows the percentage of volume reduction below the
mean in controls. Number of patients, from which the volumetry data were available, is in parentheses. In the table we show the
normalized hippocampal volumes. Statistical significances were calculated with Kruskal-Wallis and Mann-Whitney analyses: a p < 0.01;
b p < 0.001 compared to controls; c p < 0.05 compared to patients with <1 year of epilepsy; d p < 0.05 compared to patients with 2-10
years of epilepsy. Reprinted from Salmenper~i et al., 2001 with permission.

years of epilepsy were compared with patient groups
w i t h < 1 y e a r or 2 - 1 0 y e a r s o f e p i l e p s y ( P < 0.05).
No significant difference was observed in the mean
hippocampal volumes when controls and patients
with different durations of left TLE were compared
w i t h e a c h other. H o w e v e r , t h e r e w a s a t r e n d to-
w a r d s left h i p p o c a m p a l v o l u m e r e d u c t i o n i n p a t i e n t s
w i t h l o n g e r d u r a t i o n o f T L E . T h e left h i p p o c a m p u s
w a s 1 4 % s m a l l e r i n p a t i e n t s w i t h > 2 1 y e a r s o f left
T L E c o m p a r e d w i t h c o n t r o l s . T h e n u m b e r o f all
TLE patients with a hippocampal volume reduction
of >2 SD was significantly higher in patients with
11-20 y e a r s ( 1 7 % ( 7 / 4 1 ) , P < 0.05) a n d w i t h > 2 1
years (46% (25/54), P < 0.001) of TLE compared
with controls. Furthermore, the number of patients
with reduced hippocampal volume was significantly
higher in patients with >21 years of TLE (46%
(25/54)) than in patients with <1 year (5% (1/21),
P < 0.001), 2 - 1 0 y e a r s ( 1 1 % ( 4 / 3 7 ) , P < 0.001), or
1 1 - 2 0 y e a r s ( 1 7 % ( 7 / 4 1 ) , P < 0.01) o f epilepsy.
T h e r e w e r e n o s i g n i f i c a n t d i f f e r e n c e s in m e a n
amygdaloid volumes when controls and patients with
 287

TABLE 5 The number of all TLE patients with a hippocam-

Correlation between the hippocampal volumes or T2 relaxation pal volume reduction of >2 SD was higher in pa-
times and the lifetime seizure number in patients with temporal tients with 11-20 years (20% (6/30), P < 0.05) and
lobe epilepsy. Reprinted from Salmenpera et al., 2001 with with >21 years (50% (24/48), P < 0.001) of fre-
permission from Elsevier Science
quent seizures than in controls. Moreover, the num-
HC volume ber of patients with decreased hippocampal volume
Left Right was higher in patients with ->21 years of frequent
seizures (50% (24/48)) than in patient groups with
Focus on the left
Partial seizures r = -0.221 n.s. <1 year (0% (0/12), P < 0.01), with 2-10 years
n = 90 (14% (4/29), P < 0.01), or with 11-20 years (20%
P = 0.036 (6/30), P < 0.01) of frequent seizures.
Generalized seizures r = -0.239 n.s. The mean amygdaloid volumes did not differ sig-
n =90 nificantly between the study groups. There were no
P = 0.023 significant differences in the number of patients with
an amygdaloid volume reduction of ->2 SD when the
Focus on the right
patient groups with frequent or rare seizures were
Partial seizures n.s. r = -0.366
n =55 compared with each other or with controls.
P = 0.006
Generalized seizures n.s. r = -0.344
Correlation of damage with seizure number. In all
n = 55 TLE patients with seizure focus on the left, the left
P = 0.010 hippocampal volume correlated inversely with the
total number of partial (r = -0.221, P < 0.05) and
Correlations between the hippocampal volumes and the lifetime
number of partial and generalized seizures are shown separately generalized (r = -0.239, P < 0.05) seizures the pa-
in patients with seizure focus on the left or right temporal tients experienced during their lifetime (Table 5). No
lobe. Correlations were calculated using two-tailed Pearson's correlation was found between right hippocampal
correlation test. HC, hippocampus; n, number of patients; n.s., volume and seizure number. Hippocampal T2 relax-
not significant; r, Pearson's correlation coefficient,
ation time, however, correlated with the number of
partial seizures (r = 0.297, P < 0.01).
In all TLE patients with seizure focus on the right,
the fight hippocampal volume correlated inversely
a different duration of left or right TLE were com- with the total number of both partial (r = -0.366,
pared. Moreover, no differences were observed in the P < 0.01) and generalized (r = -0.344, P < 0.05)
number of all TLE patients with an amygdaloid vol- seizures (Table 5). Correspondingly, the prolongation
ume reduction between patient groups with different of fight hippocampal T2 relaxation time correlated
durations of TLE and controls. with the number of partial (r = 0.442, P < 0.01)
but not with the number of generalized seizures
Damage relative to the seizure number in TLE (Table 5). No correlation was observed between the
left hippocampal volume or T2 relaxation time and
Damage in patients with rare and frequent seizures. the number of partial or generalized seizures.
There was a significant difference when the mean In all TLE patients with seizure focus on the left,
hippocampal volumes in fight TLE patient sub- the volumes of the left or right amygdala did not
groups with frequent seizures were compared with correlate with the number of seizures the patient ex-
each other or with controls (P < 0.001) (Table 4). perienced (Table 6). In all TLE patients with fight
In patients with >21 years of frequent seizures, the seizure focus, the fight amygdala volume correlated
volume of the fight hippocampus was 34% smaller inversely with the number of generalized seizures
than in controls (P < 0.001), 40% smaller than in pa- (r = -0.332, P < 0.05) (Table 6). There was no cor-
tients with <1 year, and 32% smaller than in patients relation between left amygdaloid volume and seizure
with 2-10 years of frequent seizures (P < 0.05). number.
288
TABLE 6
Correlation between the amygdaloid volumes and the lifetime
seizure number in patients with temporal lobe epilepsy
Amygdaloid volume
Left Right
Focus on the left
Partial seizures n.s. n.s.
Generalized seizures n.s. n.s.
Focus on the right
Partial seizures n.s n.s.
Generalized seizures n.s. r = -0.332
n =51
P = 0.017
Correlations between the amygdaloid volumes and the lifetime
number of partial and generalized seizures are shown separately
in patients with seizure focus on the left or right temporal
lobe. Correlations were calculated using two-tailed Pearson's
correlation test. n, number of patients; n.s., not significant; r,
Pearson's correlation coefficient.
Damage in patients with extratemporal or
unclassified partial epilepsy (ETE/UC)
There were no significant differences in the volumes
of the left or right hippocampus when patients with
different durations of ETE/UC were compared with
each other or with controls. Furthermore, no dif-
ference was observed between patient groups with
rare or frequent seizures and controls. The number
of patients with a hippocampal volume decrease of
>2 SD was higher in patients with <10 years of
epilepsy (16% (7/43), the patient groups of < 1 year
and 2-10 years of epilepsy were combined) than in
controls (P < 0.05). The difference was significant,
however, only in patients with frequent seizures. Al-
together, 17% (4/23) of the patients with < 10 years
of frequent seizures had a volume reduction in the
hippocampus (P < 0.05 compared with controls).
No significant differences were observed in the
mean volumes of the left or right amygdala between
different patient groups and controls. The number
of cases with reduced amygdaloid volume in patient
groups with <10 years or >11 years of ETE/UC
epilepsy did not differ from each other or from
controls. Also, no differences were observed when
the different subgroups with rare or frequent seizures
were compared with each other or controls.
Damage in the entorhinal cortex in patients with
TLE (Salmenperii et al., 1999)
There were no significant differences in the volumes
of the left or right entorhinal cortex when patients
with left focus, right focus and controls were com-
pared. Also, the asymmetry index did not differ
between the study groups.
Two of 36 patients had >2 SDs volume reduction
of the entorhinal cortex (i.e., at least a 31% volume
reduction on the left side and 41% on the right side).
In 11 out of 36 patients, entorhinal volume was
reduced by at least 25% (5 ipsilateral, 3 contralateral,
3 bilateral volume reduction).
Further analysis showed significant differences
in the entorhinal volume when the occurrence of
hippocampal damage (>2 SDs volume reduction
compared to controls) was taken into account. The
entorhinal volume correlated with the hippocampal
volume ipsilaterally (n = 36, r = 0.454, P < 0.01)
and contralaterally (n = 36, r = 0.340, P < 0.05) in
TLE patients. Overall, 8 of 16 patients with hip-
pocampal damage had a 25% volume decrease in the
ipsilateral entorhinal cortex. In right TLE patients
with ipsilateral hippocampal damage, the mean vol-
ume of the ipsilateral entorhinal cortex was reduced
by 19% compared with controls (P < 0.05). Also,
the left TLE patients with left hippocampal dam-
age had a 16% volume reduction of the ipsilateral
entorhinal cortex compared with controls, but the
difference did not reach significance (P = 0.0936).
Otherwise, 8 of 11 patients with over 25% entorhinal
damage had hippocampal damage ipsilaterally. Hip-
pocampal damage was unilateral in four patients and
bilateral in four patients.
In all patients, the entorhinal and amygdaloid
volumes correlated ipsilaterally (n = 36, r = 0.346,
P < 0.05), but not contralaterally. Only 2 of 11 pa-
tients with 25% entorhinal damage had ipsilateral
amygdaloid damage (>2 SDs volume reduction).
Three of four patients with amygdaloid damage had
over 25% volume reduction in the ipsilateral entorhi-
nal cortex.
The ipsilateral entorhinal volume correlated in-
versely with the duration of TLE (n = 36, r =
-0.335, P < 0.05) in all patients. We did not, how-
ever, find any difference in the mean entorhinal
volume between the patient groups with TLE onset

<5 or >5 years of age. No correlation was found
between the total seizure number (partial, secondar-
ily generalized or all seizures) and the entorhinal
volume ipsilaterally or contralaterally.
Discussion
Few data are available on the temporal appearance
and progression of structural damage observed in
TLE patients. In the present series of studies, the
hippocampal and amygdaloid damage were assessed
with quantitative MRI first in newly diagnosed and
chronic TLE patients (K~ilvi~iinen et al., 1997b,
1998) and then, to widen the scope of the study, in
partial epilepsy patients during the course of seizure
disorder (Salmenper~i et al., 2001). Furthermore, as
the surrounding cortical areas including the entorhi-
nal and perirhinal cortices are functionally intercon-
nected with the hippocampus and the amygdala, the
volume of the entorhinal cortex was measured in
chronic TLE patients (Salmenpera et al., 1999).
Methodological considerations
Study methods and material
Studies in the present series represent a large sample
of patients with varying severity of epilepsy, as found
in routine clinical practice, rather than only surgical
candidates with intractable epilepsy. We were able
to include patients with milder forms of epilepsy, as
the Department of Neurology in Kuopio University
Hospital serves as a primary site of treatment for
all patients with seizure disorder in the district and
not solely as a tertiary referral center. Importantly,
the findings in the series of studies might not have
been found had it not been for the large study
population with variable and long duration of TLE.
This may partly explain why previous MRI reports
based on a smaller number of patients clustered at the
more severe end of the continuum have not shown
any correlations suggesting progressive hippocampal
volume reduction (Cendes et al., 1993a,d; Trenerry
et al., 1993; Kuzniecky et al., 1996; Van Paesschen
et al., 1997a).
The contradiction between earlier study results
and the present data might also be related to method-
ologic difficulties in human studies to reliably quan-
289
tify the duration of seizure history and the number
of seizures the patient has experienced. Whereas ret-
rospective calculation of seizures is always subject
to error, the patients included in the present series
of studies had been under the care of a neurolo-
gist at Kuopio University Hospital for most of their
epilepsy history, and the calculation of total seizure
number was based on hospital records of the pa-
tients collected over the years. All study patients
were directed to keep meticulous seizure calenders,
if necessary with the help of a responsible relative,
and visited the neurologist regularly depending on
the seizure frequency (at least once a year), which
improved the accuracy of the seizure count. Over-
all, even considering that some variation existed in
the seizure count using retrospective methods, the
total lifetime seizure number is more likely to be
underestimated than the opposite.
According to careful calculation from the hospi-
tal records and the collected seizure calendars, the
median total seizure number in 259 study patients
(Salmenper~i et al., 2001) was 250 (range 2-16,625).
In patients with frequent seizures, the median to-
tal seizure number was 663 (mean seizure number
+ standard deviation 1489 + 2357). Conversely, pa-
tients with rare seizures had a median total seizure
number of 4 (mean seizure number + standard devi-
ation 7 4- 9). The determination of the cut-off num-
ber of seizures the patients had experienced (rare
seizures = <2 seizures per year, frequent seizures
= >2 seizures per year) was based on clinical treat-
ment principles of epilepsy in the Department of
Neurology at Kuopio University Hospital. Accord-
ing to the therapy scheme used, an epilepsy patient
is generally regarded as well-controlled if he expe-
riences up to two seizures per year. However, the
epilepsy is regarded as drug-resistant, and more ef-
fective treatment is required, if there are more than
two seizures per year. Such a low cut-off number
may have led to different sizes of the various sub-
groups, with the frequent seizure group being more
heterogeneous in terms of seizure frequency. On the
other hand, the classification served the aim of the
series of studies, which was to further improve the
management of epilepsy patients in clinical practice:
i.e. to answer the question, do patients with good
seizure control during the years of epilepsy have less
structural damage than those with recurrent seizures?
290
The design used in studies was cross-sectional.
Therefore, the data are suspect for several kinds of
bias: for example, accumulation of refractory cases
with damage caused by an initial injury into a patient
group with long duration of epilepsy (Semah et al.,
1998), and a drop-out of seizure-free patients from
the follow-up. The results showed significant group
differences, but predicting any individual patient's
clinical and pathological features would be problem-
atic. Thus, our studies could only infer a causal rela-
tionship between seizures and hippocampal damage
suggesting progressivity. Future prospective studies,
some of which are already ongoing (K~ilviainen et
al., 1997a; Van Paesschen et al., 1998), will be able
to provide an answer to the question of whether
the structural damage represents the consequence
and end state of years of poorly controlled epilepsy.
However, while waiting for the results of follow-up
studies, a cross-sectional study design still provides
another informative approach (Sutula and Hermann,
1999).
Quantitative MRI
The principal role of MRI is in the definition of
structural abnormalities that underlie seizure disor-
ders (see review, Duncan, 1997). While marked dam-
age in the structures of the medial temporal lobe is
reliably identified with quantitative MRI (Jack et al.,
1990; Bronen et al., 1991; Watson et al., 1992; Cen-
des et al., 1993a; Insausti et al., 1998), subtle forms
of cell loss may remain below the detection threshold
of current MRI volumetric measurement techniques.
In the present series of studies, the boundaries of the
hippocampus, amygdala, and entorhinal and perirhi-
nal cortices were outlined on successive coronal MR
images. The volumes for each cortical area were
then calculated using an in-house program. How-
ever, neuronal loss can be restricted focally along
the rostrocaudal axis of the hippocampus (Jackson
et al., 1994; Kuzniecky et al., 1996) or in a specific
nucleus of the amygdala (Pitkanen et al., 1998), or in
a specific cortical layer ( D u e t al., 1995; Mikkonen
et al., 1998). Therefore, we cannot exclude the possi-
bility that the imaging technique used in the studies
was not sensitive enough to detect a subfield-specific
damage in the structures of interest.
Another relevant factor is that the 2-SD limit
from the mean of the controls, used in the studies
as the limit of abnormality, may exclude patients
with mild pathologic changes in the medial temporal
lobe structures (Quigg et al., 1997). Hippocampal
sclerosis defined by marked atrophy and T2 time
prolongation in MRI is likely to represent the end
of the continuum of various degrees of structural
damage, not an absolute cut-off point to distinguish
abnormal from normal hippocampus.
Initial insult predicting medial temporal lobe
damage
Complex febrile convulsions
There was a 16-fold increased risk of hippocampal
and a 12-fold increased risk of amygdaloid volume
reduction in all TLE patients with a history of com-
plex febrile convulsions compared with those who
did not have complex febrile convulsions in their
medical history (III). Several previous MRI stud-
ies have reported a correlation between childhood
febrile seizures and hippocampal damage (Kuks et
al., 1993; Harvey et al., 1995; Barr et al., 1997;
Bronen et al., 1991; Theodore et al., 1999). Cen-
des et al. (1993b) demonstrated that in addition to
the atrophy in the hippocampus, prolonged febrile
convulsions also correlate with a decreased amyg-
dala volume. Perhaps the most convincing evidence
linking complex febrile seizures and hippocampal at-
rophy comes from a follow-up study of VanLanding-
ham et al. (1998), who reported acute hippocampal
injury evolving to hippocampal atrophy after com-
plex febrile convulsions. Together, the data provided
support for the hypothesis that a history of complex
febrile convulsions constitute a significant etiologic
factor in TLE.
Intracranial infection
Besides complex febrile convulsions, intracranial in-
fection was an initial insult that predicted amyg-
daloid volume reduction in TLE patients (Salmen-
peril et al., 2001). The patients who had suffered
from intracranial infection had a 14-fold risk of
amygdaloid atrophy compared with those who had
not had intracranial infection. Previously, herpes
simplex encephalitis has been reported to cause

widespread damage to various brain areas, including
both the amygdala and the hippocampus (Kapur et
al., 1994). In contrast to the unilateral hippocampal
volume loss found in TLE patients with a history of
febrile convulsions, the damage may be bilateral in
patients with a history of encephalitis or meningitis
(Free et al., 1996).
Age at the onset of initial insult
The data obtained in the study by Salmenper~i et al.,
2001 demonstrated that all TLE patients who were
5 years old or younger at the onset of first sponta-
neous seizure were more likely to have hippocampal
volume reduction than those who were older than
5 years at the onset of seizures. Moreover, the re-
evaluation of the raw data in the study by K~lvi~iinen
et al., 1998, taking into account the age at onset of
seizure disorder, showed that the early onset of TLE
was one of the determinants for the development of
hippocampal damage in chronic TLE (K~ilvi~iinen et
al., 1999). Our findings are in line with those in
previous data recognizing hippocampal sclerosis and
young age of seizure onset as common features of
the syndrome of mesial temporal lobe epilepsy (En-
gel, 1996). Duncan and Sagar (1987) showed that
surgically treated TLE patients with Ammon's horn
sclerosis had their first convulsion at the mean age
of 2.2 years and first partial seizure at the mean age
of 5.5 years. More recently, correlative analyses in
MRI studies have demonstrated a significant asso-
ciation between hippocampal damage and the early
onset of seizures (Trenerry et al., 1993; Lehericy et
al., 1997; Van Paesschen et al., 1997a). In a quali-
tative MRI study, patients with a normal hippocam-
pus had an older age of seizure onset than patients
with hippocampal damage (Lehericy et al., 1997).
Confirming the visually assessed results, Van Paess-
chen et al. (1997a) reported that intractable TLE
patients with hippocampal atrophy were significantly
younger at the onset of epilepsy than patients with
normal hippocampal MRI measures. Based on the
previous data, it has been suggested that childhood-
onset and adult-onset TLE may be different entities,
each with a different course of disease. Since both
groups were included in the present studies, one
can debate the question of whether those patients
with more severe hippocampal sclerosis had refrac-
291
tory epilepsy initially (Semah et al., 1998). Due to
the limited number of patients with seizure onset
<5 years of age (n = 25) in the present studies,
we could not examine hippocampal volumes of pa-
tient groups with childhood onset and adult onset
TLE separately. The patients with early onset of
seizure disorder in our population mostly had normal
neurological development apart from their seizure
disorder. Logistic regression analysis did show, in a
subgroup of patients with seizure onset >5 years of
age, that complex febrile convulsions and high life-
time seizure number remained as predictive factors
for hippocampal volume reduction.
A corresponding association with structural dam-
age and early onset of epilepsy was not observed
in the amygdala (Salmenper~i et al., 2001). Inter-
estingly, a previous histological study by Miller et
al. (1994) reported that patients with isolated amyg-
daloid sclerosis did not have a clinical history of
seizures in early childhood, suggesting a different
pathogenesis of damage.
Recurrent seizures
Hippocampal and amygdaloid damage at the onset
of epilepsy
Our data indicate that structural damage in TLE at
the time of the first spontaneous seizures is mild
(Salmenper~i et al., 2001). Only 5% of patients
with _<1 year of TLE had a unilateral hippocam-
pal or amygdaloid volume reduction of >_2 SD.
Furthermore, there was no detectable reduction in
the mean hippocampal or amygdaloid volumes. Cor-
respondingly, no damage was observed in the mean
hippocampal volumes when newly diagnosed cryp-
togenic TLE patients were compared with controls
(K~ilvi~iinen et al., 1998). Moreover, in newly diag-
nosed TLE patients, the mean volume of the amyg-
dala did not differ from that in controls (K~ilvi~inen
et al., 1997b). Van Paesschen et al. (1997c) found
hippocampal sclerosis in 10% of newly diagnosed
partial epilepsy patients referred to neurology clin-
ics. Their findings are comparable with the present
data, considering that the Department of Neurology
in Kuopio University Hospital serves as a primary
site of treatment for all patients with newly diag-
nosed seizure disorder in the district.
292
Hippocampal damage in chronic TLE patients
No detectable hippocampal volume reduction was
found in cryptogenic chronic well-controlled TLE
patients, compared with controls (K~ilvi~iinen et al.,
1998). However, chronic drug-resistant patients had
approximately a 16% reduction in the hippocampal
volume ipsilaterally.
Correspondingly, when controls and patients with
different durations of TLE were compared, the mean
right hippocampal volume was significantly reduced
in patients with >21 years of right TLE (Salmenper~i
et al., 2001). We could not statistically show differ-
ences in the mean volume of the left hippocampus
in left TLE patients over years. However, there was
a clear trend towards a smaller left hippocampus in
patients with >21 years of left TLE.
The findings are consistent with the time course
of the increased neuron losses described in the
histopathological studies of both Mouritzen Dam
(1980) and Mathern et al. (1995). Mouritzen Dam
(1980) reported that patients with seizure histories
longer that 30 years and/or increased frequency of
generalized seizures showed greater neuron losses
in all regions of the hippocampus. Mathern et al.
(1995) indicated that after 22 years of epilepsy,
all patients with drug-refractory TLE had at least
a 60% loss of CA1 pyramidal cells. Accordingly,
in the present series of patients (Salmenper~i et al.,
2001), the longer the duration of TLE with fre-
quent seizures, the higher the number of patients
with hippocampal damage. The data also agree with
those of a recent MRI study showing that ipsilateral
hippocampal atrophy was related to the duration of
TLE in patients with uncontrolled complex partial
seizures (Theodore et al., 1999).
When patients with >21 years of TLE were di-
vided into subgroups according to seizure frequency,
the hippocampal volume reduction was apparent
only in the patient subgroups with frequent seizures
(Salmenper~i et al., 2001). Logistic regression analy-
sis did not show any gender differences as predictive
factors for hippocampal volume reduction, although
one recent study has suggested that men are partic-
ularly vulnerable to seizure-associated brain damage
(Briellmann et al., 2000).
Correlation analyses showed that the more
seizures the cryptogenic TLE patient had experi-
enced, the more severe the volume reduction in the
hippocampus (K~ilvi~iinenet al., 1998). Similarly, in
all TLE patients, both cryptogenic and symptomatic,
hippocampal volume on the focal side correlated
inversely with the total number of partial and gen-
eralized seizures (Salmenper~i et al., 2001). In line
with these results, Tasch et al. (1999) reported that
TLE patients with frequent generalized seizures had
reduced N-acetylaspartate (a putative MRI spectro-
scopic measure of neuronal number) levels bilat-
erally in temporal lobes and smaller hippocampal
volumes ipsilaterally than patients with no or rare
seizures. Convincing evidence is also provided by
recent longitudinal MRI studies which have reported
hippocampal changes occurring during follow-up of
both newly diagnosed and intractable partial epilepsy
patients (Van Paesschen et al., 1998; O'Brien et al.,
1999). These histologic and neuroimaging studies,
together with our current data, suggest that hip-
pocampal damage may be progressive in some pa-
tients with epilepsy.
Amygdaloid damage in chronic TLE patients
The mean amygdaloid volume did not significantly
differ from control values in patients with chronic
TLE (K~ilvi~iinen et al., 1997b), nor did the damage
in the amygdala differ between patient groups with
different durations of partial epilepsy or frequency
of seizures (Salmenper~i et al., 2001). In all TLE
patients, the volume of the right amygdala correlated
with the number of generalized seizures (Salmenper~i
et al., 2001). However, there was no correlation be-
tween left amygdaloid volume on the left or right
amygdala and the seizure number (Salmenper~i et
al., 2001). Approximately 20% of the chronic TLE
patients had at least 20% volume reduction in the
amygdala (K~ilvi~inen et al., 1997b). Furthermore,
amygdaloid volume reduction was observed in 10%
of patients with >21 years of TLE, which is in
accordance with previous MRI studies (Cendes et
al., 1993a,c). These results raise the question of
whether the mechanism underlying the development
of neuronal damage in the amygdala of TLE pa-
tients differs from that in the hippocampus (Hudson
et al., 1993; Miller et al., 1994). According to the
neuropathologic literature, the pathology of epilepto-
genic lesions of the amygdala may consist of a wider

variety of lesions than in the hippocampus (Falconer
and Cavanagh, 1959; Bruton, 1988). While sclerosis
is the predominant feature of damaged hippocam-
pus, small tumors, cortical dysplasia and vascular
anomalies may occur in the amygdala (Falconer and
Cavanagh, 1959; Bruton, 1988).
Conclusions
High lifetime seizure number, complex febrile con-
vulsions in the medical history and early age at
the onset of spontaneous seizures contribute to hip-
pocampal damage in patients with TLE. The risk
factors that predict amygdaloid volume reduction are
intracranial infection and complex febrile seizures.
Hippocampal damage is apparent in chronic TLE
patients with years of frequent seizures, but not in
patients with rare seizures. In TLE patients, ipsilat-
eral hippocampal volume correlates negatively with
the lifetime seizure number.
The findings of the present series of studies sup-
port the idea that damage in the medial temporal
lobe structures may be both the cause and conse-
quence of TLE. The data provide evidence that, in
some patients, hippocampal disease may progress as
a function of repeated seizures. In the future, lon-
gitudinal studies are likely to be more thorough in
fully exploring the effects of age of onset, repeated
seizures, and duration of seizures. Already there are
ongoing prospective MRI studies on newly diag-
nosed patients with epilepsy, which will hopefully
gain further insights on the development of damage
in TLE (K~ilvi~iinen et al., 1997a; Van Paesschen et
al., 1998).
However, our findings suggest that it may be
decades before prospective long-term brain imaging
studies reveal the causes of a decline in brain struc-
tures of patients with intractable TLE. Meanwhile,
the accumulating evidence of the deleterious effects
of persistent seizures argue for efficient drug therapy
or early surgery to reach complete seizure control,
Future research should address strategies for disease-
modifying therapies and ultimately remission of the
epileptic process.
293
References
Barr, W.B., Ashtari, M. and Schaul, N. (1997) Bilateral reduc-
tions in hippocampal volume in adults with epilepsy and a
history of febrile seizures. J. Neurol. Neurosurg. Psychiatry,
63: 461-467.
Bernasconi, N., Bernasconi, A., Andermann, E, Dubeau, F.,
Feindel, W. and Reutens, D.C. (1999) Entorhinal cortex in
temporal lobe epilepsy. A quantitative MRI study. Neurology,
52: 1870-1876.
Bigler, E~D., Blatter, D.D., Anderson, C.V., Johnson, S.C., Gale,
S.D., Hopkins, R.O. and Burnett, B. (1997) Hippocampal
volume in normal aging and traumatic head injury. Am. J.
Neuroradiol., 18: 11-23.
Briellmann, R.S., Berkovic, S.E and Jackson, G.D. (2000) Men
may be more vulnerable to seizure associated brain damage.
Neurology, 55: 1479-1485.
Bronen, R.A., Cheung, G., Charles, J.T., Kim, J.H., Spencer,
D.D., Spencer, S.S., Sze, G. and McCarthy, G. (1991) Imaging
findings in hippocampal sclerosis: correlation with pathology.
Am. J. Neuroradiol., t2: 933-940.
Bruton, C.J. (1988) The Neuropathology of Temporal Lobe
Epilepsy. Institute of Psychiatry, Maudsley monographs, 31,
Oxford University Press, New York.
Cavanagh, J.B. and Meyer, A. (1956) Aetiological aspects
of Ammon's horn sclerosis associated with temporal lobe
epilepsy. B~: Med. J., 2: 1403-1407.
Cavazos, J.E., Das, 1. and Sutula, T.R (1994) Neuronal loss
induced in limbic pathways by kindling: evidence for induc-
tion of hippocampal sclerosis by repeated brief seizures, J.
Neurosci., 14: 3106-3121.
Cendes, E, Andermann, E, Dubeau, F., Gloor, R, Evans, A.,
Jones-Gotman, M., Olivier, A., Andermann, E., Robitaille, Y.,
Lopes-Cendes, I., Peters, T. and Melanson, D. (1993a) Early
childhood prolonged febrile convulsions, atrophy and sclerosis
of mesial structures, and temporal lobe epilepsy: an MRI
volumetric study. Neurology, 43:1083-1087.
Cendes, E, Andermann, F., Gloor, R, Evans, A., Jones-Gotman,
M., Watson, C., Melanson, D., Olivier, A., Peters, T., Lopes-
Cendes, I. and Leroux, G. (1993b) MR1 volumetric mea-
surements of amygdala and hippocampus in temporal lobe
epilepsy. Neurology, 43: 719-725.
Cendes, F., Andermann, E, Gloor, R, Lopes-Cendes, 1., Ander-
mann, E., Melanson, D., Jones-Gotman, M., Robitaille, Y.,
Evans, A. and Peters, T. (1993c) Atrophy of mesial structures
in patients with temporal lobe epilepsy: cause or consequence
of repeated seizures. Ann. Neurol., 34: 795-801.
Cendes, E, Leproux, F., Melanson, D., Ethier, R., Evans, A.,
Peters, T. and Andermann, E (1993d) MRI of amygdala and
hippocampus in temporal lobe epilepsy. J. Comput. Assisted
Tomogr., 17: 206-210.
Cendes, E, Andermann, E, Gloor, R, Gambardella, A., Lopes-
Cendes, I., Watson, C., Evans, A., Carpenter, S. and Olivier,
A. (1994) Relationship between atrophy of the amygdala and
ictal fear in temporal lobe epilepsy. Brain, 117: 739-746.
Du, F., Eid, T., Lothman, E.W., Krhler, C. and Schwarcz, R.
(1995) Preferential neuronal loss in layer II1 of the medial
294
entorhinal cortex in rat models of temporal lobe epilepsy. J.
Neurosci., 10: 6301-6313.
Duncan, J.S. (1997) Imaging and epilepsy. Invited Review. Brain,
120: 339-377.
Duncan, J.S. and Sagar, H.J. (1987) Seizure characteristics,
pathology and outcome after temporal lobectomy. Neurology,
37: 405-409.
Engel Jr., J. (1996) Introduction to temporal lobe epilepsy.
Epilepsy Res., 26: 141-150.
Falconer, M.A. and Cavanagh, J.B. (1959) Clinico-pathological
considerations of temporal lobe epilepsy due to small focal
lesions. Brain, 82: 483-503.
Falconer, M.A., Serafetinides, E.A. and Corsellis, J.A.N. (1964)
Etiology and pathogenesis of temporal lobe epilepsy. Arch.
NeuroL, 10: 233-248.
Fernandez, G., Effenberger, O., Vinz, B., Steinlein, O., Elger,
C.E., Drhring, W. and Heinze, H.J. (1998) Hippocampal
malformation as a cause of familial febrile convulsions and
subsequent hippocampal sclerosis. Neurology, 50: 909-917.
Free, S.L., Li, L.M., Fish, D.R., Shorvon, S.D. and Stevens, J.M.
(1996) Bilateral hippocampal volume loss in patients with a
history of encephalitis or meningitis. Epilepsia, 37: 400-405.
Gowers, W.R. (1881) Epilepsy and Other Chronic Convulsive
Disorders; Their Cases, Symptoms and Treatment. William
Wood, New York, 225.
Grnnewald, R.A., Jackson, G.D., Connelly, A. and Duncan, J.S.
(1994) MR detection of hippocampal disease in epilepsy:
factors influencing T2 relaxation time. Am. J. Neuroradiol.,
15: 1149-1156.
Harvey, A.S., Grattan-Smith, J.D., Desmond, P.M., Chow, C.W.
and Berkovic, S.E (1995) Febrile seizures and hippocampal
sclerosis: frequent and related findings in intractable temporal
lobe epilepsy of childhood. Pediatr. Neurol., 12: 201-206.
Harvey, A.S., Berkovic, S.E, Wrennall, J.A. and Hopkins, I.J.
(1997) Temporal lobe epilepsy in childhood: clinical, EEG,
and neuroimaging findings and syndrome classification in a
cohort with new-onset seizures. Neurology, 49: 960-968.
Hauser, W.A. and Hesdorffer, D.C. (200l) Epidemiology of in-
tractable epilepsy. In: H.O. Luders and Y.G. Comair (Eds.),
Epilepsy Surgery. Lippincott, Williams and Wilkins, Philadel-
phia, PA, pp. 55-61.
Hudson, L.P., Munoz, D.G., Miller, L., McLachlan, R.S., Girvin,
J.P. and Blume, W.T. (1993) Amygdaloid sclerosis in temporal
lobe epilepsy. Ann. NeuroL, 33: 622-631.
Insausti, R., Juottonen, K., Soininen, H., Insausti, A.M., Parta-
nen, K., Vainio, E, Laakso, M.P. and Pitkanen, A. (1998) MRI-
based volumetric analyses of the human entorhinal, perirhinal
and temporopolar cortices. Am. J. Neuroradiol., 19: 659-671.
Jack Jr., C.R., Sharbrough, EW., Twomey, C.K., Cascino, G.D.,
Hirschorn, K.A., Marsh, W.R., Zinsmeister, A.R. and Schei-
thauer, B. (1990) Temporal lobe seizures: lateralization with
MR volume measurements of the hippocampal formation. Ra-
diology, 175: 423-429.
Jackson, G.D., Kuzniecky, R.I. and Cascino, G.D. (1994) Hip-
pocampal sclerosis without detectable hippocampal atrophy.
Neurology, 44: 42-46.
Jokeit, H., Ebner, A., Arnold, S., Schuller, M., Antke, C., Huang,
Y., Steinmetz, H., Seitz, R.J. and Witte, O.W. (1999) Bilateral
reductions of hippocampal volume, glucose metabolism, and
WADA hemispheric memory performance are related to the
duration of mesial temporal lobe epilepsy. J. Neurol., 246:
926-933.
Kapur, N., Barker, S., Burrows, E.H., Ellison, D., Brice, J.,
Illis, L.S., Scholey, K., Colbourn, C., Wilson, B. and Loates,
M. (1994) Herpes simplex encephalitis: long term magnetic
resonance imaging and neuropsychological profile. J. NeuroL
Neurosurg. Psychiatry, 57: 1334-1342.
Kuks, J.B., Cook, M.J., Fish, D.R., Stevens, J.M. and Shorvon,
S.D. (1993) Hippocampal sclerosis in epilepsy and childhood
febrile seizures. Lancet, 342: 1391-1394.
Kuzniecky, R.I., Burgard, S., Bilir, E., Morawetz, R., Gilliam,
F., Faught, E., Black, L. and Palmer, C. (1996) Qualitative
MRI segmentation in mesial temporal sclerosis: clinical corre-
lations. Epilepsia, 37: 433-439.
K~ilvi~iinen, R., Aiki~i, M., Partanen, K., SalmenperL T., Vainio,
P. and Pitk~inen, A. (1997a) Hippocampal damage correlates
with poor memory performance but not with early prognosis of
newly diagnosed patients with epilepsy. Epilepsia, 38(Suppl.
8): S144-S 145.
K~ilvi~iinen, R., Salmenpera, T., Partanen, K., Vainio, P., Riekki-
hen Sr., P. and Pitkiinen, A. (1997b) MRI volumetry and T2
relaxometry of the amygdala in newly diagnosed and chronic
temporal lobe epilepsy. Epilepsy Res., 28: 39-50.
K~ilvi~iinen, R., Salmenper~i, T., Partanen, K., Vainio, P., Riekki-
nen St., P. and Pitk~inen, A. (1998) Recurrent seizures may
cause hippocampal damage in temporal lobe epilepsy. Neurol-
ogy, 50: 1377-1382.
K~ilvi~iinen, R., Salmenper~i, T., Partanen, K., Vainio, P., Riekki-
nen Sr., P. and Pitk~inen, A. (1999) Hippocampal damage and
the onset of epilepsy. Neurology, 52: 1717.
Lehericy, S., Semah, E, Hasboun, D., Dormont, D., Clemenceau,
S., Granat, O., Marsault, C. and Baulac, M. (1997) Temporal
lobe epilepsy with varying severity: MRI study of 222 patients.
Neuroradiology, 39: 788-796.
Margerison, J.H. and Corsellis, J.A.N. (1966) Epilepsy and the
temporal lobes. A clinical, electroencephalographic and neu-
ropathological study of the brain in epilepsy, with particular
reference to the temporal lobes. Brain, 89: 499-530.
Marsh, L., Morrell, M.J., Shear, P.K., Sullivan, E.V., Freeman,
H., Marie, A., Lim, K.O. and Pfefferbaum, A. (1997) Cortical
and hippocampal volume deficits in temporal lobe epilepsy.
Epilepsia, 38: 576-587.
Mathern, G.W., Babb, T.L., Vickrey, B.G., Melendez, M. and
Pretorius, J.K. (1995) The clinical-pathogenic mechanisms of
hippocampal neuron loss and surgical outcomes in temporal
lobe epilepsy. Brain, 118:105-118.
Mikkonen, M., Soininen, H., Kalviainen, R., Tapiola, T., Yli-
nen, A., Vapalahti, M., Paljarvi, L. and Pitk~inen, A. (1998)
Remodeling of neuronal circuitries in human temporal lobe
epilepsy: increased expression of highly polysialylated neural
cell adhesion molecule in the hippocampus and the entorhinal
cortex. Ann. NeuroL, 44: 923-934.
Miller, L.A., McLachlan, R.S., Bouwer, M.S., Hudson, L.P. and
Munoz, D.G. (1994) Amygdalar sclerosis: preoperative in-

dicators and outcome after temporal lobectomy. J. Neurol.
Neurosurg. Psychiatry, 57:1099-1105.
Mouritzen Dam, A. (1980) Epilepsy and neuron loss in the
hippocampus. Epilepsia, 2l: 617-629.
Nohria, V., Lee, N., Tien, R.D., Heinz, E.R., Smith, J.S., De-
Long, G.R., Skeen, M.B., Resnick, T.J., Crain, B. and Lewis,
D.V. (1994) Magnetic resonance imaging evidence of hip-
pocampal sclerosis in progression: a case report. Epilepsia,
35: 1332-1336.
O'Brien, T.J., So, E.L., Meyer, F.B., Parisi, J.E. and Jack, C.R.
(1999) Progressive hippocampal atrophy in chronic intractable
temporal lobe epilepsy. Ann. Neurol., 45: 526-529.
Pitk~inen, A., Tuunanen, J., K~ilviainen, R., Partanen, K. and
Salmenper~i, T. (1998) Amygdala damage in experimental and
human temporal lobe epilepsy. Epilepsy Res., 32: 233-253.
Quigg, M., Bertram, E.H. and Jackson, T. (1997) Longitudinal
distribution of hippocampal atrophy in mesial temporal lobe
epilepsy. Epilepsy Res., 27:101-110.
Salmenper~i, T., Kfilvi~iinen, R., Partanen, K. and Pitk~inen, A.
(1999) Quantitative MRI volumetry of the entorhinal cortex in
temporal lobe epilepsy. Seizure, 9: 208-215.
Salmenper~i, T., K~ilvi~iinen, R., Partanen, K. and Pitk~inen,
A. (2001) Hippocampal and amygdaloid damage in par-
tial epilepsy: A cross-sectional MRI study of 241 patients.
Epilepsy Res., 46: 69-82.
Saukkonen, A., K~lvi~iinen, R., Partanen, K., Vainio, P., Riekki-
nen, P. and Pitk~inen, A. (1994) Do seizures cause neuronal
damage? A MRI study in newly diagnosed and chronic
epilepsy. NeuroReport, 6: 219-223.
Semah, F., Picot, M.C., Adam, C., Broglin, D., Arzimanoglou,
A., Bazin, B., Cavalcanti, D. and Baulac, A. (1998) Is the
underlying cause of epilepsy a major prognostic factor for
recurrence?. Neurology, 51 : 1256-1262.
Sloviter, R.S. (1983) 'Epileptic' brain damage in rats induced by
sustained electrical stimulation of the perforant path. I. Acute
electrophysiological and light microscopic studies. Brain Res.
Bull., 10: 675-697.
Soininen, H., Partanen, K., Pitkanen, A., Vainio, P., H~inninen, T.,
Hallikainen, M., Koivisto, K. and Riekkinen Sr., P. (1994) Vol-
umetric MRI analysis of the amygdala and the hippocampus in
subjects with age-associated memory impairment. Neurology,
44: 1660-1668.
Spencer, S.S., McCarthy, G. and Spencer, D.D. (1993) Diagnosis
of medial temporal lobe seizure onset: relative specificity and
sensitivity of quantitative MRI. Neurology, 43:2117-2124.
Sutula, T.P. and Hermann, B. (1999) Progression in mesial tem-
poral lobe epilepsy. Ann. Neurol., 45: 553-556.
Tasch, E., Cendes, E, Li, L.M., Dubeau, F., Andermann, F. and
Arnold, D.L. (1999) Neuroimaging evidence of progressive
neuronal loss and dysfunction in temporal lobe epilepsy. Ann.
Neurol., 45: 568-576.
Theodore, W.H., Bhatia, S., Hatta, J., Fazilat, S., DeCarli, C.,
295
Bookheimer, S.Y. and Gaillard, W.D. (1999) Hippocampal
atrophy, epilepsy duration, and febrile seizures in patients with
partial seizures. Neurology, 52: 132-136.
Tien, R.D. and Felsberg, G.J. (1995) The hippocampus in status
epilepticus: demonstration of signal intensity and morphologic
changes with sequential fast spin-echo MR imaging. Radiol-
ogy, 194: 249-256.
Trenerry, M.R., Jack Jr., C.R., Sharbrough, F.W., Cascino, G.D.,
Hirschorn, K.A., Marsh, W.R., Kelly, P.J. and Meyer, F.B.
(1993) Quantitative MRI hippocampal volumes: association
with onset and duration of epilepsy, and febrile convulsions in
temporal lobectomy patients. Epilepsy Res., 15: 247-252.
VanLandingham, K.E., Heinz, E.R., Cavazos, J.E. and Lewis,
D.V. (1998) Magnetic resonance imaging evidence of hip-
pocampal injury after prolonged focal febrile convulsions.
Ann. Neurol., 43: 413-426.
Van Paesschen, W., Connelly, A., Johnson, C.L. and Duncan, J.S.
(1996) The amygdala and intractable temporal lobe epilepsy:
a quantitative magnetic resonance imaging study. Neurology,
47: 1021-1031.
Van Paesschen, W., Connelly, A., King, M.D., Jackson, G.D. and
Duncan, J.S. (1997a) The spectrum of hippocampal sclerosis:
a quantitative magnetic resonance imaging study. Ann. Neurol.,
41: 41-51.
Van Paesschen, W., Duncan, J.S., Stevens, J.M. and Connelly,
A. (1997b) Etiology and early prognosis of newly diagnosed
partial seizures in adults: a quantitative hippocampal MRI
study. Neurology, 49: 753-757.
Van Paesschen, W., Revesz, T., Duncan, J.S., King, M.D. and
Connelly, A. (1997c) Quantitative neuropathology and quan-
titative magnetic resonance imaging of the hippocampus in
temporal lobe epilepsy. Ann. Neurol., 42: 756-766.
Van Paesschen, W., Duncan, J.S., Stevens, J.M. and Connelly, A.
(1998) Longitudinal quantitative hippocampal magnetic reso-
nance imaging study of adults with newly diagnosed partial
seizures: one-year follow-up results. Epilepsia, 39: 633-639.
Watson, C., Andermann, F., Gloor, P., Jones-Gotman, M., Pe-
ters, T., Evans, A., Olivier, A., Melanson, D. and Leroux, G.
(1992) Anatomic basis of amygdaloid and hippocampal vol-
ume measurement by magnetic resonance imaging. Neurology,
42: 1743-1750.
Wieser, H.G., Engel, J. Jr., Williamson, P.D., Babb, T.L. and
Gloor, P. (1993) Surgically remediable temporal lobe syn-
dromes. In: J. Engel Jr. (Ed.), Surgical Treatment of the
Epilepsies. Raven Press, New York, pp. 49-63.
Wieshmann, U.C., Woermann, F.G., Lernieux, L., Free, S.L.,
Bartlett, P.A., Smith, SJ.M., Duncan, J.S., Stevens, J.M. and
Shorvon, S.D. (1997) Development of hippocampal atrophy:
a serial magnetic resonance imaging study in a patient who
developed epilepsy after generalized status epilepticus. Epilep-
sia, 38: 1238-1241.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 25

Proton magnetic resonance spectroscopic imaging suggests

progressive neuronal damage in human
temporal lobe epilepsy

A. Bernasconi *, E. Tasch, E Cendes, L.M. Li and D.L. Arnold

Montreal Neurological Hospital and Institute, Department of Neurology McGill University, Montreal, PQ, H3A 2B4, Canada

Abstract: Whether temporal lobe epilepsy (TLE) is the result of an isolated, early injury or whether there is ongoing
neuronal damage due to seizures is often debated. We attempted to examine the long-term effect of seizures using proton
magnetic resonance spectroscopic imaging (~H-MRSI), which can quantify neuronal loss or dysfunction based on reduced
signals from the neuronal marker N-acetylaspartate (NAA). We performed 1H-MRSI in 82 consecutive patients with
medically intractable, non-foreign-tissue TLE to determine whether there was a correlation between seizure frequency,
type or duration of epilepsy and NAA to creatine ratios (NAA/Cr). Spectroscopic resonance intensities were categorized
as to whether they were measured from the temporal lobe ipsilateral or contralateral to the predominant EEG focus.
Ipsilateral and contralateral NAA/Cr was negatively correlated with duration of epilepsy. Furthermore, patients with
frequent generalized tonic-clonic seizures had lower NAA/Cr than patients with no or rare generalized tonic-clonic
seizures. The results suggest that although an early injury may cause asymmetric temporal lobe damage that is present at
the onset of epilepsy, generalized seizures may induce additional neuronal damage that progresses over the course of the
disease.

Temporal lobe epilepsy: static or progressive
disease?
Hippocampal sclerosis is a c o m m o n pathological
finding associated with temporal lobe epilepsy (TLE)
as demonstrated at autopsy (Margerison and Corsel-
lis, 1966; Meencke and Veith, 1991) and in tissue
resected during surgery (Meyer et al., 1954; Babb
and Brown, 1987; Gloor, 1991). The etiology and
pathogenesis of hippocampal sclerosis remain poorly
understood. TLE appears to evolve from an initial
* Correspondence to: A. Bernasconi, Epilepsy Clinic and
Brain Imaging Center, Montreal Neurological Institute
and Hospital, 3801 University, Montreal PQ, H3A 2B4,
Canada. Tel.: +1-514-398-8524; Fax: +1-514-398-2975;
E-mail: andrea @bic.mni.mcgill.ca
precipitating injury, perhaps severe febrile seizures
during childhood, which occurs many years before
the onset of chronic epilepsy. However, it is often de-
bated whether TLE is the result of an isolated early
injury or whether there is ongoing neuronal damage
due to recurrent seizures.
Animal models have shown progressive neuronal
loss associated with repetitive kindled generalized
seizures in rats (Cavazos et al., 1994). However,
the relevance of seizures induced by direct elec-
trical stimulation of the perforant pathway to the
habitual complex partial seizures of human TLE
is not clear. On the other hand, using the pilo-
carpine model of epilepsy in the rat, a model of
spontaneous recurrent seizures which follow a pe-
riod of status epilepticus, Liu et al. (1994) were
unable to show any additional neuronal loss with
repeated seizures, concluding that all variation in
298
the degree of neuronal loss could be accounted for
by the severity of the initial status epilepticus. Us-
ing human autopsy material, Mouritzen Dam (1980)
demonstrated that frequent generalized tonic-clonic
seizures (>2 seizures per month) were positively
correlated with significant reductions in the number
of hippocampal neurons when compared with pa-
tients who had suffered only a few such seizures
(<6 per year). On the other hand, several retro-
spective neuropathological reviews have provided
evidence to the contrary. Studying autopsy material
of 650 brains, Meencke and Veith (1991) found no
difference in the incidence of hippocampal sclero-
sis between patients who died before age 5 years
(36%) and patients who died after age 21 years
(40%). Examining surgical specimens of 122 TLE
patients who had temporal lobectomy for intractable
seizures, Davies et al. (1996) found no correla-
tion between moderate/marked hippocampal scle-
rosis and duration of epilepsy. Mathern et al. (1995)
examined surgical specimens of 162 TLE patients
and found that patients with initial precipitating in-
juries, such as birth injury, cerebral trauma, hypoxia,
encephalitis-meningitis, prolonged seizures-status,
non-prolonged seizures) had more severe hippocam-
pal sclerosis. Furthermore, hippocampal cell loss was
greater in patients who had TLE for more than 22
years. Based on these findings, they suggested that
hippocampal sclerosis is caused by an initial injury,
but additional neuronal loss is associated with a long
history of TLE.
MR-spectroscopy: monitoring neuronal and
axonal integrity in vivo
Unlike conventional MRI, which provides structural
information based on signals from water protons,
proton magnetic resonance spectroscopic imaging
(1H-MRSI) provides information about the chemi-
cal composition of the brain. However, because of
the tremendous difference in the relative concentra-
tions of metabolites and water (--~1/ 10,000), before
recording signals from the brain metabolites, the wa-
ter signal has to be removed. MR spectra are then
presented as a Fourier transform with signal ampli-
tude plotted against frequency and display several
resonances that are assigned to specific metabo-
lites. I H-MRSI spectra as acquired from studying
TLE are characterized by three major peaks: N-
acetylaspartate (NAA), creatine (Cr) and choline.
Using specific antibodies, it has been demon-
strated that NAA is localized exclusively in neurons
and their projections throughout the central nervous
system (Moffett et al., 1991; Simmons et al., 1991;
Urenjak et al., 1993). Therefore, NAA is used as a
putative neuronal marker, and a reduction in NAA
levels as assessed by 1H-MRSI has been a useful
tool for quantifying neuronal and axonal integrity in
vivo. Examining the hippocampal CA1 after global
ischemia and reperfusion in gerbils, Nakano et al.
(1998) found a linear correlation between NAA and
neuronal density indicating that NAA can be used as
an index of neuronal survival.
The NAA/Cr resonance intensity ratio increases
rapidly after birth and approaches mature levels by
3 years of age, after which NAA/Cr increases less
than 1% per year until reaching adult levels at age
15-20 years (Kreis et al., 1993). In clinical exper-
iments, it is convenient to quantify NAA in vivo
in relation to Cr, which is relatively homogeneously
distributed throughout the brain and is not signifi-
cantly influenced by the epileptic state (Petroff et al.,
1995).
NAA as a measure of neuronal loss and metabolic
dysfunction
Because NAA is measured in a voxel, e.g. a unit of
volume, reduction in NAA is probably due to a de-
creased density of neurons related either to neuronal
loss, neuronal shrinkage or increase in water or other
cells. Although one might assume that reduction in
NAA/Cr density observed in TLE results from Wal-
lerian degeneration of the neurons lost within the
hippocampus, the extent of the abnormality, which
also involves the temporal lobe white matter, is too
great to be explained by this phenomenon alone.
There is increasing evidence from experimental
(Dautry et al., 2000; Demougeot et al., 2001) and
clinical data (De Stefano et al., 1995; Hugg et al.,
1996; Vermathen et al., 1997; Kalra et al., 1998)
indicating that NAA reduction is not only due to a
decrease in neuronal density, but also to neuronal
metabolic dysfunction. In baboons treated with the
mitochondrial toxin 3-nitropreopionate acid, Dautry
et al. (2000) demonstrated a significant decrease in

the striatal NAA concentration, which was paral-
leled by a reduction in immunoreactivity measured
by calbindin-D28K. After 4 weeks of withdrawal
from the toxin, these authors observed a recovery
of NAA as well as in immunoreactivity. In contrast,
immunohistology in the striatum showed no signifi-
cant changes in the neuronal density in sections im-
munolabeled for NeuN, a specific neuronal marker,
indicating no detectable cell loss. Examining 14 pa-
tients with intractable TLE before and after surgery,
Cendes et al. (1997) observed that postoperatively
NAA/Cr increased to the normal range ipsilateral
to the seizure focus in patients who became seizure
free. In contrast, NAA did not change in those who
continued having seizures after surgery. The same
pattern was observed on the contralateral side. These
results imply that NAA in TLE is, at least in part, a
dynamic marker of neuronal dysfunction associated
with ongoing seizures.
1H-MRSI in temporal lobe epilepsy
The most common application of MR spectroscopy
in epilepsy has been the non-invasive lateralization
of the epileptic focus. I H-MRSI reveals abnormally
low resonance intensities of NAA/Cr within the
temporal lobes of TLE patients (Hugg et al., 1993;
Cendes et al., 1994; Connelly et al., 1994; Gadian,
1995; Cendes et al., 1997). The abnormally low
NAA/Cr is not restricted to the hippocampus, but is
found diffusely within the ipsilateral and, in about
half the patients, within the contralateral temporal
lobe as well.
Previous studies have shown contradictory evi-
dence concerning the effect of repeated seizures on
neuronal function in TLE. Using 1H-MRS, Verma-
then et al. (1997) studied a group of patients with
extra-temporal neocortical epilepsy and showed that
hippocampal NAA/Cr was not reduced, in contrast
to patients with TLE. These authors argued that
seizures did not cause secondary hippocampal dam-
age. Garcia et al. (1997) found a negative correlation
between NAA and seizure frequency in patients with
both frontal and temporal lobe foci, but no corre-
lation with duration. On the other hand, Duc et al.
(1998) found a negative correlation between NAA
and duration of TLE.
299
Cross-sectional study in intractable TLE:
patients and methods
We studied 82 consecutive patients (36 males) with
medically refractory TLE who had no mass lesion
on high quality conventional MRI. Identification
of the type and localization of the seizures was
determined by comprehensive evaluation including
video-EEG telemetry for recording at least three
habitual seizures in all patients. Estimation of the
duration and frequency of seizures was based on
a review of medical records and seizure calendars,
and specific questioning of the patient and family
members. Age of onset of epilepsy was defined as
the age at which the patient developed habitual and
recurrent seizures. The duration, or number of years
of epilepsy, was defined as the interval between the
age of onset and the time of the examination. Pro-
longed febrile convulsions were defined as seizures
lasting 30 min or more. To confirm seizure onset in
the temporal lobe, 18 patients required investigation
with stereotaxically implanted depth electrodes.
Two-dimensional 1H-MRSI scans, were acquired
by using a standardized protocol described in de-
tail in previous publications (Cendes et al., 1997;
Tasch et al., 1999) in a region of interest including
both temporal lobes (Fig. 1). The values for NAA,
choline, Cr, and NAA/Cr were determined for each
temporal lobe by averaging 24-4-3 spectra in each
region. In TLE patients, the NAA/Cr intensity ratio
for each temporal lobe was calculated and classified
as either ipsilateral (NAA/Cr-ipsi) or contralateral
(NAA/Cr-contra) to the EEG focus. Patient average
NAA/Cr for each side were compared with values
obtained in 21 healthy normal controls (12 men and
9 women; mean age, 28.2 years; SD = 4.5). Values
less than two standard deviations below the normal
controls were considered abnormal.
We calculated partial Pearson correlation coeffi-
cients between NAA/Cr-ipsi, NAA/Cr-contra, and
the duration (while controlling for age at onset),
age at onset (while controlling for the duration of
epilepsy), and frequency of complex partial and
secondarily generalized seizures. Linear regression
analysis was used to illustrate the relationship be-
tween the spectroscopic measurements and the clin-
ical parameters. Student's t-test was used to test for
differences between group means.
300
Fig. 1. Tl-weighted MRI showing the location of the voxels
used for the two-dimensional MRSI. A spectrum is obtained
from each small box on the grid. Several voxels are chosen to
obtain an average spectrum from the temporal lobe ipsilateral
and contralateral to the EEG focus. The region of interest (black
lines) include part of the hippocampal head, the hippocampal
body and tail, and part of the posterior temporal lobe containing
hippocampal axonal projections to the temporal lobe neocortex.
TABLE 1
Characteristics of 82 patients with temporal lobe epilepsy
Mean (SD)
Age at examination (years) 35 (1 l)
Age at onset (years) 14 (12)
Complex partial seizures/month 23 (37)
Generalized seizures/year 12 (47)
Duration of epilepsy 20 (9)
Patient characteristics are summarized in Table 1.
In normal controls, the mean (standard deviation)
N A A / C r in the fight temporal lobe was 4.21 (0.24)
and 4.55 (0.23) in the left temporal lobe. In patients,
the mean N A A / C r for the ipsilateral temporal lobe
was 3.65 (0.35) and 4.05 (0.37) for the contralateral
temporal lobe.
In normal controls, N A A / C r values of the left and
right temporal lobes were not significantly differ-
ent, and there was no correlation between N A A / C r
and age. In TLE patients, there was no correlation
between age at onset and either NAA/Cr-ipsi or
NAA/Cr-contra.
NAA and duration of epilepsy are negatively
correlated
Linear regression analysis (Fig. 2) showed a sig-
nificant negative correlation between duration of
epilepsy and both NAA/Cr-ipsi (r = - 0 . 3 0 , P =
0.006) and NAA/Cr-contra (r = - 0 . 3 2 , P = 0.004).
The negative correlation between N A A and the
duration of epilepsy we found suggests that pro-
gressive neuronal dysfunction may occur in both
temporal lobes in patients with TLE, even when
seizures originate in only one temporal lobe. Be-
cause duration is a composite variable, consisting
of both age of onset and the age of the patient,
one might suspect that any change in that variable
might be due to the effect of the age of onset or the
increasing age. However, the relationship we found
with duration was robust even after controlling for
age of onset. Given the cross-sectional and longitu-
dinal design of this study, we could not statistically
control for the effects of aging. However, there was
no such relationship in our normal controls. The
difficulties in dissecting out the effects of the dif-
ferent components of duration are consequences of
the cross-sectional and retrospective nature of this
study. Future, long-term prospective studies, begin-
ning in childhood, and involving serial examinations,
are required to further elucidate the possible causal
relationships suggested by the correlations we have
found.
NAA/Cr-ipsi was more reduced than N A A / C r -
contra, an observation that confirms previous work
from our group and others (Roth et al., 1980; Con-
nelly et al., 1994; Ng et al., 1994; Cross et al., 1996;
Cendes et al., 1997). However, the rate of change of
N A A / C r (e.g., the slope of the regression lines on
Fig. 2) was the same for both temporal lobes, imply-
ing that whatever the cause of this decline, it affects
both sides in a similar fashion. This relationship is
maintained even when the two regression lines are
extrapolated back to time zero, suggesting that ipsi-
 301

A
4.5
• AA

A ~k,A AA •
•& 4 AAL A~.X a a

r = -0.30, p = 0 . 0 0 6
A • • A-
Z
3

2.5

2
0 20 40 60

Duration (years)

5 B
m~ : • • •
4.5 • • •~ mmmm•~ •
• •
• • •• IBm

"• • "~ • _ ". _~r=-0.32, p=0.004

o , . ,, .-,- - -

"- 3,5 • . Im • mm m • •

z 3

2.5

i i 'i

0 20 40 60

Duration (years)
Fig. 2. NAA/Cr is plotted against duration of epilepsy for each temporal lobe for each patient ipsilaterally (A) or contralaterally (B) to
the EEG focus (see text for details).

lateral NAA/Cr is lower than contralateral NAA/Cr with mesial TLE is acquired at an early stage of the
even at a very early stage of the epileptic disorder. disease and is in agreement with data in children
These findings are consistent with the notion that with TLE (Mathern et al., 1994; Harvey et al., 1997).
neuronal damage in the temporal lobes of patients
302
Generalized seizures m a y induce additional
neuronal loss
There was no significant correlation between NAA/
Cr on either side and frequency of complex partial
seizures. However, patients with generalized tonic-
clonic seizures (n = 27) had lower NAA/Cr-ipsi
(t = 2.505, P = 0.015) and lower NAA/Cr-contra
(t = 2.498, P = 0.014) than patients who had no
or only rare generalized tonic-clonic seizures (n =
54). There was no significant difference in NAA/Cr
of either side between patients with and patients
without a history of prolonged febrile convulsions.
Complex-partial seizures did not appear to cause
progressive dysfunction given the lack of correla-
tion between seizures and NAA/Cr in either tempo-
ral lobe. However, generalized tonic-clonic seizures
were associated with lower NAA/Cr bilaterally, sug-
gesting that this type of seizure is more impor-
tantly related the to the metabolic dysfunction we
are detecting. Whether they are the cause or ef-
fect of this metabolic dysfunction remains unknown.
This association of generalized tonic-clonic seizures
with temporal lobe neuronal dysfunction echoes the
autopsy results of Mouritzen Dam (1980), which
showed increased hippocampal cell loss in patients
with frequent generalized tonic-clonic seizures. The
correlation with generalized tonic-clonic seizures
may not be surprising given the considerably easier
task of accurately estimating numbers of generalized
tonic-clonic seizures. Difficulties in estimating the
frequency of partial complex seizures may provide
an insurmountable obstacle for addressing the role
of brief isolated seizures in TLE, even when results
of longitudinal studies will be available (Sutula and
Hermann, 1999).
Unilateral N A A abnormality does not progress
over time to become bilateral
Compared to the normal controls, 33 (40%) pa-
tients had bilaterally reduced NAA/Cr. They had
significantly lower NAA/Cr-ipsi than patients with
unilaterally reduced NAA/Cr (Table 2). Student's
t-test revealed that these patients did not signifi-
cantly differ in their age, age of onset, duration, or
frequency of complex partial or generalized tonic-
clonic seizures.
TABLE2
Patients with temporal lobe epilepsy and unilateral or bilateral
NAA/Cr reduction
Unilateral Bilateral P-value
n = 49 (60%) n = 33 (40%)
NAA/Cr-ipsi 3.83 3.39 <001
Age of onset 14 15 0.867
Duration of epilepsy 18 (years) 20 (years) 0.144
NAA, N-acetylaspartate;Cr, creatine; ipsi, temporal lobe ipsilat-
eral to the EEG focus.
Despite the relationship between epilepsy dura-
tion and NAA, patients with bilaterally abnormally
low NAA do not tend to have longer duration than
those with unilaterally low NAA. Thus, our data do
not suggest that an individual with unilateral spec-
troscopic abnormality could progress over time to
become bilaterally abnormal. Therefore, our findings
are consistent both with the concept that neuronal
damage in TLE is an early, acquired condition and
with the notion that progressive neuronal dysfunction
or loss may occur.
Conclusion
The results of this cross-sectional study suggest that
NAA reduction in TLE, as measured by ~H-MRSI, is
present at the time of the onset of clinical seizures, is
bilateral but predominates on the side of the EEG fo-
cus, progresses over several years and is worsened by
frequent generalized tonic-clonic seizures. Whether
these findings represent irreversible neuronal loss
or neuronal dysfunction is unclear, in part because
of the cross-sectional and retrospective nature of
the data. Longitudinal studies are likely to be more
robust in fully exploring the effects of age, age of on-
set, repeated seizures, and duration of epilepsy and
will further elucidate the possible causal relationship
suggested by the correlations we have found.
Abbreviations
TLE temporal lobe epilepsy
~H-MRSI proton magnetic resonance spectro-
scopic imaging
NAA N-acetylaspartate

Cr creatine
SD standard deviation
References
Babb, T.L. and Brown, W.J. (1987) Pathological findings in
epilepsy. In: J. Engel Jr. (Ed.), Surgical Treatment of the
Epilepsies. Raven Press, New York, pp. 511-540.
Cavazos, J.E., Das, I. and Sutula, T.P. (1994) Neuronal loss
induced in limbic pathways by kindling: evidence for induc-
tion of hippocampal sclerosis by repeated brief seizures. J.
Neurosci., 14: 3106-3121.
Cendes, E, Andermann, E, Preul, M.C. and Arnold, D.L. (1994)
Lateralization of temporal lobe epilepsy based on regional
metabolic abnormalities in proton magnetic resonance spectro-
scopic images. Ann. Neurol., 35:211-216.
Cendes, E, Caramanos, Z., Andermann, F., Dubeau, E and
Arnold, D.L. (1997) Proton magnetic resonance spectroscopic
imaging and magnetic resonance imaging volumetry in the lat-
eralization of temporal lobe epilepsy: a series of 100 patients.
Ann. Neurol., 42: 737-746.
Connelly, A., Jackson, G.D., Duncan, J.S., King, D. and Gadian,
D.G. (1994) Magnetic resonance spectroscopy in temporal
lobe epilepsy. Neurology, 44: 1411-1417.
Cross, J.H., Connelly, A., Jackson, G.D., Johnson, C.L., Neville,
B.G. and Gadian, D.G. (1996) Proton magnetic resonance
spectroscopy in children with temporal lobe epilepsy. Ann.
Neurol., 39: 107-113.
Dantry, C., Vaufrey, E, Brouillet, E., Bizat, N., Henry, RG.,
Conde, E, Bloch, G. and Hantraye, E (2000) Early N-
acetylaspartate depletion is a marker of neuronal dysfunction
in rats and primates chronically treated with the mitochondrial
toxin 3-nitropropionic acid. J. Cereb. Blood Flow Metab., 20:
789-799.
Davies, K.G., Hermann, B.R, Dohan Jr., F.C., Foley, K.T., Bush,
A.J. and Wyler, A.R. (1996) Relationship of hippocampal scle-
rosis to duration and age of onset of epilepsy, and childhood
febrile seizures in temporal lobectomy patients. Epilepsy Res.,
24:119-126.
De Stefano, N., Matthews, EM. and Arnold, D.L. (1995) Re-
versible decreases in N-acetylaspartate after acute brain injury.
Magn. Reson. Med., 34: 721-727.
Demougeot, C., Gamier, R, Mossiat, C., Bertrand, N., Giroud,
M., Beley, A. and Marie, C. (2001) N-Acetylaspartate, a
marker of both cellular dysfunction and neuronal loss: its
relevance to studies of acute brain injury. J. Neurochem., 77:
408-415.
Duc, C.O., Trabesinger, A.H., Weber, O.M., Meier, D., Walder,
M., Wieser, H.G. and Boesiger, R (1998) Quantitative 1H
MRS in the evaluation of mesial temporal lobe epilepsy in
vivo. Magn. Reson. Imaging, 16: 969-979.
Gadian, D.G. (1995) N-Acetylaspartate and epilepsy. Magn. Res.
Imaging, 13: 1193-1195.
Garcia, RA., Laxer, K.D., van der, GJ., Hugg, J.W., Matson,
G.B. and Weiner, M.W. (1997) Correlation of seizure fre-
quency with N-acetyl-aspartate levels determined by 1H mag-
303
netic resonance spectroscopic imaging. Magn. Reson. Imaging,
15: 475-478.
Gloor, P. (1991) Mesial temporal sclerosis: historical background
and an overview from a modern perspective. In: Epilepsy
Surgery. Raven Press, New York, pp. 689-703.
Harvey, A.S., Berkovic, S.E, Wrennall, J.A. and Hopkins, I.J.
(1997) Temporal lobe epilepsy in childhood: clinical, EEG,
and neuroimaging findings and syndrome classification in a
cohort with new-onset seizures. Neurology, 49: 960-968.
Hugg, J.W., Laxer, K.D., Matson, G.B., Maudsley, A.A. and
Weiner, M.W. (1993) Neuron loss localizes human temporal
lobe epilepsy by in vivo proton magnetic resonance spectro-
scopic imaging. Ann. Neurol., 34: 788-794.
Hugg, J.W., Kuzniecky, R.I., Gilliam, F., Morawetz, R.B.,
Faught, E. and Hetherington, H.R (1996) Normalization of
contralateral metabolic function following temporal lobectomy
demonstrated by H-1 magnetic resonance imaging. Ann. Neu-
rol., 40: 236-239.
Kalra, S., Cashman, N.R., Genge, A. and Arnold, D.L. (1998)
Recovery of N-acetylaspartate in corticomotor neurons of pa-
tients with ALS after riluzole therapy. NeuroReport, 9: 1757-
1761.
Kreis, R., Ernst, T. and Ross, B.D. (1993) Development of the
human brain: in vivo quantification of metabolite and water
content with proton magnetic resonance spectroscopy. Magn.
Reson. Med., 30: 424---437.
Liu, Z., Nagao, T., Desjardins, G.C., Gloor, E and Avoli, M.
(1994) Quantitative evaluation of neuronal loss in the dor-
sal hippocampus in rats with long-term pilocarpine seizures.
Epilepsy Res., 17: 237-247.
Margerison, J.H. and Corsellis, J.A. (1966) Epilepsy and the
temporal lobes. A clinical, electroencephalographic and neu-
ropathological study of the brain in epilepsy, with particular
reference to the temporal lobes. Brain, 89: 499-530.
Mathern, G.W., Leite, J.R, Pretorius, J.K., Quinn, B., Peacock,
W.J. and Babb, T.L. (1994) Children with severe epilepsy:
evidence of hippocampal neuron losses and aberrant mossy
fiber sprouting during postnatal granule cell migration and
differentiation. Brain Res., 78: 70-80.
Mathern, G.W., Pretorius, J.K. and Babb, T.L. (1995) Influence
of the type of initial precipitating injury and at what age it
occurs on course and outcome in patients with temporal lobe
seizures. J. Neurosurg., 82: 220-227.
Meencke, H.J. and Veith, G. (1991) Hippocampal sclerosis in
epilepsy. In: H. Liiders (Ed.), Epilepsy Surgery. Raven Press,
New York, pp. 705-715.
Meyer, A., Falconer, M.A. and Beck, E. (1954) Pathological
findings in temporal lobe epilepsy. J. Neurol. Neurosurg. Psy-
chiatry, 17: 276-285.
Moffett, J.R., Namboodiri, M.A., Cangro, C.B. and Neale, J.H.
(1991) Immunohistochemical localization of N-acetylaspartate
in rat brain. NeuroReport, 2: 131-134.
Mouritzen Dam, A. (1980) Epilepsy and neuron loss in the
hippocampus. Epilepsia, 21: 617-629.
Nakano, M., Ueda, H., Li, J.Y., Matsumoto, M. and Yanagihara,
T. (1998) Measurement of regional N-acetylaspartate after
transient global ischemia in gerbils with and without ischemic
304
tolerance: an index of neuronal survival. Ann. Neurol., 44:
334-34O.
Ng, T.C., Comair, Y.G., Xue, M., So, N., Majors, A., Kolem,
H., Luders, H. and Modic, M. (1994) Temporal lobe epilepsy:
presurgical localization with proton chemical shift imaging.
Radiology, 193: 465-472.
Petroff, O.A., Pleban, L.A. and Spencer, D.D. (1995) Symbiosis
between in vivo and in vitro NMR spectroscopy: the crea-
tine, N-acetylaspartate, glutamate, and GABA content of the
epileptic human brain. Magn. Res. Imaging, 13:1197-1211.
Roth, K., Kimber, B.J. and Feeney, J. (1980) Data shift ac-
cumulation and alternate delay accumulation techniques for
overcoming dynamic range problems. J. Magn. Reson., 41:
302-309.
Simmons, M.L., Frondoza, C.G. and Coyle, J.T. (1991) Immuno-
cytochemical localization of N-acetyl-aspartate with mono-
clonal antibodies. Neuroscienee, 45: 37-45.
Sutula, T.P. and Hermann, B. (1999) Progression in mesial tem-
poral lobe epilepsy. Ann. Neurol., 45: 553-556.
Tasch, E., Cendes, F., Li, L.M., Dubeau, E, Andermann, E and
Arnold, D.L. (1999) Neuroimaging evidence of progressive
neuronal loss and dysfunction in temporal lobe epilepsy. Ann.
Neurol, 45: 568-576.
Urenjak, J., Williams, S.R., Gadian, D.G. and Noble, M. (1993)
Proton nuclear magnetic resonance spectroscopy unambigu-
ously identifies different neural cell types. J. Neurosci., 13:
981-989.
Vermathen, P., Ende, G., Laxer, K.D., Knowlton, R.C,, Matson,
G.B. and Weiner, M.W. (1997) Hippocampal N-acetylaspartate
in neocortical epilepsy and mesial temporal lobe epilepsy.
Ann. Neurol., 42: 194-199.
T. Sutula and A. Pitkanen (Eds.)
Progress in Brain Research, Vol. 135
Published by Elsevier Science B.V.

CHAPTER 26

Neuroimaging and the progression of epilepsy

W i l l i a m H. Theodore * and W i l l i a m D. Gaillard

Clinical Epilepsy Section, National Institutes of Health, Building 10, Room 5N-250, Bethesda, MD 20892, USA

Abstract: Several lines of evidence can be used to try to answer the question of whether epilepsy is a progressive disease,
and whether persistent seizures, or the underlying process itself, cause neuronal injury. The results of clinical studies have
been inconclusive. Neuroimaging studies offer a quantitative approach• In patients with temporal lobe epilepsy, structural
magnetic resonance imaging (MRI) has shown volume reductions ipsilateral to the epileptic focus in hippocampal
and extrahippocampal regions; the former, in cross-sectional studies, increase with increasing epilepsy duration. Other
factors associated with increasing hippocampal atrophy include a history of complex or prolonged febrile seizures, and
generalized tonic-clonic seizure number• Positron emission tomography (PET) has shown supporting results• However,
these studies have been cross-sectional rather than longitudinal• Preliminary results from prospective imaging studies using
fluorodeoxyglucose PET and volumetric MRI show that patients with more recent seizure onset are less likely to have
hypometabolism or volume loss than those with a long history of epilepsy• Alternate interpretations of these data include
a possible progressive effect of epilepsy, or a tendency for patients with structural or functional findings at seizure onset
to be more likely to develop uncontrolled epilepsy. In addition to the human studies that have been performed, parallel
investigations in animal models using some of the same imaging techniques may help to unravel the factors associated with
neuronal injury due to seizures, and aid in interpreting results of clinical studies.

Introduction has been hard to document clinically, due to the large

Evidence from a number of types of investigations
could be used to try to answer the question of
whether human epilepsy is a progressive disease•
Several clinical studies have suggested that seizures
become harder to treat as their number increases, a
concept that goes back at least to Gowers (Berg and
Shinnar, 1997)• Elwes et al. (1988) reported that a
retrospective study showed decreasing intervals be-
tween successive generalized tonic-clonic seizures,
suggesting that the seizure disorder became more
severe over time. However, the course of the process
* Correspondence to: W•H. Theodore, Clinical Epilepsy
Section, National Institutes of Health, Building 10, Room
5N-250, Bethesda, MD 20892, USA. Tel.: +1-301-496-
1505; Fax: -t-1-301-402-2871;
E-mall: theodorw @ninds.nih.gov
number of factors that can affect seizure frequency•
Subsequent investigations on the effect of previous
seizure number or frequency on epilepsy prognosis
have differed in their conclusions (Berg and Shin-
nar, 1997; Kwan and Brodie, 2000)• A recent study
suggested that seizure frequency rather than abso-
lute number, as well as epilepsy syndrome, predicted
prognosis (Berg et al., 2001)• This suggests that
the underlying severity of the epilepsy, rather than
individual seizures, has the most important effect•
Factors such as seizure type, or underlying pathol-
ogy, both components of the epilepsy syndrome, as
well as response to initial antiepileptic drug (AED)
exposure, affect subsequent seizure prognosis (Kwan
and Brodie, 2000)• Thus, it may be difficult to use
seizure frequency itself as the dependent variable in
assessing epilepsy progression•
Neuropsychological studies can be used to pro-
vide evidence for epilepsy progression, and are dis-
306
TABLE 1
Markers for temporal lobe epileptogenesis measurable by
imaging
Neuronal loss
Generalized
Specific, e.g. GABAergicneurons
Focal gliosis
Synapticreorganization
Neoneurogenesis
Phenotypicchange in remaining neurons (e.g. expressed
receptors)
Extrahippocampaleffects
Temporalneocortex
Thalamus
Cerebellum
Potential effectsof antiepilepticdrugs
cussed in several other chapters of this volume.
Their results can be affected by underlying disease,
and antiepileptic drug exposure, just as carl seizure
frequency.
Imaging studies offer an alternative, quantifiable
approach to measuring the possible progression of
epilepsy. Positron emission tomography (PET) and
magnetic resonance imaging (MRI) offer several
measures of brain function and pathology. Both, par-
ticularly in patients with complex partial seizures of
temporal origin, have been shown to be reliable in-
dicators of static brain dysfunction. A consideration
of some of the factors that may be related to tempo-
ral lobe epileptogenesis suggests several stages that
could be measurable by imaging methods (Table 1)
(Lado et al., 2000). In this chapter, measurements of
cerebral volume using MRI, and glucose metabolism
(CMRglc) using fluorine 18-2-deoxyglucose (FDG)
PET will be discussed.
Hippocampal volume and glucose metabolism in
temporal lobe epileptic foci as measures of
possible progression
Hippocampal (HF) atrophy is a common finding
on MR imaging in patients with complex partial
seizures (CPS), and is one of the imaging hallmarks
of mesial temporal sclerosis (MTS). The presence of
atrophy is a reliable marker of the epileptogenic zone
(Jack et al., 1990; Berkovic et al., 1995; Cascino et
al., 1995). Several factors have been associated with
the presence and severity of HF atrophy measured
by MRI. Perhaps the most prominent is a history
of complex or prolonged febrile seizures (CFS): a
seizure associated with fever occurring before the
onset of afebrile seizures, and lasting longer than
15 min, with focal features, or followed by transient
or persistent neurologic abnormalities (Nelson and
Ellenberg, 1976; Cendes et al., 1993a,b; K~ilvi~iinen
et al., 1998; Tasch et al., 1999; Theodore et al.,
1999). However, some studies have not found a
strong effect of febrile seizures on HF atrophy, or a
specific association with temporal lobe seizures, as
opposed to epilepsy in general (Davies et al., 1996;
Berg et al., 1999; MacDonald et al., 1999; Bower et
al., 2000; Lado et al., 2000).
Epilepsy duration has also been associated with
HF atrophy (K~ilviainen et al., 1998; Tasch et al.,
1999; Theodore et al., 1999). In a multivariate anal-
ysis, the effect of duration, but not age at onset or
scan, was significant (Theodore et al., 1999) (Fig. 1).
Patients with a history of FS did not have earlier age
at epilepsy onset or longer duration.
The total number of generalized tonic-clonic
seizures (GTCS) and perhaps CPS seizures, in pa-
tients with a long duration of epilepsy, are also
significantly associated with increasing HF in some
studies (K~ilvi~iinen et al., 1998; Tasch et al., 1999).
Spanaki et al. (2000a,b) did not find any associ-
ation between CPS frequency, or lifetime number
of sGTCS and HV or metabolism ipsilateral to the
EEG focus, among patients with a mean of only
eight lifetime GTCS. This number was considerably
lower than in a series that did report an association
(K~ilvi~iinen et al., 1998; Tasch et al., 1999). Vol-
ume reduction was also present in some children
with only infrequent clinical seizures (Lawson et al.,
2000). Thus, either underlying disease, or a sub-
clinical 'epileptogenic process', in addition to overt
seizures, might contribute to neuronal injury.
There have been several reports of the devel-
opment of hippocampal sclerosis in patients with
febrile or non-febrile status epilepticus, in patients
who had increased T2 signal initially, which subse-
quently resolved (Nohria et al., 1994). Wieshmann et
al. (1997) reported a patient with generalized tonic-
clonic status who developed bilateral HF atrophy
that increased over 58 months. One patient with re-
current partial and secondarily generalized seizures,
but not status epilepticus, had progressive hippocam-

cO
0
o 0
r,o
O0
0
Fig. 1. Plot of the effect of subject age and epilepsy duration on hippocampal volume. Volume decreases with increasing duration, but is
not affected by subject age. From Theodore et al. (1999).
pal sclerosis (O'Brien et al., 1999). VanLandingham
et al. (1998) found MRI abnormalities in 6 of 15
infants with focal or lateralized CFCs, but none of 12
with generalized CFCs. However, in two of the six
infants with lateralized CFCs and abnormal MRIs,
pre-existing bilateral hippocampal atrophy was con-
sistent with a history of perinatal insults. The other
infants with MRI abnormalities and lateralized CFCs
had significantly longer seizures and MRI changes
suggesting acute edema with increased hippocampal
T2-weighted signal intensity.
The combined effect of epilepsy duration and
febrile seizures suggests that, after an initial insult,
progressive HF damage may occur in patients with
persistent seizures. When status epilepticus leads to
progressive HF atrophy, pre-existing abnormalities
and seizure severity may be contributing factors.
It is possible that the progress of metabolic or
pathologic abnormalities in patients with temporal
lobe epilepsy may not be altered by adequate seizure
control. The presence of an epileptic focus might be
associated with progressive neuronal injury even in
clinically 'well-controlled' patients.
307
Focal hypometabolism is an excellent predictor
of outcome after temporal lobectomy (Theodore et
al., 1992; Radke et al., 1993). Reduced CMRglc
in temporal lobe epileptic foci probably is due to
a combination of neuronal loss and superimposed
functional factors (Gaillard et al., 1995a; O'Brien et
al., 1997; Theodore et al., 2001). In patients with
temporal lobe epilepsy, we found increasing rela-
tive hypometabolism in the mesial temporal region
ipsilateral to the epileptic focus in association with
increasing epilepsy duration (Fig. 2). The usual re-
lation between CMRglc and cerebral blood flow is
disrupted in temporal lobe epileptic foci (Gaillard et
al., 1995b). The mismatch has been reported to in-
crease with epilepsy duration, suggesting progressive
functional impairment (Breier et al., 1997).
Extratemporal volumes and glucose metabolism
Extratemporal and lateral temporal structures have
been less fully studied than mesial structures in pa-
tients with temporal lobe epilepsy. There are varying
reports of unilateral or bilateral temporal neocorti-
308
0.4 I I
0.3 _ o
© o
0.2 - o o ~ o o
O O O0
0
0
O 0
(3000
0.1
o 8 0 o
0.0
-o O o°o
oo 08
o o
-0.1 -
0 reduced ipsilateral to the focus in patients with tem-
-0.2 I I
0 10 20
DURATION
Fig. 2. Plot of the indexof asymmetryin mesial temporalmetab-
olism ipsilateral and contralateral to the epileptic focus against
epilepsy duration. There is increasing asymmetry,showing that
relative hypometabolismincreaseswith increasingduration.
cal atrophy (Jack et al., 1990; Lencz et al., 1992;
Marsh et al., 1997). A recent reported found no ef-
fect of epilepsy duration, but patients with a history
of prolonged or complex febrile seizures had reduced
lateral temporal volume, and suggested that early in-
sult may affect lateral as well as mesial temporal
lobes (Theodore et al., 2000a). Another group found
that the degree of atrophy in the extrahippocampal
structures correlated with the degree of hippocampal
atrophy, suggesting that a common process may be
responsible. They reported no correlation between
the degree of atrophy in extrahippocampal structures
and duration of epilepsy, or history of febrile convul-
sions or generalized seizures (Moran et al., 2001).
In a series of patients with left temporal foci, we
found that mean left thalamic, left caudate, and bi-
lateral lenticular volumes were significantly smaller
in the patients with epilepsy than in control sub-
jects (DeCarli et al., 1998) (Fig. 3). The left-to-right
thalamic volume ratio was also significantly lower
in the patients with epilepsy compared with control
subjects, but there were no significant group differ-
ences in caudate or lenticular ratios. The results were
confirmed in a larger series of 37 patients with both
left and right temporal loci (Theodore et al., 2000b).
Other investigators have also reported thalamic at-
Iu I I / rophy (Deasy et al., 2000). These studies show that
medically intractable temporal lobe epilepsy is asso-
© ciated with volume loss in brain structures outside
© the presumably involved hippocampus and temporal
lobe. Volume loss may reflect progressive damage
due to involvement of these structures in recurrent
0
0 seizure activity. A number of studies have suggested
that subcortical structures, particularly the thalamus,
play a role in the pathophysiology of temporo-limbic
seizures, particularly when secondary generalization
t occurs (Theodore et al., 1994).
Thalamic glucose metabolism (CMRglc) is also
poral lobe epilepsy (Henry et al., 1993). However, we
I I I
found little clear relation between thalamic CMRglc
30 40 50 60
and volume (Theodore et al., 2000b). Contralateral
but not ipsilateral to the focus, hippocampal volume
was related to thalamic metabolism. This disconnec-
tion might suggest disruption of normal relationships
by the epileptogenic process. Several studies have
reported that ipsilateral thalamic hypometabolism
helps to identify the epileptogenic zone, and that
contralateral thalamic hypometabolism predicts a
poor outcome from temporal lobectomy (Henry et
al., 1993; Newberg et al., 2000).
Both cerebellar CMRglc and volume show bilat-
eral reductions in patients with temporal lobe foci
(Theodore et al., 1987; Sandok et al., 2000). Atrophy
was related to seizure duration (Sandok et al., 2000).
Phenytoin, although associated with cerebellar toxi-
city, made only a small contribution to the reduction
of CMRglc (Theodore et al., 1987).
Patients with temporal lobe epilepsy and a history
of complex or prolonged febrile seizures may have
reduced whole brain volume as well (Lee et al.,
1998; Szabo et al., 1999; Lawson et al., 2000). We
1.2
1
0.8
0.6
0.4 DIIL-TLE
control
0.2
0 r 1
HF thalamus
Fig. 3. Graph showing that both hippocampal volumeand thala-
mic volumeare lower ipsilateral than contralateralto a temporal
lobe epilepticfocus. Adaptedfrom DeCarli et al. (1998).

1300 I I
1200
CO
E 1100
1000
¢ 900
0 several major limitations. The data are nearly all
800
700 I _ _
no yes
Complex Febrile Seizures
Fig. 4. In patients with temporallobe epileptic foci and a history
of complexor prolonged febrile seizures, total cerebral volumeis
reduced, comparedwith patients who have no history of complex
febrile seizures.
measured total cerebral volume in 40 patients with
localization-related epilepsy and temporal lobe onset
on video-EEG, and 20 controls. Patients with a
history of complex or prolonged febrile seizures had
reduced total cerebral volume compared with other
patients and controls (Fig. 4).
Lee et al. (1998) reported that total brain size was
lower in patients with temporal lobe epilepsy than
controls, but did not note an effect of febrile seizure
history. A recent study of a large group of children
with a mean age of 8 years found a non-significant
effect of simple, but not complex, febrile seizures on
total brain volume (Lawson et al., 2000). Szabo et al.
(1999) did not report any effect of febrile seizure on
whole brain in children younger than six. Reduced
brain size may be more likely to be a consequence of
prolonged febrile seizures, rather than present at their
onset. It is possible that the effect we found might
not become apparent until patients had attained full
growth.
Taken together, the volumetric MRI and FDG-
PET studies suggest that, after an initial insult,
possibly related to early status epilepticus or CFS,
increasing epilepsy duration leads to progressive vol-
ume loss. Frequent GTCS probably exacerbate the
process, which may extend beyond the region of
309
the epileptic focus, and have variable effects on other
brain structures. There may be regional differences in
the effects of both initiating events (febrile seizures)
and epilepsy itself on imaging parameters. Structural
volume and glucose metabolism may be independent
measures of neuronal integrity, and of progressive
damage in patients with persistent seizures.
The need for longitudinal studies
However, the studies that have been discussed have
cross-sectional, except for a few case reports. We
can at best infer a relation between epilepsy duration,
or in some studies, seizure number, and progressive
structural loss or functional impairment. The patients
studied generally were not selected from the popula-
tion at large, but rather from among those referred to
centers for the treatment of intractable epilepsy.
The association between long epilepsy duration
and greater HF atrophy or hypometabolism could
represent the severity of the underlying epilepsy
syndrome, rather than simply an effect of persis-
tent seizures. Moreover, we do not know the effect
of prolonged antiepileptic drug treatment on brain
volumes. At least one drug, phenytoin, has been
associated with cerebellar atrophy (Theodore et al.,
1987).
Several investigators are performing prospective
imaging studies of patients with new onset epilepsy.
We are conducting a prospective study of children
within 1 year after their third unprovoked partial
seizure with EEG, volumetric MRI, and 18FDG-PET
(Galliard et al., 1998). The mean age at seizure
onset in 40 subjects was 5.8 years, and the mean
duration since first seizure 1.1 years. We excluded
children with abnormal structural MRI, except four
with mesial temporal sclerosis and two with subtle
hippocampal dysgenesis. Initial PET analysis used
a region of interest template. An absolute asym-
metry index between two structures in right left
hemispheres (AI) greater than 0.15 was considered
abnormal. Thirty-two of 40 children had a presump-
tive temporal lobe, five fronto-temporal, and three a
frontal focus. The mean AI for all regions was not
different than from normal young adults, even when
children without a definite temporal focus were ex-
cluded. At initial scan, eight of 40 children had focal
310
temporal hypometabolism, especially in the inferior
mesial and inferior lateral regions. Abnormalities
were ipsilateral to the presumed temporal lobe ic-
tal focus. There was no association between seizure
number and presence or extent of regional metabolic
abnormalities.
Our preliminary results suggest that children with
new onset partial seizures are less likely to have
abnormalities of glucose utilization than adults with
chronic partial epilepsy (Gaillard et al., 1998). Al-
though our patients' prognosis is uncertain, resolu-
tion of epilepsy after three documented seizures is
uncommon. If, as expected, the subjects develop a
higher incidence of hypometabolism in the future
with planned follow-up studies, metabolic dysfunc-
tion might be related to persistent epilepsy rather
than present at seizure onset.
In addition, the FDG-PET results are consistent
with reports that only 10% of patients with newly
diagnosed seizures had hippocampal sclerosis on
MRI (Van Paesschen et al., 1997). It is likely that
a higher percentage of these patients will go on to
develop uncontrolled epilepsy, suggesting that MRI
abnormalities will also increase in frequency. In a 1-
year follow-up, 8% of the patients showed evidence
of increased HF volume loss (Van Paesschen et al.,
1998).
However, it is also possible that patients with
HF atrophy at seizure onset will be more likely
to develop uncontrolled epilepsy, which would be
consistent with the recent observations of Berg et
al. (2001), as well as with the data available from
imaging studies so far.
Possible limitations of longitudinal imaging
studies
Functional imaging parameters, such as CMRglc,
may be affected by a number of clinical factors,
such as antiepileptic drugs, and time since the most
recent seizure (Theodore et al., 1989; Leiderman
et al., 1994). Several studies have reported that
abnormalities in CMRglc can revert toward nor-
mal after successful temporal lobectomy, in both
contralateral mesial temporal structures, ipsilateral
frontal cortex and thalamus (Hajek et al., 1994;
Spanaki et al., 2000a,b). magnetic resonance spec-
troscopy (MRS) data also suggests that reduced N-
acetylasparatate/creatine (NAA/Cr), thought to be a
marker of neuronal number, may also be a functional
marker that could tend to become normal if seizures
remit. Series et al. (2001) reported that NAA/Cr
increased after surgery and was significantly higher
in seizure-free than in non-seizure free patients. Al-
though volume measurements sound more stable,
recent demonstration of new neuronal growth in the
adult mammalian brain suggests that volumetric MRI
measurements may be mutable as well. In addition,
we do not know the time frame for development of
progressive neuronal injury from persistent epilepsy.
The cross-sectional studies have included patients
with seizures for decades. In contrast, the prospec-
tive studies will have a time frame of 5 years or
less. Negative results from these will not rule out
the possibility of an effect that could take longer to
develop or detect.
The potential role for imaging studies in
experimental animals
However, even demonstration of the development of
hypometabolism, or progressive volume loss in other
studies now in progress (Van Paesschen et al., 1998),
would not necessarily prove that seizures cause neu-
ronal injury; both might be associated with some
underlying process. The developing ability to use
imaging to conduct longitudinal studies in animal
models will be very important in assessing this issue.
Several preliminary studies have already been per-
formed. Najm et al. (1998) used MRS to show a sig-
nificant increase in lactate/creatinine in KA-treated
rats during and 24 h after seizure onset, prevented
by cycloheximide pretreatment. NAA ratios were
significantly higher during the ictal phase following
KA treatment; this effect was not affected by cy-
cloheximide pretreatment. Nissl staining confirmed
previously reported prevention of KA-induced neu-
ronal loss in CA3 and CA1 areas of the hippocampus
by cycloheximide pretreatment. Maton et al. (1999)
used MRS to show that at 2-h after kindled seizures,
lactate/Cr increase was higher in stage 5 rats as
compared with stage 0 rats and sham control rats in
NAA/Cr ratios increased significantly after stage 0
kindling in the stimulated hippocampus but not after
stage 5. Tokumitsu et al., 1997 found that unilateral
hippocampal injection of kainate decreased NAA

and creatine levels and increased apparent diffusion
coefficient (ADC) of water were found in the ipsi-
lateral hippocampus after 14 days where neuronal
loss and gliosis were observed. In the contralateral
hippocampus, a significant increase of choline level
was observed.
Diffusion weighted imaging (DWI) may be es-
pecially sensitive to detecting experimental neu-
ronal injury in brain during early stages follow-
ing traumatic brain injury (TBI) or ischemic insult.
Diffusion-weighted MR revealed focal abnormalities
in the limbic system after 1 h of sustained seizures
induced with kainic acid, before changes on T2-
weighted imaging (Nakasu et al., 1995).
Wang et al. (1996) reported an increase in MR-
visible sodium, associated with the decrease in
ADC, consistent with the hypothesis that sequen-
tial seizures caused an increase in sodium influx and
perturbation of membrane ion homeostasis, which
eventually evolved into an irreversible phase of cel-
lular edema, with increased MR visible intracellular
sodium and decreased ADC. They explained return
of ADC to near-control level and persistent high
sodium level at 7 days by the increase in extracellu-
lar space and tissue necrosis.
Thus, DWI may prove to be highly sensitive for
the non-invasive detection of localized neural injury,
even in very early phases of the injury process,
as might occur in seizures. Furthermore, MRS can
be used to track compounds such as NAA and y-
aminobutyric acid (GABA) that may be altered in
seizure foci.
Bouilleret et al. (2000) used structural MRI to
study the development of hippocampal sclerosis in
rats up to 120 days after intrahippocampal KA in-
jection. There was a transient initial hyperintense
T2 signal in cortex above the HF, probably due to
vasogenic edema. Increased HF T2 occurred at 24
h, sometimes accompanied by increased amygdala
signal. After 1 week, only increased HF signal was
found,
These reports show that appropriate manipulation
of experimental conditions in animal imaging stud-
ies may be able to answer some of the important
questions raised by human data.
311
Conclusion: imaging epileptogenesis
The possibility of epilepsy prevention, as opposed
to treatment, will need to be based on better knowl-
edge of the process of epileptogenesis. What are
the underlying structural and functional conditions
that predispose to the onset of seizures, and to the
differential vulnerability among brain regions. Are
these factors, perhaps genetic, present, but dormant,
in patients who never develop overt epilepsy?
Imaging studies have the potential to address
many of these issues, and provide a basis for under-
standing stages in the progression of human epilep-
togenesis, as well as provide valuable insights into
neuronal dysfunction in brain regions beyond the
focus itself, and the effect of antiepileptic drugs.
Moreover, application of parallel imaging techniques
to animal models of epilepsy, as well as to humans,
will help to bridge the gap between experimental
studies and clinical observations.
References
Berg, A.T. and Shinnar, S, (1997) Do seizures beget seizures?
An assessment of the clinical evidence in humans. J. Clin.
Neurophysiol., 14: 102-110.
Berg, A.T., Shinnar, S., Levy, S.R. and Testa, EM. (1999)
Childhood-onset epilepsy with and without preceding febrile
seizures. Neurology, 53: 1742-1748.
Berg, A.T., Shinnar, S., Levy, S.R., Testa, EM., Smith-Rapaport,
S. and Beckerman,B. (2001) Early developmentof intractable
epilepsy in children. Neurology, 56: 1445-1452.
Berkovic, S.E, Mclntosh, A.M. and Kalnins, R.M. et al. (1995)
Preoperative MRI predicts outcome of temporal lobectomy:an
actuarial analysis. Neurology, 45: 1358-1363.
Bouilleret, V., Nehlig, A., Marescaux, C. and Namer, I.J. (2000)
Magnetic resonance imaging follow-up of progressive hip-
pocampal changes in a mouse model of mesial temporal lobe
epilepsy. Epilepsia, 41: 642-650.
Bower, S.P.C., Kilpatrick, C.J., Vogrin, S.J., Morris, K. and
Cook, M.J. (2000) Degree of hippocampal atrophy is not
related to a history of febrile seizures in patients with proved
hippocampal sclerosis. J. Neurol. Neurosurg. Psychiatry, 69:
733-738.
Breier, J.I., Mullani, N.A., Thomas, A.B., Wheless, J.W.,
Ptenger, P.M., Gould, K.L., Papanicolaou, A. and Willmore,
L.J. (1997) Effects of duration of epilepsy on the uncoupling
of metabolism and blood flow in complex partial seizures.
Neurology, 48: 1047-1053.
Cascino, G.D., Trennary, M.R., Sharbrough, F.W., So, E.S.,
Marsh, W.R, and Strelow, D.C. (1995) Depth electrode stud-
ies in temporal lobe epilepsy: relation to quantitative magnetic
312
resonance imaging and operative outcome. Epilepsia, 36: 230-
235.
Cendes, F., Andermann, F. and Gloor, P. et al. (1993a) Atrophy
of mesial structures in patients with temporal lobe epilepsy:
cause or consequence of repeated seizures?. Ann. Neurol., 34:
795-801.
Cendes, E, Andermann, E, Gloor, P., Lopes-Cendes, I., Ander-
mann, E., Melanson, D., Jones-Gotman, M., Robitallle, Y.,
Evans, A. and Peters, T. (1993b) Atrophy of mesial structures
in patients with temporal lobe epilepsy: cause or consequence
of repeated seizures?. Ann. Neurol., 34(6): 795-801.
Davies, K.G., Hermann, B.P., Dohan, EC., Foley, K.T., Bush,
A.J. and Wyler, A.R. (1996) Relation of hippocampal sclerosis
to duration and age of onset of epilepsy, and childhood febrile
seizures, in temporal lobectomy patients. Epilepsy Res., 24:
119-126.
Deasy, N.P., Jarosz, J.M., Elwes, R.C.D., Polkey, C.E. and Cox,
T.C.S. (2000) Thalamic changes with mesial temporal sclero-
sis: MRI. Neuroradiology, 42: 341-346.
DeCarli, C., Hatta, J., Fazilat, S., Fazilat, S., Gaillard, W.D. and
Theodore, W.H. (1998) Extratemporal atrophy in patients with
complex partial seizures of left temporal origin. Ann. Neurol.,
43: 41-45.
Elwes, R.D., Johnson, A.L. and Reynolds, E.H. (1988) The
course of untreated epilepsy. Br. Med. J., 297: 948-950.
Gaillard, W.D., Bhatia, S., Bookheimer, S.Y., Fazilat, S., Sato, S.
and Theodore, W.H. (1995a) FDG-PET and MRI volumetry in
partial seizure focus localization. Neurology, 45: 123-127.
Galliard, W.D., Fazilat, S., White, S., Malow, B., Sato, S.,
Reeves, P., Herscovitch, P. and Theodore, W.H. (1995b) In-
terictal metabolism and blood flow are uncoupled in temporal
lobe cortex of patients with partial epilepsy. Neurology, 45:
1841-1848.
Gaillard, W.D., Weinstein, S., Pearl, P., Conry, J.A., Fazilat,
S., Braniecki, S., Kolodgie, M.J., Dubovsky, E.C., Vezina,
L.G. and Theodore, W.H. (1998) Natural history of metabolic
abnormalities in children with partial epilepsy determined by
FDG-PET. Epilepsia, 39(Suppl. 6): 101.
Hajek, M., Wieser, H.G., Khan, N., Antonini, A., Schrott, P.R.,
Maguire, P., Beer, H.-E and Leenders, K.L. (1994) Preopera-
tive and postoperative glucose consumption in mesiobasal and
lateral temporal lobe epilepsy. Neurology, 44: 2125-2132.
Henry, T.R., Mazziotta, J.C. and Engel, J.P. (1993) lnterictal
metabolic anatomy of mesial temporal lobe epilepsy. Arch.
Neurol., 50: 582-589.
Jack, C.R., Sharbrough, EW., Twomey, C.K., Cascion, G.D.,
Hirschoru, K.D., Marsh, W.R., Zinsmeister, A.R. and Schei-
thaner, B. (1990) Temporal lobe seizures: lateralization with
MR volume measurements and the hippocampal formation.
Radiology, 175: 423-429.
Kwan, P. and Brodie, M.J. (2000) Early identification of refrac-
tory epilepsy. New Engl. J. Med., 342(5): 314-319.
K~ilvifiinen, R., Salmenper~i, T., Partanen, K., Vainio, P., Riekki-
nen, P. and Pitkanen, A. (1998) Recurrent seizures may cause
hippocampal damage in temporal lobe epilepsy. Neurology,
50: 1377-1382.
Lado, EA., Sankar, R., Lowenstein, D. and Moshe, S.L.
(2000) Age-dependent consequences of seizures: relationship
to seizure frequency, brain damage, and circuitry reorganiza-
tion. Ment. Retard. Dev. Disabil. Res. Rev., 6(4): 242-252.
Lawson, J.A., Vogrin, S. and Bleasel, A.E (2000) Predictors
of hippocampal, cerebral, and cerebellar volume reduction in
childhood epilepsy. Epilepsia, 41: 2540-2545.
Lee, J.W., Andermann, E, Dubeau, E, Beruasconi, A., Mac-
Donald, D., Evans, A. and Reutens, D.C. (1998) Morphome-
tric analysis of the temporal lobe in temporal lobe epilepsy.
Epilepsia, 39: 727-736.
Leiderman, D.B., Albert, P., Balish, M., Bromfield, E. and
Theodore, W.H. (1994) The dynamics of metabolic change
following seizures as measured by positron emission tomog-
raphy with 18-fluoro-2-deoxyglucose. Arch. Neurol., 51: 932-
936.
Lencz, T., McCarthy, G. and Bronen, R.A. et al. (1992) Quan-
titative temporal lobe imaging in temporal lobe epilepsy: re-
lationship to neuropathology and neuropsychological function.
Ann. Neurol., 31: 629-637.
MacDonald, B.K., Johnson, A.L., Sander, J.W. and Shorvon,
S.D. (1999) Febrile convulsions in 220 children - neurological
sequelae at 12 years follow-up. Eur. Neurol., 41: 179-186.
Marsh, L., Morrell, M.J. and Shear, P.K. et al. (1997) Cortical
and hippocampal volume deficits in temporal lobe epilepsy.
Epilepsia, 38: 576-587.
Maton, B.M., Najm, I.M., Wang, Y., Luders, H.O. and Ng, T.C.
(1999) Postictal in situ MRS brain lactate in the rat kindling
model. Neurology, 53: 2045-2052.
Moran, N.E, Lemieux, L., Kitchen, N.D., Fish, D.R. and
Shorvon, S.D. (2001) Extrahippocampal temporal lobe atro-
phy in temporal lobe epilepsy and mesial temporal sclerosis.
Brain, 124: 167-175.
Nakasu, Y., Nakasu, S., Morikawa, S., Uemura, S., Inubushi, T.
and Handa, J. (1995) Diffusion-weighted MR in experimental
sustained seizures elicited with kainic acid. Am. J. Neurora-
diol., 16: 1185-1192.
Najm, I.M., Wang, Y., Shedid, D., Luders, H.O., Ng, T.C. and
Comair, Y.G. (1998) MRS metabolic markers of seizures and
seizure-induced neuronal damage. Epilepsia, 39(3): 244-250.
Nelson, K.B. and Ellenberg, J.H. (1976) Predictors of epilepsy in
children who have experienced febrile seizures. New Engl. J.
Med., 295: 1029-1033.
Newberg, A.B., Alavi, A. and Berlin, J. et al. (2000) Ipsilateral
and contralateral thalamic hypometabolism as a predictor of
outcome after temporal lobectomy for seizures. J. NucL Med.,
41: 1964-1968.
Nohria, V., Lee, N., Tien, R.D., Heinz, E.R., Smith, J.S., De-
Long, G.R., Skeen, M.B., Resnick, T.J., Crain, B. and Lewis,
D.V. (1994) Magnetic resonance imaging evidence of hip-
pocampal sclerosis in progression: a case report. Epilepsia,
35: 1332-1336.
O'Brien, T.J., Newton, M.R., Cook, M.J., Berlangieri, S.U.,
Kilpatrick, C., Morris, K. and Berkovic, S.E (1997) Hip-
pocampal atrophy is not a major determinant of regional
hypometabolism in temporal lobe epilepsy. Epilepsia, 38: 74-
80.
O'Brien, T.J., So, E.L., Meyer, EB., Parisi, J.E. and Jack, C.R.

(1999) Progressive hippocampal atrophy in chronic intractable
temporal lobe epilepsy. Ann. Neurol., 45: 526-529.
Radke, R.A., Hanson, M.W. and Hoffman, J.M. et al. (1993)
Temporal lobe hypometabolism on PET: predictor of seizure
control after temporal lobectomy. Neurology, 43: 1088-1092.
Sandok, E.K., O'Brien, T.J., Jack, C.R. and So, E.L. (2000)
Significance of cerebellar atrophy in intractable temporal lobe
epilepsy: a quantitative MRI study. Epilepsia, 41: 1315-1320.
Series, W., Li, L.M., Antel, S.B., Cendes, F., Gotman, J., Olivier,
A., Andermann, F., Dubeau, F. and Arnold, D.L. (2001) Time
course of postoperative recovery of N-acetyl-aspartate in tem-
poral lobe epilepsy. Epilepsia, 42: 190-197.
Spanaki, M., Kopylev, L., Liow, K., DeCarli, C., Fazilat, S.,
Gaillard, W.D. and Theodore, W.H. (2000a) Postoperative
changes in cerebral metabolism in temporal lobe epilepsy.
Arch. Neurol., 57: 1447-1453.
Spanaki, M.V., Kopylev, L., DeCarli, C., Gaillard, W.D., Fazilat,
S., Fazilat, S., Liow, K., Reeves, P., Sato, S., Kufta, C. and
Theodore, W.H. (2000b) Relationship of seizure frequency
to hippocampus volume and metabolism in temporal lobe
epilepsy. Epilepsia, 41: 1227-1229.
Szabo, C.A., Wyllie, E., Siavalas, E.L., Najm, I., Ruggieri, P.,
Kotagal, P. and Luders, H. (1999) Hippocampal volumetry in
children 6 years or younger: assessment of children with and
without complex febrile seizures. Epilepsy Res., 33(1): 1-9.
Tasch, E., Cendes, F., Li, L.M., Dubeau, F., Andermann, F. and
Arnold, D.L. (1999) Neuroimaging evidence of progressive
neuronal loss and dysfunction in temporal lobe epilepsy. Ann.
Neurol., 45: 568-576.
Theodore, W.H., Fishbein, D., Deitz, M. and Baldwin, P. (1987)
Complex partial seizures: cerebellar metabolism. Epilepsia,
28: 319-323.
Theodore, W.H., Bromfield, E. and Onorati, L. (1989) The ef-
fect of carbamazepine on cerebral glucose metabolism. Ann.
Neurol., 25: 516-520.
Theodore, W.H., Sato, S., Kufta, C., Balish, M.B., Bromfield,
E.B. and Leiderrnan, D.B. (1992) Temporal lobectomy for un-
controlled seizures: the role of positron emission tomography.
Ann. Neurol., 32: 789-794.
Theodore, W.H., Porter, R.J., Albert, P., Kelley, K., Bromfield,
E.B., Devinsky, O. and Sato, S. (1994) The secondary general-
313
ized tonic-clonic seizure: a videotape analysis. Neurology, 44:
1403-1408.
Theodore, W.H., Bhatia, S., Hatta, J., Fazilat, S., DeCarli, C.,
Bookheimer, S. and Gaillard, W.D. (1999) Hippocampal at-
rophy, epilepsy duration, and febrile seizures in patients with
partial seizures. Neurology, 52: 132-136.
Theodore, W.H., Bhatia, S., DeCarli, C., Gaillard, W.D. and
Hatta, J. (2000a) Lateral temporal lobe volumes in patients
with localization-related epilepsy. Ann. Neurol., 48: 463.
Theodore, W.H., DeCarli, C., Hatta, J., Fazilat, S., Fazilat, S.,
Bhatia, S. and Gaillard, W.D. (2000b) Thalamic volume and
glucose metabolism in temporal lobe epilepsy. Neurology,
54(suppl. 3): A5.
Theodore, W.H., Gaillard, W.D., DeCarli, C., Bhatia, S. and
Hatta, J. (2001) Hippocampal volume and glucose metabolism
in temporal lobe epileptic foci. Epilepsia, 42: 130-133.
Tokumitsu, T., Mancuso, A., Weinstein, P.R., Weiner, M.W.,
Naruse, S. and Maudsley, A.A. (1997) Metabolic and patho-
logical effects of temporal lobe epilepsy in rat brain detected
by proton spectroscopy and imaging. Brain Res., 744: 57-67.
VanLandingham, K.E., Heinz, E.R., Cavazos, J.E. and Lewis,
D.V. (1998) Magnetic resonance imaging evidence of hip-
pocampal injury after prolonged focal febrile convulsions.
Ann. Neurol., 43(4): 413-426.
Van Paesschen, W., Duncan, J.S., Stevens, J.M. and Connelly,
A. (1997) Etiology and early prognosis of newly diagnosed
partial seizures in adults. Neurology, 49: 753-757.
Van Paesschen, W., Duncan, J.S., Stevens, J.M. and Connelly, A.
(1998) Longitudinal quantitative hippocampal magnetic reso-
nance imaging study of adults with newly diagnosed partial
seizures: one-year follow-up results. Epilepsia, 39: 633-639.
Wang, Y., Majors, A. and Najm, I. et al. (1996) Postictal al-
teration of sodium content and apparent diffusion coefficient
in epileptic rat brain induced by kainic acid. Epilepsia, 37:
1000-1006.
Wieshmann, U.C., Woermann, F.G., Lemieux, L., Free, S.L.,
Bartlett, P.A., Smith, S.J., Duncan, J.S., Stevens, J.M. and
Shorvon, S.D. (1997) Development of hippocampal atrophy:
a serial magnetic resonance imaging study in a patient who
developed epilepsy after generalized status epilepticus. Epilep-
sia, 38: 1238-1241.
T. Sutula and A. Pitkanen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Published by Elsevier Science B.V.

CHAPTER 27

Summary: Evidence for seizure-induced damage in human

studies: epidemiology, pathology, imaging,
and clinical studies

Thomas Sutula 1,2,, and Asia Pitk~inen 3,4

1 Department of Neurology and 2 Department of Anatomy, University of Wisconsin, Madison, WI 53792, USA
3 Epilepsy Research Laboratory, A.L Virtanen Institute for Molecular Sciences, and 4 Department of Neurology,
Kuopio University Hospital, Kuopio, Finland

Experimental studies reviewed in Section II and
extensive literature on cell death mechanisms in an-
imal models have firmly established that prolonged
seizures and briefer episodes of neuronal synchro-
nization can activate pathways leading to neuronal
death. Although seizure-induced damage in humans
is easily recognized following status epilepticus, it
has been difficult in humans to detect evidence for
damaging effects of repeated brief seizures. Never-
theless, the adverse effects of continuing seizures
are prompting ever-increasing expectations for rapid
treatment in cases of status epilepticus (for example,
see Alldredge et al., 2001). Despite the increasing
emphasis on the importance of vigorous early treat-
ment of status epilepticus at shorter intervals after
onset (i.e., after briefer seizures!), epidemiological
studies and clinical anecdotes are frequently cited
as evidence against the possibility that there are cu-
mulative adverse effects of repeated brief seizures.
Examples of these perspectives, which have been a
dominant influence in clinical decision-making, are
reviewed in Chapters 19 and 20.
* Correspondence to: T. Sutula, Department of Neurology
H6/570, University of Wisconsin, Madison, WI 53792,
USA. Tel.: -t-1-608-263-5448; Fax: +1-608-263-0412;
E-mail: sutula @neurology.wisc.edu
Epidemiological studies clearly demonstrate that
not all seizures are inevitably progressive. When ap-
plied to clinical decisions such as when and how
vigorously seizures ought to be treated, epidemio-
logical studies suggest that not all seizures demand
aggressive treatment, especially when the relative
risks and benefits of anticonvulsant treatment must
be considered (Chapter 19). Epidemiological stud-
ies, however, also provide clear evidence that s o m e
syndromes are progressive. For example, a subset
of children experiencing prolonged or complicated
febrile seizures eventually develop mesial temporal
lobe epilepsy, which is unquestionably progressive
and cumulatively damaging (Chapter 19). Population
outcome measures, such as the aggregate risk for
developing recurrent seizures after an insult or first
seizure, are clearly of limited sensitivity for assess-
ment of adverse effects of single or repeated seizures
on neural circuitry, and certainly have limitations as
the basis for clinical decision-making in individual
cases, where syndromic classification is often not
possible. Given the evidence that there are signifi-
cant subsets of individuals who experience adverse
effects of seizures, and the perspective that genetic
background is an important variable that influences
damage after seizures (Chapter 12), clinical advice
to patients about the consequences of seizures must
be individualized.
316
This viewpoint is also supported by the epidemio-
logical data reported in Chapter 20, which reports a
subset of patients who demonstrate a significant in-
crease in risk for seizure recurrence with increasing
number of seizures. Interestingly, this increased risk
was noted in individuals who otherwise have a good
prognosis for going into remission. This difference
in risk for progression to epilepsy as a function of
preexisting risk factors has similarities to observa-
tions in experimental models reported in Chapters
6 and 8, where the effects of repeated seizures on
cumulative neuronal death were less in animals that
had an initial episode of status compared to initially
normal animals undergoing kindling. These human
population and experimental studies suggest that the
effects of seizures may vary as a function of the
previous activity in neural circuitry, a possibility also
suggested by distinct effects of preexisting lesions on
the development of kindling, and protection against
damaging effects of status epilepticus in previously
kindled rats (Kelley and McIntyre, 1994).
The importance of preexisting pathology as a de-
terminant of the course of epilepsy, as demonstrated
in epidemiological studies, is strongly supported by
retrospective clinical pathological correlation stud-
ies in medically intractable temporal lobe epilepsy
(Chapter 21). The presence of hippocampal sclerosis
in patients with intractable temporal lobe epilepsy is
often associated with an initial precipitating injury
(IPI), but the severity of the hippocampal neuronal
loss progresses as a function of the duration of
epilepsy. The increasing severity of the hippocampal
neuronal loss becomes most evident at long peri-
ods after the onset of the epilepsy, that is, 20-30
years duration, an interval that is also noted in cross-
sectional studies correlating cognitive performance
with duration of epilepsy (see Section V). Unfor-
tunately, slowly cumulative consequences of poorly
controlled epilepsy extending for such long intervals
are also extremely challenging for clinical research
studies.
Case studies of febrile status epilepticus occurring
in one member of identical twins have been similarly
informative about the significance of initial precipi-
tating injury and hippocampal damage. Complicated
febrile seizures with febrile status epilepticus occur-
ring in one twin from a pair of twins experiencing
febrile seizures has been followed by development
of hippocampal atrophy and epilepsy, while the twin
experiencing only simple febrile seizures has not
yet experienced recurring unprovoked seizures or
demonstrated hippocampal volume loss (Jackson et
al., 1998). Thus, retrospective clinical studies and
twin studies support the viewpoint that hippocampal
sclerosis, at least when defined as severe, visually
apparent neuronal loss in the hilus of the dentate
gyrus, CAI, and CA3 (Chapter 21), can be caused
by an initial precipitating injury, often status epilep-
ticus. This neuronal loss progresses with the course
of epilepsy, which is consistent with progression of
the primary lesion OR cumulative effects of repeated
seizures. Given recent observations of progressive
hippocampal atrophy in some patients without an
IPI (for example, see Briellman et al., 2001), these
observations support the viewpoint that hippocampal
neuronal loss, ultimately reaching the criteria of vi-
sually apparent 'hippocampal sclerosis', can be both
cause and effect of repeated seizures. These obser-
vations are also in line with the data presented about
the progression of damage after status epilepticus in
spontaneously seizing and kindled rats (Chapters 6,
8, 9).
Serial MRI studies in children experiencing
febrile status epilepticus have unequivocally demon-
strated that prolonged febrile seizures can result
in hippocampal atrophy and hippocampal sclero-
sis (Chapter 23). These observations directly con-
firm that injury occurring during status epilepticus
can produce the lesion of hippocampal sclerosis.
Whether this status epilepticus and hippocampal at-
rophy will turn out to be an 'initial precipitating in-
jury', as suggested by retrospective studies (Chapter
21), will be determined by longitudinal observation
of the hippocampal lesion, the incidence of devel-
opment of unprovoked seizures (i.e., epilepsy), and
assessment of cognitive function in this important
group of patients, which is underway (Chapter 23).
While determination of the outcome may require a
decade or more of prospective observation, it will
not be surprising if at least a subset of these patients
develops epilepsy.
The possible contribution of repeated seizures
to progression of hippocampal damage in human
epilepsy is now being addressed by magnetic res-
onance imaging (MRI) and other noninvasive in
vivo imaging techniques in both cross-sectional

and prospective studies (Chapter 22). Current tech-
niques can detect hippocampal and cerebellar vol-
ume changes of ~ 3 % and neocortical changes of
~1.6% (Chapter 22). Hippocampal volume loss or
atrophy has been correlated with the pathological
lesion of hippocampal sclerosis, and it is likely that
with the continuing refinement of MRI methods even
greater sensitivity will be possible.
Numerous cross-sectional MRI studies have
demonstrated that there is an association of more se-
vere hippocampal atrophy with duration of epilepsy,
and in some cases correlation of the atrophy with
estimated numbers of lifetime seizures has been
reported (Chapter 24). In medically intractable tem-
poral lobe epilepsy, the volume loss may involve
extrahippocampal and other regions of limbic cir-
cuitry, an observation also noted in experimental
studies of repeated seizures evoked by kindling (for
example, see Chapter 8 and Cavazos et al., 1994).
Structural damage at the time of the first spontaneous
seizures is relatively mild, and volume reductions are
not observed in well-controlled patients with tem-
poral lobe epilepsy (Chapter 24), which supports
that the atrophy is progressive. The progressive na-
ture of alterations in the temporal lobe has also
been suggested by studies using FDG-PET (Chapter
26). MR spectroscopy, which provides an indirect
measure of neuronal loss or dysfunction through
the N-acetylaspartate (NAA) to creatine (Cr) ratio
(NAA/Cr), also supports the viewpoint that there is
early neuronal injury at the onset of epilepsy, but
that repeated generalized seizures may induce ad-
ditional damage. Interestingly, the damaging effects
of repeated generalized seizures has also been noted
in pathological studies (for example, see Mouritzen
Dam, 1980; Chapters 6, 24, 25), experimental sta-
tus (Chapter 6), kindling (Chapter 8), and cognitive
studies (see Dikmen and Matthews, 1977).
At the present time, the majority of studies asso-
ciating severity of hippocampal atrophy with dura-
tion of epilepsy or estimated numbers of seizures
317
are cross-sectional, which precludes establishment
of cause or effect, or the interpretation that repeated
seizures produce the progressive volume loss. Longi-
tudinal studies using imaging and in vivo techniques
are underway, and may provide insight into the con-
tributions of the IPI and continuing seizures to the
cumulative damage in patients with epilepsy. While
not all patients will demonstrate progressive changes
or damage (Chapters 19, 20), clinicians must be at-
tentive to the subset of patients in whom progressive
changes are possibly related to continuing seizures,
and to the potentially adverse effects of recurring
seizures in poorly controlled patients. Continuing
seizures in this subset of patients should not be triv-
ialized, as duration of poorly controlled epilepsy is
associated with cumulative and progressive cognitive
impairment (Section V).
References
Alldredge, B.K., Gelb, A.M., Isaacs, S.M., Corry M.D., Allen,
E, Ulrich, S., Gottwald, M.D., O'Neil, N., Neuhaus, J.M.,
Segal, M.R. and Lowenstein, D.H. (2001) A comparison of
lorazepam, diazepam, and placebo for the treatment of out-of-
hospital status epilepticus. NEJM 345(9): 631-637.
Briellmann, R., Newton, M., Wellard, M. and Jackson, G. (2001)
Hippocampal sclerosis following brief generalized seizures in
adulthood. Neurology, 57: 318-320.
Cavazos, J.E., Das, I. and Sutula, T. (1994) Neuronal loss in-
duced in limbic pathways by kindling: evidence for induction
of hippocampal sclerosis by repeated brief seizures. J. Neu-
rosci., 14(5): 3106-3121.
Dikmen, S. and Matthews, C.G. (1977) Effect of major mo-
tor seizure frequency upon cognitive-intellectual functions in
adults. Epilepsia, 18: 21-29.
Jackson, G.D., Mclntosh, A.M., Briellmann, R.S. and Berkovic,
S.E (1998) Hippocampalsclerosis studied in identical twins.
Neurology, 51(1): 78-84.
Kelley, M.E. and Mclntyre, D.C. (1994) Hippocampalkindling
protects several structures from the neuronal damageresulting
from kainic acid induced status epilepticus. Brain Res., 634(2):
245-256.
Mouritzen Dam, A. (1980) Epilepsy and neuron loss in the
hippocampus. Epilepsia, 21: 617-629.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Published by Elsevier Science B.V.

CHAPTER 28

Seizure-induced damage in the developing human:

relevance of experimental models

Gregory L. Holmes 1,*, Rustem Khazipov 2 and Yehezkiel Ben-Ari 2

I Department of Neurology, Harvard Medical School, Center for Research in Pediatric Epilep~Lv, Children's Hospital,
Boston, MA 02115, USA
2 lnstitut National de la Santd de la Recherche Medicale, Unit 29, Institut de Neurobiologie de la Miditerran(e, Marseille, France

Abstract: A considerable amount of money and effort is spent every year investigating the effects of seizure on the
developing rodent brain. A critical question is the relevance of these studies to children. The goal of this chapter is to
review the relationship between seizures during early development and cognitive impairment in children and rodents.
While the majority of children with epilepsy have normal cognitive development, a small group of children with frequent,
recurrent seizures show progressive cognitive impairment. Likewise, in rodent models recurrent seizures during early
development are associated with cognitive impairment and histological changes including mossy fiber sprouting and
reduced neurogenesis. Status epilepticus is associated with a lower morbidity and mortality rate in children than in adults.
Status epilepticus in rodent models is associated with less cell loss and cognitive impairment than in adults. While rodent
studies can offer a great deal of insight into mechanisms of seizure-induced brain damage, they also have significant
limitations. No animal models have yet been developed that mimic human epileptic syndromes, such as infantile spasms,
Lennox-Gastaut syndrome, or the severe myoclonic epilepsies. In addition, rodent studies supply only crude measures of
learning and memory. Disturbances of language or higher cortical functions such as visual or auditory processing cannot
be tested in animal models.

Introduction discussed. Both recurrent seizure models and status

Epilepsy is one of the more severe developmen-
tal disabilities to occur in children. Children with
epilepsy are at high risk for academic and behav-
ioral problems. Understanding the mechanisms of
seizure-induced brain damage during development
requires the availability of animal models that mimic
the clinical situation. In this review, the relevance of
animal models to the human condition in assessing
seizure-induced brain injury during development is
* Correspondence to: G.L. Holmes, Clinical Neurophysi-
ology Laboratory, Hunnewell 2, Children's Hospital, 300
Longwood Avenue, Boston, MA 02115, USA. Tel.: +1-
617-355-8461; Fax: +1-617-738-1734;
E-mail: gregory.holmes @tch.harvard.edu
epilepticus will be reviewed. Table 1 summarizes
some of the key points of this presentation.
Seizure-induced damage in children: recurrent
seizures
Epilepsy is more c o m m o n in children than adults. In
the United States, there are approximately 125,000
new cases of epilepsy each year; 30% of this group
will be less than 18 years old at the time of diagnosis
(Hauser and Hersdorffer, 1990). The largest number
of newly diagnosed cases of epilepsy occurs among
children under the age of 2 years.
There is general agreement that childhood
epilepsy carries a significant risk for a variety of
problems involving cognition and behavior. The dis-
tribution of IQ scores of children with epilepsy is
322

TABLE 1
Summary of clinical observations and basic observations with regard to childhood seizures
Features
Seizure susceptibility
Effects of status epilepticus on brain
development
Types of deficits following status
epilepticus in children
Pathological lesions following status
epilepticus in children
Effects of recurrent seizures on the
brain
Types of deficits following recurrent
seizures in children
Effects of recurrent seizures on
subsequent seizure susceptibility
Pathological lesions following recurrent
seizures in children
Clinical observations
High susceptibility in children
Prognosis in children is better than adults
Vary from profound effects on motor and
cognitive function to subtle defects in
attention and higher cortical function
Cell loss; synaptic reorganization; mesial
temporal sclerosis
Recurrent seizures more detrimental in
children than adults
Vary from none to progressive loss of
cognitive skills
No evidence that seizures beget seizures
Cell loss; synaptic reorganization
Basic observations
High susceptibility in immature animals
Immature brain less susceptible to status
epilepticus-induced injury
Limited repertoire of behavior in rodents
makes assessment of subtle neurological
deficits difficult
Minimal cell loss and synaptic reorganization
in hippocampus, necrosis in the thalamus in
animals <P20; cell loss; synaptic
reorganization; mesial temporal sclerosis in
older animals
Not clear whether the immature brain is more
or less prone to injury induced by recurrent
seizures than the mature brain
Impairment in tasks of visual-spatial memory;
activity level
Clear evidence for chemical and electrical
kindling
Cell loss; synaptic reorganization

skewed toward lower values (Farwell et al., 1985;
Neyens et al., 1999) and the number of children
experiencing difficulties in school because o f learn-
ing disabilities or behavioral problems is greater
than in the normal population (Sillanpaa et al.,
1998; W i l l i a m s et al., 1998; Bailet and Turk, 2000;
W a k a m o t o et al., 2000). Even children with normal
IQs and well-controlled seizures are at high risk for
learning problems (Bailet and Turk, 2000).
There is evidence that some children with
epilepsy slow in their mental development (Neyens
et al., 1999) or even have progressive declines o f IQ
on serial intelligence tests and behavioral and psychi-
atric deterioration over time (Bourgeois et al., 1983;
Farwell et al., 1985; Rodin et al., 1986; Funakoshi
et al., 1988). W h i l e there are a number of factors,
such as etiology o f the seizures and antiepileptic
drug therapy, that could contribute to this cognitive
impairment, there is evidence that recurrent seizures
play an important role in this cognitive impairment
(Farwell et al., 1985; Holmes, 1997). W h i l e cog-
nitive deterioration can occur in adults after many
years o f seizures (Jokeit and Ebner, 1999), like chil-
dren, most adults with m e d i c a l l y intractable epilepsy
have stable neuropsychological test scores (Holmes
et al., 1998b).
There are indications from the literature that the
earlier the age of onset o f seizures, the higher the
likelihood of neurological sequelae. Seizures during
the neonatal period appear to be particularly detri-
mental (Bergman et al., 1983; Painter et al., 1986;
Huttenlocher and Hapke, 1990; Ko and Holmes,
1999). Between 20 and 40% of term infants who
have seizures are subsequently handicapped and this
increases to almost 90% in preterm infants (Scher et
al., 1993). Vasconcellos et al. (2001), in a study o f
100 patients with intractable epilepsy secondary to
focal brain lesions, found that the younger ages at
seizure onset were associated with lower IQ scores.
Children with onset of epilepsy before 24 months
had a F S I Q that was 14 points below that seen in
patients with onset after 24 months.
The type o f epileptic syndrome plays a critical
variable in outcome (Bulteau et al., 2000). Children
with benign Rolandic epilepsy, febrile seizures, and
absence seizures typically do very well from a cog-

nitive standpoint, whereas children with syndromes
such as severe myoclonic epilepsy of infancy, in-
fantile spasms, myoclonic-astatic epilepsy, Lennox-
Gastaut syndrome, and Landau-Kleffner syndrome
do poorly. In syndromes with poor outcomes, the
cause of the poor cognitive outcome may not neces-
sarily be secondary to the seizures per se, but the on-
going subclinical epileptiform activity on the EEG.
For example, some children with Landau-Kleffner
syndrome have few or no seizures, but have severely
abnormal EEGs. The term epileptic encephalopathy
has been used to describe those children who suffer
from cognitive deterioration secondary to frequent
EEGs, frequent epileptiform activity on the EEG, or
both (Tassinari et al., 2000; Zupanc, 2001).
The question of how much damage, if any, occurs
with recurrent seizures in children remains unan-
swered. Distinguishing the effects of seizures from
the underlying brain process causing the seizures
and the adverse effects of therapy is difficult. For
example, the observation that an early age of onset
of seizures results in a poorer prognosis than that
occurring when seizures start at an older age, must
be interpreted cautiously. Disorders that present with
an early age of onset may be more severe than dis-
orders beginning at a later age. The age of seizure
onset may simply be a marker of the underlying
disease process rather than a cause of the cognitive
dysfunction.
Seizure-induced damage in developing animals:
recurrent seizures
Epileptic seizures consist of massive depolarization
of network of neurons that result in action potentials,
release of neurotransmitters, including glutamate,
entry of calcium and activation of a transduction
pathways. It follows that seizures may perturb a
wide range of developmental phenomena that are
activity-dependent, including cell division, migra-
tion, sequential expression of receptors, formation,
and probably stabilization of synapses (Holmes and
Ben-Ari, 1998). There is increasing evidence that
seizures can modify - - slow down or accelerate -
a wide range of unique processes that take place
during development and are essential for the correct
formation and wiring of the circuitry.
323
Seizure-induced behavioral changes
There are now a number of studies demonstrating
that recurrent seizures during early development can
result in long-term morphological and behavioral
changes (Wasterlain and Plum, 1973; Holmes et al.,
1998a, 1999; Liu et al., 1999; Wasterlain, 1997). Our
laboratory has used the flurothyl-inhalation model to
induce generalized seizures during the first weeks
of life (Holmes et al., 1998a; Huang et al., 1999;
Liu et al., 1999; Schmid et al., 1999). This is a
useful model for developmental studies since the
seizures are readily and reliably induced with the
duration of the ictus easily controlled by the exam-
iner. The seizures are associated with a low mortal-
ity rate. Sprague-Dawley rats subjected to a series
of recurrent seizures during the first weeks of life
demonstrate cognitive impairment when the animals
are studied during adolescence or adulthood. Using
the Morris water maze, a measure of visual-spatial
memory (Morris et al., 1982, 1986; Liu et al., 1999),
a number of investigators (Holmes et al., 1998a;
Neill et al., 1996; Huang et al., 1999) have found
that recurrent neonatal seizures are associated with
long-term cognitive dysfunction. Neill et al. (1996)
found that recurrent seizures in young rats between
the ages of 15 and 20 days result in an impairment of
auditory discrimination.
Synaptic reorganizationfollowing seizures
Despite the effects of recurrent seizures on cognitive
function, recurrent seizures during the first 2 weeks
of life result in no discernible cell loss (Holmes
et al., 1998a, 1999; Liu et al., 1999). Following
seizures, there is extensive synaptic reorganization
of the axons and terminals of the dentate granule
cells, also termed mossy fibers, when the animals are
studied as adults (Holmes et al., 1998a; Huang et al.,
1999). The sprouting of mossy fibers occurs in both
the molecular region of the dentate granule cells as
well as the CA3 hippocampal subfield (Fig. 1). Un-
like studies examining sprouting following recurrent
seizures in adult animals (Cavazos et al., 1991), the
sprouting seen in animals with seizures during the
first 2 weeks of life is not associated with cell loss
(Holmes et al., 1998a; Huang et al., 1999; Liu et al.,
1999).
324

Fig. 1. Example of mossy fiber sprouting in control rats (A,C) and rats with neonatal flurothyl seizures (B,D). In the rat with a history of
multiple flurothyl seizures as neonates, there is increased Timm staining (arrows) in the stratum pyramidale and stratum oriens of CA3
(B) compared to the controls (A). Increased Timm staining was also greater in the inner molecular layer of the dentate granular cell layer
(arrows) in the rats with neonatal seizures (D) compared to the controls (C). Scale bar: 75 txm in A,B; 50 gm in C,D. From Huang et al.
(1999) with permission.

An important question is whether there is any re-
lationship between the morphological changes seen
and the cognitive impairment. To address this ques-
tion, De Rogalski Landrot et al. (2001) compared
performance in the water maze and mossy fiber
sprouting in CA3 following a series of 55 seizures
induced with flurothyl during the first 12 days of
life. The animals were tested during adolescence.
Animals subjected to neonatal seizures performed
much poorer in the water maze than control ani-
mals, never reaching the level of performance of the
controls, despite 8 training days in the water maze
(Fig. 2). There was an inverse correlation between
degree of mossy fiber sprouting in the CA3 regions
with visual-spatial learning in the water maze in rats
with a prior history of neonatal seizures. Animals
with the most extensive sprouting in CA3 had the
poorest water maze performance (Fig. 3). Unlike the
CA3 sprouting, sprouting in the granule cell layer of
the dentate gyms was not correlated with water maze
performance.
Other investigators reported that the degree of
stratum pyramidale mossy fiber projections corre-
lates with learning (Lipp et al., 1984; Crusio et al.,
1987; Lipp et al., 1988). Lipp et al. (1988) showed
that the magnitude of the stratum pyramidale pro-
jections of mossy fibers correlated with number of
trials to criterion in two-way avoidance learning with
animals having more CA3 mossy fiber terminals do-
ing poorer than animals with fewer terminals. These
authors reported an inverse relationship between the
extent of infrapyramidal mossy fiber projections and
 325

110" Neonatal Seizures

100-

o 90-

"-" 80-
u
~" 70-

~ 60-
o. 50-
u
~ 40-
c
30-

~E 20-

10-

D1 D2 D3 D4 D5 D8 D7 D8

Day of Testing
Fig. 2. Comparison of escape latencies to platform in the water maze (mean+SEM) in animals subjected to 55 neonatal seizures and
controls. Note that both groups improved their performance during the testing period although the rats with the neonatal seizures never
achieved the performance of the controls even after 8 days of training. Modified from De Rogalski Landrot et al. (2001) with permission.

5.0x 10 o4.

4 . 0 x 1 0 04.

3,0x10 o4" • J • -

2,0x10 o4"

_m_ ~ ~ ~i ~ - ~ ~ . . . . . . - ~ -- ~ - ~

1.0x10 °4-
" • m a _ J ' ' ~ •

O.Ox I 0 ° °
0 5'0 100 150
Mean Time To Water Maze Platform
Fig. 3. Linear regression of mean water maze score versus Timm density measurement from CA3 pyramidal cell layer in both the
controls and rats subjected to neonatal seizures. The slope of the line was significantly different from zero (P = 0.005). Modified from
De Rogalski Landrot et al. (2001) with permission.
326
two-way avoiding learning in rats treated with L-
thyroxine (Lipp et al., 1984). Cmsio et al. (1987)
found that the size of the hippocampal stratum pyra-
midale and infrapyramidal mossy fiber terminal field
correlated inversely with error number in a radial-
maze test. While it is tempting to suggest that the
CA3 sprouting is responsible for the cognitive im-
pairment seen following recurrent seizures in young
rats (De Rogalski Landrot et al., 2001), it is possible
that the sprouting is a marker of cognitive impair-
ment and is not directly related to the deficits seen
in the rats with recurrent neonatal seizures. At the
present time, the causes for the impaired learning
following neonatal seizures is unclear.
Neurogenesis
There is now evidence that seizures during early de-
velopment can alter the formation of new neurons. It
is now known that neurogenesis continues through-
out life in selected brain regions and can be modified
by many factors. Neurogenesis in the dentate gyms
of adult rodents has been demonstrated to be mod-
ified by excitatory input and N-methyl-D-aspartate
(NMDA) receptor activation (Cameron et al., 1995),
adrenal steroids (Cameron and Gould, 1994; Gould
and Tanapat, 2000) or adrenalectomy (Cameron and
Gould, 1996; Montaron et al., 1999), growth factors
(Cameron et al., 1998; Wagner et al., 1999), envi-
ronmental stimuli (Gould et al., 1999; Young et al.,
1999), running (Van Praag et al., 1999a,b), estrogen
(Tanapat et al., 1999), stress (Gould et al., 1998;
Tanapat et al., 1998), ischemia (Liu et al., 1998),
malnutrition (DeBassio et al., 1996), and seizures
(Bengzon et al., 1997; Gray and Sundstrom, 1998;
Parent et al., 1997; Parent et al., 1998; Scott et al.,
1998).
Neurogenesis is more robust during the first
weeks of life than later in life. Dentate granule
cells begin to originate on embryonic (E) day 17
and by E22 the dentate gyms is present throughout
the hippocampus (Bayer, 1980). Only about 20% of
the granule cells are present at birth in the rat; by
P5, about 50% of granule cells are present. While
neurogenesis continues into adulthood, the rate of
neurogenesis declines significantly with age of the
animal (Altman and Das, 1965; Mehler and Kessler,
1999; Young et al., 1999). The progressive thicken-
ing of the granule cell layer of the dentate gyms after
birth is due to accumulation of neurons proliferating
along its inner (hilar) margin (Angevine, Jr., 1965).
McCabe et al. (2001) studied the extent of neu-
rogenesis in the granule cell layer of the dentate
gyms over multiple time points following a series
of 25 flurothyl-induced seizures administered be-
tween postnatal day (P) 0 (Lamsa et al., 2000) and
P4. Rats with neonatal seizures had a signifcant
reduction in the number of the thymidine analog
5-bromo-2'-deoxyuridine-5'-monophosphate (BrdU)
labeled cells in the dentate gyms and hilus com-
pared to the control groups when the animals were
sacrificed either 36 h or 2 weeks after the BrdU injec-
tions. The reduction in BrdU-labeled cells continued
for 6 days following the last seizure. BrdU-labeled
cells largely co-localized with the neuronal marker
neuron-specific nuclear protein (NeuN) (Wolf et al.,
1996) and rarely co-localized with the glial cell
marker glial fibrillary acidic protein (GFAP), pro-
viding evidence that a very large percentage of the
newly formed cells were neurons. Immature rats sub-
jected to a single seizure did not differ from controls
in number of BrdU-labeled cells. In comparison,
adult rats undergoing a series of 25 flurothyl-induced
seizures had a significant increase in neurogenesis
compared to controls. This study indicates that fol-
lowing recurrent seizures in the neonatal rat there
is a reduction in newly born granule cells. We have
also found that recurrent neonatal seizures are asso-
ciated with reduced neurogenesis of granule cells of
the dentate gyrus (McCabe et al., 2001), unlike the
situation in adult rats where recurrent seizures are
associated with increased neurogenesis (Bengzon et
al., 1997; Parent et al., 1998; Scott et al., 1998).
These seizure-induced decreases in neurogenesis
are consistent with prior studies by Wasterlain and
colleagues (Wasterlain and Plum, 1973; Wasterlain,
1976, 1978) who concluded that recurrent neonatal
seizures, while not causing cell death, resulted in
reduced cell number. Wasterlain and Plum (1973)
compared the effects of 10 daily electroconvulsive
seizures on rats from P2 to 11, P9 to 18, and P19
to 28 days. Animals receiving neonatal (P2-11) or
infantile seizures (P9-18) had significantly smaller
brains than controls. In addition, neonatal seizures
reduced brain DNA, RNA, protein and cholesterol.
The authors interpreted these findings to indicate a

reduction of cell number, but not cell size, in rats
with neonatal seizures. Altered developmental mile-
stones and reduced seizure thresholds were found
several weeks after the status.
Mathem et al. (1994) have demonstrated reduc-
tions in the number of granule cells in temporal
lobe specimens from children with non-temporal
lobe epilepsy. These patients typically had cerebral
malformations outside the temporal lobe and had
frequent seizures, resulting in surgical resection. In
addition, despite the lack of any significant cell loss
elsewhere in the hippocampus, sprouting of mossy
fibers was present.
Animals subjected to neonatal seizures with
flurothyl do not have reductions in granule cell num-
ber when the animals are sacrificed as adults. It is
therefore likely that there is a subsequent increase in
neurogenesis, decrease in apoptosis, or both, follow-
ing the initial series of seizures. The patients reported
by Mathern et al. (1994) with reduced granule cells
were having frequent seizures up until the time of
their surgery, while in the study of McCabe et al.
(2001), rats had no seizures after the neonatal period.
Seizure-induced changes in cerebral excitability
Recurrent seizures result in subsequent alterations in
seizure susceptibility (Holmes et al., 1998a, 1999;
Mosh6 and Albala, 1982) and altered excitability
in the CA1 hippocampal subfield (Villeneuve et
al., 2000). Rats kindled as pups will have lasting
changes in seizure susceptibility despite the lack
of cell loss (Mosh6 and Albala, 1982). Intracellular
recordings of CA1 and CA3 pyramidal neurons from
rats subjected to a series of 25 neonatal seizures
and then studied as adolescents revealed no signifi-
cant differences in resting membrane potential, input
resistance, membrane time constant or action po-
tential characteristics. However, firing properties of
CA1 pyramidal cells from flurothyl-treated rats had
marked reductions in spike frequency adaptation and
a reduced amplitude of the afterhyperpolarizing po-
tential following a spike train, factors that are likely
to result in increased excitability of the hippocampal
circuitry. In parallel studies, these rats were found
to have an altered seizure threshold (Holmes et al.,
1998a, 1999). However, spontaneous seizures were
never observed in these animals.
327
Relevance of animal studies
While rodent studies can offer a great deal of insight
into mechanisms of seizure-induced brain damage,
they also have significant limitations. No animal
models have yet been developed that mimic hu-
man epileptic syndromes such as infantile spasms,
Lennox-Gastaut syndrome, or the severe myoclonic
epilepsies. In addition, rodent studies supply only
crude measures of learning and memory. Distur-
bances of language or higher cortical functions such
as visual or auditory processing cannot be tested in
animal models.
Seizure-induced damage in children: status
epilepticus
Status epilepticus is a major neurological and medi-
cal emergency associated with a high morbidity and
mortality rate. Status epilepticus is most common in
young children (Pellock, 1993). In an analysis of the
records of 394 children, aged 1 month to 16 years
with status epilepticus, greater than 40% of the cases
occurred in children younger than 2 years (Shinnar
et al., 1997).
Both the mortality and morbidity of status epilep-
ticus has declined over the past 30 years. In the
study of Aicardi and Chevrie (1970) of 239 cases
of status epilepticus in children with a duration of
at least 60 min, acquired neurological deficits were
found after the status epilepticus in 47 (20%) and
mental retardation in 78 (33%). The total incidence
of new mental and neurological abnormalities fol-
lowing status epilepticus was 34%. The incidence
of neurological deficits following status epilepticus
has been substantially lower in more recent studies
(Maytal et al., 1989; Shinnar et al., 2001). In a study
of status epileptieus in children, Maytal et al. (1989)
found new neurologic deficits in 17 (9%) of the 186
survivors. All of the deaths and almost all of the
neurologic sequelae (15 of 17 cases) occurred in the
56 children with an acute or progressive neurological
disorder. Neurologic sequelae were age-dependent,
occurring in 29% of infants younger than 1 year of
age, 11% of children 1-3 years of age, and 6% of
children older than 3 years. However, these results
reflected the greater incidence of acute neurologic
disease in the younger age groups. It is likely that
328
the improved mortality and morbidity rates associ-
ated with status epilepticus are due to earlier and
improved methods of treatment.
Children have a lower morbidity and mortality
rate following status epilepticus than adults (Maytal
and Shinnar, 1995; DeLorenzo et al., 1996). While
overall outcome following status epilepticus appears
more favorable in children than adults, children may
incur neurologic sequelae, even when appropriately
managed (Kwong et al., 1995; Van Esch et al., 1996;
Eriksson and Koivikko, 1997). In a retrospective
study of 65 children treated for status epilepticus
in Finland, neurological sequelae secondary to sta-
tus epilepticus were identified in 15% of the cases
and subsequent epilepsy in 23% during the mean
follow-up time of 3.6 years (Eriksson and Koivikko,
1997). Van Esch et al. (1996) retrospectively stud-
ied 57 children (age 6-57 months) who had status
epilepticus secondary to fever. None of the children
had previous seizures or neurological abnormalities.
Twelve children (21%) had subsequent neurologi-
cal sequelae varying from speech deficits in nine
children to severe neurologic deficits and epilepsy
in the other three children. In this study, the most
important predictors of adverse sequelae were the
numbers of drugs needed for seizure termination and
the duration of the seizures.
There is limited data on the neuropathological
consequences of status epilepticus in young children
since few children die during the status epilepticus.
As discussed by others in this volume, there are
indications that some children with status epilepticus
may develop mesial temporal sclerosis.
Seizure-induced damage in developing animals:
status epilepticus
Animal studies have demonstrated that the patho-
physiological consequences of status epilepticus in
the developing brain differ from those of the ma-
ture brain. In the adult animal, status epilepticus
causes neuronal loss in hippocampal fields CA1,
CA3, and the dentate hilus (Meldrum and Brierley,
1973; Meldrum et al., 1973; Ben-Aft et al., 1978,
1980a,b; Nadler et al., 1978; Olney et al., 1979;
Nadler, 1981; Sloviter and Damiano, 1981; Sloviter,
1983; reviewed in Ben-Aft, 1985), with the pattern
of cell loss dependent upon the agent used to in-
duce the seizures. Studies using quantitative depth
EEGs as well as local measures of blood flow and
oxygen consumption and lesions have shown that
the seizures in the CA3 region is due to excessive
neuronal activity per se and cannot be attributed to
global disturbances (Ben-Ari, 1987). Cellular dam-
age occurs from excessive excitatory neurotransmit-
ter release which activates NMDA receptors and
voltage-activated Ca 2+ channels, allowing Ca 2+ to
enter the cell. Ca 2+ and other ionic changes result
in a cascade of biochemical changes eventually re-
sulting in cell death (Lipton and Rosenberg, 1994).
High Ca 2+ leads to generation of reactive oxygen
species via activation of nitric oxide synthase, un-
couples oxidative phosphorylation in mitochondria,
and activates a large range of enzymes, such as li-
pases, proteases, endonucleases, and other catabolic
enzymes that collectively have adverse consequences
for cell function (De Keyser et al., 1999).
Seizures in the adult brain lead to various forms of
synaptic plasticity, including long-term potentiation
of synaptic responses, a process that is reminiscent
of that occurring in memory processes (Ben-Aft and
Gho, 1988). This is followed by alterations in the
cortical network that result in a reduction of seizure
threshold. Seizures have been shown to activate hun-
dreds of genes that lead to axonal growth and neosy-
naptogenesis (Represa and Ben-Aft, 1997). Thus,
prolonged seizures can cause synaptic reorganization
with aberrant growth (sprouting) of granule cell ax-
ons (the so-called mossy fibers) in the supragranular
zone of the fascia dentata and infrapyramidale region
of CA3 in the supragranular zone of the fascia den-
tata (Represa et al., 1987; Tauck and Nadler, 1985)
and infrapyramidale region of CA3 (Represa et al.,
1987).
Since glutamate is the neurotransmitter of the
mossy fibers, it is likely that this sprouting results in
an excessive degree of excitation of dentate granule
cells and, perhaps more importantly, CA3 pyramidal
neurons. As a further indication of the role of ex-
citability in the generation of synaptic plasticity is
the observation that blocking one of the glutamate
subreceptors (NMDA) retards the development of
mossy fiber development (McNamara and Routten-
berg, 1995; Sutula et al., 1996). Sprouting and neosy-
napse formation occur in other brain regions - - no-
tably the CA 1 pyramidal neurons, where it has been

recently shown that newly formed synapses produce
an enhanced frequency of glutamatergic spontaneous
synaptic currents (Esclapez et al., 1999). These al-
terations appear to be a general response of cortical
networks to hyperactivity; the consequences of the
seizures far outlasting the effects of the initiating
event. Additionally, status epilepticus in adult rats
results in long-term deficits in learning, memory,
behavior (Stafstrom et al., 1993; Rice et al., 1998;
Kelsey et al., 2000).
Status epilepticus in adult rats also result in
changes in interneuron function (Cossart et al.,
2001). Both kainate- and pilocarpine-induced status
epilepticus results in a loss of GABA interneurons
containing somatostatin that have their cell body in
stratum oriens and project to lacunosum moleculare
(O-LM interneurons). This loss is selective as sev-
eral other interneurons, including basket cells that
innervate the soma of the principal cells, do not
degenerate. Direct patch recordings from the apical
dendrites of pyramidal neurons in epileptic slices
revealed a loss of the spontaneous inhibitory tone
(50% reduction of the mean frequency of spon-
taneous IPSCs). In contrast, somatic GABAergic
inhibition was not reduced. These observations sug-
gest that the failure of inhibition in temporal lobe
epilepsy is restricted to the dendrites of pyramidal
neurons. The parallel increase of glutamatergic drive
and the reduction of dendritic inhibition leads to a
highly significant change of the GABA/glutamate
ratio in the dendrites of the principal cells. As den-
dritic inhibition is known to control the generation
and propagation of calcium currents in the dendrites,
there will be a facilitated generation and propagation
of epileptiform events from the dendrites to the cell
body. However, the maintenance of somatic inhibi-
tion - - that controls the generation of sodium action
potentials and hence the output of the system -
will prevent the occurrence of seizures continuously.
Interestingly, the higher spontaneous discharge of
surviving interneurons observed in that study most
likely reflects an attempt to prevent ongoing seizures.
Clearly, therefore, the notion of failure of inhibition
must be re-evaluated to include more subtle changes,
notably a mismatch between dendritic and somatic
inhibitions as well as a differential plasticity between
glutamatergic pyramidal neurons and interneurons.
Young animals are less vulnerable to cell loss
329
following a prolonged seizure than mature animals
(Albala et al., 1984; Berger et al., 1984; Nitecka
et al., 1984; Tremblay et al., 1984; Holmes et al.,
1988c; Hirsch et al., 1992; Stafstrom et al., 1993).
Sprouting of mossy fibers is less prominent fol-
lowing prolonged seizures in young animals than
seizures of similar duration in older animals (Sper-
b e r e t al., 1991; Yang et al., 1998). However, the
immature brain is not totally resistant to seizure-
induced brain damage. Starting at approximately 2
weeks of life of age rats with status epilepticus will
demonstrate cell loss and sprouting (Sankar et al.,
1998). Kubovfi et al. (2001) recently demonstrated
that status epilepticus can result in necrotic damage
in the mediodorsal nucleus of the thalamus in rat
pups.
Developing neurons are less vulnerable, in terms
of neuronal damage and cell loss, than adult neu-
rons to a wide variety of pathological insults. For
example, immature hippocampal neurons will con-
tinue responding to synaptic stimuli in a fully anoxic
environment for longer durations than adult ones;
likewise, longer anoxic episodes are required to irre-
versibly destroy the circuit in young animals (Cheru-
bini et al., 1989). The immature brain also appears
to be more 'resistant' to the toxic effects of glu-
tamate than the mature brain (Bickler et al., 1993;
Liu et al., 1996; Marks et al., 1996). Marks et al.
(1996) found that the degree of Ca 2+ entry into the
hippocampal subfield CA1 and subsequent damage
was directly related to age. In P1-3 neurons, glu-
tamate increased intracellular Ca 2+ minimally while
in P21-25, neurons glutamate resulted in marked
increases in intracellular Ca 2+ and caused severe
swelling of the cell and retraction of dendrites into
the soma of the neuron. This relative resistance is
thought to be due to the smaller density of active
synapses, lower energy consumption, and in general,
the relative immaturity of biochemical cascades that
lead to cell death following insults.
Behavioral consequences following status epilep-
ticus are also related to age of the animal at the time
of the status; adult animals surviving status epilep-
ticus have significant deficits in learning, memory,
and behavior whereas young rats following status
epilepticus had fewer deficits in learning, memory,
and behavior (Stafstrom et al., 1993; Liu et al.,
1995). Likewise, spontaneous seizures following sta-
330
tus epilepticus are more likely to occur in adult an-
imals experiencing status epilepticus than in young
animals (Cronin and Dudek, 1988; Cronin et al.,
1992; Stafstrom et al., 1992).
While overt cell loss and synaptic organization
appear to be minimal during the first weeks of life
(Cilio et al., 1999), this does not mean that status
epilepticus does not alter the developing brain. Koh
et al. (1999) studied the effects of status epilepticus
in the second week of life on subsequent seizure-
induced neuronal damage and behavior. Systemic
kainate was used to induce seizures on day 15 of life
and again in adulthood, at postnatal day 45. While
kainic acid seizures on day 15 did not result in any
detectable injury or cell death, it predisposed animals
to more extensive neuronal injury after the second
seizure in adulthood. Moreover, although early-life
kainic acid-induced seizures caused no impairment
of spatial learning, animals that had early-life and
adult seizures performed significantly worse than
those who had seizures only as an adult. This study
demonstrated that early-life seizures, without caus-
ing overt cellular injury, predisposed the brain to the
damaging effects of seizures later in life. Likewise,
Schmid et al. (1999) reported that status epilepti-
cus in adolescent rats with a history of neonatal
seizures caused substantially more damage than in
animals without a history of neonatal seizures. The
authors found no cell loss in animals that had neona-
tal seizures only. While the mechanism by which this
enhanced susceptibility to injury is not yet known,
the study provides further evidence that seizures can
alter the developing brain by means other than cell
loss.
Comparison of human and animal studies: status
epilepticus
There are parallels between human and rodent stud-
ies in status epilepticus. Both clinical and animal
studies suggest that the immature brain is more prone
to status epilepticus, but less vulnerable to long-term
sequelae. Animal models are useful in comparing the
pathophysiology of status epilepticus-induced brain
damage in immature and mature rats. However, an-
imal models are not very useful in assessing clini-
cally relevant, but subtle defects in human cognitive
abilities such as language-based learning deficits.
Of course, a detailed comparison will have to also
include primate data. A recent study has shown
that seizures are readily generated by bicuculline in
primates in utero in hippocampal sliced already 2
months before birth (Khazipov et al., 1999). Future
studies in primates notably will provide direct data
on the age relevance between animal models and
neonate infants.
Conclusions
While much can be learned from animal models
regarding the pathophysiology of seizure-induced in-
jury, there are serious limitations in extrapolating
animal results to the human condition. The reper-
toire of behaviors in the rodent is limited and many
aspects of higher cortical function in humans can-
not be tested. For example, rodent models provide
no insight into the mechanisms of such problems
as language impairment and attention deficit dis-
orders, both of which can occur in children with
epilepsy. Also, the behavioral and electroencephalo-
graphic characteristics of seizures in rodent models is
restricted and human conditions such as severe my-
oclonic epilepsy of infancy, Landau-Kleffner syn-
drome, or infantile spasms have not yet been mod-
eled.
Acknowledgements
This research was supported by the Emily R Rogers
Research Fund and a grant to GLH from the NINDS
(NS27984).
References
Aicardi, J. and Chevrie, J.J. (1970) Convulsive status epilepticus
in infants and children. Epilepsia, 11: 187-197.
Albala, B.J., Moshr, S.L. and Okada, R. (1984) Kainic-acid-
induced seizures: a developmental study. Dev. Brain Res., 13:
139-148.
Altman, J. and Das, G.D. (1965) Autoradiographic and histolog-
ical evidenceof postnatal hippocampalneurogenesis in rats, J.
Comp. Neurol., 124: 319-336.
Angevine Jr., J.B. (Jr., 1965) Time of neuron origin in the
hippocampal region. An autoradiographic study in the mouse.
Exp. NeuroL, Suppl. 2: 1-70.
Bailet, L.L. and Turk, W.R. (2000) The impact of childhood
epilepsy on neurocognitive and behavioral performance: a
prospective longitudinal study. Epilepsia, 41: 426-431.

Bayer, S.A. (1980) Development of the hippocampal region in
the rat. I. Neurogenesis examined with 3H-thymidine autora-
diography. J. Comp. NeuroL, 190: 87-114.
Ben-Aft, Y. (1985) Limbic seizure and brain damage produced
by kainic acid: mechanisms and relevance to human temporal
lobe epilepsy. Neuroscience, 14: 375-403.
Ben-Ari, Y. (1987) Brain damage cause by seizure activity.
Electroencephalogr. Clin. Neurophysiol., 39(Suppl.): 209-211.
Ben-Aft, Y. and Gho, M. (1988) Long-lasting modification of the
synaptic properties of rat CA3 hippocampal neurones induced
by kainic acid. J. Physiol., 404: 365-384.
Ben-Ari, Y., Lagowska, Y. and Le Gall La Salle, G. et al. (1978)
Diazepam pretreatment reduces distant hippocampal damage
induced by intra-amygdaloid injections of kainic acid. Eur. J.
Pharmacol., 52: 419-420.
Ben-Ari, Y., Tremblay, E. and Ottersen, O.P. (1980a) Injections
of kainic acid into the amygdaloid complex of the rat: an
electrographic, clinical and histological study in relation to the
pathology of epilepsy. Neuroscience, 5:515-528.
Ben-Aft, Y., Tremblay, E. and Ottersen, O.P. et al. (1980b) The
role of epileptic activity in hippocampal and 'remote' cerebral
lesions induced by kainic acid. Brain Res., 191: 79-97.
Bengzon, J., Kokaia, Z. and Elm6r, E. et al. (1997) Apoptosis
and proliferation of dentate gyrus neurons after single and
intermittent limbic seizures. Proc. Natl. Acad. Sci. USA, 94:
10432-10437.
Berger, M.L., Tremblay, E. and Nitecka, L. et al. (1984) Matura-
tion of kainic acid seizure-brain damage syndrome in the rat,
III. Postnatal development of kainic acid binding sites in the
limbic system. Neuroscience, 13:1095-1104.
Bergman, I., Painter, M.I. and Hirsch, R.P. et al. (1983) Outcome
of neonates with convulsions treated in an intensive care unit.
Ann. Neurol., 14: 642-647.
Bickler, P.E., Gallego, S.M. and Hansen, B.M. (1993) Devel-
opmental changes in intracellular calcium regulation in rat
cerebral cortex during hypoxia. J. Cereb. Blood Flow Metab.,
13: 811-819.
Bourgeois, B.ED., Prensky, A.L. and Palkes, H.S. et al. (1983)
Intelligence in epilepsy: A prospective study in children. Ann.
Neurol., 14: 438-444.
Bulteau C., Jambaque, I. and Viguier, D. et al. (2000) Epilep-
tic syndromes, cognitive assessment and school placement: a
study of 251 children. Dev. Med. Child Neurol., 42: 319-327.
Cameron, H.A. and Gould, E. (1994) Adult neurogenesis is reg-
ulated by adrenal steroids in the dentate gyrus. Neuroscience,
61 : 203-209.
Cameron, H.A. and Gould, E. (1996) Distinct populations of
cells in the adult dentate gyrus undergo mitosis or apoptosis in
response to adrenalectomy. J. Comp. NeuroL, 369: 56-63.
Cameron H.A., McEwen, B.S. and Gould, E. (1995) Regulation
of adult neurogenesis by excitatory input and NMDA receptor
activation in the dentate gyrus. J. Neurosci., 15: 4687-4692.
Cameron H.A., Hazel, T.G. and McKay, R.D.G. (1998) Regula-
tion of neurogenesis by growth factors and neurotransmitters.
J. Neurobiol., 36: 287-306.
Cavazos, J.E., Golarai, G. and Sutula, T.P. (1991) Mossy fiber
synaptic reorganization induced by kindling: time course of
331
development, progression, and permanence. J. Neumsci., 11:
2795-2803.
Cherubini, E., Ben-Aft, Y. and Krnjevic, K. (1989) Anoxia
produces smaller changes in synaptic transmission, membrane
potential and input resistance in immature rat hippocampus. J.
Neurophysiol., 62: 882-895.
Cilio, M.R., Sogawa, Y., Huang, L.-T., Silveira, D,C., McCabe,
B.K. and Holmes, G.L. (1999) Status epilepticus in the de-
veloping brain: age-dependent neuronal injury, mossy fiber
sprouting, seizure susceptibility, and cognitive impairment.
Epilepsia, 40(Suppl. 7): 34.
Cossart, R., Dinocourt, C. and Hirsch, J.C. et al. (2001) Den-
dritic but not somatic GABAergic inhibition is decreased in
experimental epilepsy. Nat. Neurosci., 4: 52-62.
Cronin, J. and Dudek, EE. (1988) Chronic seizures and collateral
sprouting of dentate mossy fibers after kainic acid treatment in
rats. Brain Res., 474: 181-184.
Cronin, J., Obenaus, A. and Houser, C.R. et al. (1992) Elec-
trophysiology of dentate granule cells after kainate-induced
synaptic reorganization of mossy fibers. Brain Res., 573: 305-
310.
Crusio, W.E., Schwegler, H. and Lipp, H.-E (1987) Radial-maze
performance and structural variation of the hippocampus in
mice: a correlation with mossy fiber distribution. Brain Res.,
425: 182-185.
De Keyser, J., Sulter, G. and Luiten, EG. (1999) Clinical trials
with neuroprotective drugs in acute ischaemic stroke: are we
doing the right thing?. Trends Neurosci., 22: 535-540.
De Rogalski Landrot, I., Minokoshi, M. and Silveira, D.C. et al.
(2001) Recurrent neonatal seizures: relationship of pathology
to the electroencephalogram and cognition. Dev. Brain Res.,
129: 27-38.
DeBassio, W.A., Kemper, T.L. and Tonkiss, J. et al. (1996)
Effect of prenatal protein deprivation on postnatal granule cell
generation in the hippocampal dentate gyrus. Brain Res. Bull.,
41: 379-383.
DeLorenzo, R.J., Hauser, W.A. and Towne, A.R. et al. (1996)
A prospective, population-based epidemiologic study of status
epilepticus in Richmond, Virginia. Neurology, 46: 1029-1035.
Eriksson, K.J. and Koivikko, M.J. (1997) Status epilepticus in
children: aetiology, treatment, and outcome. Dev. Med. Child
Neurol., 39: 652-658.
Esclapez, M., Hirsch, J. and Ben-Ari, Y. et al. (1999) Newly
formed excitatory pathways provide a substrate for hyper-
excitablity in experimental temporal lobe epilepsy. J. Comp.
NeuroL, 408: 449-460.
Farwell, J.R., Dodrill, C.B. and Batzel, L.W. (1985) Neuropsy-
chological abilities of children with epilepsy. Epilepsia, 26:
395-400.
Funakoshi, A., Moftkawa, T. and Muramatsu, R. et al. (1988) A
prospective WISC-R study in children with epilepsy. Jap. J.
Psychiatry NeuroL, 42(3): 562-564.
Gould, E. and Tanapat, E (2000) Stress and hippocampal neuro-
genesis. Biol. Psychiatry, 46: 1472-1479.
Gould, E., Tanapat, E and McEwen, B.S. et al. (1998) Prolifer-
ation of granule cell precursors in the dentate gyrus of adult
332
monkeys is diminished by stress. Proc. Natl. Acad. Sci. USA,
95: 3168-3171.
Gould, E., Beylin, A. and Tanapat, P. et al. (1999) Learning
enhances adult neurogenesis in the hippocampal formation.
Nat. Neurasci., 2: 260-265.
Gray, W.E and Sundstrom, L.E. (1998) Kainic acid increases the
proliferation of granule cell progenitors in the dentate gyrus of
the adult rat. Brain Res., 790: 52-59.
Hauser, W.A. and Hersdorffer, D.C. (1990) Epilepsy: Frequenc);
Causes and Consequences. Demos, New York.
Hirsch, E., Baram, T.Z. and Snead III, O.C. (1992) Ontogenic
study of lithium-pilocarpine-induced status epilepticus in rats.
Brain Res., 583: 120-126.
Holmes, G.L. (1997) Epilepsy in the developing brain: lessons
from the laboratory and clinic. Epilepsia, 38:12-30.
Holmes, G.L. and Ben-Ari, Y. (1998) Seizures in the developing
brain: perhaps not so benign after all. Neuron, 21: 1231-1234.
Holmes, G.L., Gaiarsa, J.-L. and Chevassus-Au-Louis, N. et
al. (1998a) Consequences of neonatal seizures in the rat:
morphological and behavioral effects. Ann. Neural., 44: 845-
857.
Holmes, M.D., Dodrill, C.B. and Wilkus, R.J. et al. (1998b) Is
partial epilepsy progressive? Ten-year follow-up of EEG and
neuropsychological changes in adults with partial seizures.
Epilepsia, 39:1189-1193.
Holmes, G.L., Thompson, J.L. and Marchi, T. et al. (1988c) Be-
havioral effects of kainic acid administration on the immature
brain. Epilepsia, 29: 721-730.
Holmes, G.L., Sarkisian, M. and Ben-Ari, Y. et al. (1999) Mossy
fiber sprouting following recurrent seizures during early devel-
opment in rats. J. Camp. Neural., 404: 537-553.
Huang, L.-T., Cilia, M.R. and Silveira, D.C. et al. (1999) Long-
term effects of neonatal seizures: a behavioral, electrophys-
iological, and histological study. Dev. Brain Res., 118: 99-
107.
Huttenlocher, ER. and Hapke, R.J. (1990) A follow-up study of
intractable seizures in childhood. Ann. Neural., 28: 699-705.
Jokeit, H. and Ebner, A. (1999) Long term effects of refractory
temporal lobe epilepsy on cognitive abilities: a cross sectional
study. J. Neural. Neurosurg. Psychiatry, 67: 44-50.
Kelsey, J.E., Sanderson, K.L. and Frye, C.A. (2000) Perforant
path stimulation in rats produces seizures, loss of hippocampal
neurons, and a deficit in spatial mapping which are reduced by
prior MK-801. Behav. Brain Res., 107: 59-69.
Khazipov, R., Esclapez, M., Caillard, O., Bernard, C., Hirsch,
E., Leinekugel, X., Berger, B. and Ben-Ari, Y. (1999) Early
maturation of hippocampal network in the fetal cynomolgus
monkey. Sac. Neurosci. Abstr., 25: 2266.
Ko, T.-S. and Holmes, G.L. (1999) EEG and clinical predictors
of medically intractable childhood epilepsy. Clin. Neurophys-
iol., 110: 1245-1251.
Koh, S., Storey, T.W. and Santos, T.C. et al. (1999) Early-life
seizures in rats increase susceptibility to seizure-induced brain
injury in adulthood. Neurology, 53: 915-921.
Kubovfi, H., Druga, R. and Lukasiuk, K. et al. (2001) Status
epilepticus causes necrotic damage in the mediodorsal nucleus
of the thalamus in immature rats. J. Neurosci., 21: 3593-3599.
Kwong, K.L., Lee, S.L. and Yung, A. et al. (1995) Status
epilepticus in 37 Chinese children: aetiology and outcome. J.
Paediatr. Child Health, 31 : 395-398.
Lamsa, K., Palva, J.M. and Ruusuvuori, E. et al. (2000) Synaptic
GABA(A) activation inhibits AMPA kainate receptor medi-
ated bursting in the newborn (POP2) rat hippocampus. J.
Neurophysiol., 83: 359-366.
Lipp, H.-E, Schwegler, H. and Driscoll, P. (1984) Postnatal mod-
ification of hippocampal circuitry alters avoidance learning in
adult rats. Science, 225: 80-82.
Lipp, H.-E, Schwegler, H. and Heimrich, B. et al. (1988) In-
frapyramidal mossy fibers and two-way avoidance learning:
developmental modification of hippocampal circuitry and adult
behavior of rats and mice. J. Neurosci., 8: 1905-1921.
Lipton, S.A. and Rosenberg, P.A. (1994) Excitatory amino acids
as a final common pathway for neurologic disorders. New
Engl. J. Med., 330: 613-622.
Liu, J., Solway, K. and Messing, R.O. et al. (1998) Increased
neurogenesis in the dentate gyrus after transient global is-
chemia in gerbils. J. Neurosci., 18: 7768-7778.
Liu, Z., Gatt, A. and Mikati, M. et al. (1995) Long-term behav-
ioral deficits following pilocarpine seizures in immature rats.
Epilepsy Res., 19: 191-204.
Liu, Z., Stafstrom, C.E. and Sarkisian, M. et al. (1996) Age-
dependent effects of glutamate toxicity in the hippocampus.
Dev. Brain Res., 97: 178-184.
Liu, Z., Yang, Y. and Silveira, D.C. et al. (1999) Consequences
of recurrent seizures during early brain development. Neuro-
science, 92: 1443-1454.
Marks, J.D., Friedman, J.E. and Haddad, G.G. (1996) Vulnerabil-
ity of CA 1 neurons to glutamate is developmentally regulated.
Dev. Brain Res., 97: 194-206.
Mathern, G.W., Leite, J.P. and Pretorius, J.K. et al. (1994) Chil-
dren with severe epilepsy: evidence of hippocampal neuron
losses and aberrant mossy fiber sprouting during postnatal
granule cell migration and differentiation. Dev. Brain Res., 78:
70-80.
Maytal, J. and Shinnar, S. (1995) Status epilepticus in children.
In: S. Shinnar, N. Amir and D. Branski (Eds.), Childhood
Seizures. Karger, Basel, pp. 111-122.
Maytal, J., Shinnar, S. and Mash6, S.L. et al. (1989) Low
morbidity and mortality of status epilepticus in children. Pedi-
atrics, 83(3): 323-331.
McCabe, B.K., Silveira, D.C. and Cilia, M.R. et al. (2001)
Neonatal seizures result in a decrease in neurogenesis in the
dentate. J. Neurosci., 21 : 2094-2103.
McNamara, R.K. and Routtenberg, A. (1995) NMDA receptor
blockade prevents kainate induction of protein F1/GAP-43
mRNA in hippocampal granule cells and subsequent mossy
fiber sprouting in the rat. Mol. Brain Res., 33: 22-28.
Mehler, M.E and Kessler, J.A. (1999) Progenitor cell biology.
Implications for neural regeneration. Arch. Neural., 56: 780-
784.
Meldrum, B.S. and Brierley, J.B. (1973) Prolonged epileptic
seizures in primates: ischaemic cell change and its relation to
ictal physiological events. Arch. NeuraL, 28: 10-17.
Meldrum, B.S., Vigouroux, R.A. and Brierley, J.B. (1973) Sys-

temic factors and epileptic brain damage. Prolonged seizures
in paralyzed artificially ventilated baboons. Arch. Neurol., 29:
82-87.
Montaron, M.F., Petry, K.G. and Rodriguez, J.J. et al. (1999)
Adrenalectomy increases neurogenesis but not PSA-NCAM
expression in aged dentate gyms. Eu~: J. Neurosci., 11: 1479-
1485.
Morris, R.G.M., Garrud, P. and Rawlins, J.N.P. et al. (1982)
Place navigation impaired in rats with hippocampal lesions.
Nature, 297: 681-683.
Morris, R.G.M., Anderson, E. and Lynch, G.S. et al. (1986)
Selective impairment of learning and blockade of long-term
potentiation by an N-methyl-D-aspartate receptor antagonist,
AP5. Nature, 319: 774-776.
Moshr, S.L. and Albala, B.J. (1982) Kindling in developing rats:
persistence of seizures into adulthood. Dev. Brain Res., 4: 67-
71.
Nadler, J.V. ( 1981 ) Kainic acid as a tool for the study of temporal
lobe epilepsy. Life Sci., 29: 2031-2042.
Nadler, J.V., Perry, B.W. and Cotman, C.W. (1978) Intraventric-
ular kainic acid preferentially destroys hippocampal pyramidal
cells. Nature, 271: 676-677.
Neill, J., Liu, Z. and Sarkisian, M. et al. (1996) Recurrent
seizures in immature rats: effect on auditory and visual dis-
crimination. Dev Brain Res., 95: 283-292.
Neyens, L.G., Aldenkamp, A.P. and Meinardi, H.M. (1999)
Prospective follow-up of intellectual development in children
with a recent onset of epilepsy. Epilepsy Res., 34: 85-90.
Nitecka, L., Tremblay, E. and Charton, G. et al. (1984) Matura-
tion of kainic acid seizure-brain damage syndrome in the rat.
I1. Hi stopathological sequelae. Neuroscience, 13: 1073-1094.
Olney, J.W., Fuller, T. and De Gubareff, T. (1979) Acute den-
drotoxic changes in the hippocampus of kainate treated rats.
Brain Res., 176: 91-100.
Painter, M.J., Bergman, I. and Crnmrine, P. (1986) Neonatal
seizures. Pediatr Clin. North Am., 33: 91-109.
Parent, J.M., Yu, T.W. and Leibowitz, R.T. et al. (1997) Den-
tate granule cell neurogenesis is increased by seizures and
contributes to aberrant network plasticity in the adult hip-
pocampus. J. Neurosci., 17:3727 3738.
Parent, J.M., Janumpalli, S. and McNamara, J.O. et al. (1998) In-
creased dentate granule cell neurogenesis following amygdala
kindling in the adult rat. Neurosci. Lett., 247: 9-12.
Pellock, J.M. (1993) Status epilepticus. In: W.E. Dodson and
J.M. Pellock (Eds.), Pediatric Epilepsy: Diagnosis and Ther-
apy. Demos, New York, pp. 197-206.
Represa, A. and Ben-Ari, Y. (1997) Molecular and cellular cas-
cades in seizure-induced neosynapse formation. Adv. Neurol.,
72: 25-34.
Represa, A., Tremblay, E. and Ben-Ari, Y. (1987) Kainate bind-
ing sites in the hippocampal mossy fibers: localization and
plasticity. Neuroscience, 20: 739-748.
Rice, A.C., Floyd, C.L. and Lyeth, B.G. et al. (1998) Status
epilepticus causes long-term NMDA receptor-dependent be-
havioral changes and cognitive deficits. Epilepsia, 39: 1148-
1157.
Rodin, E.A., Schmaltz, S. and Twitty, G. (1986) Intellectual
333
functions of patients with childhood-onset epilepsy. Dev. Med.
Child Neurol., 28: 25-33.
Sankar, R., Shin, D.H. and Liu, H. et al. (1998) Patterns of status
epilepticus-induced neuronal injury during development and
long-term consequences. J. Neurosci., 18: 8382-8393.
Scher, M.S., Aso, K, and Beggarly, M.E. et al. (1993) Electro-
graphic seizures in preterm and full term neonates: clinical
correlates, associated brain lesions and risk for neurological
sequelae. Pediatrics, 91: 128-134.
Schmid, R., Tandon, P. and Stafstrom, C.E. et al. (1999) Ef-
fects of neonatal seizures on subsequent seizure-induced brain
injury. Neurology, 53: 1754-1761.
Scott, B.W, Wang, S. and Burnham, W.M. et al. (1998)
Kindling-induced neurogenesis in the dentate gyrus of the
rat. Neurosci. Lett., 248: 73-76.
Shinnar, S., Pellock, J.M. and Moshr, S. et al. (1997) In whom
does status epilepticus occur: age-related differences in chil-
dren. Epilepsia, 38: 907-914.
Shinnar, S., Pellock, J.M. and Berg, A.T. et al. (2001) Short-term
outcomes of children with febrile status epilepticus. Epilepsia,
42: 47-53.
Sillanpaa, M., Jalava, M. and Kaleva, O. et al. (1998) Long-term
prognosis of seizures with onset in childhood. New Engl. J.
Med., 338: 1916-1918.
Sloviter, R.S. (1983) 'Epileptic' brain damage in rats induced by
sustained electrical stimulation of the perforant path. I. Acute
electrophysiological and light microscopic studies. Brain Res,
Bull., 10: 675-697.
Sloviter, R,S. and Damiano, B.P. (1981) Sustained electrical
stimulation of the perforant path duplicates kainate-induced
electrophysiological effects and hippocampal damage in rats.
Neurosci. Lett., 24: 279-284.
Sperber, E.F., Haas, K.Z. and Stanton, P.K. et al. (1991) Resis-
tance of the immature hippocampus to seizure-induced synap-
tic reorganization. Dev. Brain Res., 60: 88-93.
Stafstrom, C.E., Thompson, J.L. and Holmes, G.L. (1992) Kainic
acid seizures in the developing brain: status epilepticus and
spontaneous recurrent seizures. Dev. Brain Res., 65: 227-236.
Stafstrom, C.E., Chronopoulos, A. and Thurber, S. et al. (1993)
Age-dependent cognitive and behavioral deficits following
kainic acid-induced seizures. Epilepsia, 34: 420-432.
Sutula, T., Koch, J. and Golarai, G. et al. (1996) NMDA receptor
dependence of kindling and mossy fiber sprouting: evidence
that the NMDA receptor regulates patterning of hippocampal
circuits in the adult brain. J. Neurosci., 16: 7398-7406.
Tanapat, P., Galea, L.A. and Gould, E. (1998) Stress inhibits
the proliferation of granule cell precursors in the developing
dentate gyrus. Int. J. Dev. Neurosci., 16: 235-239.
Tanapat, P., Hastings, N.B. and Gould, E. (1999) Estrogen stim-
ulates a transient increase in the number of new neurons in
the dentate gyrus of the adult female rat. J. Neurosci., 19:
5792-5801.
Tassinari, C.A., Rubboli, G. and Volpi, L. et al. (2000) En-
cephalopathy with electrical status epilepticus during slow
sleep or ESES syndrome including the acquired aphasia. Clin.
Neurophysiol., 11 l(Suppl. 2): $94-S102.
Tauck, D. and Nadler, J.V. (1985) Evidence of functional mossy
334
fiber sprouting in the hippocampal formation of kainic acid-
treated rats. J. Neurosci., 5: 1016-1022.
Tremblay, E., Nitecka, L. and Berger, M.L. et al. (1984) Matura-
tion of kainic acid seizure-brain damage syndrome in the rat.
I. Clinical, electrographic and metabolic observations. Neuro-
science, 13(4): 1051-1072.
Van Esch, A., Ramlal, I.R. and van Steensel-Moll, H.A. et al.
(1996) Outcome after febrile status epilepticus. Dev. Med.
Child Neurol., 38: 19-24.
Van Praag, H., Christie, B.R. and Sejnowski, T.J. et al. (1999a)
Running enhances neurogenesis, learning, and long-term po-
tentiation in mice. Proc. Natl. Acad. Sci. USA, 96: 13427-
13431.
Van Praag, H., Kempermann, G. and Gage, EH. (1999b) Run-
ning increases cell proliferation and neurogenesis in the adult
mouse dentate gyms. Nat. Neurosci., 2: 266-270.
Vasconcellos, E., Wyllie, E. and Sullivan, S. et al. (2001) Mental
retardation in pediatric candidates for epilepsy surgery: the
role of early seizure onset. Epilepsia, 42: 268-274.
Villeneuve, N., Ben-Ari, Y. and Holmes, G.L. et al. (2000)
Neonatal seizures induced persistent changes in intrinsic prop-
erties of CA1 rat hippocampal cells. Ann. Neurol., 47: 729-
738.
Wagner, J.P., Black, I.B. and DiCicco-Bloom, E. (1999) Stimula-
tion of neonatal and adult brain neurogenesis by subcutaneous
injection of basic fibroblast growth hormone. J. Neurosci., 19:
6006-6016.
Wakamoto, H., Nagao, H. and Hayashi, M. et al. (2000) Long-
term medical, educational, and social prognoses of childhood-
onset epilepsy: a population-based study in a rural district of
Japan. Brain Dev., 22: 246-255.
Wasterlain, C.G. (1976) Effects of neonatal status epilepticus on
rat brain development. Neurology, 26: 975-986.
Wasterlain, C.G. (1978) Neonatal seizures and brain growth.
Neuropaediatrie, 9: 213-228.
Wasterlain, C.G. (1997) Recurrent seizures in the developing
brain are harmful. Epilepsia, 38: 728-734.
Wasterlain, C.G. and Plum, E (1973) Vulnerability of developing
rat brain to electroconvulsive seizures. Arch. NeuroL, 29: 38-
45.
Williams, J., Griebel, M.L. and Dykman, R.A. (1998) Neuropsy-
chological patterns in pediatric epilepsy. Seizure, 7: 223-228.
Wolf, H.K., Buslei, R. and Schmidt-Kastner, R. et al. (1996)
NeuN: A useful neuronal marker for diagnostic histopathol-
ogy. J. Histochem. Cytochem., 44: 1167-1171.
Yang, Y., Tandon, P. and Liu, Z. et al. (1998) Synaptic reorgani-
zation following kainic acid-induced seizures during develop-
ment. Dev. Brain Res., 107: 169-177.
Young, D., Lawlor, P.A. and Leone, P. et al. (1999) Environ-
mental enrichment inhibits spontaneous apoptosis, prevents
seizures and is neuroprotective. Nat. Med., 4: 448-453.
Zupanc, M.L. (2001) Infantile spasms. Curr. Treat. Opt. Neurol.,
3: 289-300.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Published by Elsevier Science B.V.

CHAPTER 29

Seizure-induced neuronal death in the immature brain

Claude G. Wasterlain *, Jerome Niquet, Kerry W. Thompson, Roger Baldwin,

Hantao Liu, Raman Sankar, Andrey M. Mazarati, David Naylor, Hiroshi Katsumori,
Lucie Suchomelova and Yukiyoshi Shirasaka

Epilepsy Research Laboratory, VA Greater Los Angeles Healthcare System, Department of Neurology and Brain Research Institute,
UCLA School of Medicine, Los Angeles, CA 90095, USA

Abstract: The response of the developing brain to epileptic seizures and to status epilepticus is highly age-specific.
Neonates with their low cerebral metabolic rate and fragmentary neuronal networks can tolerate relatively prolonged
seizures without suffering massive cell death, but severe seizures in experimental animals inhibit brain growth, modify
neuronal circuits, and can lead to behavioral deficits and to increases in neuronal excitability. Past infancy, the developing
brain is characterized by high metabolic rate, exuberant neuronal and synaptic networks and overexpression of receptors
and enzymes involved in excitotoxic mechanisms. The outcome of seizures is highly model-dependent. Status epilepticus
may produce massive neuronal death, behavioral deficits, synaptic reorganization and chronic epilepsy in some models,
little damage in others. Long-term consequences are also highly age- and model-dependent. However, we now have some
models which reliably lead to spontaneous seizures and chronic epilepsy in the vast majority of animals, demonstrating
that seizure-induced epileptogenesis can occur in the developing brain. The mode of cell death from status epilepticus is
largely (but not exclusively) necrotic in adults, while the incidence of apoptosis increases at younger ages. Seizure-induced
necrosis has many of the biochemical features of apoptosis, with early cytochrome release from rnitochondria and caspase
activation. We speculate that this form of necrosis is associated with seizure-induced energy failure.

Introduction or of childhood epilepsy who come to surgery for

The problem of seizure-induced neuronal injury in
the immature brain has a long and controversial
history (Camfield, 1997; Wasterlain, 1997), which
we will review only very briefly.
Clinical evidence
Neuronal loss is seen in the brains of many pa-
tients with a history of severe febrile convulsions
*Correspondence to: C.G. Wasterlain, Department of
Neurology, VA Medical Center (127), 11301 Wilshire
Boulevard, West Los Angeles, CA 90073, USA. Tel.: + 1-
310-268-3399; Fax: +1-310-268-4611 ;
E-maih wasterla@ucla.edu
intractable seizures (Babb and Brown, 1987). This
includes the massive loss of hippocampal neurons
in mesial temporal sclerosis but can also be seen
in other parts of the brain. The association be-
tween prolonged convulsive episodes in childhood
and mesial temporal sclerosis in patients with tem-
poral lobe epilepsy has raised the question of causal-
ity. It should be noted that only a minority of such
patients have a history of status epilepticus (SE)
or prolonged febrile seizures in childhood (Falconer
and Taylor, 1968; Cendes et al., 1993; Mathern et
al., 1995). On the other hand, prospective epidemi-
ological studies have suggested that simple febrile
convulsions have a benign outcome (Nelson and E1-
lenberg, 1978), and some studies even find a benign
outcome of childhood SE (Maytal et al., 1989), al-
though others suggest that seizure duration adversely
336
affects prognosis (Verity et al., 1993; Verity, 1998).
The presence of neuronal death in the brains of chil-
dren dying acutely of SE (Margerison and Corsellis,
1966; Sagar and Oxbury, 1987) is not conclusive,
since it could be a result of the metabolic complica-
tions of SE or of the illness that cause the seizures,
rather than a result of the seizures themselves.
Several studies have suggested that epilepsy is a
progressive disease (Scheibel et al., 1974). Intervals
between successive seizures may tend to become
shorter (Elwes et al., 1988), temporal lobe epilepsy
(TLE) is more likely with a history of multiple
seizures, long seizure duration is associated with
hippocampal atrophy (K~ilvi~iinen et al., 1998; Tasch
et al., 1999; Miller et al., 2000; Spanaki et al.,
2000; Theodore et al., 2001). Among the factors that
predict seizure recurrence (Hesdorffer et al., 1998;
Kwan and Brodie, 2000), is a history of multiple
seizures, or of febrile seizures lasting over 15 min
(Nelson and Ellenberg, 1978; DeCarli et al., 1998).
Imaging studies anecdotally support that view (see
Theodore and Gaillard, 2002, this volume).
Experimental evidence
Animal studies have been equally controversial.
Seizures induced in immature rats by kainate (A1-
bala et al., 1984; Ben-Ari et al., 1984), pilocarpine
(Cavalheiro et al., 1987), kindling (Okada et al.,
1984), or flurothyl (Wasterlain, 1976; Fujikawa et
al., 1992), show little or no neuronal loss, suggesting
that there are some forms of status that may not dam-
age the immature brain. On the other hand, seizures
induced by kainate in immature rabbits (Franck and
Schwartzkroin, 1984) and several recently developed
models of SE in the immature rat brain (Thompson
et al., 1998; Sankar et al., 1998, 2000a,b) reliably
induce neuronal injury and the delayed development
of recurrent spontaneous seizures, as detailed be-
low. Here we will briefly review the evidence for
or against the vulnerability of the immature brain
to seizure-induced neuronal loss and seizure-induced
epileptogenesis, and will summarize some recent
studies on the mode of seizure-induced neuronal
death and its cellular mechanism, which appears to
differ in the developing versus the adult brain.
Is there such a thing as 'the immature brain'?
One key issue that must be addressed is the fact
that the concept of 'the immature brain' is a vast
oversimplification. Neonates and infants of several
species including humans ('perinatal' or 'postnatal'
brain developers) have a cerebral metabolic rate far
lower than that of the adult. By contrast, during
the childhood period, many mammalian species, also
including humans, show a cerebral metabolic rate
higher than the adult, a higher complement of neu-
rons and synapses than adults, and also show tran-
sient overexpression of several receptors involved in
excitotoxic neuronal death. Therefore it is best to
separate these two periods in studies of neuronal vul-
nerability. While no quantitative studies have been
done on seizures, a study of ischemia (Duffy et al.,
1975) shows that in neonatal rats which have a met-
abolic rate 20 times lower than the adult, it takes
approximately 20 times as long for critical signs
of brain injury to develop with a similar level of
hypoxic-ischemic exposure. In other words, the time
for neuronal compromise to develop is inversely pro-
portional to the metabolic rate. Simply extrapolated
to seizures, that rule would predict that neonates
would tolerate seizures of a much longer duration
than adults before developing brain damage, but
that children would not. However, during seizures,
which maximally increase cerebral metabolic rate,
the problem is more complex: it is not the basal
metabolic rate which determines the rate of injury,
but the increased metabolic rate induced by seizures.
Here again, the neonatal period-infancy should be
quite separate from the childhood period. During the
former, the percent increase in metabolic rate during
seizures is lower than in the adult, while in the latter,
the increase in metabolic rate during seizures is at
least as high as or higher than in adults. As reviewed
below, there is now good evidence that some types of
prolonged seizures or SE can damage the brain quite
extensively and trigger widespread neuronal death
in immature animals with a high cerebral metabolic
rate ('childhood' period). During 'infancy' or in the
neonatal period (with their low cerebral metabolic
rate), little neuronal death has been demonstrated
(although no comprehensive studies have been car-
tied out), but adverse consequences of seizures on
brain growth (Wasterlain, 1976), cerebral organiza-

tion (Dwyer and Wasterlain, 1982; Swann et al.,
1999), on the development of neuronal connections
(Jorgensen et al., 1980; Jiang et al., 1998; Ander-
son et al., 1999) on behavior (Neill et al., 1996;
Holmes et al., 1998; Huang et al., 1999; Lynch et al.,
2000) and on seizure propensity (Wasterlain, 1976;
Villeneuve et al., 2000) have been observed and ap-
pear to be specific for discrete developmental stages
(Wasterlain, 1997; Swann et al., 1999). This review
will not cover the problem of the consequences of
seizures in neonates and infants, but will focus on
experimental studies dealing with seizures occurring
at ages P12-28, which are the rodent equivalent of
early to late childhood.
S e i z u r e - a s s o c i a t e d neuronal death: is it due to
seizures per se or to associated factors?
The presence of neuronal loss in the hippocampi
of children dying of SE, and of patients with
childhood-onset epilepsy with intractable seizures
and no history of SE, does not resolve the problem
of causality. Cell loss could be due to seizures, but
could also be due to associated metabolic compli-
cations or due to the illness which caused seizures
in the first place. MRI studies of the hippocampus
in intractable epilepsy and in complex or prolonged
febrile seizures (Wieshmann et al., 1997; Vanland-
ingham et al., 1998; Sutula and Herman, 1999) are
in progress in many centers (see Lewis et al., 2002,
among others, in this volume) and may resolve the
problem of the timing of hippocampal atrophy and
mesial temporal sclerosis.
Is the best model of a child a rat or a rabbit?
Animal studies using the kainate model of SE in im-
mature rats initially supported the interpretation that
the immature brain was immune to seizure-induced
neuronal injury, since behavioral seizures were ob-
served but no cell loss ensued, as mentioned above.
However, evidence accumulated over the last few
years suggests that, in some models of SE, exten-
sive neuronal loss occurs as a result of the seizures
themselves and not of associated factors. Franck and
Schwartzkroin (1984) illustrated the presence of ex-
tensive neuronal loss following kainic acid (KA) SE
in immature rabbits (1986), suggesting that the lack
337
of lesions after KA SE in the rat might be species-
specific.
Ipsilateral neuronal death from stimulation of an
excitatory pathway
Thompson et al. (1998) showed that in rats subjected
to long periods of intermittent, seizure-like perforant
path stimulation on postnatal day 14-15 (P15), ex-
tensive cell loss in the hilus of the dentate gyms was
seen only on the stimulated side, the contralateral
hilus being spared. This loss was selective for spe-
cific populations of interneurons (e.g. somatostatin-
immunoreactive) and spared basket cells. Its unilat-
eral nature suggested that metabolic factors com-
plicating seizures were unlikely to be the cause of
neuronal injury. This loss of interneurons was ac-
companied by loss of physiological inhibition in the
dentate gyms. Further proof that hippocampal dam-
age resulted from the seizures themselves and not
from systemic changes came from studies of SE
induced by lithium and pilocarpine in P10 rabbits,
an age roughly equivalent to the neonatal period in
humans (Fig. 1). Although electrographically, the an-
imals were in SE, behaviorally, seizures were subtle,
without generalized convulsive activity (Thompson
et al., 1998). Massive damage to CA1, CA3 and hilar
neurons was present, in spite of complete preser-
vation of arterial oxygen saturation throughout SE
(Fig. 1, insert). Relative preservation of granule cells
completed the picture, which closely resembled the
distribution of damage observed in children dying
during SE (Margerison and Corsellis, 1966), and in
mesial temporal sclerosis (Babb and Brown, 1987).
In conclusion, this pattern of hippocampal damage,
which is the acute precursor of mesial temporal
sclerosis, could not have resulted from inadequate
oxygen availability, and was the direct effect on
vulnerable neurons of uncontrolled seizure activity.
Ontogeny of seizure-induced neuronal death
Sankar et al. (1997, 1998) showed that lithium/pilo-
carpine-induced SE in the young is associated with
extensive neuronal loss, seen histologically and con-
firmed by elevation of serum neuron-specific eno-
lase. The severity and distribution of this neuronal
loss varied markedly with age. In this model, neu-
338

Fig. 1. Hippocampus of a P10 rabbit subjected to SE induced by lithium (3 mEq/kg, i.p., 16 h pre) and pilocarpine (100 mg/kg i.p.),
physiologically monitored (inset in right lower corner: arterial gases before and during SE), and perfused 72 h later. Hematoxylin and
eosin stain. Note the massive destruction of pyramidal neurons in CA1 and CA3, the loss of hilar neurons and severe hippocampal
swelling, with relative preservation of dentate granule cells. Modified from Thompson and Wasterlain (1997).

ronal loss in CA1, which is minimal in P15 rats
in the perforant path stimulation model, was maxi-
mal in P15 pups, and declined with advancing age
(Fig. 2), while loss of hilar interneurons in the den-
tate gyrus was minimal at P15, peaked at P21 and
remained high at P28 and in adults (Fig. 3). Sankar
et al. (2000a,b) also showed that this cell loss was
associated with the development of chronic sponta-
neous seizures, i.e. was epileptogenic, and that the
degree of epileptogenicity also varied with the age
and with the seizure model. Ribak and Baram (1995)
demonstrated a selective death of CA3 pyramidal
cells after CRH-induced SE in infant rats. Dube et
al. (2000) later demonstrated neuronal injury as the
result of febrile SE. Kubova et al. (2001) demon-
strated that SE in P12 rats was associated with
neuronal death in thalamus and other regions. Ages
younger than P12 in the rat have not been adequately
studied, and the problems of adequate seizure mon-
itoring in newborn rats and mice are formidable,
but so far little seizure-induced damage has been
detected.
Human relevance
It is difficult to relate the stages of rat brain devel-
opment to human brain development, since P28 rats
are just a few days past weaning, and yet are close
to puberty, while these processes are years apart
in humans. However, P28 rats are perhaps closest
to the early childhood years in humans, in terms
of having a metabolic rate higher than adults, and of
showing considerably higher vulnerability to seizure-
induced damage and seizure-induced epileptogenesis
than P I 5 rats (Sankar et al., 1999, 2000a,b).
In summary, it now seems clear that severe
seizures can produce neuronal loss in the immature
brain (with the possible exception of the neonatal pe-
riod and early infancy), and it appears that this loss is
both model-specific and species- and age-dependent.
 339

3 w k - o l d rat

4 \s k-old tat Adult rat

Fig. 2. Age dependency of neuronal injury induced by lithium-pilocarpine SE. The CA1 sector of the hippocampus of rats sacrificed
20 h after a bout of SE induced at the age of 2 weeks (A), 3 weeks (B), 4 weeks (C), or as adults (D, 12-16 weeks) was stained with
hematoxylin and eosin. Injured neurons are brightly fluorescent. Scale bar: 100 Itm. Neuronal injury is most severe in 2-week-olds.
Modified from Sankar et al. (1998).

The problem of neuronal loss from repeated single
seizures and the minimum seizure duration needed to
cause neuronal loss have not been adequately studied
in that age group.
Epileptogenicity of status epilepticus in the
developing brain
The early observations of Falconer and Taylor (1968)
suggested an association between prolonged febrile
convulsive episodes during early childhood and
mesial temporal sclerosis associated with intractable
TLE. The topic has remained highly controversial.
Some studies of severe, intractable seizures, or of tis-
sue obtained from patients with intractable epilepsy,
suggest a meaningful association (Represa et al.,
1989; Cendes et al., 1993; Verity et al., 1993; Math-
ern et al., 1995; Van Esch et al., 1996) while large
epidemiological studies which are population-based
suggest a benign outcome (Nelson and Ellenberg,
1978; Maytal et al., 1989). Until recently, there was
no reliable experimental model of seizure-induced
epileptogenesis in immature animals. Many stud-
ies suggested that severe seizures in the developing
brain led to a long-term decrease in seizure thresh-
old or to increased seizure susceptibility lasting into
adulthood (Wasterlain, 1976; Holmes et al., 1998;
Dube et al., 2000), while others did not find such an
association (Okada et al., 1984), but none of those
models, with the exception of neonatal tetanus toxin
injection (Swann et al., 1999) generated spontaneous
seizures.
340

l*

i 4 wk-ofd rat ," " /\dull rat

Fig. 3. Dentate gyrus of rats sacrificed 20 h after a bout of SE induced at the age of 2 weeks (A), 3 weeks (B), 4 weeks (C), or as adults
(D, 12-16 weeks) was stained with hematoxylin and eosin. Injured neurons are brightly fluorescent. Scale bar: 100 Ixm. Modified from
Sankar et al. (1998). Neuronal injury in the hilus is minimal at 2 weeks, but prominent at 3 weeks and beyond.

A model of seizure-induced epileptogenesis in
immature rats
We studied the effect of SE induced by lithium (3
mEq/kg) and pilocarpine (60 mg/kg) in rat pups of
different ages (2, 3, 4 weeks and adults). Animals
were monitored for 3 months or longer after the
initial episode of SE. In our first study (Sankar et al.,
1999), of 11 rats subjected to SE at 2 weeks of age,
three developed spontaneous seizures that started at
least 4 months after SE. These seizures resembled
Racine's stages 3-5 in kindled animals (Racine,
1972). Also observed in the same three animals were
seizures induced by handling, characterized by a few
myoclonic jerks leading to stage 3-5 seizures. Of the
11 rats subjected to LiPi SE at 3 weeks of age, eight
displayed spontaneous seizures after a latent period
lasting less than 3 months, shorter than that seen in
animals treated at 2 weeks of age. Of the 8 rats that
underwent SE at 4 weeks, six developed spontaneous
seizures, after a latent period which was also shorter
than 3 months.
Epileptogenicity is age- and model-dependent
We conducted more extensive studies compar-
ing epileptogenesis in rats subjected to lithium-
pilocarpine SE at P21, P35, or as adults (12-16
weeks old). A parallel group underwent SE in-
duced by perforant path stimulation at the same
ages (Sankar et al., 2000a). Perforant path stimula-
tion (PPS) was induced by 10-s 20-Hz trains (single
square wave monophasic stimuli, 20 V, 0.1 ms)
delivered every minute on a background of 2 Hz
continuous stimulation. The duration of stimulation
was 8 h in P21 and P35 rats, but only 30 min in

adults. After a period of 1-4 months, the animals
were reimplanted and continuously monitored for a
week (24 h a day), with a video camera and elec-
troencephalographic software (Monitor 81 program,
Stellate software, Montreal, Quebec, Canada) config-
ured for automatic detection of seizures and spikes.
Wistar pups and adults subjected to lithium-
pilocarpine SE showed recurrent episodes of clonus
up to stage 3-5 seizures according to the classifica-
tion of Haas et al. (1990). There was no mortality
in this experiment. With PPS-induced SE, the P21
pups exhibited frequent wet dog shakes with chew-
ing and salivation, and occasional periods of bilateral
forelimb clonus, but rarely showed rearing or stage
4-5 seizures. Mortality was less than 5%. The P35
animals subjected to PPS displayed much more se-
vere seizures, which often reached stage 6-7, and
approximately 40% died during stimulation. Adults,
which only received 30 min of stimulation, showed
long-lasting recurrent stage 3-5 seizures as previ-
ously described (Mazarati et al., 1998), but no death
occurred in the current experiment.
After a silent period of 2 - 4 months, the two types
of SE led to very different incidences of sponta-
neous seizures in the younger groups. Among rats
subjected to PPS at P21, only one of 9 animals
showed spontaneous seizures. By contrast, 8 of 11
rats that underwent lithium-pilocarpine SE at P21,
showed spontaneous seizures behaviorally and by
EEG (Fig. 1). Further experiments will be needed
to determine whether this difference was due to
a lower seizure severity in the P21 PPS group or
whether it was an age-specific response to this type
of seizure. All the surviving rats that underwent
PPS (or lithium-pilocarpine SE) at P35 or as adults
displayed recurrent spontaneous seizures.
These results show that seizure-induced epilep-
togenesis, a widespread and well-established phe-
nomenon in the adult rat, can also be seen after SE in
the young. The lithium-pilocarpine model of SE re-
liably produced recurrent spontaneous seizures in its
victims. The results also show that epileptogenesis
is highly age-dependent and model-dependent. PPS
produced a much higher incidence of recurrent spon-
taneous seizures in P35 rats than in P21 rats. At the
same time, the high incidences of spontaneous recur-
rent seizures which followed lithium-pilocarpine SE
at P21 (and the occurrence of spontaneous seizures
341
in a small percentage of animals following LiPi SE
at P15 or PPS SE at P21) shows that SE can be
epileptogenic in the immature brain.
Seizure spread is highly age- and model-dependent
We used c-Jun immunoreactivity to map the extent of
network recruitment during SE in those two models.
The results showed that seizure spread was highly
model-dependent. PPS in P21 rats resulted in in-
duction of c-Jun immunoreactivity in hippocampus,
with only mild induction in the amygdala, and the
rest of the brain showing none at all. By contrast,
during lithium-pilocarpine SE at P21, we saw exten-
sive activation of hippocampus, amygdala, piriform
cortex, substantia nigra, temporal neocortex, and tha-
lamus. Thus the extensive seizure spread may have
been the critical factor in the differential response
to seizures induced by PPS versus lithium and pi-
locarpine. Histological studies showed that neuronal
injury in the hilus and CA3 regions was minimal in
the P21 PPS group, but moderately severe in the P21
lithium-pilocarpine group. SE-induced neurogenesis
was more prominent than that in the adult (Sankar et
al., 1999).
Synaptic reorganization parallels epileptogenicity
Timm-stained sections of hippocampus were exam-
ined for evidence of sprouting of mossy fibers, the
axon of dentate granule cells, in rats subjected to PPS
or to lithium-pilocarpine SE at P21, P35 or as adults.
In order to estimate the extent of mossy fibers sprout-
ing in the inner molecular layer of the dentate gyrus,
images captured on a frame grabber were analyzed us-
ing a tracing function in Image Pro software (version
2.0) to determine the gray value difference (GVD) be-
tween the inner and outer molecular layers, on a scale
ranging from 0 to 255. The mean GVD value (av-
eraging both sides in a section of approximately 3.6
mm posterior to bregma), was 146 in rats undergoing
lithium pilocarpine SE at P21, 111 for rats undergo-
ing PPS at P35, and 139 adults after PPS, against 37
(P < 0.05 vs. all three) in rats that underwent PPS at
P21. This indicates that the extent of synaptic reorga-
nization was far less in the latter group. This differ-
ence could be model-specific, or could reflect reduced
seizure severity in the P21 PPS group.
342
Human relevance
What do these results imply for the human animal?
It is difficult to equate developmental stages across
species. Moshe et al. (1993) have compared the 7 -
10-day-old rats to a human neonate. Rat pups are
usually weaned around P22, although P30 rats have
been described as juveniles and are close to puberty
(Bronzino et al., 1999). Overall, the P21 rat pups can
probably be used to model early childhood seizures,
while keeping in mind the limitations of such com-
parisons. The demonstration that seizure-induced
epileptogenesis can be easily induced in develop-
ing rodents raises the possibility that some childhood
epilepsies might result from the damage caused by
prolonged febrile or non-febrile seizures. This is an
area where modern imaging techniques will enable
us to ask the question directly, in a population free
of pre-existing gross brain abnormality, and some of
the chapters in this book deal with this issue.
Modes of neuronal death induced by seizures
Apoptosis versus necrosis
Apoptosis was originally described by Kerr et al.
(1972) on a morphological basis, and that definition
has endured. Apoptosis is usually characterized by
the development of earlier nuclear changes while
the cytoplasm is still relatively intact. Formation of
large clumps of chromium, sometimes budding into
apoptotic bodies, is distinctive. DNA breaks can be
demonstrated by various methods, and as a result
these, DNA fragments migrate in agarose gels in
multiples of 1/80 based pairs suggesting the action
of a restriction enzyme. The cells showing, mem-
brane remain intact and organelle relatively normal
morphologically until late in the course, when sec-
ondary necrosis can occur. By contrast, necrosis
is characterized by earlier cytoplasm changes with
swelling of mitochondria and endoplasmic reticu-
lum, membrane breaks and cell swelling, and late
changes in the nucleus.
Many studies suggest that massive insult results
in necrosis, while milder stress and milder elevation
of intracellular free calcium trigger apoptosis. On
the other hand, apoptosis may require a minimum of
energy for its development, and some studies have
been able to transform apoptosis into necrosis by a
profound depletion of energy reserves (Leist et al.,
1997).
Role of caspases
Caspases, a group of cysteine proteases (now num-
bering 14 members) are the executioners of apopto-
sis. Caspases are expressed constitutionally in many
brains, including the human, as inactive proenzymes,
and contain three subunits, an N-terminal prodomain,
large (20 kDa) and small (10 kDa) subunits. Upon
cleavage, they form active heterotetramers. They
show a nearly absolute specificity for cleaving pro-
teins at the end-terminal of aspartic acid residues,
and their catalytic site contains a highly conserved
sequence (QACXG). They form cascade of proteases
which activate each other, in much the same way as
the complement or clotting system. Caspase activa-
tion seems to involve many different pathways, often
ending in the activation of Caspase 3, which is the
main executioner of cell death. Many of the mor-
phological features of apoptosis can be accounted
for by the action of caspases. While these processes
are undoubtedly present in apoptosis, recent reports
indicate that caspase activation is often seen in cells
with a necrotic morphology by electron microscopy
(Desphande et al., 1992; Petito et al., 1997; Chen et
al., 1998; Colbourne et al., 1999). Similarly, caspase
inhibitors have been effective in focal and global
ischemia in rescuing from cell death neurons which
by EM could look either apoptotic or necrotic (Chen
et al., 1998; Himi et al., 1998; Gillardon et al., 1999;
Rami et al., 2000). Caspase knock-out mice are more
resistant to ischemic neuronal death than wild-type
controls (Schielke et al., 1998; Kang et al., 2001).
This is equally true in the immature brain (Liu et al.,
1999a,b), where caspase inhibitors also reduce brain
injury (Cheng et al., 1998).
While caspase activation has often been equated
with apoptosis, the recent identification of many
intermediate forms of cell death raises questions
about its specificity.
Role of cyclin-dependent kinases
CDK is a family of kinases which share a motif
(PSTAIR) and control various phases of the cell

cycle. For example Cyclin D1-CDK4-6 and others
regulate the G1 phase of cell division, other CDKs
regulate the S or the M phase progression. In apopto-
sis, the cell frequently seem to be preparing for cell
division before committing toward a cell death path-
way. CDKs appear to be involved in these processes,
and both biochemical and pharmaceutical data sug-
gest their involvement in apoptosis. Cyclin D 1 tran-
scripts and CDK4-CDC2 are up regulated during
apotopic death of sympathetic neurons deprived of
the growth factor (Freeman et al., 1994). Increases in
Cyclin D1 and CDK4 have been reported in ischemic
neurons (Osuga et al., 2000). Flavopiridol, a CDK in-
hibitor, reduces ischemic damage, and mice deficient
in E2F1, a downstream target of the CDK cascade,
also display smaller infarct volume after focal stroke
(MacManus et al., 1999). The tumor suppressor RB,
a target of CDK4, and its associated transfer fac-
tor E2F, are also known to regulate apoptotic cell
death (Park et al., 1996, 1997; Padmanabhan et al,,
1999). It appears that Bax is a downstream target of
the CDK-RB-E2F cascade, and that its subsequent
translocation to the mitochondria results in cyto-
plasmic release of cytochrome c, caspase activation
and apoptotic death (Park, 2000). Flavopiridol and
olomoucine, another CDK inhibitor, block neuronal
apoptosis-induced DNA damage (Park et al., 1997)
and prevent Bax translocation, cytochrome c release
and caspase activation. These factors are particularly
relevant to neuronal death in the immature brain,
where CDKs are expressed abundantly. They may
account for the predominance of apoptosis versus
necrosis in the immature brain in a variety of patho-
logical conditions (Pulera et al., 1998; Thompson et
al., 1998; Sankar et al., 1999).
Apoptosis and necrosis are both seen after SE in the
immature brain
Our initial studies (Sankar et al., 1998) used the
lithium-pilocarpine model of SE at P14-15, P21,
P28, and in mature rats (12-16 weeks of age).
Rats were given 3 mEq/kg of lithium chloride
i.p., followed approximately 16 h later by SC pi-
locarpine (60 mg/kg). Animals were perfused-fixed
with paraformaldehyde or glutaraldehyde 24 h after
pilocarpine injection.
Double-stranded DNA breaks were identifed by
343
the TUNEL method. Nuclear morphology was ex-
amined by a light/confocal microscopy after ethid-
ium bromide staining. DNA extraction and agarose
gel electrophoresis were performed as previously
described (Sankar et al., 1998). Long-term seizure
monitoring was carried out using Harmonic software
(Stellate Systems, Montreal).
Behavioral seizures. Behavioral seizures appeared
less severe in the 2-week-old pups, where they con-
sisted mostly of stages 1-3, while the 3- and 4-
week-old rats frequently developed stage 6 or 7
seizures, sometimes culminating in tonic extension
and death. Mortality was low at 2 weeks, but approx-
imately one-third of the 3- and 4-week-old animals
and half of the adults died. Blood gas studies showed
no hypoxemia during the seizures, but none of the
sampling took place during a stage 6 or 7 seizure.
Neuronal injury. Neuronal injury was strikingly
age-dependent: in CA1, neuronal injury was max-
imal in 2-week-old pups, less severe in 3- and 4-
week-olds and least severe in the adults (Fig. 2). In
the hilus, the severity of neuronal injury increased
with age (Fig. 3). By EM, in the CA1 section of
2-week-old pups, both necrosis and apoptosis were
seen, but when cell injury was given at least 24
h to mature, apoptosis was most common (Fig. 4).
By contrast, in adults, a necrotic morphology was
far more common. Nuclear changes were prominent
by EM, with intact membranes and relative preser-
vation of cytoplasm and organelles, and with DNA
clumping into large masses, which could sometimes
be seen budding into apoptotic bodies (Fig. 5). Bio-
chemically, the brain displayed many of the hall-
marks of apoptotic death, including double-stranded
DNA breaks, laddering with a periodicity of 180
base pairs by agarose gel electrophoresis (Fig. 6),
and activation of caspase 3. Nuclear fragmentation
could also be seen clearly in many cells stained with
ethidium bromide (data not shown).
Seizure-induced death in the adult brain usually has
a necrotic morphology, but an apoptosis-like
biochemistry
We induced SE in mice with kainic acid (35 mg/kg),
and studied neuronal morphology by light and elec-
tron microscopy and enzyme induction/activation by
immunocytochemistry (Liu et al., 1999a,b).
344

Fig. 4. By confocal microscopy,the nucleus of ethidium bromide-stained CA I neurons shows a fine chromatin distribution throughout
the nucleus in a control (C), but large chromatin clumps (A,D) and an apoptotic body budding off a neuron (B) in P15 rats subjected to
SE.

Twenty-four hours after kainic acid injection, cell
injury was extensive in CA1, CA3, and at the C A 2 -
CA3 junction. By EM, an apoptotic morphology was
only observed in a limited number of cells at the
CA2-CA3 junction. Nearly all neurons in CA1 and
CA3 had a necrotic appearance, with prominent cy-
toplasmic swelling, extensive damage to mitochon-
dria and endoplasmic reticulum, membrane breaks,
and relatively late nuclear changes (Fig. 7). In spite
of their appearance, most injured neurons, includ-
ing those in regions CA1 and CA3 with a necrotic
morphology, showed abundant double-strained DNA
breaks by the TUNEL method (Fig. 8). They also
showed extensive expression of the immediate early
gene Bax (Fig. 9). Furthermore, the intracellular lo-
calization of Bax changed from a diffuse cytoplasmic
distribution in controls to a granular appearance in
regions rich in mitochondria, suggesting a transloca-
tion of this immediate early gene to the mitochon-
drial matrix, a classical feature of apoptotic death
which was seen here in necrotic-appearing neurons.
Immunocytochemistry using antibodies specific for
the active form of caspase 3 showed widespread ac-
tivation of this enzyme in the regions with a necrotic
morphology as well as in the small region with an
apoptotic appearance. Nearly all injured cells in CA1
and CA3 were loaded with active caspase 3, which
was essentially absent in controls (Fig. 10).
 345

Fig. 5. In these electron micrographs, the CA1 sector of a 2-week-old rat subjected to SE (A) shows an apoptotic neuron with condensed
cytoplasm (arrow) and several necrotic cells with vacuolated cytoplasm (arrowheads). Granule cells near the hilar border of a 3-week-old
rat subjected to SE (B) show one necrotic neuron and several neurons in the early stages of apoptosis. Control CA1 neurons from a
2-week-old pup and dentate gyrus cells from a 3-week-old pup are displayed in C and D, respectively. Scale bar: 4 p~m. Modified from
Sankar et al. (1998).

In s u m m a r y , the vast m a j o r i t y o f n e u r o n s i n j u r e d Seizure-induced necrosis shows early mitochondrial

b y S E in this m o d e l s h o w e d a n e c r o t i c m o r p h o l o g y changes
a n d an a p o p t o t i c b i o c h e m i s t r y .
W e l o o k e d at the early t i m e c o u r s e o f n e u r o n a l
346

Fig. 6. Agarose gel electrophoresis of hippocampal DNA from lithium-pilocarpine SE (right lanes) and control rats (left lanes). A
laddering pattern is visible in rats after SE at all ages (A, 2-week-old; B, 3-week-old; C, 4-week-old; D, adults). A hundred base pair
standard is shown on the fight. Modified from Sankar et al. (1998).

Fig. 7. Electron micrographs of the hippocampus of adult mice 24 h after SE induced by kainic acid show a few cells at the CA2-CA3
junction with large chromatin chunks and relative cytoplasm preservation suggesting an apoptotic process (B), and many cells in CA1
(C) and CA3 with extensive cytoplasmic swelling and organelle damage, indicating a necrotic morphology. A control CA1 neuron is
shown in A. Modified from Liu et al. (1999b).
 347

- CA1

CA3

C D
Fig. 8. Twenty-four hours after KA SE, the CA1 and CA3 sectors of the hippocampus, where neurons appeared necrotic by EM, show
extensive double-stranded DNA breaks by the TUNEL method (B, D) not seen in controls (A, C). Modified from Liu et al. (1999b).

Fig. 9. Twenty-four hours after KA SE, there is extensive expression of Bax-like immunoreactivity (-LI) in the CA1 and CA3 sectors
of the hippocampus (B, D), not present in controls (A, C). Furthermore, after SE there is intracellular redistribution of Bax-LI from a
diffuse cytoplasmic pattern in controls to a granular pattern in mitochondria-rich regions. Modified from Liu et al. (1999b).

injury in 2 - w e e k - o l d rat pups using the l i t h i u m - organelles w e r e seen after 30 m i n o f seizures, at a

pilocarpine m o d e l o f S E (Niquet et al., in press). t i m e w h e n n u c l e a r c h a n g e s w e r e m i n i m a l (Fig. 11).
M a r k e d s w e l l i n g and v a c u o l a t i o n o f c y t o p l a s m and A t that time, the m o s t p r o m i n e n t c h a n g e s w e r e
348

Fig. 10. Twenty-four hours after KA SE (B, D), we can observe extensive induction of immunoreactivity against the active form of
caspase 3 in both CA1 and CA3, and this is not present in controls (A, C). Modified from Liu et al. (1999b).

Fig. 11. Electron micrograph of a CA1 neuron from a rat perfused 30 min after the onset of lithium-pilocarpine SE: severe mitochondrial
and moderate cytoplasmic swelling are seen next to the intact nucleus. Note the disaggregation of ribosomes from rough endoplasmic
reticulum, a typical finding during SE.
 349

CA1 C SE 2 hrs

S E 2 hrs SE 2 hrs

Fig. 12. Semi-thin (1 ~tm) sections of the CAI sector of a control 2-week old rat (A) and of a littermate perfused after 2 h of
lithium-pilocarpine SE (B), show extensive SE-associated neuronal injury, not visible in hematoxylin and eosin or Cresyl violet sections
(not shown). EM showed a few apoptotic profiles (C), but most cells displayed extensive vacuolation and organelle swelling and damage,
and electron-dense cytoplasm and nucleus, suggesting necrosis (D).

marked swelling and deformity of mitochondria. De-
granulation of endoplasmic reticulum, a reflection
of seizure-induced inhibition of protein synthesis
during which ribosomes become detached from the
endoplasmic reticulum membrane, was prominent.
In animals perfused after 2 h of seizures (Fig. 12),
semi-thin, Toluidine blue-stained sections showed
extensive neuronal injury in CA1 (not visible by
hematoxylin and eosin or Cresyl violet staining).
Electron microscopy showed most of those cells to
have a necrotic morphology, although a minority
showed condensation of DNA into large clumps,
suggesting apoptosis (Fig. 12). In most cells, ex-
tensive cytoplasmic vacuolation, gross mitochondrial
swelling, swelling of endoplasmic reticulum, and
marked condensation of both cytoplasm and nucleus
into an electron-dense matrix were the rule, and
suggested a necrotic type of death. The predomi-
nance of necrosis over apoptosis at 2 h in CA1,
which in P15 pups shows a majority of neurons
with an apoptotic morphology at 24 h, may reflect
the more rapid time course of necrosis. It also im-
plies that the same seizures kill different individual
neurons in the same population of CA1 pyramids
at different rates and by a different process, possi-
bly as a result of differences in connectivity, seizure
participation and/or levels of depletion of energy
reserves.
350
The presence of severe mitochondrial swelling af-
ter only 30 min of seizures suggests that neuronal
injury from SE can develop rapidly even in imma-
ture rats. Mitochondrial swelling itself is a reversible
change, but our preliminary results suggest that it
leads rapidly to release of cytochrome c into the
cytoplasm. This triggers the activation of caspase 9,
which itself proteolytically activates caspase 3, the
main executioner of cell death. It is not clear at
which point this process leads to an irreversible com-
mitment to cell death. The severity of EM changes
observed after 2 h of seizures suggests that the point
of no return may have been reached, but there is
a paucity of information on that issue. Caspase 3
inhibitors have been reported to rescue ischemically
injured neurons when applied after the insult, but no
detailed time course of fine structural changes at that
time are available. Our data in hypoxic hippocampal
neurons in culture suggests that mitochondrial re-
lease of cytochrome c is a very early event, followed
by caspase activation which initially damages the
cytoplasm at the location of release (around mito-
chondria), and only reaches the nucleus many hours
later, thus accounting for the necrotic appearance of
damage (Niquet et al., in preparation).
Seizure-induced apoptosis and necrosis: a
speculative hypothesis
The mitochondrial location of early changes and the
high proportion of necrotic-appearing cell death at
early time points following SE suggest the follow-
ing hypothesis: in cells where seizures induced mild
energy failure (a known feature of SE in the im-
mature brain, see Wasterlain and Duffy, 1976) or
excitotoxic injury, the relative mild energy depletion
permitted some macromolecular synthesis, allowing
the expression of immediate early genes such as
Jun (Sankar et al., 2000a,b) or Bax, which trig-
gered the apoptotic cascade. Since energy depletion
from seizures is less rapid in the developing brain
than in adults, this process might predominate in
the immature brain. It would be further favored by
the constitutive expression during brain development
of cyclin-dependent kinases and of some immedi-
ate early genes and caspases, reducing the energy
requirements for full expression of the apoptotic cas-
cade, since several of the molecules required for
the early or intermediate steps do not need to be
synthesized de novo.
In cells where energy depletion in mitochon-
dria was more severe (as would be expected in
the adult), mitochondrial swelling and mitochondrial
malfunction may have resulted in liberation of cyto-
chrome c, which activated caspases locally, resulting
in swelling and injury to cytoplasm and organelles,
and in a necrotic-like appearance in which the nu-
cleus was only involved late in the process of cell
death. This form of cell death may not depend on
de novo gene expression, since energy depletion
may be too profound to allow it, but instead may
rely on caspase activation from constitutively ex-
pressed inactive proenzymes, a process triggered by
cytochrome c with minimal energetic requirements.
The biochemical cascade of the two types of
neuronal death may be similar, but the difference in
the ability to synthesize macromolecules and in the
location of caspase activation may result in strikingly
different morphologies by the two processes.
The predominance of apoptotic morphologies in
the immature brain may reflect in part its greater
reliance on glycolysis and resilience to energy fail-
ure, and in part its lesser energy requirements for
apoptosis, since many of the apoptotic tools (e.g.
cyclin-dependent kinases, caspases) are already ex-
pressed in developing cells.
The predominance of necrotic morphologies in the
adult brain would reflect in part the ease with which
SE depletes its energy reserves, and its greater reliance
on respiration, resulting in a mitochondrial location
of energy failure and in a perimitochondrial location
of caspase activation and proteolytic damage.
Conclusions
The problem of the consequences of epileptic
seizures for the immature brain is enormously com-
plex. Experimental studies in animals are beginning
to yield some basic biological rules, but their rele-
vance to the human situation is still uncertain.
In neonates, with their low metabolic rate and
fragmentary synaptic networks, there is good ev-
idence that seizure activity can cause short-term
effects on growth and neurogenesis and long-term
effects on synaptic wiring, hippocampal function
and seizure susceptibility.

In i m m a t u r e p r e p u b e s c e n t rodents, w i t h their h i g h
m e t a b o l i c rate and e x u b e r a n t synaptic and neuronal
networks, it is clear that s o m e seizure m o d e l s cause
e x t e n s i v e n e u r o n a l death, synaptic r e o r g a n i z a t i o n
and chronic e p i l e p s y w h i l e others do not, but w e
do not understand w h a t m a k e s seizures m a l i g n a n t or
benign, or h o w the a n i m a l data relate to the h u m a n
situation. H o w e v e r , w e are b e g i n n i n g to understand
the m e c h a n i s m o f s e i z u r e - i n d u c e d injury to both ma-
ture and i m m a t u r e neurons, and the m e c h a n i s m s o f
r e c o v e r y f r o m s e i z u r e - i n d u c e d d a m a g e . Hopefully,
this u n d e r s t a n d i n g will lead to m o r e e f f e c t i v e thera-
peutic and rehabilitative m e a s u r e s in the future.
Acknowledgements
S u p p o r t e d by Grant RO1 N S 13515 f r o m N I N D S
and by the V H A R e s e a r c h Service.
References
Albala, B.J., Moshe, S.L. and Okada, R. (1984) Kainic acid-
induce seizures: a developmental study. Dev. Brain Res., 13:
139-148.
Anderson, A.E., Hrachovy, R.A., Antalffy, B.A., Armstrong,
D.L. and Swann, J.W. (1999) A chronic focal epilepsy with
mossy fiber sprouting follows recurrent seizures induced by
intrahippocampal tetanus toxin injection in infant rats. Neuro-
science, 92: 73-82.
Babb, T.L. and Brown, W.J. (1987) Pathological finding in
epilepsy. In: J. Engel (Ed.), Surgical Treatment of the Epilep-
sies. Raven Press, New York, pp. 511-540.
Ben-Ari, Y., Tremblay, E., Berger, M. and Nitecka, L. (1984)
Kainic acid seizure syndrome and binding sites in developing
rats. Dev. Brain Res., 14: 284-288.
Bronzino, J.D., Blaise, J.H., Mokler, D.J. and Morgan, P.J.
(1999) Dentate granule cell modulation on freely moving
rats: vigilance state effects. Dev. Brain Res., 114: 143-148.
Camfield, P.R. (1997) Recurrent seizures in the developing brain
are not harmful. Epilepsia, 38: 735-737.
Cavalheiro, E.A., Silva, D.E, Turski, W.A., Calderazzo-Filho,
L.S., Bartolotto, Z. and Turski, L. (1987) The susceptibility
of rats to pilocarpine in age dependent. Dev. Brain Res., 37:
43-58.
Cendes, E, Andermann, F. and Dubeau, E et al. (1993) Early
childhood prolonged febrile convulsions, atrophy and sclerosis
of mesial structures, and temporal lobe epilepsy: an MRI
volumetric study. Neurology, 43: 1083-1087.
Chen, J., Nagayama, T., Jin, K., Stetler, R.A., Zhu, R.L., Graham,
S.H. and Simon, R.P. (1998) Induction of caspase-3-1ike pro-
tease may mediate delayed neuronal death in the hippocampus
after transient cerebral ischemia. J. Neurosci., 18: 4914-4928.
Cheng, Y., Deshmukh, M., D'Costa, A., Demaro, J.A., Gidday,
351
J.M., Shah, A., Sun, Y., Jacquin, M.E, Johnson, E.M. and
Holtzman, D.M. (1998) Caspase inhibitor affords neuroprotec-
tion with delayed administration in a rat model of neonatal
hypoxic-ischemic brain injury. J. Clin. Invest., 101: 1992-
1999.
Colbourne, F., Sutherland, G. and Auer, R. (1999) Electron
microscopic evidence against apoptosis as the mechanism of
neuronal death in global ischemia. J. Neurosci., 19: 4200-
4210.
DeCarli, C., Hatta, J., Fazilat, S., Fazilat, S., Gaillard, W.D. and
Theodore, W.H. (1998) Extratemporal atrophy in patients with
complex partial seizures of left temporal origin. Ann. Neurol.,
43: 41-45.
Desphande, J., Bergstedt, K., Linden, T., Kalimo, H. and Wie-
loch, T. (1992) Ultrastructural changes in the hippocampal
CA1 region following transient cerebral ischemia: evidence
against programmed cell death. Exp. Brain Res., 88: 91-105.
Dube, C., Chen, K., Eghbal-Ahmadi, M., Brunson, K., Soltesz,
I. and Baram, T.Z. (2000) Prolonged febrile seizures in the
immature rat model enhance hippocampal excitability long
term. Ann. Neurol., 47: 336-344.
Duffy, T.E., Kohle, S.J. and Vannucci, R.C. (1975) Carbohy-
drate and energy metabolism in perinatal rat brain: relation to
survival in anoxia. J. Neurochem., 24: 271-276.
Dwyer, B.E. and Wasterlain, C.G. (1982) Electroconvulsive
seizures in the immature brain adversely affect myelin ac-
cumulation. Exp. Neurol., 78: 616-628.
Elwes, R.D., Johnson, A.L. and Reynolds, E.H. (1988) The
course of untreated epilepsy. Brit. Med. J., 297: 948-950.
Falconer, M.A. and Taylor, D. (1968) Surgical treatment of
drug-resistant epilepsy due to mesial temporal sclerosis. Arch.
Neurol., 19: 353-361.
Franck, J.E. and Schwartzkroin, P.A. (1984) Immature rabbit
hippocampus is damaged by systemic but not intraventricular
kainic acid. Brain Res., 315: 219-227.
Freeman, R.S., Estus, S. and Johnson Jr., E.M. (1994) Analysis
of cell cycle-related gene expression in postmitotic neurons:
selective induction of Cyclin D1 during programmed cell
death. Neuron, 12: 343-355.
Fujikawa, D.G., Soderfeldt, B. and Wasterlain, C.G. (1992) Neu-
ropathological changes during generalized seizures in newborn
monkeys. Epilepsy Res., 12: 243-251.
Gillardon, E, Kiprianova, I., Sandkuhler, J., Hossmann, K.A.
and Spranger, M. (1999) Inhibition of caspases prevents cell
death of hippocampal CA1 neurons, but no impairment of
hippocampal long-term potentiation following global ischemia.
Neuroscience, 93: 1219-1222.
Haas, K.Z., Sperber, E.F. and Moshe, S.L. (1990) Kindling in de-
veloping animals: expression of severe seizures and enhanced
development of bilateral foci. Dev. Brain Res., 56: 275-280.
Hesdorffer, D.C., Logroscino, G., Cascino, G., Annegers, J.E
and Hauser W.A. (1998) Risk of unprovoked seizure after
acute symptomatic seizure: effect of status epilepticus. Ann.
Neurol., 44: 908-912.
Himi, T., Ishizaki, Y. and Murota, S. (1998) A caspase inhibitor
blocks ischemia-induced delayed neuronal death in the gerbil.
Eur. J. Neurosci., 10: 777-781.
352
Holmes, G.L., Gaiarsa, G.-L., Chevassus-Au-Louis, L. and Ben
Aft, Y. (1998) Consequences of neonatal seizures in the rat:
morphological and behavioral effects. Ann. NeuroL, 44: 845-
857.
Huang, L., Cilio, M.R., Silveira, D.C., McCabe, B.K., Sogawa,
Y., Safstrom, C.E. and Holmes, G.L. (1999) Long-term effects
of neonatal seizures: a behavioral, electrophysiological and
histological study. Dev. Brain Res., 118: 99-107.
Jiang, M., Lee, C.L., Smith, K.L. and Swann, J.W. (1998) Spine
loss and other persistent alterations of hippocampal pyramidal
cell dendrites in a model of early-onset epilepsy. J. Neurosci.,
18: 8356-8368.
Jorgensen, O.S., Dwyer, B.E. and Wasterlain, C.G. (1980)
Synaptic proteins after electroconvulsive seizures in immature
rats. J. Neurochem., 35: 1235-1237.
K~ilvi~iinen, R., Salmenper~i, T., Partanen, K., Vainio, P., Riekki-
nen, P. and Pitkanen, A. (1998) Recurrent seizures may cause
hippocampal damage in temporal lobe epilepsy. Neurology,
50: 1377-1382.
Kang, S.J., Wang, S., Hara, H., Peterson, E.P., Namura, S.,
Amin-Hanjani, S., Huang, Z., Srinivasan, A., Tomaselli, K.J.,
Kubova, H., Druga, R., Suchomelova, L., Haugvicova, R.,
Jirmanova, I. and Pitkanen, A. (2001) Status epilepticus causes
necrotic damage in the mediodorsal nucleus of the thalamus in
immature rats. J. Neurosci., 21: 3593-3599.
Kerr, J.E, Wyllie, A.H. and Currie, A.R. (1972) Apoptosis: a
basic biological phenomenon with wide-ranging implications
in tissue kinetics. Br. J. Cancer, 6: 239-257.
Kubova, H., Druga, R., Lukasiuk, K., Suchomelova, L., Haugvi-
cova, R., Jirmanova, I. and Pitkiinen, A. (2001) Status epilepti-
cus causes necrotic damage in the mediodorsal nucleus of the
thalamus in immature rats. J. Neurosci., 21: 3593-3599.
Kwan, P. and Brodie, M.J. (2000) Early identification of refrac-
tory epilepsy. N. Eng. J. Med., 342: 314-319.
Leist, M., Single, B., Castoldi, A.E, Kuhnle, S. and Nicotera, E
(1997) Intracellular adenosine tripbosphate (ATP) concentra-
tion: a switch in the decision between apoptosis and necrosis.
J. Exp. Med., 185: 1481-1486.
Lewis, D.V., Barboriak, D., MacFall, J.R., Provenzale, J.M.,
Mitchell, T.V. and VanLandingham, K.E. (2002) Do prolonged
febrile seizures produce medial temporal sclerosis? Hypothe-
ses, MRI evidence and unanswered questions. In: T. Sutula and
A. Pitk~inen (Eds.), Do Seizures Damage the Brain. Progress
in Brain Research, Vol. 135. Elsevier, Amsterdam, pp. 263-
278.
Liu, X.H., Kwon, D., Schielke, G.P., Yang, C.Y., Silverstein,
ES. and Barks, J.D. (1999a) Mice deficient in interleukin-I
converting enzyme are resistant to neonatal hypoxic-ischemic
brain damage. J. Cereb. Blood Flow Metab., 19:1099-1104.
Liu, H., Cao, Y., Basbaum, A.I., Mazarati, A.M., Sankar, R. and
Wasterlain, C.G. (1999b) Resistance to excitotoxin-ind~ced
seizures and neuronal death in mice lacking the prepro-
tachykinin A gene. Proc. Natl. Acad. Sci. USA, 96: 12096-
12101.
Lynch, M., Sayin, U., Bownds, J., Janupalli, S. and Sutula, T.
(2000) Long-term consequences of early postnatal seizures
on hippocampal learning and plasticity. Eur. J. Neurosci., 12:
2252-2264.
MacManus, J.P., Koch, C.J., Jian, M., Walker, T. and Zu-
rakowski, B. (1999) Decreased brain infarct following focal
ischemia in mice lacking the transcription factor E2FI. Neu-
roReport, 10: 2711-2714.
Margerison, J.H. and Corsellis, J.A. (1966) Epilepsy and the
temporal lobes: a clinical, electroencephalographic and neu-
ropathological study of the brain with particular reference to
the temporal lobes. Brain, 89: 680-708.
Mathern, G.W., Pretorious, J.K. and Babb, T.L. (1995) Influence
of the type of initial precipitating injury and at what age it
occurs on course and outcome in patients with temporal lobe
seizures. J. Neurosurg., 82: 220-227.
Maytal, J., Shinnar, S., Moshe, S.L. and Alvarez, L.A. (1989)
Low morbidity, and mortality of status epilepticus in children.
Pediatrics, 83: 323-331.
Mazarati, A.M., Wasterlain, C.G., Sankar, R. and Shin, D. (1998)
Self-sustaining status epilepticus after brief electrical stimula-
tion of the perforant path. Brain Res., 801: 251-253.
Miller, S.E, Li, L.M., Cendes, E, Tasch, E., Andermann, F.,
Dubeau, E and Arnold, D.L. (2000) Medial temporal lobe neu-
ronal damage in temporal and extratemporal lesional epilepsy.
Neurology, 54: 1465-1470.
Moshe, S.L., Stanton, P.K. and Sperber, E.E (1993) Sensitivity of
the immature central nervous system to epileptogenic stimuli.
In: EA. Schwartzkroin (Ed.), Epilepsy: Models, Mechanisms
and Concepts. Cambridge University Press, Cambridge, pp.
171-198.
Nelson, K.B. and Ellenberg, J.H. (1978) Prognosis in children
with febrile seizures. Pedatrics, 61: 720-727.
Neill, J.C., Liu, Z., Sarkisian, M., Tandon, E, Yang, Y.,
Stafstrom, C.E. and Holmes, G.L. (1996) Recurrent seizures
in immature rats: effect on auditory and visual discrimination.
Brain Res. Dev. Brain Res., 95: 283-292.
Niquet, J., Mazarati, L., Suchomelova, L., Mazarati, A., Bald-
win, R. and Wasterlain, C.G., Programmed necrosis in status
epilepticus, J. Neurochem., in press.
Okada, R., Moshe, S.L. and Albala, EJ. (1984) Infantile status
epilepticus and future seizures susceptibility in the rat. Brain
Res., 317: 177-183.
Osuga, H., Osuga, S., Wang, E, Fetni, R., Hogan, M.J., Slack,
R.S., Hakim, A.M., Ikeda, J. and Park, D.S. (2000) Cyclin
dependent kinases as a therapeutic target for stroke. Proc.
Natl. Acad. Sci. USA, 97: 10254-10259.
Padmanabhan, J., Park, D.S., Greene, L.A. and Shelanski, M.L.
(1999) Role of cell cycle regulatory proteins in cerebellar
granule neuron apoptosis. J. Neurosci., 19: 8747-8756.
Park, D.S., Farinelli, S.E. and Greene, L.A. (1996) Inhibitors
of cyclin-dependent kinases promote survival of post-mitotic
neuronally differentiated PC12 cells and sympathetic neurons.
J. Biol. Chem., 271: 8161-8169.
Park, D.S., Morris, E.J., Greene, L.A. and Geller, H.M. (1997)
GI/S cell cycle blockers and inhibitors of cyclin-dependent
kinases suppress camptothecin-induced neuronal apoptosis. J.
Neurosci., 17: 1256-1270.
Petito, C.K., Torres-Munoz, J., Roberts, B., Olarte, J.P., Nowak

Jr., T.S. and Pulsinelli, W.A. (1997) DNA fragmentation fol-
lows delayed neuronal death in CA1 neurons exposed to tran-
sient global ischemia in the rat. J. Cereb. Blood Flow Metab.,
17: 967-976.
Pulera, M.R., Adams, L.M., Liu, H., Santos, D.G., Nishimura,
R.N., Yang, F., Cole, G.M. and Wasterlain, C.G. (1998) Apop-
tosis in a neonatal rat model of cerebral hypoxia-ischemia.
Stroke, 29: 2622-2630.
Racine, R.J. (1972) Modification of seizure activity by electri-
cal stimulation. II. Motor seizure. Electroencephalogr. Clin.
Neurophysiol. 32: 281-294.
Rami, A., Agarwal, R., Botez, G. and Winckler, J. (2000) Mu-
Calpain activation, DNA fragmentation, and synergistic effects
of caspase and Calpain inhibitors in protecting hippocampal
neurons from ischemic damage. Brain Res., 866:299-312.
Represa, A., Robain, O., Tremblay, E. and Ben-Ari, Y. (1989)
Hippocampal plasticity in childhood epilepsy. Neurosci. Lett.,
99:351-355.
Ribak, C.E. and Baram, T.Z. (1995) Selective death of hip-
pocampal CA3 pyramidal cells with mossy fiber afferent after
CPH-induced status epilepticus in infants rats. Dev. Brain Res.,
91(2): 245-251.
Sagar, H.J. and Oxbury, J.M. (1987) Hippocampal neuron loss
in temporal lobe epilepsy; correlation with early childhood
convulsions. Ann. Neurol., 22: 334-340.
Sankar, R., Shin, D.H. and Wasterlain, C.G. (1997) Serum
neuron-specific enolase is a marker for neuronal damage fol-
lowing status epilepticus in the rat. Epilepsy Res., 28: 129-
136.
Sankar, R., Shin, D.H. and Liu, H. et al. (1998) Patterns of status
epilepticus induced neuronal injury during development and
long-term consequences. J. Neurosci., 18: 8382-8393.
Sankar, R., Shin, D., Mazarati, A.M., Liu, H. and Wasterlain,
C.G. (1999) Ontogeny of self-sustaining status epilepticus.
Dev. Neurosci., 21 : 345-351.
Sankar, R., Shin, D., Liu, H., Katsumori, H. and Wasterlain, C.G.
(2000a) Granule cell neurogenesis after status epilepticus in
the immature rat brain. Epilepsia, 41(Suppl. 6): $53-$56.
Sankar, R., Shin, D., Mazararti, A.M., Liu, H., Katsumori, H.,
Lezama, R. and Wasterlain, C.G. (2000b) Epileptogenesis after
status epilepticus reflects age- and model-dependent plasticity.
Ann. Neurol., 48: 580.
Scheibel, M.E., Crandall, P.H. and Scheibel, A.B. (1974) The
hippocampal-dentate complex in temporal lobe epilepsy. A
Golgi study. Epilepsia, 15: 55-80.
Schielke, C.G., Yang, C.Y., Shivers, B.D. and Betz, A.L. (1998)
Reduced ischemic brain injury in interleukin-I beta converting
enzyme-deficient mice. J. Cereb. Blood Flow Metab., 18:180-
185.
Spanaki, M.V., Kopylev, L., Liow, K., DeCarli, C., Fazilat, S.,
Gaillard, W.D. and Theodore W.H. (2000) Relationship of
353
seizure frequency to hippocampus volume and metabolism in
temporal lobe epilepsy. Epilepsia 41: 1227-1229.
Sutula, T.P. and Herman, B. (1999) Progression in temporal lobe
epilepsy. Ann. Neurol., 45: 553-556.
Swann, J.W., Pierson, M.G., Smith, K.L. and Lee, C.L. (1999)
Developmental neuroplasticity: roles in early life seizures and
chronic epilepsy. Adv. Neurol., 79: 203-216.
Tasch, E., Cendes, E, Li, L.M., Dubeau, F., Andermann, F. and
Arnold, D.L. (1999) Neuroimaging evidence of progressive
neuronal loss and dysfunction in temporal lobe epilepsy. Ann.
Neurol., 45: 568-576.
Theodore, W.H. and Gaillard, W.D. (2002) Neuroimaging and
the progression of epilepsy. In: T. Sutula and A. Pitk~inen
(Eds.), Do Seizures Damage the Brain. Progress in Brain
Research, Vol. 135. Elsevier, Amsterdam, pp. 305-313.
Theodore, W.H., Gaillard, W.D., De Carli, C., Bhatia, S. and
Hatta, J. (2001) Hippocampal volume and glucose metabolism
in temporal lobe epileptic foci. Epilepsia, 42: 130-132.
Thompson, K.W. and Wasterlain, C.G. (1997) Lithium-
pilocarpine status epilepticus in the immature rabbit. Brain
Res., 100: 1-4.
Thompson, K., Holm, A.M., Schousboe, A., Popper, P.,
Micevych, P. and Wasterlain, C.G. (1998) Hippocampal stim-
ulation produces neuronal death in the immature brain. Neuro-
science, 82: 337-348.
Van Esch, A., Ramlal, I.R., Van Steensel-Moll, H.A., Steyerberg,
E.W. and Derkeson-Lubsen, G. (1996) Outcome after febrile
status epilepticus. Dev. Med. Child Neurol., 38: 19-24.
Vanlandingham, K.E., Heinz, E.R. and Cavazos, J.E. et al. 0998)
Magnetic resonance imaging evidence of hippocampal injury
after prolonged focal febrile convulsions. Ann. Neurol., 43:
413 -426.
Verity, C.M., Ross, E.M. and Golding, J. (1993) Outcome of
childhood status epilepticus and lengthy febrile convulsions:
findings of national cohort study, Br. Med. J., 307: 225.
Verity, C.M. (1998) Do seizures damage the brain? The epidemi-
ological evidence. Arch. Dis. Child., 78: 78-84.
Villeneuve, N., Ben Ari, Y., Holmes, G.L. and Gaiarsa, J.-L.
(2000) Neonatal seizures induced persistent changes in intrin-
sic properties of CAI rat hippocampal cells. Ann. Neurol., 47:
729.
Wasterlain, C.G. (1976) Effect of neonatal status epilepticus on
rat brain development. Neurology, 26: 975-986.
Wasterlain, C.G. (1997) Recurrent seizures in the developing
brain are harmful. Epilepsia, 38: 728-734.
Wasterlain, C.G. and Duffy, T.E. (1976) Status epilepticus in
immature rats. Arch. Neurol., 33: 821-827.
Wieshmann, U.C., Woermann, F.G, and Lemieux, L. et al. (1997)
Development of hippocampal atrophy: a serial magnetic reso-
nance imaging study in a patient who developed epilepsy after
generalized status epilepticus. Epilepsia, 38: 1238-1241.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 30

Effects of brief seizures during development

Libor Velfgek 1,* and Solomon L. Mosh6 1,2

1Departments of Neurology and Neuroscience, Albert Einstein College of Medicine, Einstein/Montefiore Epilepsy Management Center,
Bronx, NY 10461, USA
2 Department of Pediatrics, Albert Einstein College of Medicine, Bronx, NY 10461, USA

Abstract: The effects of brief seizures during development depend on multiple factors such as underlying brain pathology,
specific age of occurrence and frequency. Studies in rats are frequently used to determine the consequences of seizures
in the developing brain. The shorter prepubertal development and life span of the rat compared to humans may suggest
that brief seizures in the rat are not necessarily equivalent to brief seizures in humans. Nevertheless, there is substantial
evidence that in the rat, the consequences of seizures are age-dependent. The immature brain is relatively resistant to
morphological damage, especially in the hippocampus, and functional changes as measured by electrophysiology and
behavior. Developmental kindling can be used as a model to study brief seizures early in life. Kindling permanently alters
the brain so that rats stimulated again in adulthood require only few kindling stimuli for fully kindled seizures to occur
although there are no apparent morphological and functional changes in the hippocampus resulting from kindling early in
life. The appreciation that kindling can alter brain function without any discrete (to date) morphological changes may lead
to the development of effective neuroprotective strategies to alter the process, but it is not clear that all kindling-induced
changes are detrimental to the brain.

Introduction span. In humans, prepubertal development (10-12

For the purpose of this paper, brief seizures will be
defined as only few minutes long episodes of EEG
epileptiform activity or motor convulsions. However,
is a brief seizure in laboratory animal similar to a
brief seizure in humans? If, in children, we con-
sider brief seizures to be several minutes long as
maximum, is it possible to apply the same time
scale to laboratory rats? The life span of laboratory
rat (approx. 2 years) is 1 / 3 5 - 1 / 3 8 of the human
life span. Another confounding factor, especially in
developmental studies, is the relatively very short
proportion of the rat prepubertal life to the total life
* Correspondence to: L. Velfgek, AECOM, K 314, 1410
Pelham Parkway South, Bronx, NY 10461, USA. Tel.:
+ 1-718-430-2490; Fax: +1-718-430-8899;
E-mail: velisek@aecom.yu.edu
years) represents 1 / 6 - 1 / 7 of the life span. In the
rat, the entire prepubertal period is finished within
5 weeks which is 1/20 of the rat life span. Fur-
thermore, the rat, as a precocious animal, is born at
a developmental stage corresponding to human pre-
mature newborn. Based on comparative ontogenetic
studies of the rate of brain growth, a 7-8-day-old
rat is considered equivalent to a human full term
(Gottlieb et al., 1977; Dobbing and Sands, 1979).
This further trims the corresponding period of pre-
pubertal development down to only 4 weeks (1/25
of the life span). These calculations would indicate
that in the adult rat, every minute of seizure would
represent at least a 35-min seizure in humans and in
prepubertal rats, even more, up to 100 min, which
is far in the range of status epilepticus. While one
can argue that basic elements of the nervous system
function such as action potentials have similar du-
ration in both humans and rats, these are dependent
356
on electrochemical features of the nervous tissue and
cannot vary too much or be relative to or even in-
dicative of the life span (cf. Aplysia). On the other
hand, complex functions of the nervous system may
reflect the different duration of the life span: kindling
is very rare in humans (Sramka et al., 1977; Dhuna
et al., 1991), however can be easily accomplished in
rats (Goddard et al., 1969; Post, 1977; Mosh6 and
Ludwig, 1988).
The effects of brief seizures may differ signif-
icantly depending on their frequency. Five to ten
seizures per day with a long postictal recovery pe-
riod may have an effect different from a single brief
seizure with minimal postictal recovery. Models,
which involve many repeated seizures with long re-
covery periods within 1 day may be associated with
malnutrition, which in this case is extremely diffi-
cult to control for. Finally, brief repeated seizures
may have a kindling effect. Thus, the originally brief
seizures may progress in duration and severity over
time and their long-term consequences may be dis-
proportionally enhanced.
Timing of brief seizures and brain development
To study the age-related changes in seizure suscep-
tibility in experimental animals, the investigator has
to correlate the brain development of the animal
to human brain development. As pointed out, a 7 -
8-day-old rat is considered equivalent to a human
full-term newborn (Gottlieb et al., 1977; Dobbing
and Sands, 1979) and the rat begins puberty between
33 and 38 days of age (Ojeda and Urbanski, 1994).
Thus, the rat at 2-3 weeks may be equivalent to a
human infant/toddler while at 4-5 weeks it may be
equivalent to an older prepubescent child. The rats
are considered as adults at age 55-60 postnatal days.
It should be emphasized that any correlation between
the development of human and rat brain is difficult
and should be always viewed cautiously because not
all parameters studied follow similar developmental
curves.
This information indicates (and is supported by
experimental studies) that there may be a difference
between the effects of brief seizures administered to
neonatal rats during the first week of life, during
the second and third postnatal week (a period of
increased seizure susceptibility; Mosh6 et al., 1981,
1983; Albala et al., 1984; de Feo et al., 1985; Zouhar
et al., 1989; Mareg and Velfgek, 1992; Velfgek et
al., 1992; de Feo and Mecarelli, 1993) or between
postnatal day 20 (PN20) until the puberty begins.
Additionally, sometimes it may be difficult to control
for the occurrence of brief seizures in the model, es-
pecially if the models do not utilize direct induction
of seizures but involve a treatment leading to seizure
development (e.g. hypoxia, tetanus toxin). In those
models, thorough monitoring may provide informa-
tion about brief seizure frequency and duration.
Clinical studies indicate that a major factor de-
termining the outcome after brief developmental
seizures may be the underlying brain pathology in
combination with seizures and not necessarily the
brief seizures per se. To date, the epileptic potential
and consequences of chemically, physically or ge-
netically induced brain structural abnormalities has
not been adequately explored (Roper et al., 1995;
Germano et al., 1996; Luhmann and Raabe, 1996;
Germano and Sperber, 1997; Gonzalez et al., 1997).
Outcomes
What are the long-term changes after brief seizures
during development? The expected spectrum of al-
terations is derived from the changes observed in
the adult rats after a series of brief seizures (mostly
kindling) and also after a bout of status epilepticus.
These alterations include long-term, histopathologi-
cal, neurophysiological and behavioral changes and
changes in seizure susceptibility.
Histopathological hippocampal changes
In adult rats, repeated brief seizures or a bout
of status epilepticus produce a spectrum of hip-
pocampal histopathological changes consisting of
neuronal loss, axonal sprouting and induction of
neo-neurogenesis in the dentate gyrus (Nadler et al.,
1978; Sperk et al., 1985; Sutula et al., 1988; Parent et
al., 1997, 1998). Therefore, similar long-term alter-
ations have been searched for after a series of brief
seizures in young rats. Available data suggest that
there is no definitive evidence that neuronal death
and sprouting occur after a series of brief seizures in
young rats (before PN20) (Sperber et al., 1999; Sper-
ber and Mosh6, 2001). A recent study (Haas et al.,

2001) demonstrated that in rats kindled on PN15-
PN16, there is no decrease in pyramidal neuron num-
bers in the CA3c area of the hippocampus after 2
weeks. Similarly, exposure to three flurothyl seizures
daily for 5 days on PN10-PNI5 did not produce any
gross morphological changes in the hippocampus
(Neill et al., 1996). Thus the data indicate a relatively
increased resistance of immature hippocampus (<3
weeks of age) to brief seizure-induced histopatho-
logical changes. However, subjecting immature rats
to a total of 50 flurothyl-induced seizures from PN0-
PN10 or PN10-PN23 caused increased mossy fiber
sprouting (Huang et al., 1999; Liu et al., 1999).
Somewhat different findings were found in adult
rats after tetanus toxin injection in the hippocampus
on PN10 which induced intense seizure activity on
the ensuing days (Swann et al., 1999). There was
a considerable reduction in the density of dendrite
spines in hippocampal area CA3c and the diameters
of dendritic segments were markedly reduced (Jiang
et al., 1998). Additionally, these rats had positive
Timm staining indicating axonal sprouting in the
inner molecular layer of the dentate gyrus (Ander-
son et al., 1999). However, two remarks should be
made. First, the rats with intrahippocampal tetanus
toxin on PN10 developed spontaneous seizures after
a time lag and these morphological changes may be a
function of spontaneous seizures in adulthood. Sec-
ond, spine density and dendritic diameter are quite
discrete changes, which may remain unnoticed after
brief seizures of other origins because investigators
have not specifically searched for them.
The relative resistance to seizure-induced cell
death in the hippocampus of P16 rats cannot be
explained by a decreased involvement of the hip-
pocampus in seizures at this age. Studies mapping
brain metabolic changes with 2-deoxyglucose uti-
lization during seizures, have shown that the hip-
pocampus is highly active at all ages tested in both
kainic acid-induced status epilepticus (as early as 3
days old; Tremblay et al., 1984) and kindled seizures
(16 days old; Ackermann et al., 1989). Although
kindling in PN15-PN16 rats is permanent and per-
sists till adulthood (Moshr, 1981; Mosh6 and Albala,
1982), the lack of cell loss and mossy fiber reorgani-
zation which we observed after kindling in P16 rats
indicates that these histopathologies are not obliga-
tory substrates of kindling.
357
While limited morphological changes have been
reported in the hippocampus after a short series of
brief seizures in young rats, this may be due to
differential sensitivity of brain structures to repeated
seizures. It seems that in the adult rats, the hippocam-
pus is the most vulnerable structure with respect to
seizures. However, in young rats, the vulnerabil-
ity threshold may be shifted and there is another,
still undiscovered, brain area with histopathological
changes. It is also possible that the consequences in
the developing brain are different from those seen in
the mature brain and the insistence of using similar
measurements in all age group may fail to uncover
developmental differences. This was demonstrated
for detection of damaged cells using acid fuchsin
stain and silver impregnation in immature brain
(Chang and Baram, 1994; Toth et al., 1998). The
fact that the immature neuron is changed and the
change is depicted by these stainings does not imply
that the cell is dead or even dying. The significance
of the developmental differences remains to be deter-
mined. Of course, if the seizure load to the immature
brain is heavy, neurons eventually will show mor-
phological changes. Another possible explanation is
that immature neurons in contrast to adult neurons
are only transiently stressed without gross morpho-
logical damage but with long-term metabolic conse-
quences as shown in the model of pentylenetetrazol-
induced status epilepticus in immature rats (Nehlig
and de Vasconselos, 1996).
Neurophysiological changes
Some alterations induced by brief repetitive seizures
may not be prominent enough to produce fixed mor-
phological changes. Therefore, electrophysiological
features of the hippocampal neurons were investi-
gated after repeated brief seizures in young rats.
An earlier report showed that an acute epilepti-
form activity induced by penicillin in the primary
visual cortex of infant rabbits led to persistent al-
terations of receptive field properties (Crabtree et
al., 1981). No alterations were found in adult rab-
bits (Crabtree et al., 1981). Amygdala kindling in
P16 rats did not cause a change in perforant path
paired-pulse profiles (Haas et al., 1996, 2001). Simi-
larly, no significant differences in paired paired-pulse
inhibition was noted between flurothyl-treated (50
358
seizures on PN0-PN10) and control rats (Huang et
al., 1999). In hippocampal slices prepared from adult
rats that had undergone hypoxia at P10, Mg2+-free
epileptiform discharges were significantly more fre-
quent compared to controls. Additionally, the slices
prepared just after an hypoxic episode displayed
a greater excitability than controls (Jensen et al.,
1998). In the slices from adult rats subjected to
intrahippocampal tetanus toxin spontaneous epilepti-
form network bursts were recorded in the area CA3c
(Smith et al., 1998). However, as stated above, the
results may be confounded by the occurrence of
spontaneous seizures in these rats in adulthood.
The data indicate that in some cases but not
always brief bouts of developmental seizures may
alter excitability of the limbic system with or without
alterations in hippocampal morphology.
Behavioral and cognitive changes
Status epilepticus induced by systemic administra-
tion of kainic acid in infant rats resulted in an
impaired ability of the rats to acquire conditioned
avoidance responses later in life (de Feo et al.,
1986). Repeated flurothyl-induced seizures in PN15
rats impaired the performance of these rats in adult-
hood in the water maze and their auditory location
(Neill et al., 1996). On the other hand, brief hy-
poxic seizures on PN10 did not change performance
of the rats in the adulthood in water maze, open
field, and handling tests (Jensen et al., 1992). Rats
with 50 flurothyl seizures between PN0 and PN10
had impaired learning and memory in the water
maze (Huang et al., 1999). So far, there is lim-
ited information on kindling-induced seizures. Rats
kindled at PN20 did not have any defects in wa-
ter maze and open field tests; however, were more
emotional than controls (Holmes et al., 1993). Pro-
longed kainic acid-induced seizures on PN1-PN14
also altered performance of the affected rats in the
radial maze in adulthood. While the rats treated
with kainic acid on PN1-PN14 required signifi-
cantly more trials to reach criterion and displayed
more reference and working errors, their impairment
was significantly smaller than the impairment in-
duced by kainic acid in adult rats (Lynch et al.,
2000). Similarly, immature rats injected intrahip-
pocampally with tetanus toxin display learning and
memory deficits when tested as adults (Swann, 2002,
this volume).
Changes in seizure susceptibility
In several models of repeated brief seizures (or a bout
of status epilepticus) in adult rats (Pinel and Rovner,
1978; Priel et al., 1996) these seizures may eventu-
ally lead to the occurrence of spontaneous seizures.
Currently, the only model with spontaneous seizures
in the adulthood after brief seizures early in life is
the tetanus toxin model. Thus, PN10 rats injected
with tetanus toxin in the hippocampus, which expe-
rience brief seizures, develop spontaneous seizures
as adults (Lee et al., 1995). The results suggest
that, in the normal rat younger than 3 weeks, re-
peated brief seizures (in combination with a toxin)
can predispose to seizures in adulthood. There are
several models of brief developmental seizures that
ultimately increase seizure susceptibility so seizures
in the adulthood can be triggered by minute exter-
nal stimuli. Increases in susceptibility to seizures in
adulthood have been shown after developmental kin-
dling in rats and kittens (Mosh6 and Albala, 1982;
Haas et al., 1990; Shouse et al., 1990) in terms
of kindling permanence. Further, rats experiencing
hypoxic seizures at PN10-PN12 showed enhanced
seizure susceptibility as adults (Chiba, 1985; Jensen
et al., 1992) to seizures induced by kindling and
fturothyl. Chiba (Chiba, 1985) showed that PN10
rats suffering from severe 0% 02 hypoxia have in-
creased susceptibility to pentylenetetrazol-induced
seizures in adulthood. Moreover, 13 of 20 hypoxic
rats developed status epilepticus while none of the 20
controls experienced status epilepticus. Additionally,
the amygdala kindling rate in adult rats subjected
to hypoxia on PN10 was twice faster than in con-
trols. Thus, hypoxia-induced seizures in young brain
may increase (under certain circumstances) seizure
susceptibility in adult brain although may not alter
other brain functions (Jensen et al., 1992; Applegate
et al., 1996). This finding is in agreement with epi-
demiological prospective studies in humans which
suggests that the outcome depends on the underlying
disease (and possibly on a combination of factors)
rather than on the isolated seizure itself (Verity et al.,
1992). However, Mosh6 and Albala (1985) subjected
either neonatal (PN1) or PN10 rats to 6% oxygen

hypoxia for either 4 h (PN1) or until a lethal ending
began to occur in most sensitive PN10 rats. These
hypoxic rats did not have an increased susceptibility
to kindling or flurothyl seizures as preadolescents
(during the fourth postnatal week) compared to sim-
ilarly handled controls (Mosh6 and Albala, 1985).
The difference may be in the degree of the hypoxic
insult. The former studies used 0% oxygen (Mosh6
and Albala, 1985), while the latter the exposure to
6% oxygen (Chiba, 1985). A second reason can be
developmental.
Kindling in developing rats
Fast acquisition of kindling
Kindling in young rats (permanent induction of
seizures after repeated subthreshold stimulations)
has been introduced in 1981 (Mosh6, 1981). It has
been demonstrated, that even very young (PN10) rats
can be successfully kindled (Baram et al., 1993).
There are several age-specific features of kindling.
Young, PN15, rats do not have a significant refrac-
tory period (a period, during which a subsequent
stimulation produces a shorter afterdischarge than
was the previous one; Mosh6, 1981; Mosh6 et al.,
1981; Michelson and Lothman, 1991; Velf~ek and
MareL 1991) and therefore, the stimulation can be
successfully delivered every 15-20 min. This 'rapid
kindling paradigm has been successfully employed
in the hippocampus and amygdala of the immature
rats (Haas et al., 1990; Michelson and Lothman,
1991). Next, in the amygdala, the afterdischarge
threshold, defined as the lowest intensity required
to trigger an afterdischarge, varies with age and the
highest threshold was found in the youngest rats (i.e.
in PNI5 vs. PN60 (Mosh6 et al., 1981). A similar
profile of the afterdischarge threshold was described
for the hippocampus (Mikol~i~ovfi et al., 1994).
Permanence
Once the young brain is kindled, the kindling ef-
fect is permanent. Thus, in adulthood, rats kindled at
PN15-PN17 require only few stimulations for the re-
expression of fully developed seizures (Mosh6 and
Albala, 1982). The permanence of infantile kindling
and its persistence to adulthood is not limited to
359
the initial stimulation site but extend to contralateral
homotopic regions, suggesting that kindling early in
life may have introduced secondary epileptogenesis
in other regions of the brain (Mosh6 and Albala,
1982). Similarly in kittens, the development of kin-
dling was progressive and permanent (Shouse et al.,
1990). As the permanence of infantile kindling and
its persistence to adulthood are not associated with
a significant hippocampal cell death and mossy fiber
reorganization in the dentate gyrus, other factors may
be involved (Haas et al., 1996). Thus, these studies
suggest that early in life there may be dissociation
between seizure-induced reorganization of neuronal
substrate and permanence of seizures. Although per-
manent in the adulthood, the kindling seizures are
still triggered by an external stimulus; however, on
rare occasions few spontaneous seizures have been
observed (Haas et al., 1990; Shouse et al., 1990).
These data raise several questions. (1) Why
is the imprint of kindling in infancy permanent
and includes the contralateral homologic structures?
(2) Why are so few morphological and functional
changes associated with a permanent functional state
of kindling? (3) Is there a way to prevent the
development/permanence of the infantile kindling
imprint?
Permanence and involvement of contralateral
structures after kindling
It has been demonstrated that kindling devel-
opment significantly involves NMDA receptor-
mediated neurotransmission (Mody and Heinemann,
1987). NMDA receptor antagonists are potent anti-
kindling agents in both adult (Gilbert, 1988; Rund-
feldt et al., 1994) and developing rats (Trommer and
Pasternak, 1990). During the second and third post-
natal week of the rat, the NMDA system is rapidly
developing (Luhmann and Prince, 1990) with unique
features of supersensitivity to agonists (Tsumoto et
al., 1987) and antagonists (Brady et al., 1994). At
this age, there is abundance of synaptic contacts,
which are gradually eliminated (Wolff and Missler,
1992; Kakizawa et al., 2000) in some structures in
a NMDA-dependent fashion (Rabacchi et al., 1992).
This indicates that the immature brain is plastic
permanently storing significant patterns of synap-
tic activation. This feature of the immature brain
360
greatly exceeds similar features of the adult brain
(Wolff and Missler, 1992). Behavioral and cognitive
patterns are formed and stored in the brain with
the help of NMDA receptor-mediated transmission
(Morris et al., 1986; Collingridge, 1987). The perma-
nence of kindling in developing animals may be due
to a strong synaptic activation by kindling stimuli
imprinted into the permanent pattern probably via
NMDA receptor involvement.
Dissociation between morphological and functional
changes and kindling (permanence) in young brain
The lack of apparent 'adult-like' morphological
changes associated with kindling in developing rats
is intriguing. In adult rats, an entire spectrum of mor-
phological changes occurs, such as hippocampal cell
loss and rearrangement of mossy fibers in the dentate
gyrus. Yet, none of these changes were seen after
kindling in young rats. Furthermore, even functional
changes clearly recorded using paired-pulse potenti-
ation paradigm in adult rats (Haas et al., 2001) were
not observed after kindling in young rats.
The reason for this may be an increased level of
plasticity of the immature brain. During this devel-
opmental period, immature neurons are flooded with
calcium due to enhanced activation of the supersen-
sitive NMDA receptor system. Indeed, this supersen-
sitivity period is associated with the period of devel-
opmental learning, acquisition of skills and building
the cognitive processes. Only some synaptic contacts
will remain in place and only some neurons will sur-
vive this formative stage of brain development. The
physiological loads of intracellular calcium provide
priming of neurons against at least calcium-mediated
cell death. On the other hand, those cells, which
receive only small influx of calcium may be destined
for active elimination triggered by small intracellular
calcium increases. Thus, an enhanced plasticity and
postseizure survival of the neurons go hand-in-hand.
An analogous effect has been demonstrated in the
adult rats: both traditional and rapid hippocampal
kindling protected against the hippocampal neuronal
death after a challenge with kainic acid (Kelly and
Mclntyre, 1994; Penner et al., 2001). We propose
that the more plastic, the more resistant is the brain
to the seizure-induced damage, yet the more capable
it is to make the seizure-induced changes permanent.
Is there a way to prevent the
development~permanence of infantile kindling
imprint?
The prevention of the development and permanence
of kindling would be a great accomplishment and
enhancement of the therapeutic spectrum for treat-
ment of childhood seizures. However, this is not a
simple task. A simple decrease in brain plasticity
such as after using NMDA receptor antagonist (CPP-
ene or MK-801) would prevent the development of
kindling (Gilbert, 1988). However, in the terrain of
the highly plastic developing brain this treatment af-
fects other highly desirable plastic features (Gorter
and de Bruin, 1992). Such a treatment may then
induce more frequent and more serious alterations
(cognitive problems) than progressive epileptogene-
sis itself.
One option would be to fully utilize the enhanced
developmental brain plasticity. Previous studies have
demonstrated, that in rats, kindling (usually using
50 or 60 Hz stimulus trains 0.5-2 s long) can be
significantly retarded by an application of long-term
1 Hz stimulation to the kindled site in between kin-
dling stimuli (Gaito, 1981; Gaito and Gaito, 1981;
Weiss et al., 1995). Our unpublished data suggest
that this low-frequency interference prevents the kin-
dling development also in PN15 rats. The kindling
stimulation paradigm closely resembles to the stim-
ulation used to induce long-term potentiation (LTP)
of synaptic transmission (i.e. the stimulation, which
enhances synaptic response of the pathway) (Teyler
and DiScenna, 1987). On the other hand, the long-
term 1-Hz stimulation corresponds to the stimulation
pattern used to elicit long-term depression (LTD) of
synaptic transmission (a process leading to a selec-
tive suppression of synaptic activity in the pathway)
(Reyes-Harde et al., 1999). So far, it is not clear
whether there are any effects of the long-term 1-Hz
stimulation on behavior and cognition. If this stimu-
lation has no long-term side effect in terms of altered
brain function, it might be used as a tool of stimu-
lation therapy of epilepsy in children, and especially
for the prevention of progressive epileptogenesis and
its effects on cognition. A putative procedure design
is given in Table 1. Other possibilities may include
the use of vitamin E (Behl, 2000), glutathione (Levy
et al., 1991), N-acetylcysteine (Hussain et al., 1996;

TABLE 1
Putative design of low-frequency synaptic activation paradigm
for treatment of childhood seizures
(1) Identification of focus or multifocal origin of seizures
(2) Identification of the structure in control of progressive
epileptogenesis
(3) Application of low-frequency synaptic activation paradigm
into either the primary focus (foci) or to the controlling
structure
Kheir-Eldin et al., 2001) or hormonotherapy (Behl,
2000; Behl et al., 2000; Velfgkovfi et al., 2000;
Garcia-Segura et al., 2001) as neuroprotectants.
On the other hand, there are probably differ-
ent, more natural ways to selectively enhance brain
developmental plasticity. Hubel and Wiesel demon-
strated that the extent of recovery from visual de-
privation was greater in the kittens actively involved
in visual experience than in kittens receiving pas-
sive visual information (Wiesel and Hubel, 1965).
Recent studies with exposure of animals to enriched
environment clearly revive this finding (van Praag et
al., 1999; Kempermann et al., 2000). Therefore, it
m a y be possible to use paradigms of active learning
or exposure to the enriched environment for im-
proving the outcome in the developing brain during
progressive epileptogenesis. Table 2 raises several
methodological issues that should be addressed ex-
perimentally.
TABLE 2
Issues on the use of the enhanced brain plasticity approach for
the prevention of progressive epileptogenesis in the developing
brain
(1) There is no enriched environment available for application in
young rats
(2) How to implement LTD in the enriched environment?
(3) Does the enriched environment lead to an enhancement of all
cognitive processes without a selection?
(4) How much of willful/forced activity should be applied (if
any forced)?
(5) Is the available time window long enough to implement
these approaches (for example, in the cerebellum, NMDA
supersensitivity occurs only in PN15-PN16 rats; Kakizawa
et al., 2000)?
(6) Can we determine endpoints of normal vs. enhanced brain
activity during active learning/exposure to enriched
environment?
361
Conclusions
The issue of permanence of the kindling process in
the developing brain may be especially important
for the understanding of long-term consequences of
childhood seizures. Seizures m a y not only perma-
nently imprint the pattern of seizure activity and
pathways of propagation into the developing brain
but also m a y recruit those synaptic connections and
pathways either destined to be eliminated or being
potentially utilized for cognitive processing during
the development. The former leads to an increased
level of 'noise' activity in the developing brain; the
latter produces functional impairments directly. In
either case, the result is not only fixation o f the
seizure patterns but also a serious impairment of the
functions attained by the developing brain.
The data are inconclusive as to the effects of brief
seizures on the developing brain. If one looks for
changes, changes will be found. W h a t is the meaning
of these changes? Are they always detrimental to
the brain? Is the treatment more beneficial than
the 'abnormal p r o c e s s ' ? If indeed some detrimental
effects are identified then age-specific treatments
could be instituted.
Acknowledgements
Supported in part by a grant NS-20253 from N I N D S
and a CURE Foundation Research Grant. S L M is a
Martin A. and E m i l y L. Fisher Fellow in Neurology
and Pediatrics.
References
Ackermann, R.E, Mosh6, S.L. and Albala, B.J. (1989) Restric-
tion of enhanced 14C-2-deoxyglucose utilization to rhinen-
cephalic structures in immature amygdala-kindled rats. Exp.
Neurol., 104: 73-81.
Albala, B.J., Mosh6, S.L. and Okada, R. (1984) Kainic-acid-
induced seizures: a developmental study. Dev. Brain Res., 13:
139-148.
Anderson, A.E., Hrachovy, R.A., Antalffy, B.A., Armstrong,
D.L. and Swann, J.W. (1999) A chronic focal epilepsy with
mossy fiber sprouting follows recurrent seizures induced by
intrahippocampal tetanus toxin injection in infant rats. Neuro-
science, 92: 73-82.
Applegate, C.D., Jensen, F., Burchfiel, J.L. and Lombroso, C.
(1996) The effects of neonatal hypoxia on kindled seizure
362
development and electroconvulsive shock profiles. Epilepsia,
37: 723-727.
Baram, T.Z., Hirsch, E. and Schultz, L. (1993) Short-interval
amygdala kindling in neonatal rats. Dev Brain Res., 73: 79-
83.
Behl, C. (2000) Vitamin E protects neurons against oxidative
cell death in vitro more effectively than 17-beta estradiol and
induces the activity of the transcription factor NF-kappaB. J.
Neural Transm., 107: 393-407.
Behl, C., Moosmann, B., Manthey, D. and Heck, S. (2000) The
female sex hormone oestrogen as neuroprotectant: activities at
various levels. Novartis Found. Symp., 230: 221-234.
Brady, R.J., Gorter, J.A., Monroe, M.T. and Swann, J.W. (1994)
Developmental alterations in the sensitivity of hippocampal
NMDA receptors to AP5. Dev. Brain Res., 83: 190-196,
Chang, D. and Baram, T.Z. (1994) Status epilepticus results in
reversible neuronal injury in infant rat hippocampus: novel use
of a marker. Brain Res. Dev. Brain Res., 77: 133-136.
Chiba, S. (1985) Long term effect of postnatal hypoxia on the
seizure susceptibility in rats. Life Sci., 37: 1597-1604.
Collingridge, G.L. (1987) The role of NMDA receptors in learn-
ing and memory. Nature, 330: 604-605.
Crabtree, J.W., Chow, K.L., Ostrach, L.H. and Baumbach, H.D.
(1981) Development of receptive field properties in the vi-
sual cortex of rabbits subjected to early epileptiform cortical
discharges. Dev. Brain Res., 1: 269-281.
De Feo, M.R. and Mecarelli, O. (1993) Ontogenetic models
of epilepsy. In: G. Avanzini, R. Fariello, U. Heinemann and
R. Mutani (Eds.), Epileptogenic and Excitotoxic Mechanisms.
John Libbey, London, pp. 89-97.
De Feo, M., Mecarelli, O. and Ricci, G. (1985) Bicuculline- and
allyglycine-induced epilepsy in developing rats. Exp. Neurol.,
90:411-421.
De Feo, M.R., Mecarelli, O., Palladini, G. and Ricci, G.F. (1986)
Long-term effects of early status epilepticus on the acquisition
avoidance behavior in rats. Epilepsia, 27: 476-482.
Dhuna, A., Pascual-Leone, A. and Langendorf, F. (1991)
Chronic, habitual cocaine abuse and kindling: A case report.
Epilepsia, 32: 890-894.
Dobbing, J. and Sands, J. (1979) Comparative aspects of the
brain growth spurt. Early Hum. Dev., 3: 79-83.
Gaito, J. (1981) The effect of low frequency and direct cur-
rent stimulation on the kindling phenomenon in rats. Can. J.
NeuroL Sci., 8: 249-253.
Gaito, J. and Gaito, S.T. (1981) The effect of several intertrial
intervals on the 1 Hz interference effect. Can. J. Neurol. Sci.,
8: 61-65.
Garcia-Segura, L.M., Azcoitia, I. and DonCarlos, L.L. (2001)
Neuroprotection by estradiol. Prog. Neurobiol., 63: 29-60.
Germano, I.M. and Sperber, E.E (1997) Increased seizure sus-
ceptibility in adult rats with neuronal migration disorders.
Brain Res., 777: 219-222.
Germano, I.M., Zhang, Y.E, Sperber, E.F. and Moshe, S.L.
(1996) Neuronal migration disorders increase susceptibility to
hyperthermia-induced seizures in developing rats. Epilepsia,
37: 902-910.
Gilbert, M.E. (1988) The NMDA-receptor antagonist, MK-801,
suppresses limbic kindling and kindled seizures. Brain Res.,
463: 90-99.
Goddard, G.V., Mclntyre, D.C. and Leech, C.K. (1969) A per-
manent change in brain function resulting from daily electrical
stimulation. Exp. Neurol., 25: 295-330.
Gonzalez, J.L., Russo, C.J., Goldowitz, D., Sweet, H.O., Davis-
son, M.T. and Walsh, C.A. (1997) Birthdate and cell marker
analysis of scrambler: a novel mutation affecting cortical
development with a reeler-like phenotype. J. Neurosci., 17:
9204-9211.
Gorter, J.A. and de Bruin, J.P. (1992) Chronic neonatal MK-801
treatment results in an impairment of spatial learning in the
adult rat. Brain Res., 580: 12-17.
Gottlieb, A., Keydor, I. and Epstein, H.T. (1977) Rodent brain
growth stages. An analytical review. Biol. Neonate, 32: 166-
176.
Haas, K., Sperber, E.F. and Mosh6, S.L. (1990) Kindling in de-
veloping animals: expression of severe seizures and enhanced
development of bilateral foci. Dev. Brain Res., 56: 275-280.
Haas, K.Z., Sperber, E.E, Mosh6, S.L. and Stanton, P.K. (1996)
Kainic acid-induced seizures enhance dentate gyrus inhibition
by downregulation of GABAB receptors. J. Neurosci., 16:
4250-4260.
Haas, K.Z., Sperber, E.F., Opanashuk, L.A., Stanton, P.K. and
Mosh6, S.L. (2001) Resistance of the immature hippocampus
to morphologic and physiologic alterations following status
epilepticus or kindling. Hippocampus, 11: 615-625.
Holmes, G.L., Thurber, S.J., Liu, Z., Stafstrom, C.E., Gatt,
A. and Mikati, M.A. (1993) Effects of quisqualic acid and
glutamate on subsequent learning, emotionality, and seizure
susceptibility in the immature and mature animal. Brain Res.,
623: 325-328.
Huang, L., Cilio, M.R., Silveira, D.C., McCabe, B.K., Sogawa,
Y., Stafstrom, C.E. and Holmes, G.L. (1999) Long-term effects
of neonatal seizures: a behavioral, electrophysiological, and
histological study. Brain Res. Dev. Brain Res., 118: 99-107.
Hnssain, S., Slikker Jr., W. and Ali, S.E (1996) Role of met-
allothionein and other antioxidants in scavenging superoxide
radicals and their possible role in neuroprotection. Neurochem.
Int., 29: 145-152.
Jensen, EE., Holmes, G.L., Lombroso, C.T., Blume, H.K. and
Firkusny, I.R. (1992) Age-dependent changes in long-term
seizure susceptibility and behavior after hypoxia in rats.
Epilepsia, 33: 971-980.
Jensen, EE., Wang, C., Stafstrom, C.E., Liu, Z., Geary, C.
and Stevens, M.C. (1998) Acute and chronic increases in
excitability in rat hippocampal slices after perinatal hypoxia In
vivo. J. NeurophysioL, 79: 73-81.
Jiang, M., Lee, C.L., Smith, K.L. and Swann, J.W. (1998) Spine
loss and other persistent alterations of hippocampal pyramidal
cell dendrites in a model of early-onset epilepsy. J. Neurosci.,
18: 8356-8368.
Kakizawa, S., Yamasaki, M., Watanabe, M. and Kano, M. (2000)
Critical period for activity-dependent synapse elimination in
developing cerebellum. J. Neurosci., 20: 4954-4961.
Kelly, M.E. and Mclntyre, D.C. (1994) Hippocampal kindling
protects several structures from the neuronal damage resulting

from kainic acid-induced status epilepticus. Brain Res., 634:
245-256.
Kempermann, G., van Praag, H. and Gage, EH. (2000) Activity-
dependent regulation of neuronal plasticity and self repair.
Prog. Brain Res., 127: 35-48.
Kheir-Eldin, A.A., Motawi, T.K., Gad, M.Z, and Abd-ElGawad,
H.M. (2001) Protective effect of vitamin E, beta-carotene and
N-aeetylcysteine from the brain oxidative stress induced in
rats by lipopolysaccharide. Int. Z Biochem. Cell. Biol., 33:
475-482.
Lee, C.L., Hrachovy, R.A., Smith, K.L., Frost Jr., I.D. and
Swann, J.W. (1995) Tetanus toxin-induced seizures in infant
rats and their effects on hippocampal excitability in adulthood.
Brain Res., 677: 97-109.
Levy, D.I., Sucher, N.J. and Lipton, S.A. (1991) Glutathione
prevents N-methyl-D-aspartate receptor-mediated neurotoxic-
ity. Neuroreport, 2: 345-347.
Liu, Z., Yang, Y., Silveira, D.C., Sarkisian, M.R., Tandon, P.,
Huang, L.T., Stafstrom, C.E. and Ho|mes, G.L. (1999) Conse-
quences of recurrent seizures during early brain development.
Neuroscience, 92: 1443-1454.
Luhmann, H.J. and Prince, D.A. (1990) Transient expression of
polysynaptic NMDA receptor-mediated activity during neocor-
tical development. Neurosci. Lett., 111:109-115.
Luhman, H.J. and Raabe, K. (1996) Characterization of neuronal
migration disorders in neocortical structures: I. Expression of
epileptiform activity in an animal model. Epilepsy Res., 26:
67-74.
Lynch, M., Sayin, U., Bownds, J., Janumpalli, S. and Sutula,
T. (2000) Long-term consequences of early postnatal seizures
on hippocampal learning and plasticity. Ear. J. Neurosci., 12:
2252-2264.
MareL P. and Velf~ek, L. (1992) N-Methyl-l~-aspartate (NMDA)-
induced seizures in developing rats. Dev. Brain Res., 65: 185-
189.
Michelson, H.B. and Lothman, E.W. (1991) An ontoge-
netic study of kindling using rapidly recurring hippocampal
seizures. Dev. Brain Res., 61: 79-85.
Mikolgt~ov~i, R., Velfgek, L., Vorlicek, J. and MareL E (1994)
Developmental changes of ketamine action against epileptic
afterdischarges induced by hippocampal stimulation in rats.
Brain Res., 81: 105-112.
Mody, I. and Heinemann, U. (1987) NMDA receptors of den-
tate gyrus granule cells participate in synaptic transmission
following kindling. Nature, 326: 701-704.
Morris, R.G.M., Anderson, E., Lynch, G.S. and Baudry, M.
(1986) Selective impairment of learning and blockade of LTP
by an NMDA receptor antagonist AP5. Nature, 319: 774-775.
Mosht, S.L. (1981) The effects of age on the kindling phe-
nomenon. Dev. Psychobiol., 14: 75-81.
Mosht, S.L. and Albala, B.J. (1982) Kindling in developing rats:
persistence of seizures into adulthood. Dev. Brain Res., 4: 67-
71.
Mosht, S.L. and Albala, B.J. (1985) Perinatal bypoxia and sub-
sequent development of seizures. Physiol. Behav., 35: 819-
823.
Mosht, S.L. and Ludwig, N. (1988) Kindling. In: T.A. Pedley
363
and B.S. Meldrum (Eds.), Recent Advances in Epilepsy. Vol.
4, Churchill Livingstone, Edinburgh, pp. 21-44.
Mosht, S.L., Sharpless, N.S. and Kaplan, J. (1981) Kindling
in developing rats: afterdischarge thresholds. Brain Res., 211:
190-195.
Mosht, S.L., Albala, B.J., Ackermann, R.F. and Engel, J.J.
(1983) Increased seizure susceptibility of the immature brain.
Dev. Brain Res., 7: 81-85.
Nadler, J.V., Perry, B.W. and Cotman, C.W. (1978) Intraventric-
ular kainic acid preferentially destroys hippocampal pyramidal
cells. Nature, 271: 676-677.
Nehlig, A. and de Vasconselos, A.P. (1996) The model of
pentylenetetrazol-induced status epilepticus in the immature
rat: short- and long-term effects. Epilepsy Res., 26: 93-103.
Neill, J.C., Liu, Z., Sarkisian, M., Tandon, P., Yang, Y.,
Stafstrom, C.E. and Holmes, G.L. (1996) Recurrent seizures
in immature rats: effect on auditory and visual discrimination.
Brain Res. Dev. Brain Res., 95: 283-292.
Ojeda, S.R. and Urbanski, H.F. (1994) Puberty in the rat. In: E.
Knobil (Ed.), The Physiology of Reproduction. Vol. I, Raven
Press, New York, pp. 363-411.
Parent, J.M., Yu, T.W., Leibowitz, R.T., Geschwind, D.H.,
Sloviter, R.S. and Lowenstein, D.H. (1997) Dentate granule
cell neurogenesis is increased by seizures and contributes to
aberrant network reorganization in the adult rat hippocampus.
J. Neurosci., 17: 3727-3738.
Parent, J.M., Janumpalli, S., McNamara, J.O. and Lowenstein,
D.H. (1998) Increased dentate granule cell neurogenesis fol-
lowing amygdala kindling in the adult rat. Neurosci. Lett., 247:
9-12.
Penner, M.R., Pinaud, R. and Robertson, H.A. (2001) Rapid
kindling of the hippocampus protects against neural damage
resulting from status epilepticus. Neuroreport, 12: 453-457.
Pinel, J.P.J. and Rovner, L.I. (1978) Experimental epileptogene-
sis: kindling induced epilepsy in rats. Exp. Neurol., 58: 190-
202.
Post, R.M. (1977) Progressive changes in behavior and seizures
following chronic cocaine administration relationship to kin-
dling and psychosis. Adv. Behav. Biol., 21: 353-372.
Priel, M.R., dos Santos, N.F. and Cavalheiro, E.A. (1996) De-
velopmental aspects of the pilocarpine model of epilepsy.
Epilepsy Res., 26:115-121.
Rabacchi, S., Bailly, Y., Delhaye-Bouchaud, N. and Mariani,
J. (1992) Involvement of the N-metbyl-D-aspartate (NMDA)
receptor in synapse elimination during cerebellar development.
Science, 256: 1823-1825.
Reyes-Harde, M., Empson, R., Potter, B.V., Galione, A. and
Stanton, P.K. (1999) Evidence of a role for cyclic ADP-ribose
in long-term synaptic depression in hippocampus. Proc. Natl.
Acad. Sci. USA, 96: 4061-4066.
Roper, S.N., Gilmore, R.L. and Houser, C.R. (1995) Experimen-
tally induced disorders of neuronal migration produce an in-
creased propensity for electrographic seizures in rats. Epilepsy
Res., 21: 205-219.
Rundfeldt, C., Wlaz, E and Ltscher, W. (1994) Anticonvulsant
activity of antagonists and partial agonists for the NMDA
364
receptor associated glycine site in the kindling model of
epilepsy. Brain Res., 653: 125-130.
Shouse, M.N., King, A., Langer, J., Vreeken, T., King, K. and
Richkind, M. (1990) The ontogeny of feline temporal lobe
epilepsy: kindling a spontaneous seizure disorder in kittens.
Dev. Brain Res., 52: 215-224.
Smith, K.L., Lee, C.L. and Swann, J.W. (1998) Local circuit
abnormalities in chronically epileptic rats after intrahippocam-
pal tetanus toxin injection in infancy. J. Neurophysiol., 79:
106-116.
Sperber, E.E and Mosh& S.L. (2001) The effects of seizures on
the hippocampus of the immature brain. In: J.J. Engel, P.A.
Schwartzkroin, S.L. Mosh6 and D.H. Lowenstein (Eds.), Brain
Plasticity and Epilepsy: A Tribute to Frank Morrell. Vol. 45,
Academic Press, San Diego, CA, pp. 119-139.
Sperber, E.E, Germano, I.M., Friedman, L.K., Velf~kovfi, J. and
Romero, M.T. (1999) The resiliency of the immature brain
to seizure-induced damage. In: A. Nehlig, J. Motte, S.L.
Mosh6 and P. Plouin (Eds.), Childhood Epilepsies and Brain
Development. John Libbey, London, pp. 255-262.
Sperk, G., Lassman, H., Baran, H., Seitelherger, E and
Hornykiewicz, O. (1985) Kainic acid-induced seizures: Dose
relationship of behavioural, neurochemical and histopathologi-
cal changes. Brain Res., 338: 289-295.
Sramka, M., Sedhik, P. and N~dvomfk, P. (1977) Observation of
the kindling phenomenon in treatment of pain by stimulation
in thalamus. In: W.H. Sweet (Ed.), Neurosurgical Treatment in
Psychiatry, Pain, and Epilepsy. University Park Press, Balti-
more, MD, pp. 651-654.
Sutula, T., He, X., Cavazos, J. and Scott, G. (1988) Synap-
tic reorganization induced in the hippocampus by abnormal
functional activity. Science, 239:1147-1150.
Swann, J.W. (2002) Recent experimental studies of the effects of
seizures on brain development. In: T. Sutula and A. Pitk~inen
(Eds.), Do Seizures Damage the Brain. Progress in Brain
Research, Vol. 135. Elsevier, Amsterdam, pp. 391-393.
Swann, J.W., Pierson, M.G., Smith, K.L. and Lee, C.L. (1999)
Developmental neuroplasticity: roles in early life seizures and
chronic epilepsy. Adv. Neurol., 79: 203-216.
Teyler, T.J. and DiScenna, P. (1987) Long-term potentiation.
Annu. Rev. Neurosci., 10: 131-161.
Toth, Z., Yan, X.X., Haftoglou, S., Ribak, C.E. and Baram,
T.Z. (1998) Seizure-induced neuronal injury: vulnerability to
febrile seizures in an immature rat model. J. Neurosci., 18:
4285-4294.
Tremblay, E., Nitecka, L., Berger, M. and Ben-Ari, Y. (1984)
Maturation of kainic acid seizure-brain damage syndrome in
the rat. I. Clinical, electrographic and metabolic observations.
Neuroscience, 13: 1051 - 1072.
Trommer, B.L. and Pasternak, J.E (1990) NMDA receptor antag-
onists inhibit kindling epileptogenesis and seizure expression
in developing rats. Dev. Brain Res., 53: 248-252.
Tsumoto, T., Hagihara, H., Sato, H. and Hata, S. (1987) NMDA
receptors in the visual cortex of young kittens are more effec-
tive than those of adult cats. Nature, 327: 513-514.
Van Praag, H., Christie, B.R., Sejnowski, T.J. and Gage, EH.
(1999) Running enhances ueurogenesis, learning, and long-
term potentiation in mice. Proc. Natl. Acad. Sci. USA, 96:
13427-13431.
Velf~ek, L. and MareS, E (1991) Increased epileptogenesis in the
immature hippocampus. Exp. Brain Res. Ser., 20: 183-185.
Velf~ek, L., Kubov~i, H., Pohl, M., Stankov~i, L., Mareg, E
and Schickerov~i, R. (1992) Pentylenetetrazol-induced seizures
in rats: An ontogenetic study. Naunyn-Schmiedeberg's Arch.
Pharmacol., 346: 588-59l.
Velf~kovfi, J., Velf~ek, L., Galanopoulou, A.S. and Sperber, E.E
(2000) Neuroprotective effects of estrogens on hippocampal
cells in adult female rats after status epilepticus. Epilepsia, 41:
$30-35.
Verity, C.M., Ross, E.M. and Golding, J. (1992) Epilepsy in the
first 10 years of life: findings of the child health and education
study. Br Med. J., 305: 857-861.
Weiss, S.R., Li, X.L., Rosen, J.B., Li, H., Heynen, T. and
Post, R.M. (1995) Quenching: inhibition of development and
expression of amygdala kindled seizures with low frequency
stimulation. Neuroreport, 6: 2171-2176.
Wiesel, T.N. and Hubel, D.H. (1965) Extent of recovery from the
effects of visual deprivation in kittens. J. Neurophysiol., 28:
1060-1072.
Wolff, J.R. and Missler, M. (1992) Synaptic reorganization in
developing and adult nervous systems. Anat. Anz., 174: 393-
403.
Zouhar, A., Mareg, P., Ligkov~i-Bernfigkov~i,K. and Mudrochov~i,
M. (1989) Motor and electrocorticographic epileptic activity
induced by bicuculline in developing rats. Epilepsia, 30: 501-
510.
T. Sutula and A. P i t k ~ e n (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 31

Is neuronal death required for seizure-induced

epileptogenesis in the immature brain?

Tallie Z. Baram *, Mariam Eghbal-Ahmadi and Roland A. Bender

Departments of Pediatrics, Anatomy Neurobiology and Neurology, UniversiO, of California at ln, ine, lrvine, CA 92697-4475, USA

Abstract: Do seizures cause neuronal death? At least in the immature hippocampus, this may not be the critical question
for determining the mechanisms of epileptogenesis. Neuronal injury and death have clearly been shown to occur in
most epilepsy models in the mature brain, and are widely considered a prerequisite to seizure-induced epilepsy. In
contrast, little neuronal death occurs after even a severe and prolonged seizure prior to the third postnatal week. However,
seizures early in life, for example prolonged experimental febrile seizures, can profoundly and permanently change the
hippocampal circuit in a pro-epileptogenic direction. These seizure-induced alterations of limbic excitability may require
transient structural injury, but are mainly due to functional changes in expression of gene coding for specific receptors
and channels, leading to altered functional properties of hippocampal neurons. Thus, in some pro-epileptogenic models
in the developing brain, neither the death of neurons nor death-induced abnormalities of surviving neurons may underlie
the formation of an epileptic circuit. Rather, findings in the experimental prolonged febrile seizure model suggest that
persistent functional alterations of gene expression ('neuroplasticity') in diverse hippocampal neuronal populations may
promote pro-epileptogenic processes induced by these seizures. These findings also suggest that during development,
relatively short, intense bursts of neuronal activity may disrupt 'normal' programmed maturational processes to result in
permanent, selective alterations of gene expression, with profound functional consequences. Therefore, determining the
cascade of changes in the programmed expression of pertinent genes, including their temporal and cell-specific spatial
profiles, may provide important information for understanding the process of transformation of an evolving, maturing
hippocampal network into one which is hyperexcitable.

Introduction killing neurons, leading to reduced inhibition or to

The issue of neuronal injury and death caused by
seizures has haunted investigators in the field for sev-
eral decades (Margerison and Corsellis, 1966; Babb
and Brown, 1987; Armstrong, 1993). The striking
cell loss in specific hippocampal regions and lay-
ers found in humans with temporal lobe epilepsy
has suggested that seizures may cause epilepsy by
* Correspondence to: T.Z. Baram, Departments of Pedi-
atrics and Anatomy/Neurobiology, ZOT 4475, University
of California at Irvine, Irvine, CA 92697-4475, USA. Fax:
+ 1-949-824-1106; E-mail: tallie@uci.edu
the development of excitatory synapses and circuits
(e.g., Sloviter, 1991; Dudek et al., 1994; Scharfman,
1999).
Indeed, a strong body of evidence using mod-
els of seizure-induced epilepsy has documented that
prolonged limbic seizures (status epilepticus) as well
as kindling (Cavazos et al., 1994) result in hippocam-
pal cell loss in a pattern reminiscent of that found
in human temporal lobe epilepsy (e.g., Lothman and
Collins, 1981; Nadler, 1981; Ben-Ari, 1985; Sperk
et al., 1985; Obenaus et al., 1993; Buckmaster and
Dudek, 1997). This cell loss has been found to be
progressive (Sutula, 1991; Kalviainen et al., 1998),
and associated with - - in fact, probably required
366
for (Schauwecker et al., 2000) - - synaptic reorga-
nization and increased excitability in the involved
circuits (Dudek et al., 1994; Scharfman et al., 2000).
In analogy to the usefulness of mature animal
models for elucidating the role of seizure-induced
neuronal death in the epileptogenic process in human
adults, limbic seizures have been induced during the
first 2 weeks of life in the rat, using kainic acid
and other convulsants (e.g., Albala et al., 1984;
Nitecka et al., 1984; Holmes and Thompson, 1988;
Veliskova et al., 1988; Holmes et al., 1998; McCabe
et al., 2001). These experiments have attempted to
provide clues about the immediate and long-term
consequences of early-life seizures in the human,
and in particular, about the relationship of seizures,
such as those induced by neonatal asphyxia (Jensen
et al., 1991), fever (Shinnar, 1998) or other triggers
(Baram and Hatalski, 1998), to subsequent epilepsy.
Specifically, whether seizures early in life cause cell
death, and whether this death is required, sufficient,
or even related, to subsequent epilepsy has been a
topic of intense investigation (for discussions see
Holmes and Ben-Aft, 1998; Sperber et al., 1999;
Dube et al., 2000; Kubova et al., 2001; Bender and
Baram, 2002).
Because seizures provoked by fever are the most
common human developmental seizures which are
associated with subsequent temporal lobe epilepsy
and hippocampal cell loss, we developed and char-
acterized a model of experimental prolonged febrile
seizures in the immature rat. Here we discuss the
issues of the occurrence of cell death after these
seizures, of other structural alterations in the 'wiring'
of the hippocampal network, and of the functional
changes induced by these seizures, including en-
hanced susceptibility to further seizures. We consider
the molecular and cellular processes that may under-
lie these changes. These findings indicate important
differences between mechanisms of seizure-induced
epileptogenicity in mature and still developing hip-
pocampus, and suggest that the interaction of a bout
of intense neuronal activity with programmed mat-
uration of the hippocampal network may lead to
long-lasting neuroplastic alterations which promote
a hyperexcitable state without the requirement for
neuronal death.
The rationale for studying prolonged febrile
seizures and temporal lobe epilepsy
Temporal lobe epilepsy (TLE) is the most preva-
lent type of human focal epilepsy, yet the processes
leading to spontaneous seizures involving the hip-
pocampus have not been fully determined. Specifi-
cally, the relationship of childhood febrile seizures
to adult TLE has remained a focus of intense con-
troversy (for brief recent reviews see Shinnar, 1998;
Sloviter and Pedley, 1998; Lewis, 1999; Dube et
al., 2000). Epidemiological evidence from prospec-
tive studies has convincingly shown that most febrile
seizures carry a benign outcome: they do not lead
to development of subsequent unprovoked seizures
(epilepsy). However, retrospective analyses of adults
with TLE have demonstrated a high prevalence (30%
to >60%) of a history of prolonged (longer than
10-15 min) febrile seizures during early childhood,
suggesting an etiological role for these seizures in
the development of TLE (e.g., Cendes et al., 1993;
French et al., 1993). Specifically, neuronal damage
induced by febrile seizures has been suggested as a
mechanism for the development of mesial temporal
sclerosis, the pathological hallmark of TLE (Bruton,
1988; Armstrong, 1993). In addition, recent imaging
studies in children with prolonged febrile seizures
have shown acute hippocampal swelling in some,
indicating acute neuronal injury (VanLandingham et
al., 1998). However, these data should not be taken to
indicate a causal relationship, and alternative mech-
anisms may exist for the correlation of prolonged
febrile seizures and TLE. For example, pre-existing
(genetic or acquired, functional or structural) neu-
ronal abnormalities may provide a predisposition to
the occurrence of prolonged febrile seizures or for
subsequent neuronal injury and TLE.
Given the high prevalence of febrile seizures (1 in
20-30 children), understanding their consequences
for the developing brain is critical, because even a
relatively small contribution by these seizures to the
development of epilepsy will result in large numbers
of affected individuals. However, febrile seizures
cannot be induced, and the critical question of the
causal relationship of prolonged febrile seizures and
epilepsy cannot be studied in children. Therefore, an
immature rat model for these seizures has been cre-
ated. Because 'complex', typically prolonged, febrile

seizures are those that have been associated with sub-
sequent limbic epilepsy (TLE), the model aimed to
reproduce this subtype of human febrile seizures as
closely as possible. Seizures in the model are pro-
voked by generating brain temperatures seen phys-
iologically in ill infants, and seizure duration is
regulated to reproduce relatively prolonged febrile
seizures (420 min), those considered complex by
the International League Against Epilepsy, and asso-
ciated retrospectively with the development of TLE.
Several features of the model, which render it suit-
able for study of the mechanisms and consequences
of these prolonged febrile seizures, have been char-
acterized. These include an age-specificity, tempera-
tures required for seizure induction, lack of mortal-
ity or acute morbidity and pharmacological profile,
which are similar to those of human febrile seizures
(Knudsen, 1996; Baram et al., 1997; Dube et al.,
2000). In addition, the neuronal circuits involved in
the seizures have been mapped (Chen et al., 1999;
Dube et al., 2000; Hatalski et al., 2000).
Note that throughout this chapter, reference is
made to the developmental stage when febrile
seizures may be 'generated or provoked'. This, in the
animal model, implies postnatal days 9-14 (Baram et
al., 1997), and the seizures are induced on days 10-
11. It is fully recognized that direct correlations of
rat brain development to that in the human are impre-
cise. However, in general, evidence based on rates of
neuronal birth and myelination (Dobbing and Sands,
1973, 1979), and saltatory growth stages (Gottlieb et
al., 1977) suggest that the 5-7-days-old rat may be
'equivalent' to the human newborn. Rat brain devel-
opment at 10-15 postnatal days, the age of maximal
susceptibility to triggered seizures (including those
induced by hyperthermia; Hjeresen and Diaz, 1988;
Jensen et al., 1991; Baram and Hatalski, 1998) may
thus best correspond to the stage of brain develop-
ment during human infancy (Gottlieb et al., 1977).
This model of complex (prolonged) febrile
seizures has been used to address the fundamental
question of whether these seizures promote epilepsy
by causing death of vulnerable hippocampal neu-
ronal populations leading to mesial temporal scle-
rosis, neuroanatomical matrix of TLE. It should be
noted that this specific pattern of neuronal loss is
found in the majority of individuals with TLE (Arm-
strong, 1993; Kuzniecky et al., 1997), but whether
367
neuronal death promotes epilepsy, or whether recur-
rent seizures result in neuronal death is unclear.
Prolonged experimental febrile seizures result in
permanent increase of hippocampal excitability,
and in susceptibility to the development of
further iimbic seizures
Whether prolonged febrile seizures in the imma-
ture rat model lead to the development of sponta-
neous seizures was investigated using both in vivo
and in vitro approaches (Dube et al., 2000). Af-
ter induction of such seizures, animals were al-
lowed to mature (three months), then underwent
extensive hippocampal-EEG and behavioral moni-
toring. Both EEGs and behavioral measures failed
to demonstrate spontaneous seizures. However, these
animals showed a fourfold increase in susceptibil-
ity to kainic acid, an activator of the AMPA-type
glutamate receptors. In essence, a dose that failed
to provoke seizures in most adult rats which had
not experienced prolonged febrile seizures in 'in-
fancy' (normothermic controls and those who were
subjected to hyperthermia but in which seizures had
been blocked) led to severe seizures in all adult
animals who had prolonged experimental febrile
seizures early in life. This increased susceptibility
to limbic convulsants was confirmed in vitro: sponta-
neous epileptiform discharges were not observed in
hippocampal-entorhinal cortex slices derived from
either control or experimental groups. However,
Schaffer collateral stimulation induced prolonged,
self-sustaining, status-epilepticus-like discharges ex-
clusively in slices from experimental rats. These
data indicate that experimental prolonged febrile
seizures do not cause spontaneous limbic seizures
during adulthood. However, they reduce thresholds
to chemical convulsants in vivo and to electrical
stimulation in vitro, indicating persistent enhance-
ment of hippocampal excitability that may facilitate
the development of epilepsy.
The mechanisms by which prolonged febrile
seizures enhance excitability do not involve cell
death
As mentioned earlier, a large body of literature in-
volving adult animal models supports the notion
368
that provoked seizures may lead to spontaneous
seizures (epilepsy) by killing vulnerable neurons
in hippocampus and amygdala, altering the bal-
ance of excitation/inhibition in the limbic network
(Sloviter, 1994). Indeed, experimental models us-
ing pilocarpine (Mello et al., 1993; Obenaus et al.,
1993) or kainic acid (Pollard et al., 1994; Buckmas-
ter and Dudek, 1997) document that neuronal loss
induced by these seizures precedes the emergence of
spontaneous seizures. Therefore, the hypothesis was
tested that experimental prolonged febrile seizures
increased hippocampal excitability by causing the
loss of vulnerable neuronal populations.
Using molecular methods for visualizing neu-
ronal death, no excess of in situ end-labeled cells
was found 1, 4, 8.5, 20 or 48 h after seizures last-
ing 20 or 60 rain (Toth et al., 1998). In addition,
stereological counts in amygdala (Toth et al., 1998)
or in specific hippocampal sub-populations that are
vulnerable to seizure-induced death in other models,
failed to reveal loss of mossy cells or other seizure-
sensitive neuronal populations (Bender and Baram,
1999, 2002). Thus, it was concluded that experimen-
tal prolonged febrile seizures do not lead to cell loss.
This is in accord with data from other single pro-
longed developmental seizures such as those induced
by hypoxia (Jensen and Baram, 2000) or by chem-
ical provocation, during the second postnatal week
(Sperber et al., 1992), and indicates that the mech-
anisms by which prolonged febrile seizures increase
hippocampal excitability may not involve hippocam-
pal cell death. In addition, the findings support the
notion that these mechanisms may involve interac-
tion with concurrent maturational processes in the
developing hippocampus.
Neurogenesis is not altered by prolonged
experimental febrile seizures
Death of hippocampal CA3 pyramidal cells or of hi-
lar neurons deprives the excitatory granule cells of
their targets and leads to abnormal growth ('sprout-
ing') of their axons, the mossy fibers. The excita-
tory synaptic connections formed by these axons are
widely considered to contribute to the mechanism of
enhanced hippocampal excitability and epileptogene-
sis (e.g., Pollard et al., 1994; Buckmaster and Dudek,
1997). A second trigger for abnormal granule cell
excitatory innervation is seizure-induced alteration of
their postnatal proliferation rate and total numbers
(Parent et al., 1997; Parent and Lowenstein, 2002, this
volume), as shown for several experimental seizure
models in adult animals. However, no evidence for
altered granule cell proliferation rate and only modest
'sprouting' of the granule cell axons was found after
prolonged febrile seizures in the immature rat model
(Baram et al., 2000; Bender et al., 2000). These find-
ings reinforce the notion that these seizures affect the
hippocampal network via processes which are distinct
from those implicated in adult epileptogenesis, and
which must interact with - - and perhaps disrupt - -
developmental events coinciding with these seizures
(Jensen and Baram, 2000).
Prolonged 'febrile' seizures injure specific
populations of hippocampal neurons
The data discussed above demonstrated a dichotomy
between the functional and neuroanatomical changes
induced by experimental prolonged febrile seizures.
Namely, enhanced susceptibility to further seizures
was observed long-term, but this was achieved with-
out any evidence for acute or chronic cell death.
Therefore, we evaluated the possibility that experi-
mental prolonged febrile seizures induced neuronal
injury that was sufficient to permanently alter the
properties of these neurons, without leading to their
death. A method considered sensitive to changes
in cytoskeletal elements of neurons was chosen
(Gallyas et al., 1990; Toth et al., 1998) to visual-
ize the potential effects of hyperthermic seizures on
neuronal structure. The overall approach involved
a comparison of three experimental groups: nor-
mothermic and hyperthermic controls and animals
subjected to prolonged experimental febrile seizures.
For analysis of neuronal injury using the Gallyas
'dark'-neuron silver stain, animals were sacrificed
24 h, 1 week or 2 weeks after seizure induction.
For cell counting, animals (n = 12, four per experi-
mental group) were sacrificed 4 weeks following the
hyperthermic seizures.
As shown in Fig. 1, significant and prolonged
alterations in the physicochemical properties of neu-
rons in the pyramidal layer of the hippocampal CA1
and all the CA3 subfields were found. Specifically,
starting within 24 h of seizures and persisting for
 369

Fig. 1. Injury to hippocampal neurons after a single 20-min episode of intense neuronal activity induced by hyperthermia (byperthermic
seizure, an experimental model of prolonged febrile seizures). Sections obtained from immature rats killed 24 h after a seizure.
Silver-stained neurons (Gallyas' dark-neuron method; Gallyas et al., 1992) are evident in the CA3c pyramidal cell layer in this high-
magnification photomicrograph. The distribution of the argyrophilic neurons involved also CA3a and b, CAI, some hilar interneurons,
and discrete nuclei in amygdala and perirbinal cortex (Toth et al., 1998). Such neurons were not observed in animals subjected to
byperthermia alone, i.e., when the seizures were blocked, s.p. and s.r. are strata pyramidale and radiatum, respectively.

at least 2 weeks, numerous pyramidal cells as well
as less abundant hilar neurons exhibited pronounced
avidity to silver stain (argyrophilia). The distribution
of these argyrophilic neurons indicated the pattern
of neuronal vulnerability to febrile seizures in this
model, and shared significant similarities with the
pattern of injury found with other limbic seizure
types (and in human temporal lobe epilepsy). In the
hippocampus, major involvement of CA3 and CA1
pyramidal cell layers and relative sparing of the gran-
ule cell layer and subiculum were consistent with
vulnerability patterns in adult models of kainic acid-
(Nadler et al., 1978; Sperk et al., 1983; Ben-Ari,
1985; Pollard et al., 1994) and pilocarpine-induced
status epilepticus (Clifford et al., 1987; Mello et al.,
1993; Liu et al., 1994).
However, unlike the chronic outcome of these
seizures in adult rats, no evidence of neuronal cell
loss was evident at any time after the hyperthermic
seizures, and cell counts revealed no evidence of
loss in specific vulnerable hippocampal cell popula-
tions (see above). Thus, these data, revealing striking
but transient alterations of neuronal integrity in re-
gions known to be affected by other limbic seizure
paradigms, might provide a mechanism to reconcile
conflicting reports regarding the effects of develop-
mental limbic seizures on neuronal survival. Specif-
ically, our findings suggest that similar neuronal
populations share vulnerability to limbic seizures in
both the immature and mature hippocampus, but
immature neurons may undergo injury followed by
recovery, whereas mature neurons progress from in-
370
jury to death (Chang and Baram, 1994; Owens et al.,
1997).
Do argyrophilia, acid-fuchsin staining or in situ
end-labeling (ISEL) of neurons indicate their
death?
The data presented above demonstrate that the
physicochemical properties of neurons may change
dramatically, permitting increased avidity to silver
stains (Gallyas et al., 1990; Van den Pol and Gallyas,
1990; Toth et al., 1998) without these changes be-
ing followed by neuronal degeneration. The relative
nature of silver uptake by different classes of in-
tact and injured neurons and subcellular organelles
has been discussed (Gallyas et al., 1990). Indeed,
avidity to silver staining can be induced by subject-
ing the brain to postmortem trauma, indicating that
this process is independent from the process of cell
death (Gallyas et al., 1992). This fact, together with
earlier studies (Chang and Baram, 1994), raised the
question as to the interpretation of neuroanatomi-
cal methods used to demonstrate 'cell death'. Put
differently, acquisition of the avidity to silver in a va-
riety of methods may not necessarily mean neuronal
death. The changes or injury which renders a cell
argyrophilic may be reversible and not lead to cell
loss (death). In analogy, the acid-fuchsin method, de-
scribed originally for hypoglycemic cell death, may
merely imply increased avidity to this dye, without
'fatal' injury to the cell (see discussion in Chang
and Baram, 1994, and by Nehlig and Pereira de
Vasconcelos, 1996; Motte et al., 1998; Pineau et al.,
1999). Somewhat more controversial, the interpreta-
tion of TUNEL and ISEL, methods which rely on
labeling of end-terminals of DNA, has come un-
der question. Whereas breaking of DNA into pieces
of roughly equal length ('laddering') has been de-
scribed in the process of apoptotic cell death, this
form of death may occur without overt DNA frag-
mentation. In addition, injury-induced repair may
also yield enhanced numbers of DNA 'ends' with
enzymatic labeling. Finally, in the immature brain,
normal cell death occurs, and these dying cells may
also be labeled. Because of the potential ambiguities
of each of the methods described here regarding its
specificity for cell death, a recent trend (Sankar et
al., 1998; Toth et al., 1998; Kubova et al., 2001)
has been the adoption of several methods in com-
bination. In addition, several time points have often
been analyzed in recent studies of seizure-induced
neuronal death in the immature brain. Thus, Toth et
al., 1998 (see above) found reversible silver staining
with absence of in situ end-labeling or of neuronal
dropout, and concluded that the prolonged hyper-
thermic seizures did not kill hippocampal neurons.
Sankar et al. (1998) used several methods, including
Fluoro-jade, to assess pilocarpine-induced cell death.
In an elegant recent study, Kubova et al. (2001)
resorted to electron microscopy to determine cate-
gorically that seizures killed specific populations in
discrete thalamic nuclei.
Changes in gene expression follow prolonged
experimental febrile seizures, and may alter
neuronal function to promote hippocampal
excitability
The paragraphs above suggest that experimental
prolonged febrile seizures induce pro-epileptogenic
changes in the immature hippocampal network, and
that neuronal death may not be required for this pro-
cess. What then, might the responsible mechanisms
be?
In addition to the absence of cell death, cell birth
rate (and cell fate) has been found not to change af-
ter these seizures. Thus, recent research has focused
on potential sequential changes in the expression of
genes which may impact excitability in the develop-
ing hippocampal circuit. Because experimental (and
clinical) febrile seizures occur uniquely in a distinct
phase of development, emphasis has been placed
on molecules that influence hippocampal excitability
during this age.
We first tested the hypothesis that excitatory drive
to the hippocampal circuit is enhanced persistently
via long-term upregulation of the expression of the
excitatory neuropeptide, corticotropin-releasing hor-
mone (CRH), which is normally expressed in hip-
pocampal interneurons (for review see Yan et al.,
1998; Y. Chen et al., 2001). CRH immunoreactive
interneurons are more numerous in the principal cell
layers of the immature rat, compared with the adult,
peaking during the second and third postnatal weeks
(Y. Chen et al., 2001), and the pro-excitatory actions
of the peptide on hippocampal neurons are also max-
 371

0,07

0.06
O)
--1--
(,9
:::L 0.05

CA1
0.04

0.03
0.00
CONTROL 24 HR 1 WEEK 1 MONTH

0.07
T
-

,
ii~!i~i~;i;~ ;!: i ~i i~ii~]
;
0.06 -

CA3 (D
:ZL 0.05 -

0.04
0.03
0.00
CONTROL 24 HR 1 WEEK 1 MONTH

0.07 -

0.06 -

DG 0.05

0,04

0.03
0,00
CONTROL 24 HR 1 WEEK 1 MONTH
Fig. 2. Time-course of CRH expression in the ammon's horn pyramidal layer (CAI and CA3) as well as in the granule cell layer
of the hippocampal formation after prolonged experimental febrile seizures, CRH expression in these layers is confined to basket and
chandelier-type interneurons (Yan et al., 1998; Y. Chen et al., 2001).

imal during this developmental age (for review see
Baram and Hatalski, 1998). Indeed, within hours of
the seizures, robust increase in C R H - m R N A levels
in the principal cell layers of the hippocampal for-
mation was evident (Hatalski et al., 2000; Fig. 2).
However, these changes persisted only for 2 4 - 4 8 h
and were no longer evident at 1 week or 1 month
after the seizures (Eghbal-Ahmadi, 2000), whereas
the enhanced excitability in the limbic circuit per-
sisted (Dube et al., 2000). It should be noted that
the enhanced expression of CRH was not due sim-
ply to the stressful effects of the seizures, since
372
it did not occur with other stressors such as cold
(Hatalski et al., 2000). In addition, this enhanced
gene expression required neuronal activity, since it
was abolished when the seizures (but not the hyper-
thermia) were eliminated via pre-treatment with the
short-acting barbiturate pentobarbital. Finally, lack
of persistent changes in hippocampal CRH expres-
sion was not due to the inability of this transcript to
undergo long-term upregulation, since protracted en-
hancement (up to 12 months) of CRH-mRNA levels
in the hippocampus was induced in the immature rat
by other means (Brunson et al., 2001).
The permanent functional changes in the hip-
pocampal network following prolonged experimental
febrile seizures led to a search for persistent alter-
ation in the expression of other candidate genes.
One such candidate emerged from the in vitro
electrophysiological studies (K. Chen et al., 2001;
Thon et al., 2002). Whereas enhanced excitability
of the hippocampal circuit was evident from both in
vivo and in vitro data (Dube et al., 2000, and see
above), single-cell electrophysiology (Chen et al.,
1999) suggested that experimental prolonged febrile
seizures led to significantly increased GABA release
onto CA1 pyramidal cells. This change indicated
enhancement o f inhibitory drive (Walker and Kull-
mann, 1999), and failed to explain the augmented
excitability in the hippocampal network after these
seizures. However, more recent electrophysiology
data (K. Chen et al., 2001) resolved this conundrum,
demonstrating a remarkable and persistent change
in an ion channel, which can convert the potenti-
ated inhibition into excitation. Specifically, a chan-
nel activated by hyperpolarization and leading to
depolarization by permitting entry of Na + ions was
altered, in a manner that rendered it more highly ac-
tivated under physiological conditions. This channel
(hyperpolarization-activated, cyclic AMP-regulated
mixed-cation channel, HCN), producing the hy-
perpolarization activated (In) current, is composed
of several, recently characterized subunit isoforms
(Santoro et al., 1998, 2000; Siegelbaum, 2000).
Because the functional properties of the HCN
channels are governed also by the subunit or isoform
make up of the channel (Santoro et al., 1998, 2000;
Siegelbaum, 2000), current experiments are aimed at
determining whether prolonged experimental febrile
seizures alter the relative expression of these subunit
isoforms. The existence of these molecules in de-
veloping hippocampus has been demonstrated (Ben-
der et al., 2001). Furthermore, the expression of
each of the three hippocampal-expressed isoforms
is highly age-dependent, demonstrating a distinct
spatio-temporal expression profile in both interneu-
ronal populations and pyramidal cells (Bender et
al., 2001). Therefore, current experiments are testing
the hypothesis that prolonged experimental febrile
seizures may disrupt the normal evolution of mat-
urational changes in HCN subunit expression, thus
leading to permanent alteration in the expression
of these subunits, and ultimately, to altered channel
function.
Conclusion
Experimental prolonged febrile seizures lead to en-
hanced excitability in the limbic circuit. However,
this is not accompanied by neuronal death. Tran-
sient neuronal injury is induced by these seizures,
manifested as enhanced avidity to silver stains. This
structural alteration is associated with both tran-
sient and persistent functional changes that may
derive from disruption of programmed, sequential
and orderly expression of genes critical to normal
hippocampal maturation. Thus, a single experimen-
tal febrile seizure may modify gene expression and
resultant neuronal function persistently, leading to
altered properties of the hippocampal network long-
term.
References
Albala, B.J., Moshe, S.L. and Okada, R. (1984) Kainic-acid-
induced seizures: a developmental study. Brain Res., 315:
139-148.
Armstrong, D.D. (1993) The neuropathologyof temporal lobe
epilepsy.J. Neuropathol. Exp. Neurol., 52: 433-443.
Babb, T.L. and Brown, B.J. (1987) Pathological findings in
epilepsy. In: J. Engel (Ed.), Surgical Treatment of the Epilep-
sies. Raven, New York, NY, pp. 511-552.
Baram, T.Z. and Hatalski, C.G. (1998) Neuropeptide-mediated
excitability: a key triggeringmechanismfor seizure generation
in the developingbrain. Trends Neurosci., 21:471-476.
Baram, T.Z., Gerth, A. and Schultz, L. (1997) Febrile seizures:
an appropriate-aged model suitable for long-term studies.
Brain Res. Dev. Brain Res., 98: 265-270.
Baram, T.Z., Mina, E. and Bender, R.A. (2000) Neurogenesisof

dentate gyrus granule cells is not altered by prolonged febrile
seizures in the immature rat. Epilepsia, 41(Suppl. 7): 13.
Ben-Ari, Y. (1985) Limbic seizure and brain damage produced
by kainic acid: mechanisms and relevance to human temporal
lobe epilepsy. Neuroscience, 14: 375-403.
Bender, R.A. and Baram, T.Z. (1999) Effects of febrile seizures
in the immature rat model on interneuronal parvalbumin (PV)
expression in the dentate gyrus. Epilepsia, 40(Suppl. 7): 120.
Bender, R.A. and Baram, T.Z. (2002) Do prolonged febrile
seizures injure hippocampal neurons? Insights from animal
models. In: T.Z. Baram and S. Shinnar (Eds.), Febrile Seizures.
Academic Press, San Diego, CA, pp. 127-137.
Bender, R.A., Dube, C. and Baram, T.Z. (2000) Mossy fiber
sprouting into the dentate gyrus inner molecular layer fol-
lows prolonged febrile seizures in the immature rat model.
Epilepsia, 41(Suppl. 7): 76.
Bender, R.A., Brewster, A., Santoro, B., Ludwig, A., Hofmann,
F., Biel, M. and Baram, T.Z. (2001) Differential and age-
dependent expression of hyperpolarization-activated, cyclic
nucleotide-gated cation channel isoforms 1-4 suggest evolving
roles in the developing rat hippocampus. Neuroscience, 106:
689-698.
Brunson, K.L., Eghbal-Ahmadi, M., Bender, R., Chen, Y. and
Baram, T.Z. (2001) Long-term, progressive hippocampal cell
loss and dysfunction induced by early-life administration of
corticotropin-releasing hormone reproduce the effects of early-
life stress. Proc. Natl. Acad. Sci. USA, 98: 8856-8861.
Bruton, C.J. (1988) The Neuropathology of Temporal Lobe
Epilepsy. Oxford University Press, New York, Maudsley
Monographs, No. 31.
Buckmaster, P.S. and Dudek, RE. (1997) Neuron loss, granule
cell axon reorganization and functional changes in the dentate
gyrus of epileptic kainate-treated rats. J. Comp. Neurol., 385:
385-404.
Cavazos, J.E., Das, I. and Sutula, T.P. (1994) Neuronal loss
induced in limbic pathways by kindling: evidence for induc-
tion of hippocampal sclerosis by repeated brief seizures. Z
Neurosci., 14: 3106-3121.
Cendes, E, Andermann, F., Gloor, P., Lopes-Cendes, I., Ander-
mann, E., Melanson, D., Jones-Gotman, M., Robitaille, Y.,
Evans, A. and Peters, T. (1993) Atrophy of mesial structures
in patients with temporal lobe epilepsy: cause or consequence
of repeated seizures?. Ann. Neurol., 34: 795-801.
Chang, D. and Baram, T.Z. (1994) Status epilepticus results in
reversible neuronal injury in infant rat hippocampus: novel use
of a marker. Brain Res. Dev. Brain Res., 77: 133-136.
Chen, K., Baram, T.Z. and Soltesz, I. (1999) Febrile seizures
in the developing brain result in persistent modification of
neuronal excitability in limbic circuits [see comments]. Nat.
Med., 5: 888-894.
Chen, K., Aradi, 1., Thon, N., Eghbal-Ahmadi, M., Baram, T.Z.
and Soltesz, I. (2001) Persistently modified H-channels after
complex febrile seizures convert the seizure-induced enhance-
ment of inhibition to hyperexcitability. Nat. Med., 7:1 7.
Chen, Y., Bender, R.A., Frotscher, M. and Baram, T.Z. (2001)
Novel and transient populations of corticotropin-releasing
hormone-expressing neurons in developing hippocampus sug-
373
gest unique functional roles: a quantitative spatiotemporal
analysis. J. Neurosci., 21: 7171-7181.
Clifford, D.B., Olney, J.W., Maniotis, A., Collins, R.C. and Zo-
rumski, C.E (1987) The functional anatomy and pathology of
lithium-pilocarpine and high-dose pilocarpine seizures. Neu-
roscience, 23: 953-968.
Dobbing, J. and Sands, J. (1973) Quantitative growth and devel-
opment of human brain. Arch. Dis. Child, 48: 757-767.
Dobbing, J. and Sands, J. (1979) Comparative aspects of the
brain growth spurt. Early Hum. Dev., 3: 79-83.
Dube, C., Chen, K., Eghbal-Ahmadi, M., Brunson, K., Soltesz, I.
and Baram, T.Z. (2000) Prolonged febrile seizures in immature
rat model enhance hippocampal excitability long-term. Ann.
Neurol., 47: 336-344.
Dudek, F.E., Obenaus, A., Schweitzer, J.S. and Wuarin, J.-P.
(1994) Functional significance of hippocampal plasticity in
epileptic brain: electrophysiological changes of the dentate
granule cells associated with mossy fiber sprouting. Hip-
pocampus, 4: 259-265.
Eghbal-Ahmadi, M. (2000) Potential role of corticotropin releas-
ing hormone (CRH) in age-specific developmental seizures.
Thesis. University of California.
French, J.A., Williamson, P.D., Thadani, V.M., Darcey, T.M.,
Mattson, R.H., Spencer, S.S. and Spencer, D.D. (1993) Char-
acteristics of medial temporal lobe epilepsy. I. Results of
history and physical examination. Ann. Neurol., 34: 774-780.
Gallyas, E, Guldner, EH., Zoltay, G. and Wolff, J.R. (1990)
Golgi-like demonstration of 'dark' neurons with an argy-
rophil III method for experimental neuropathology. Acta Neu-
ropathol., 79: 620-628.
Gallyas, F., Zoltay, G. and Horvath, Z. (1992) Light microscopic
response of neuronal somata, dendrites and axons to post-
mortem concussive head injury. Acta Neuropathol., 83: 499-
503.
Gottlieb, A., Keydar, I. and Epstein, H.T. (1977) Rodent brain
growth stages: an analytical review. Biol. Neonate, 32: 166-
176.
Hatalski, C.G., Brunson, K.L., Tantayanubutr, B., Chen, Y. and
Baram, T.Z. (2000) Neuronal activity and stress differen-
tially regulate hippocampal and hypothalamic corticotropin-
releasing hormone expression in the immature rat. Neuro-
science, 10l: 571-580.
Hjeresen, D.L, and Diaz, J. (1988) Ontogeny of susceptibility
to experimental febrile seizures in rats. Dev. Psychobiol., 21:
261-275.
Holmes, G.L. and Ben-Ari, Y. (1998) Seizures in the developing
brain: perhaps not so benign after all. Neuron, 21: 1231-1234.
Holmes, G.L. and Thompson, J.L. (1988) Effects of kainic acid
on seizure susceptibility in the developing brain. Brain Res.,
467: 51-59.
Holmes, G.L., Gairsa, J.L., Chevassus Au Louis, N. and Ben
Ari, Y. (1998) Consequences of neonatal seizures in the rat:
morphological and behavioral effects. Ann. Neurol., 44: 845-
857.
Jensen, F.E. and Baram, T.Z. (2000) Developmental seizures
induced by common early-life insults: short- and long-term
374
effects on seizure susceptibility. Ment. Retard. Dev. Disabil.
Res. Rev., 6: 253-257.
Jensen, EE., Applegate, C.D., Holtzman, D., Belin, T.R. and
Burchfiel, J.L. (1991) Epileptogenic effect of hypoxia in the
immature rodent brain. Ann. Neurol., 29: 629-637.
Kalviainen, R., Salmenpera, T., Partanen, K., Vainio, P., Riekki-
nen, P. and Pitkanen, A. (1998) Recurrent seizures may cause
hippocampal damage in temporal lobe epilepsy. Neurology,
50: 1377-1382.
Knudsen, EU. (1996) Febrile seizures - - treatment and outcome.
Brain Dev., 18: 438-449.
Kubova, H., Druga, R., Lukasiuk, K., Suchomelova, L., Haugvi-
cova, R., Jirmanova, I. and Pitkanen, A. (2001) Status epilepti-
cus causes necrotic damage in the mediodorsal nucleus of the
thalamus in immature rats. J. Neurosci., 21: 3593-3599.
Kuzniecky, R.I., Bilir, E., Gilliam, F., Faught, E., Palmer, C.,
Morawetz, R. and Jackson, G. (1997) Multimodality MRI in
mesial temporal sclerosis: relative sensitivity and specificity.
Neurology, 49: 774-778.
Lewis, D.V. (1999) Febrile convulsions and mesial temporal
sclerosis. Curr. Opin. Neurol., 12: 197-201.
Liu, Z., Nagao, T., Desjardins, G.C., Gloor, P. and Avoli, M.
(1994) Quantitative evaluation of neuronal loss in the dor-
sal hippocampus in rats with long-term pilocarpine seizures.
Epilepsy Res., 17: 237-247.
Lothman, E.W. and Collins, R.C. (1981) Kainic acid in-
duced limbic seizures: metabolic, behavioral, electroen-
cephalographic and neuropathological correlates. Brain Res.,
218: 299-318.
Margerison, J.H. and Corsellis, J.A.N. (1966) Epilepsy and the
temporal lobes: a clinical electroencephalographic and neu-
ropathological study of the brain in epilepsy, with particular
reference to the temporal lobes. Brain, 399: 1246-1283.
McCabe, B.K., Silveira, D.C., Cilio, M.R., Cha, B.H., Liu, X.,
Sogawa. Y. and Holmes, G.L. (2001) Reduced neurogenesis
following neonatal seizures. J. Neurosci., 21: 2094-2103.
Mello, L.E., Cavalheiro, E.A., Tan, A.M., Kupfer, W.R., Preto-
rius, J.K., Babb, T.L. and Finch, D.M. (1993) Circuit mecha-
nisms of seizures in the pilocarpine model of chronic epilepsy:
cell loss and mossy fiber sprouting. Epilepsia, 34: 985-995.
Motte, J., Fernandes, M.J., Baram, T.Z. and Nehlig, A. (1998)
Spatial and temporal evolution of neuronal activation, stress
and injury in lithium-pilocarpine seizures in adult rats. Brain
Res., 793: 61-72.
Nadler, J.V. (1981 ) Kainic acid as a tool for the study of temporal
lobe epilepsy. Life Sci., 29: 2031-2041.
Nadler, J.V., Perry, B.W. and Cotman, C.W. (1978) Intraventric-
ular kainic acid preferentially destroys hippocampal pyramidal
cells. Nature, 271: 676-677.
Nehlig, A. and Pereira de Vasconcelos, A. (1996) The model
of pentylenetetrazol-induced status epilepticus in the immature
rat: short- and long-term effects. Epilepsy Res., 26: 93-103.
Nitecka, L., Tremblay, E., Charton, G., Bouillot, J.P., Berger,
M.L. and Ben-Ari, Y. (1984) Maturation of kainic acid seizure-
brain damage syndrome in the rat, II. Histopathological seque-
lae. Neuroscience, 13: 1073-1094.
Obenaus, A., Esclapez, M. and Houser, C.R. (1993) Loss of
glutamate decarboxylase mRNA-containing neurons in the rat
dentate gyrus following pilocarpine-induced seizures. J. Neu-
rophysiol., 13: 4470-4485.
Owens, J.J., Robbins, C.A., Wenzel, H.J. and Schwartzkroin,
P.A. (1997) Acute and chronic effects of hypoxia on the
developing hippocampus. Ann. Neurol., 41: 187-199.
Parent, J.M. and Lowenstein, D.H. (2002) Seizure-induced neu-
rogenesis: are more new neurons good for an adult brain?
In: T. Sutula and A. Pitk~inen (Eds.), Do Seizures Damage
the Brain. Progress in Brain Research, Vol. 135. Elsevier,
Amsterdam, pp. 121-132.
Parent, J.M., Yu, T.W., Leibowitz, R.T., Geschwind, D.H.,
Sloviter, R.S. and Lowenstein, D.H. (1997) Dentate granule
cell neurogenesis is increased by seizures and contributes to
aberrant network reorganization in the adult rat hippocampus.
J. Neurosci., 17: 3727-3738.
Pineau, N., Charriaut-Marlangue, C., Motte, J. and Nehlig, A.
(1999) Pentylenetetrazol seizures induce cell suffering but not
death in the immature rat brain. Brain Res. Dev. Brain Res.,
112: 139-144.
Pollard, H,, Charriaut-Marlangue, C., Cantagrel, S., Represa,
A., Robain, O., Moreau, J. and Ben-Ari, Y. (1994) Kainate-
induced apoptotic cell death in hippocampal neurons. Neuro-
science, 63: 7-18.
Sankar, R., Shin, D.H., Liu, H., Mazarati, A., Pereira de Vas-
conceits, A. and Wasterlain, C. (1998) Patterns of status
epilepticus-induced neuronal injury during development and
long-term consequences. J. Neurosci., 18: 8382-8393.
Santoro, B., Liu, D.T., Yao, H., Bartsch, D., Kandel, E.R., Siegel-
baum, S.A. and Tibbs, G.R. (1998) Identification of a gene
encoding a hyperpolarization-activated pacemaker channel of
brain. Cell, 93: 717-729.
Santoro, B., Chen, S., Ltithi, A., Pavlidis, P., Shumyatsky, G.P.,
Tibbs, G.R. and Siegelbanm, S.A. (2000) Molecular and func-
tional heterogeneity of hyperpolarization-activated pacemaker
channels in the mouse CNS. J. Neurosci., 20: 5264-5275.
Scharfman, H.E. (1999) The role of nonprincipal cells in den-
tate gyrus excitability and its relevance to animal models
of epilepsy and temporal lobe epilepsy. In: A.V. Delgado-
Esqueta, W.A. Wilson, R.A. Olson and R.J. Porter (Eds.),
Basic Mechanisms of the Epilepsies: Molecular and Cellular
Approaches. Lippincott-Raven, New York, NY, 3rd ed., pp.
805-820.
Scharfman, H.E., Goodman, J.H. and Sollas, A.L. (2000)
Granule-like neurons at the Hilar/CA3 border after status
epilepticus and their synchrony with area CA3 pyramidal
cells: functional implications of seizure-induced neurogenesis.
J. Neurosci., 20: 6144-6158.
Schauwecker, EE., Ramirez, J.J. and Steward, O. (2000) Genetic
dissection of the signals that induce synaptic reorganization.
Exp. Neurol., 161: 139-152.
Siegelbaum, S.A. (2000) Presynaptic facilitation by
hyperpolarization-activated pacemaker channels. Nat. Neu-
rosci., 3: 101-102.
Shinnar, S. (1998) Prolonged febrile seizures and mesial tempo-
ral sclerosis. Ann. Neurol., 43:411-412.
Sloviter, R.S. (1991) Permanently altered hippocampal structure,

excitability, and inhibition after experimental status epilepticus
in the rat: the 'dormant basket cell' hypothesis and its possible
relevance to temporal lobe epilepsy. Hippocampus, 1: 41-66.
Sloviter, R.S. (1994) The functional organization of the hip-
pocampal dentate gyrus and its relevance to the pathogenesis
of temporal lobe epilepsy. Ann. Neurol., 35: 640-654.
Sloviter, R.S. and Pedley, T.A. (1998) Subtle hippocampal mal-
formation: importance in febrile seizures and development of
epilepsy. Neurology, 50: 846-849.
Sperber, E.E, Stanton, EK., Haas, K., Ackerman, R.F. and
Mosbe, S.L. (1992) Developmental differences in the neurobi-
ology of epileptic brain damage. In: J. Engel Jr., C. Waster-
lain, E. A. Cavalheiro, U. Heinemann and G. Avanzini (Eds.),
Molecular Neurobiology of Epilepsy. Elsevier, Amsterdam, pp.
67-81.
Sperber, E.F., Germano, I.M., Friedman, L.K., Velfskov~, J. and
Romero, M.T. (1999) The resiliency of the immature brain
to seizure-induced damage. In: A. Nehlig, J. Motte, S.L.
Mosh6 and E Plouin (Eds.), Childhood Epilepsies and Brain
Development. John Libbey, London, pp. 255-262.
Sperk, G., Lassmann, H., Baran, H., Kish, S.J., Seitelberger, E
and Hornykiewicz, O. (1983) Kainic acid induced seizures:
neurochemical and histopathological changes. Neuroscience,
10: 1301-1315.
Sperk, G., Lassman, H., Baran, H., Seitelberger, E and
Hornykiewicz, O. (1985) Kainic acid-induced seizures: Dose
relationship of behavioural, neurochemical and histopathologi-
cal changes. Brain Res., 338: 289-295.
Sutula, T.E (1991) Reactive changes in epilepsy: cell death and
axon sprouting induced by kindling. Epilepsy Res., 10: 62-70.
375
Thon, N., Chen, K., Aradi, I. and Soltesz, I. (2002) Physiology
of limbic hyperexcitability after experimental complex febrile
seizures: interactions of seizure-induced alterations at multiple
levels of neuronal organization. In: T.Z. Baram and S. Shinnar
(Eds.), Febrile Seizures. Academic Press, San Diego, CA, pp.
202-213.
Toth, Z., Yan, X.X., Haftoglou, S., Ribak, C.E. and Baram,
T.Z. (1998) Seizure-induced neuronal injury: vulnerability to
febrile seizures in an immature rat model. J. Neurosci., 18:
4285-4294.
Van den Pol, A.N. and Gallyas, F. (1990) Trauma-induced Golgi-
like staining of neurons: a new approach to neuronal organi-
zation and response to injury. J. Comp. Neurol., 296: 654-
673.
VanLandingham, K.E., Heinz, E.R., Cavazos, J.E. and Lewis,
D.V. (1998) Magnetic resonance imaging evidence of hip-
pocampal injury after prolonged focal febrile convulsions.
Ann. Neurol., 43: 413-426.
Veliskova, J., Velisek, L. and Mares, P. (1988) Epileptic phe-
nomena produced by kainic acid in laboratory rats during
ontogenesis. Physiologia Bohemoslovaca, 37: 395-405.
Walker, M.C. and Kullmann, D.M. (1999) Febrile convulsions: a
'benign' condition?. Nat. Med., 5: 871-872.
Yan, X.X., Toth, Z., Schultz, L., Ribak, C.E. and Baram, T.Z.
(1998) Corticotropin-releasing hormone (CRH)-containing
neurons in the immature rat hippocampal formation: light
and electron microscopic features and colocalization with glu-
tamate decarboxylase and parvalbumin. Hippocampus, 8: 231-
243.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 32

Assessing the behavioral and cognitive effects of seizures

on the developing brain

Carl E. S t a f s t r o m *

Departments of Neurology and Pediatrics, University of Wisconsin, Madison, WI 53792, USA

Abstract: The degree to which seizures lead to 'brain damage' is not fully known, but this question has important clinical
implications. Seizure-induced brain damage can be defined in several ways: structural, physiological, and behavioral. The
behavioral and cognitive effects of seizures are difficult to ascertain in patients, because it is hard to differentiate the effects
of the seizures from the underlying brain pathology, anticonvulsant treatment, and developmental variables. In animal
models, the ability to control seizure variables allows detailed investigation of factors that cannot be easily distinguished
in clinical studies. In models of experimental epilepsy, both brief and prolonged seizures lead to brain damage. While
the consequences of seizures are much more extensive in the adult brain, long-term alterations are also seen in the
developing brain. This chapter focuses on the effects of seizures during development on subsequent behavior and cognition
in experimental epilepsy models. The investigator must choose carefully among the various tests of behavior, learning,
memory, and cognition, since the existence or extent of deficits may depend upon which test is selected and how the data
are analyzed. The experimental evidence suggests that seizures early in life are associated with subtle deficits in behavior
and cognition, even in the absence of overt structural neuronal damage. These deficits are dependent upon the age at which
seizures occur (less severe deficits at younger ages), seizure frequency and seizure severity, but are largely independent of
seizure etiology, occurring after several types of chemoconvulsants and electrical stimulation. Seizure-induced behavioral
and cognitive deficits, which may not become obvious until long after the onset of the epilepsy, might be equally or more
detrimental to a child's overall function than the seizures themselves.

Introduction -- seizures and brain damage
The debate about whether seizures damage the de-
veloping brain rages on (Camfield, 1997; Wasterlain,
1997; Theodore and Wasterlain, 1999). In approach-
ing this complex yet critical clinical question, the
first essential task is to define what comprises 'brain
d a m a g e ' . Additional important considerations are
whether seizure-induced brain damage is permanent,
* Correspondence to: C.E. Stafstrom, Department of Neu-
rology, H6-528, University of Wisconsin, 600 Highland
Avenue, Madison, WI 53792, USA. Tel.: +1-608-262-
2154; Fax: +1-608-263-0412;
E-maih stafstrom @neurology.wisc.edu
whether histological evidence of damage necessarily
implies functional impairment, whether behavioral
impairment can exist in the absence of structural
damage, and whether the brain possesses reparative
mechanisms and how these vary with age.
Brain damage can be measured or assessed in
several ways: structural or histological changes (both
cell death and compensatory processes) at the levels
of single cells or neuronal networks; electrophysio-
logical changes in membrane or circuit properties;
or behavioral measures including learning, memory,
and other cognitive processes. This chapter focuses
on the behavioral consequences of seizures in the
developing brain. The tests and measures by which
' d a m a g e ' is assessed are reviewed critically, fol-
lowed by a consideration of published data on the
378
effects of seizures during ontogeny on subsequent
behavior and cognition.
Behavioral tests to assess brain damage after
seizures
In the clinical setting, parents inevitably ask whether
their child's seizures are causing brain damage.
By 'brain damage', they usually mean intellectual
deficits. The clinical literature suggests that repeated
seizures lower general cognitive skills, memory,
and behavior (e.g. Elwes et al., 1988; Beckung
and Uvebrant, 1997; Bourgeois, 1998; Schoenfeld
et al., 1999; Austin and Dunn, 2002, this volume)
but the plethora of confounding variables preclude
direct demonstration that the seizures themselves
rather than the underlying etiology are responsi-
ble for the behavioral deficits. In animal models of
epilepsy, variables such as seizure etiology, severity,
frequency, and duration can be controlled. There-
fore, animal models have been used to explore these
questions. However, the use behavioral data as a
determinant of brain damage has not been subject
to critical scrutiny in developmental seizure models.
Analysis of the validity and potential shortcomings
of each behavioral test is needed before concluding
that seizures have damaged the brain. The various
behavioral tests used to assess brain damage after
seizures in animals are now reviewed as to how
each test is performed and analyzed, what neuro-
logic function each test subserves, and whether a
specific brain area mediates that neurologic function.
Many variations of each test have been utilized, and
only the most commonly used protocols are dis-
cussed here. Unless indicated, the tests are restricted
to those used in rats and mice, the most commonly
used animals in epilepsy research. Reference will
be made to human tests when appropriate. For each
test, a comparison between control and experimen-
tal groups allows a determination of whether the
experimental procedure, usually seizure(s), is asso-
ciated with some deficit in function. Note, the word
'causes' is omitted since there are multiple steps
in the sequence from seizure to deficit that remain
undefined and for which these tests cannot provide
evidence of causation.
Tests of sensorimotor function and reflexes
Behavioral tests usually assess motor responses to
sensory stimuli. Therefore, before concluding that
seizures have produced cognitive dysfunction, it
must be shown that sensory or motor deficits are
not responsible. In addition to primary deficits in
an animal's ability to perceive sensory stimuli and
exhibit normal motor behavior, several factors can
influence sensorimotor function, including general
health, time of day, level of arousal, level of anxi-
ety, age (Fox, 1965; Altman and Sudarshan, 1975),
and genetic background (Crawley, 1999; Fox et al.,
2001).
The most popular test of gross motor function is
the rotarod, which assesses the ability of an animal to
maintain balance and keep pace on a rod that rotates
at increasing speeds. The latency to falling off the
rod is taken as a measure of gross motor skill and
coordination at the various rotation rates. The task
challenges the integration of the animal's sensory,
motor, and coordination systems, and is thought to
be mediated primarily by the brainstem and spinal
cord (Ba and Seri, 1995).
Fine motor ability can be assessed by having the
animal walk on a balance beam of a narrow width.
The animal grasps each side of the beam with its
paws, and an error is defined as a misstep or 'foot
fault' (the animal's grasp on the beam is lost) (Fox et
al., 2001).
Rodents exhibit numerous reflex behaviors that
measure various levels of neurologic function, from
spinal cord to brainstem to cortex. Examples include
the righting reflex (pons and mesencephalon), grasp
reflex (cerebral cortex), placing reflex (cerebral cor-
tex), and auditory startle (medulla), and corneal and
pupillary reflexes (pons, mesencephalon, medulla,
and upper cervical cord) (Tupper and Wallace, 1980).
While it is probably not necessary to test all reflexes
exhaustively, these could become important when
searching for subtle phenotypic differences between
groups of rodents, e.g. in transgenics or knockouts
(Crawley and Paylor, 1997). In epilepsy research,
the main goal is to ensure that motor, sensory, or
reflex differences do not explain performance dif-
ferences on behavioral or cognitive tests. Several
detailed descriptions of how to perform rodent neu-
rologic examinations are available (Fox, 1965; Tup-

per and Wallace, 1980; Tremml et al., 1998; Moser,
2OOO).
Tests of locomotion and exploration
Spontaneous locomotor activity and exploration are
aspects of motor function that can be used to com-
pare animals having experienced seizures with con-
trols. The open field test is the most popular test of
these behavioral tests (Walsh and Cummins, 1976;
Fox et al., 2001). Typically, rodents actively explore
a new environment but become less active on sub-
sequent exposures (habituation). When novel objects
are introduced into the open field, rats actively in-
vestigate the objects. In the open field, the general
activity level can be dissociated from exploratory
behavior (Whimbey and Denenberg, 1967; Corman
and Shafer, 1968). An animal is placed into a square
or circular arena (open field), the floor of which is
divided into identically sized areas. The degree of
activity in the open field is measured by the number
of times the animal crosses into the various marked
off areas. The amount of time the animal spends
exploring novel objects introduced into the field (e.g.
a small toy, bottle cap, etc.) or exploring holes in
the field by dipping their noses into the holes are
measures of timidity versus willingness to examine
a novel environment. Other parameters that can be
quantitated include the number of rearings, groom-
ing behaviors, and stereotypical behaviors (biting,
head weavings, etc.). Some investigators have used
the number of fecal boli that the animal produces as
an outcome measure, but this number is usually too
small to be useful and is dependent on time since the
last meal and other confounders (Fox et al., 2001).
The open field test is simple to design and per-
form. Measurements can be made in an automated
fashion (e.g. with infrared beam crossings) or by
observation. Care must be taken to clean the field
from trial to trial, as rodent behavior on this task
varies markedly as a function of odor trails (Walsh
and Cummins, 1976). It is still unclear what brain
region(s) mediates each specific open field behav-
ior; it is likely that multiple levels of the CNS are
involved, including olfactory cortex, limbic areas
(emotionality, fear), and higher neocortical regions
(motor activity). Therefore, if differences in open
field behaviors are detected between animals with
379
and without epilepsy, the most conservative inter-
pretation would be that some nonspecific aspect of
emotionality or locomotion is affected, rather than a
specific brain region.
Tests of visual-spatial learning and memory
Water maze
The Morris water maze (WM) or its variations have
been perhaps the most popular test of 'cognitive
function' employed in the past two decades (Mor-
ris et al., 1982; Brandeis et al., 1989). A literature
search revealed over 2000 articles in that period.
In addition to its use in assessing the effects of
seizures on learning and memory in young, adult,
and aged animals (Stafstrom et al., 1993), the WM
has been widely employed in defining the behavioral
phenotype of mice transgenic for a huge diversity of
genes (Crawley, 1999). The WM is a powerful test
of visual-spatial ('place') learning and memory, re-
quiting the integrity of the hippocampus for optimal
performance. Unfortunately, the water maze is often
considered synonymous with 'learning and mem-
ory'. In reality, learning and memory are complex,
multifactorial systems (Willingham, 1997; Kessels
et al., 2001) and care must be taken to define the
relevant subcomponents of learning and memory, es-
pecially when using these functions to assess the
consequences of seizures.
In the WM, an animal uses extra-maze visual cues
to learn the location of a platform slightly submerged
under water in a swimming tank. The latency (swim-
ming time) for the animal to locate and climb onto
the platform is used as the outcome measure. Al-
though rats are proficient swimmers, they prefer to
be out of water; therefore, the WM utilizes negative
reinforcement (water immersion) to encourage the
animal to learn and remember the platform location.
The WM dissociates memory deficits from deficits
in sensory function, motor function, motivation, and
retrieval processes (McNamara and Skelton, 1993).
The WM is a deceptively simple test. An animal
is placed into the tank at various positions around its
perimeter; it first learns the platform location, then
uses visual cues to find the platform on subsequent
trials. Performance typically improves in daily trials.
Once platform location is learned, a variety of other
380
tests are used to test memory for its location (known
variously as retrieval memory, 'spatial bias', 'probe'
or 'transfer' tests). Probe tests entail removal of the
platform from the water, and recording how much
time the animal spends searching for the platform at
its previous location. It is usually assumed that the
normal strategy is for the rat to spend greater time
searching for the platform in its previous location.
However, at some point, a more adaptive strategy
would be to abandon the search in the vacated quad-
rant and search elsewhere. Specific protocols for the
WM test and its modifications are available (Morris
et al., 1982; Stafstrom et al., 1993; Hollup et al.,
2001; Terry, 2001).
Optimal performance in the WM depends on in-
tact hippocampal function, partly accounting for its
popularity in epilepsy models. Several other brain
systems also modify WM performance, including
forebrain cholinergic systems and cortical and hip-
pocampal projections from the nucleus basalis mag-
nocellularis. WM performance requires intact cholin-
ergic and glutamatergic function; blocking those
receptors decreases spatial learning but not recall
(McNamara and Skelton, 1993).
Given the popularity of the WM, the question
arises as to how carefully the test is used and in-
terpreted. One should be aware that the WM is a
test for specific cognitive abilities - - spatial learning
and memory. Care should be taken not to interpret
the results too broadly, e.g. as a general measure
of 'cognition'. For example, the terms 'learning and
memory' are applicable only when the probe trial
is included after the standard place learning acqui-
sition phase; the probe test assesses memory, while
the hidden platform test measures place learning.
Other caveats involve the aforementioned sensori-
motor deficits; if the motor aspects of swimming
are not equivalent in the experimental and control
animals, group differences may be a result of motor
skills, not cognitive ones. For rodents, water expo-
sure is stressful, but may affect one group more than
another, with escape from the water being an insuf-
ficient reward (Jaffard et al., 2001). When evaluating
WM learning, the proper statistic is the 2-way analy-
sis of variance with repeated measures. The WM is a
powerful, simple, reproducible test of visual-spatial
learning and memory that can be adapted to assess
both working (memory with changing contents) and
reference memory (memory with fixed contents). Re-
suits should be interpreted cautiously with regard to
potential confounding variables and with appropriate
attention to the memory system being tested.
Radial arm maze (RAM)
As opposed to the WM, which uses negative re-
inforcement, the RAM uses positive reinforcement
to test visual-spatial learning and memory. Both
spatial memory (place learning) and non-spatial
memory (associative learning) can be assessed. The
RAM exploits the natural tendency of rodents to
explore, learn and remember different spatial loca-
tions for food reinforcement (Levin, 2001). As in
the WM, rodents use extra-maze visual cues to nav-
igate the maze. Performance on the RAM depends
on the integrity of the hippocampus, frontal cortex,
and forebrain cholinergic pathways (Becker et al.,
1980).
After adaptation to handling by humans and to the
maze environment, the win-shift acquisition protocol
is administered. Each arm is baited with a small
bit of food at the end. In this test, the animal is
only reinforced once for entry into each arm of
the maze. Entry into an arm is recorded when the
animal passes a threshold distance into the arm. The
test is over when the animal enters all arms or 5
rain elapses. Once an animal learns the protocol,
its performance remains stable and the effects of
treatments on memory can be tested.
Both working and reference memory can be tested
in the RAM. Some arms do not contain food bait;
entry into an unbaited arm is a reference (long-
term) memory error. Reentries into a baited arm is
regarded as a working (short-term) memory error
since the food is now gone and the status of the arm
has changed from baited to unbaited.
The effects of drugs, seizures, genetic alterations
and a variety of other manipulations can be com-
pared using the RAM. Variations of the method
allow tremendous flexibility in assessing learning
and memory. The task can be made quite challenging
(e.g. by increasing the number of arms) or simpli-
fied, depending on the degree of sensitivity desired.
However, the experimenter should be aware of the
disadvantages of the RAM as well. Animals must be
modestly food deprived (to increase motivation suf-

ficiently for optimal performance). The adaptation
period and learning process can be quite laborious.
Spatial learning in humans
Most likely, no person has ever been tested in a
Morris WM tank, but interestingly, there have been
a number of studies utilizing 'virtual' water mazes
and similar navigational tasks to assess human spa-
tial learning and memory in both children and adults
(O'Connor and Glassman, 1993; Overman et al.,
1996; Abrahams et al., 1997). The virtual experi-
ments involve computer-generated tasks (similar to
a video game), in which a person must learn to
navigate along various paths and learn the location
of certain targets. Among normal individuals, males
and females differ significantly in their use of spa-
tial information to master the task; males generally
learn the task quicker and utilize both landmark and
geometrical cues to navigate to the target, while
females tend to use landmark cues only (Astur et
al., 1998; Sandstrom et al., 1998). The reasons for
gender-related performance differences remain to be
explained, and offer a caveat when testing groups of
animals that include both sexes (Roof and Stein,
1999). Performance on virtual water maze tasks
is impaired in persons with traumatic brain injury
(Skelton et al., 2000) and hippocampal lesions, es-
pecially right-sided lesions (Bohbot et al., 1998).
Virtual tests of spatial learning and memory could be
a powerful method to study memory deficits in pa-
tients with various types of hippocampal dysfunction
(Ploner et al., 1999).
Tests of anxiety
A variety of tests are available to assess anxiety in
experimental animals. One of the most popular is the
elevated plus-maze, consisting of two elevated, open
(brightly lit) arms perpendicular to two enclosed
(dark) arms (Lister, 1987; File, 1993). Rodents pre-
fer dark, enclosed spaces to brightly lit open ones,
but they are also highly exploratory by nature. The
elevated plus-maze is referred to as an uncondi-
tioned spontaneous behavioral conflict model (Wall
and Messier, 2001), using an ethologically relevant
situation to measure the conflict between exploration
of a novel environment and avoidance of a brightly
381
lit, open area (Crawley, 1999). The number of en-
tries into each arm, the ratio of open arm entries
to total arm entries, and the time spent in each arm
are recorded over a given time period, providing
measures of anxiety-related behavior. The elevated
plus-maze is a well validated test that can be used
to compare anxiety levels in control versus epileptic
animals, after anxiolytic or anxiogenic drugs, or in
other experimental situations (Pellow et al., 1985;
Hogg, 1996). Despite its widespread use, investiga-
tors must be aware that there may be fundamental
differences between anxiety in humans and animals.
In humans, anxiety is an affective, emotional state
that may or may not have an externally observable
correlate. In testing anxiety in animals, we must rely
on observable behaviors and assume that these re-
flect the internal emotional state (Wall and Messier,
2001).
Tests of social adaptation
Persons with temporal lobe epilepsy are prone to a
variety of behavioral and social difficulties, observa-
tions that have been verified in laboratory animals
(Griffith et al., 1987). Tests to determine sociabil-
ity and interaction include the handling test and the
home cage intruder test. The handling test is a mea-
sure of emotional response to graded amounts of
discomfort, elicited by nonstressful handling (rub-
bing the fur along its grain), 'stressful handling'
(rubbing the fur against its grain), and graded tail
pinch with a hemostat. Specific responses are graded
according to a validated scale (Holmes et al., 1988;
Stafstrom et al., 1993).
In the home cage intruder test, a test animal
is placed into the cage of an experimental animal,
and aggressive, passive, and other interactive and
non-interactive behaviors are recorded (Thurmond,
1975; Mellanby et al., 1981 ; Kaliste-Korhonen and
Eskola, 2000). Animals with experimental epilepsy
have been found to be more passive than controls,
in contrast to their more aggressive behavior to-
ward experimenters (Mellanby et al., 1981; Holmes
et al., 1988). These findings remain unexplained,
and suggest caution when trying to correlate animal
and human behaviors with specific brain lesions or
insults.
382

TABLE 1 Seizure-induced behavioral changes during

Selected tests to assess seizure-induced behavioral and cognitive development
impairment

Test Function tested Brain area a Differences between developing and mature brain
Rotarod Motor coordination Brainstem,
The developing brain and the mature brain differ
spinal cord
Open field test Locomotor activity, Multiple substantially in their response to a prolonged, se-
exploratory behavior vere seizure, such as status epilepticus. Prolonged
Water maze Spatial learning and Hippocampus seizures in the mature animal result in neuronal
memory death (especially in limbic areas) (Meldrum et al.,
Radial ann Spatial learning and Hippocampus
1973) and accompanying behavioral, cognitive, and
maze memory
Elevated plus Anxiety Multiple physiologic deficits. Adult rats subjected to the con-
maze vulsant kainic acid (KA) exhibit profound neuron
Handling test Response to graded Multiple loss in vulnerable areas of hippocampus, especially
discomfort CA3 and dentate hilus. In addition, these rats develop
Home cage Social aggression Multiple
numerous neurologic sequelae including behavioral
intruder test
(aggressiveness, hyperactivity), cognitive (impaired
a Presumed brain regions involved in mediating the function. spatial learning and memory), and epileptic (spon-
taneous recurrent seizures) abnormalities (Ben-Ari,
1985; Cronin and Dudek, 1988; Milgram et al., 1988;
Summary of behavioral tests Stafstrom et al., 1993). An important question is
whether the ongoing spontaneous recurrent seizures
The behavioral and cognitive tests described above contribute to further cognitive impairment, beyond
represent only a sample of available methods to as- that incited by the initial status epilepticus (Dudek
sess the effects of seizures, and the rodent 'neuropsy- et al., 2002, this volume). One study of pilocarpine-
chological battery' listed in Table 1 can be modified induced status epilepticus in adult rats found no close
according to the experimenter's goals and questions. relationship between memory dysfunction during the
Before concluding that seizures have led to impair- latent period and the time of onset of spontaneous re-
ments in behavior or cognition, one must ensure that current seizures (Hort et al., 1999). This issue needs
elementary sensorimotor function (as well as sensory to be evaluated in younger animals, since some clin-
capabilities such as vision and hearing) is intact. Be- ical data suggest that seizure frequency in children
yond that, tests should be chosen to examine specific is a key factor as to whether seizure-induced cogni-
aspects of brain function. In designing experiments tive impairment will occur (Schoenfeld et al., 1999;
to quantify the effects of seizures on behavior and Austin et al., 2001).
cognition, the experimenter should choose tests with In contrast, seizures of similar duration and sever-
a specific hypothesis in mind, rather than because a ity have fewer detrimental effects on the developing
test is popular or easy to administer. For example, brain, and it has been surprisingly difficult to de-
the Morris water maze is sometimes used almost tect overt structural or functional abnormalities after
indiscriminately as a general measure of 'learning seizures occurring in the early postnatal period. Sim-
and memory', when, in fact, it assesses only spatial ilar or even more intense seizure activity in young
learning and memory. animals results in little observable structural damage
Are there better tests, or more sensitive ones to (Albala et al., 1984; Cavalheiro et al., 1987; Sperber
detect subtle abnormalities? What criteria should we et al., 1991, 1992; Stafstrom et al., 1992), despite
agree on as to whether an abnormality on behav- induction of seizures at a much lower convulsant
ioral testing is sufficient evidence of seizure-induced dose in young animals compared to adults, i.e. the
causation? These are questions that await further ex- developing brain has a lower seizure threshold. It re-
perimental investigation, but are central in the debate mains unclear why brains that can so easily be made
over the effects of seizures on brain damage. to seize are so hearty when it comes to long-term

structural damage. These observations suggest a dis-
sociation between seizure threshold and long-term
sequelae.
Many mechanisms can be envisioned to ac-
count for the protection of the immature brain from
seizure-induced damage, including immature mem-
brane properties, synaptic machinery, ion homeo-
static mechanisms, and growth factor effects (Hol-
mes, 1997; Stafstrom et al., 2000; Ben-Aft, 2001;
Sanchez and Jensen, 2001). Reasons for the apparent
difference in vulnerability to seizure-induced dam-
age may be both biological and methodological. Be-
cause of the complexity of cellular processes in early
development, seizure-induced neuronal damage or
physiological alterations could be masked by other
ongoing developmental processes, such as neuroge-
nesis. Seizures could alter patterns of differentiation
or connectivity, despite a normal macroscopic ap-
pearance of the brain following seizures. Therefore,
the concept of 'brain damage' should be expanded
to encompass other compensatory processes, such
as axonal sprouting and synaptic reorganization (al-
tered connectivity), physiological changes (increased
excitation or decreased inhibition), enhanced suscep-
tibility to recurrent seizures, and behavioral and cog-
nitive impairment. There needs to be comprehensive
and systematic study of the structural and functional
effects at long intervals after seizures, across a range
of time points and stages of development, aspects
that were not always considered in earlier studies.
Brain development consists of a series of evolving
yet specific and precisely regulated processes, many
of which are sensitive to activity-dependent modula-
tion and could therefore be altered by seizures.
The perspective that the young brain is resistant
to seizure-induced damage needs to be reassessed in
light of recent experimental results (Holmes, 1997;
Holmes and Ben-Ari, 1998; Lynch et al., 2000).
Utilization of sensitive markers of neuronal injury
has shown that seizures can cause altered brain
structure and function in young rodents (Holmes
et al., 1998, 1999; Sankar et al., 1998; Thomp-
son et al., 1998; Chen et al., 1999). Several recent
studies have provided evidence that the developing
brain is vulnerable to a variety of seizure-induced
alterations, including neuronal death, synaptic reor-
ganization, and long-term cognitive and behavioral
deficits. These adverse sequelae were observed de-
383
spite the absence of gross structural lesions following
seizures in the early postnatal period, although the
overt histologic injury is far less extensive than in
the mature brain (Holmes and Ben-Aft, 1998; Sankar
et al., 1998). Although seizure-induced damage is
far greater in the mature brain, the sensitivity of the
immature nervous system to seizure-induced damage
may manifest more subtly as behavioral, learning,
and cognitive deficits.
Studies of seizure-relatedcognitive changes during
development
Table 2 lists some of the experimental studies that
have examined the behavioral and cognitive effects
of seizures at various times during development. It is
obvious that these studies employed a wide range of
experimental designs. Comparisons between studies
are difficult because of different methods and ages
of seizure induction, different ages when behavior
was tested, and different behavioral tests used. If
a study concludes that seizures during development
adversely affect subsequent cognition, it must be
determined whether the effect is due to the test
employed, the method of seizure induction, the age
at testing (latency from seizure), or a combination of
these factors.
Despite their methodological diversity, the studies
fall into a few basic designs, each of which is dis-
cussed below. In the first type of study design, status
epilepticus was induced at a young age, then cogni-
tion was studied at a later date. The second category
of studies employed a similar protocol, but multiple
episodes of status epilepticus were induced during
development. In the third type ('two-hit' models),
two episodes of status epilepticus were induced, sep-
arated by several weeks, followed later by behavioral
testing. In the final type of design, brief, recurrent
seizures were induced (usually multiple per day)
over a several-day period during development; cog-
nition was examined subsequently in adulthood.
Status epilepticus models (single episode)
Several studies have examined the effects of sta-
tus epilepticus on subsequent cognitive function in
developing animals. A wide variety of seizure induc-
tion methods have been associated with adverse cog~
384

TABLE 2
Selected references on the effects of seizures during development on behavior in rats

Reference Seizure Age at seizure Age at Behavioral outcome Histology

induction testing
Status Epilepticus Studies (Single Episode)
De Feo et al., 1 9 8 6 Kainic acid or PI0 or P25 P45 Decreased active avoidance in Not reported
PTZ shuttle box in KA treated rats
only; worse in rats with
seizure at P10
Holmes et al., 1 9 8 8 Kainic acid P24-28 PI50 Deficits in WM, OF, HCIT Not reported
Jensen et al., 1 9 9 2 Hypoxia P5, 10 P60-85 No difference compared to No pathological changes
controls in WM, OF, H
Thurber et al., 1992 Continuous P20-60 P80 Impaired WM learning in P60 No cell loss at any age
hippocampal only
stimulation
Stafstrom et al., 1993 Kainic acid P5-60 P80 Age-dependent deficits in CA3 and hilar cell loss in
WM, OF, H, only in P30 P>_ 2O
Liu et al., 1 9 9 5 Pilocarpine P20, P45 P80 Deficits in OF, H in P45 CA3 cell loss in P45
group only; deficits in WM group only
learning in P20 and P45 rats
Sperber et al., 1 9 9 9 Flurothyl PI4 (SE up to 60 - Behavior not assessed No cell loss or gliosis, no
min) supragranular MFS
Lynch et al., 2000 Kainic acid P1-24 P95 Deficits in RAM (reference CA3 and hilar cell loss
and working errors) only in P _> 24
Sutula et al., 2000 Kainic acid PI-24 P95 Deficits in RAM and EPM; no Not reported
alteration in OF
Brunson et al., 2001 CRH P10 3, 6, 10 Progressive impairment in Decreased CA3 neurons
months of WM spatial learning over the
age 3 ages of testing
Status Epilepticus Studies (Multiple Episodes)
Dos Santos et al., Pilocarpine P7-9 (3 SE P60 Less active in OF, less anxious No cell loss or gliosis, no
2000 episodes) in EPM, learning deficits in supragranular MFS
inhibitory step-down
avoidance and Skinner box,
no difference on rotarod
Sarkisian et al., 1997 KA P20-26 (4 SE P60 No impairment in WM spatial No hippocampal cell loss
episodes) learning acquisition

Two-Hit Studies
Koh et al., 1999 Kainic acid PI5 and P45 P50 Worse WM learning in P45 Rats with KA on both P15
rats if also had KA on P15 and P45 bad worse DNA
fragmentation in limbic
areas.

Schmid et al., 1999 Flurothyl, PO-4 (5 sz/day) Behavior not assessed. Greater KA-induced
P0-4; KA, Compared KA-induced hippocampal damage in
P45 hippocampal damage in rats rats with prior flurothyl
on P45. seizures.

nitive c h a n g e s later in life (Table 2). T h e c h e m o c o n - age f o l l o w i n g K A s e i z u r e s , c o g n i t i v e d e f i c i t s w e r e

v u l s a n t K A has b e e n u t i l i z e d e x t e n s i v e l y , b e c a u s e o f also s h o w n to b e a g e - r e l a t e d ( S t a f s t r o m et al., 1993).
the s i m i l a r i t i e s b e t w e e n t h e s e i z u r e s y n d r o m e c a u s e d K A status e p i l e p t i c u s w a s i n d u c e d in P5, 10, 20, 30,
by K A and h u m a n temporal lobe epilepsy (Ben-Ari, a n d 60 rats. In a d u l t h o o d , several b e h a v i o r a l tests
1985). In a d d i t i o n to a g e - d e p e n d e n t n e u r o n a l d a m - w e r e p e r f o r m e d , i n c l u d i n g w a t e r m a z e , o p e n field
 385

TABLE 2 (continued)

Reference Seizure Age at seizure Age at Behavioraloutcome Histology

induction testing
Recurrent Seizure Studies
Holmes et al., 1993 Kindling P20, 40, 60 P80 No differencecompared to No lesions in
controls in WM, OF; P 2 0 s experimentals or controls
and P40s more emotional than
controls on H
Neill et al., 1 9 9 6 Flurothyl P15-19 (3 sz/day) P53 Deficits in AD, WM No cell loss
Holmes et al., 1998 Flurothyl P(IM (5 sz/day) P24 Deficits in WM learning and CA3 and supragranular
OF decreased activity MFS
Huang et al., 1999 Flurothyl P0-9 (5 sz/day) P82 Deficits in WM learning CA3 and supragranular
MFS
De Rogalski Landrot Flurothyl P0-1 I (4-5 P27 Deficits in WM learning and CA3 and supragranular
et al., 2001 sz/day) memory MFS
Lee et al., 2001 Tetanus toxin PI0 P57 Deficits in WM learning Dispersion of s.
pyramidale neurons but no
cell loss
Abbreviations: P = postnatal age (in days); WM = water maze; OF = open field; H = handling test; AD = auditory discrimination;
RAM = radial arm maze; HCIT = home cage intruder test; EPM = elevated plus-maze; PTZ = pentylenetetrazole; CRH =
corticotropin-releasinghormone; SE = status epilepticus;MFS = mossy fiber sprouting;sz = seizure; s. = stratum.

test, and handling test. Rats that had experienced
status epilepticus at P5 or P10 had no deficits on
any behavioral measure, compared to controls with-
out seizures. P20 rats had deficits only on the water
maze probe test (suggesting impairment of memory
retrieval), whereas rats that had status epilepticus at
P30 or P60 had impaired spatial learning and mem-
ory, excessive activity in the open field, and greater
aggression when handled. In the P60 group, more
significant deficits were seen in animals with spon-
taneous recurrent seizures, but the number of spon-
taneous seizures did not correlate with the degree
of learning deficit. Therefore, younger animals were
relatively protected from behavioral and cognitive
deficits induced by KA-induced status epilepticus.
A recent study reexamined this question by corre-
lating behavioral and physiological changes (Lynch
et al., 2000). KA seizures were evoked during early
postnatal development in the rat (P1-P24). A K A
seizure induced between P1 and P I 4 was associated
with long-term (life-long) impairment on the radial
arm maze, implying impaired spatial memory. Errors
committed by the rats were both of the working and
reference types (see the section 'Radial arm maze'),
suggesting impairment of both short- and long-term
memory. The deficits were accompanied by impaired
induction of long-term potentiation (LTP). These
long-term, behaviorally significant effects of early
seizures on hippocampal memory demonstrate the
influence of activity-dependent and seizure-induced
plasticity during development on subsequent cogni-
tive function in adulthood. The chronic reduction
in synaptic plasticity induced by seizures from P I -
P I 4 was also manifested as a long-term reduction in
susceptibility to kindled seizure development and en-
hanced paired pulse inhibition in the dentate gyms.
The increase in inhibition and loss of plasticity were
maximal when the seizures occurred on P1 but were
also significant when seizures were induced as late
as PI4. However, the cognitive deficits did not fol-
low this ontogenetic sequence; deficits were worse
when seizures occurred in adulthood, but within the
P I - 1 4 age range, the deficits did not vary in a close
age-dependent manner.
In a subsequent study, using a similar protocol,
KA seizures were induced in P 1 - P 2 4 rats, and their
performance on the elevated plus maze, open field
test, and radial arm maze was evaluated in adulthood
(Sutula et al., 2000). There was no difference in gross
locomotor activity among the groups in the open
field test. Adult rats that had experienced seizures
during P 1 - 2 4 had an increased preference for coy-
386
ered arms in the plus maze, suggesting increased
anxiety/avoidance. These rats also bad a reduced
rate of spatial learning in the radial arm maze, imply-
ing hippocampal dysfunction. These findings suggest
that each age epoch during development should be
considered on its own accord, with seizures affecting
each age differently according to the specific neural
processes taking place at that time.
It is unknown why one study found no cognitive
deficits following KA seizures in the early perina-
tal period (Stafstrom et al., 1993), whereas another
group found behavioral deficits in animals undergo-
ing status as early as P1 (Lynch et al., 2000). The
two studies used different behavioral tests, though
both assessed spatial learning and memory; it is pos-
sible that the radial arm maze is more sensitive to
deficits in the spatial learning domain. The duration
of status was not reported by Lynch and colleagues
and it is unknown whether their rats had sponta-
neous recurrent seizures. Prolonged seizures caused
by other etiologies (e.g. corticotropin-releasing hor-
mone) (Baram and Schultz, 1991) early in develop-
ment are associated with later impairment of water
maze learning, and the deficits appear to be progres-
sive over time (Brunson et al., 2001).
Together, these studies delimit a period of postna-
tal susceptibility in the developing rat hippocampus
during which disruption of normal neural activity by
seizures produces discrete deficits in hippocampal-
dependent behavior and plasticity manifest in adult-
hood, even in the absence of cell loss. Such damage
can apparently occur even before the full maturation
of hippocampal circuits (Ribak and Navetta, 1994).
Status epilepticus models (multiple episodes)
Cognitive effects of multiple episodes of status
epilepticus were studied in two studies (Table 2).
Four episodes of KA-induced status from P20-26
did not result in water maze deficits later in life
(Sarkisian et al., 1997), whereas three episodes of
pilocarpine-induced status from P7-9 resulted in
marked impairment of learning, anxiety, and emo-
tionality (Dos Santos et al., 2000). Neither study
reported histologic changes, supporting the notion
that behavioral sequelae can occur without structural
brain damage.
Two-hit models
Besides the occurrence of neurologic sequelae in
response to a single episode of prolonged status
epilepticus or a series of multiple brief seizures
confined to the neonatal period, other studies have
shown that early life seizures can 'prime' the brain
for severe seizure-related damage later in life. These
'two-hit' models show that even in the absence of
demonstrable neuronal damage during development,
when such animals are challenged with a second
seizure in adulthood, the resultant damage is greater
than if the initial seizure had not occurred. Koh and
colleagues (Koh et al., 1999) produced status epilep-
ticus in P15 rats with KA; no overt cell damage was
found following status epilepticus. If such rats later
underwent another KA-induced seizure at P45, much
more severe hippocampal cell damage was seen than
in animals that got KA on P45 only. Rats with two
KA exposures also had greater impairment of spatial
learning in the water maze than did rats undergo-
ing status on P45 only. In another study, a series
of brief neonatal seizures induced by the convulsant
inhalant flurothyl was associated with enhanced KA
seizure-induced hippocampal cell damage later in
life, compared to controls that had not undergone
prior flurothyl seizures, although cognitive changes
were not evaluated in those animals (Schmid et al.,
1999). These studies strongly suggest that seizures
early in life are not benign (Holmes and Ben-Ari,
1998).
Recurrent, brief seizure models
Frequent brief seizures early in development can
also cause neurologic deficits. Multiple flurothyl- or
pentylenetetrazole-induced generalized seizures in
the newborn period lead to impaired learning and in-
creased seizure susceptibility later in life, even in the
absence of overt cell loss (Neill et al., 1996; Holmes
et al., 1998, 1999; Huang et al., 1999). Infant rats
with intrahippocampal tetanus toxin injections de-
velop recurrent seizures over the next 7-10 days (Lee
et al., 2001). When tested as adults, these rats display
marked deficiencies in spatial learning ability in the
water maze. Therefore, recurrent early life seizures
impair subsequent spatial learning irrespective of
the seizure etiology, though impairments following

kindled seizures are relatively mild (Holmes et al.,
1993). Measurable hippocampal cell death was not
detected in any of these models, although seizures
early in life induced sprouting of both dentate gran-
ule cells and CA3 pyramidal neurons (Holmes et al.,
1998; Huang et al., 1999). In addition, in the im-
mature hippocampus, multiple seizures are accom-
panied by significant neurogenesis of newly formed
dentate granule neurons (Holmes et al., 1999), as has
also been documented in adult animals (Parent et al.,
1997).
Other recent studies have revealed that seizures
in rat pups may induce cellular alterations in the
hippocampus, such as reduction in dendritic spine
density (Jiang et al., 1998), neuronal loss (Mont-
gomery et al., 1999), and abnormalities in the ter-
minal field of the mossy fiber pathway (Huang et
al., 1999). Such forms of synaptic reorganization
may provide the basis for long-lasting neurologic
sequelae such as hyperexcitable neuronal circuits
(Tauck and Nadler, 1985; Dudek and Spitz, 1997).
Recent observations in developing rats have clearly
demonstrated that seizures during the postnatal pe-
riod modify hippocampal development and have per-
sistent, long-term functional effects in hippocampal
circuitry, which influence learning, memory, and sus-
ceptibility to epilepsy in adulthood.
These observations demonstrate robust long-term
behavioral and cognitive consequences of seizures
during development. The emerging perspective from
these independent observations has important clin-
ical implications with regard to the consequences
of epileptogenesis during development. Even in the
absence of gross seizure-induced structural damage,
subtle but important physiological changes occur
in neurons and neuronal networks, with significant
behavioral consequences, including adverse effects
on learning, memory, and cognitive function. Such
deficits may impact significantly on the child, family,
and society.
References
Abrahams, S., Pickering, A., Polkey, C.E. and Morris, R.G.
(1997) Spatial memory deficits in patients with unilateral dam-
age to the right hippocampal formation.Neuropsychologia, 35:
11-24.
Albala, B., Moshe, S. and Okada, R. (1984) Kainic acid induced
seizures: a developmentalstudy. Dev. Brain Res., 13: 139-148.
387
Altman, J. and Sudarshan, K. (1975) Postnatal developmentof
locomotion in the laboratoryrat. Anim. Behav., 23: 896-920.
Astur, R.S., Ortiz, M.L. and Sunderland,R.J. (1998) A character-
ization of performance by men and women in a virtual Morris
water task: a large and reliable sex difference. Behav. Brain
Res., 93: 185-190.
Austin, J.K. and Dunn, D.W. (2002) Progressive behavioral
changes in children with epilepsy. In: T. Sutula and A. Pitk~i-
hen (Eds.), Do Seizures Damage the Brain. Progress in Brain
Research, Vol. 135. Elsevier, Amsterdam, pp. 419-427.
Austin, J.K., Harezlak, J., Dunn, D.W., Huster, G.A., Rose, D.F.
and Ambrosius, W.T. (2001) Behavior problems in children
before first recognized seizures. Pediatrics, 107:115-122.
Ba, A. and Seri, B.V. (1995) Psychomotor functions in develop-
ing rats: ontogenetic approach to structure-function relation-
ships. Neurosci. Biobehav. Rev., 19: 413-425.
Baram, T.Z. and Schultz, L. (1991) Corticotropin-releasinghor-
mone is a rapid and potent convulsant in the infant rat. Dev.
Brain Res., 61: 97-101.
Becker, J.T., Walker, J.A. and Olton, D.S. (1980) Neuroanatomi-
cal basis of spatial memory.Brain Res., 200: 307-320.
Beckung, E. and Uvebrant, P. (1997) Hidden dysfunction in
childhood epilepsy. Dev. Med. Child Neurol., 39: 72-79.
Ben-Ari, Y. (1985) Limbic seizure and brain damage produced
by kainic acid: mechanisms and relevance to human temporal
lobe epilepsy.Neuroscience, 14: 375-403.
Ben-Ari, Y. (2001) Developing networks play a similar melody.
Trends Neurosci., 24: 353-360.
Bohbot, V.D., Kalina, M., Stepankova, K., Spackova, N.,
Petrides, M. and Nadel, L. (1998) Spatial memory deficits
in patients with lesions to the right hippocampus and to the
right parahippocampal cortex. Neuropsychologia, 36: 1217-
1238.
Bourgeois, B.F. (1998) Antiepilepticdrugs, learning, and behav-
ior in childhood epilepsy. Epilepsia, 39: 913-921.
Brandeis, R., Brandys, Y. and Yehuda, S. (1989) The use of the
Morris water maze in the study of memory and learning, lnt.
J. Neurosci., 48: 29-69.
Brunson, K.L., Eghbal-Ahmadi, M., Bender, R., Chen, Y. and
Baram, T.Z. (2001) Long-term, progressive hippocampal cell
loss and dysfunction induced by early-life administration of
corticotropin-releasinghormone reproduce the effects of early-
life stress. Proc. Natl. Acad. Sci. USA, 98: 8856-8861.
Camfield, E (1997) Recurrent seizures in the developing brain
are not harmful. Epilepsia, 38: 735-737.
Cavalheiro, E., Silva, D., Turski, W., Calderazzo, F., Bor-
tolotto, Z. and Turski, L. (1987) The susceptibility of rats
to pilocarpine-inducedseizures is age-dependent. Brain Res.,
465: 43-58.
Chen, K., Baram, T. and Soltesz, I. (1999) Febrile seizures in the
developing brain result in persistent modificationof neuronal
excitability in limbic circuits. Nat. Med,, 5: 888-894.
Corman, C.D. and Shafer, J.N. (1968) Open-field activity and
exploratory behavior. Psychon. Sci., 13: 55-56.
Crawley, J.N. (1999) Behavioral phenotyping of transgenic and
knockout mice: experimental design and evaluation of gen-
388
eral health, sensory functions, motor abilities, and specific
behavioral tests. Brain Res., 835: 18-26.
Crawley, J.N. and Paylor, R. (1997) A proposed test battery and
constellations of specific behavioral paradigms to investigate
the behavioral phenotypes of transgenic and knockout mice.
Horm. Behav., 31:197-211.
Cronin, J. and Dudek, EE. (1988) Chronic seizures and collateral
sprouting of dentate mossy fibers after kainic acid treatment in
rats. Brain Res., 474: 181-184.
De Feo, M.R., Mecarelli, O., Palladini, G. and Ricci, G.F. (1986)
Long-term effects of early status epilepticus on the acquisition
of conditioned avoidance behavior in rats. Epilepsia, 27: 476-
482.
De Rogalski Landrot, I., Minokoshi, M., Silveira, D.C., Cha,
B.H. and Holmes, G.L. (2001) Recurrent neonatal seizures:
relationship of pathology to the electroencephalogram and
cognition. Dev. Brain Res., 129: 27-38.
Dos Santos, N.E, Arida, R.M., Filho, E.M.T., Priel, M.R. and
Cavalheiro, E.A. (2000) Epileptogenesis in immature rats fol-
lowing recurrent status epilepticus. Brain Res. Rev., 32: 269-
276.
Dudek, EE. and Spitz, M. (1997) Hypothetical mechanisms for
the cellular and neurophysiologic basis of secondary epilep-
togenesis: Proposed role of synaptic reorganization. J. Clin.
NeurophysioL, 14: 90-101.
Dudek, EE., Hellier, J.L., Williams, P.A., Ferraro, D.J. and
Staley, KJ. (2002) The course of cellular alterations associated
with the development of spontaneous seizures after status
epilepticus. In: T. Sutula and A. Pitk~inen (Eds.), Do Seizures
Damage the Brain. Progress in Brain Research, Vol. 135.
Elsevier, Amsterdam, pp. 53-65.
Elwes, R.D., Johnson, A.L. and Reynolds, E.H. (1988) The
course of untreated epilepsy. Br. Med. J., 297: 948-950.
File, S.E. (1993) The interplay between learning and anxiety in
the elevated plus-maze. Behav. Brain Res., 58: 199-202.
Fox, W.M. (1965) Reflex-ontogeny and behavioural development
of the mouse. Anita. Behav., 13: 234-241.
Fox, G.B., Curzon, P. and Decker, M.W. (2001) The behavioral
assessment of sensorimotor processes in the mouse: acoustic
startle, locomotor activity, rotarod, and beam walking. In: J.J.
Buccafusco (Ed.), Methods of Behavioral Analysis in Neuro-
science. CRC Press, Boca Raton, FL, pp. 27-49.
Griffith, N., Engel Jr., J. and Bandler, R. (1987) Ictal and endur-
ing interictal disturbances in emotional behavior in an animal
model of temporal lobe epilepsy. Brain Res., 400: 360-364.
Hogg, S. (1996) A review of the validity and variability of the
elevated plus-maze as an animal model of anxiety. Pharmacol.
Biochem. Behav., 54: 21-30.
Hollup, S.A., Kjelstrup, K.G., Hoff, J., Moser, M.B. and Moser,
E.I. (2001) Impaired recognition of the goal location during
spatial navigation in rats with hippocampal lesions. J. Neu-
rosci., 21: 4505-4513.
Holmes, G.L. (1997) Epilepsy in the developing brain: lessons
from the laboratory and clinic. Epilepsia, 38: 12-30.
Holmes, G.L. and Ben-Aft, Y. (1998) Seizures in the developing
brain: perhaps not so benign after all. Neuron, 21: 1231-1234.
Holmes, G.L., Thompson, J.L., Marchi, T. and Feldman, D.S.
(1988) Behavioral effects of kainic acid administration on the
immature brain. Epilepsia, 29: 721-730.
Holmes, G.L., Chronopoulos, A., Stafstrom, C.E., Mikati, M.A.,
Thurber, S.J., Hyde, P.A. and Thompson, J.L. (1993) Effects
of kindling on subsequent learning, memory, behavior, and
seizure susceptibility. Dev. Brain Res., 73:71-77.
Holmes, G.L., Gaiarsa, J.-L., Chevassus-Au-Louis, N. and Ben-
Ari, Y. (1998) Consequences of neonatal seizures in the rat:
morphological and behavioral effects. Ann. Neurol., 44: 845-
857.
Holmes, G.L., Sarkisian, M., Ben-Ari, Y. and Chevassus-Au-
Louis, N. (1999) Mossy fiber sprouting after recurrent seizures
during early development in rats. J. Comp. Neurol., 404: 537-
553.
Hort, J., Brozek, G., Mares, R, Langmeier, M. and Komarek,
V. (1999) Cognitive functions after pilocarpine-induced status
epilepticus: changes during silent period precede appearance
of spontaneous recurrent seizures. Epilepsia, 40:1177-1183.
Huang, L., Cilio, M., Silveira, D., McCabe, B., Sogawa, Y.,
Stafstrom, C.E. and Holmes, G.L. (1999) Long-term effects
of neonatal seizures: a behavioral, electrophysiological and
histological study. Dev. Brain Res., 118: 99-107.
Jaffard, R., Bontempi, B. and Menzaghi, E (2001) Theoretical
and practical considerations for the evaluation of learning
and memory in mice. In: J.J. Buccafusco (Ed.), Methods of
Behavioral Analysis in Neuroscience. CRC Press, Boca Raton,
FL, pp. 295-323.
Jensen, F., Holmes, G., Lombroso, C., Blume, H. and Firkusny,
I. (1992) Age-dependent changes in long-term seizure sus-
ceptibility and behavior after hypoxia in rats. Epilepsia, 33:
971-980.
Jiang, M., Lee, C., Smith, K. and Swann, J. (1998) Spine loss
and other persistent alterations of hippocampal pyramidal cell
dendrites in a model of early-onset epilepsy. J. Neurosci., 18:
8256-8368.
Kaliste-Korhonen, E. and Eskola, S. (2000) Fighting in N1H/S
male mice: consequences for behaviour in resident-intruder
tests and physiological parameters. Lab. Anim., 34: 189-198.
Kessels, R.RC., de Haan, E.H.E, Kappelle, L.J. and Postma, A.
(2001) Varieties of human spatial memory: a meta-analysis
on the effects of hippocampal lesions. Brain Res. Rev., 35:
295-303.
Koh, S., Storey, T., Santos, T., Mian, A. and Cole, A. (1999)
Early-life seizures in rats increase susceptibility to seizure-
induced brain injury in adulthood. Neurology, 53: 915-921.
Lee, C.L., Hannay, J., Hrachovy, R., Rashid, S., Antalffy, B.
and Swann, J.W. (2001) Spatial learning deficits without hip-
pocampal neuronal loss in a model of early-onset epilepsy.
Neuroscience, 107: 71-84.
Levin, E.D. (2001) Use of the radial-ann maze to assess learning
and memory in rodents. In: J.J. Buccafusco (Ed.), Methods of
Behavioral Analysis in Neuroscience. CRC Press, Boca Raton,
FL, pp. 189-199.
Lister, R.G. (1987) The use of a plus-maze to measure anxiety in
the mouse. Psychopharmacology, 92: 180-185.
Liu, Z., Gatt, A., Mikati, M.A. and Holmes, G.L. (1995) Long-

term behavioral deficits following pilocarpine seizures in im-
mature rats. Epilepsy Res., 19: 191-204.
Lynch, M., Sayin, U., Bownds, J., Janumpalli, S. and Sutula,
T. (2000) Long-term consequences of early postnatal seizures
on hippocampal learning and plasticity. Eur. J. Neurosci., 12:
2252-2264.
McNamara, R.K. and Skelton, R.W. (1993) The neuropharma-
cological and neurochemical basis of place learning in the
Morris water maze. Brain Res. Rev., 8: 33-49.
Meldrum, B., Vigoroux, R. and Brierley, J. (1973) Systemic
factors and epileptic brain damage: prolonged seizures in
paralyzed artificially ventilated baboons. Arch. Neurol., 29:
82-87.
Mellanby, J., Strawbridge, E, Collingridge, G.I., George, G.,
Rands, G., Stroud, C. and Thompson, E (1981) Behavioural
correlates of an experimental hippocampal epileptiform syn-
drome in rats. J. Neurol. Neurosurg. Psychiatr),, 44: 1084-
1093.
Milgram, N.W., lsen, D.A., Mandel, D., Palantzas, H. and Pep-
kowski, M.J. (1988) Deficits in spontaneous behavior and
cognitive function following systemic administration of kainic
acid. Neurotoxicology, 9:611-624.
Montgomery, E., Bardgett, M., Lall, B., Csernansky, C. and Cser-
nansky, J. (1999) Delayed neuronal loss after administration
of intracerebroventricular kainic acid to preweanling rats. Dev.
Brain Res., 112:107-116.
Morris, R.G.M., Garrud, E, Rawlins, J.N.E and O'Keefe, J.
(1982) Place navigation impaired in rats with hippocampal
lesions. Nature, 297: 681-683.
Moser, V.C. (2000) The functional observational battery in adult
and developing rats. Neurotoxicology, 21: 989-996.
Neill, J.C., Liu, Z., Sarkisian, M., Tandon, E, Yang, Y.,
Stafstrom, C.E. and Holmes, G.L. (1996) Recurrent seizures
in immature rats: effect on auditory and visual discrimination.
Dev. Brain Res., 95: 283-292.
O'Connor, R.C. and Glassman, R.B. (1993) Human performance
with a seventeen-arm radial maze analog. Brain Res. Bull., 30:
189-19I.
Overman, W.H., Pate, B.J., Moore, K. and Peuster, A. (1996)
Ontogeny of place learning in children as measured in the
radial arm maze, Morris search task, and open field task.
Beha~: Neurosci., 110: 1205-1228,
Parent, J., Yu, T., Leibowitz, R., Geschwind, D., Sloviter, R.
and Lowenstein, D. (1997) Dentate granule cell neurogenesis
is increased by seizures and contributes to aberrant network
reorganization in the adult rat hippocampus. J. Neurosci., 17:
3727-3738.
Pellow, S., Chopin, E, File, S.E. and Briley, M. (1985) Validation
of open: closed arm entries in an elevated plus-maze as a
measure of anxiety in the rat. J. Neurosci. Methods, 14: 149-
167.
Ploner, C.J., Gaymard, B.M., Ehrle, N., Rivaud-Pechoux, S.,
Baulac, M., Brandt, S.A., Clemenceau, S., Samson, S. and
Pierrot-Deseilligny, C. (1999) Spatial memory deficits in pa-
tients with lesions affecting the medial temporal neocortex.
Ann. Neurol., 45: 312-319.
Ribak, C.E. and Navetta, M.S. (1994) An immature mossy fiber
389
innervation of hilar neurons may explain their resistance to
kainate-induced cell death in 15-day old rats. Dev. Brain Res.,
79: 47-62.
Roof, R.L. and Stein, D.G. (1999) Gender differences in Morris
water maze performance depend on task parameters. Physiol.
Behav., 68: 81-86.
Sanchez, R.M. and Jensen, F.E. (2001) Maturational aspects
of epilepsy mechanisms and consequences for the immature
brain. Epilepsia, 42: 577-585.
Sandstrom, N.J., Kaufman, J. and Huettel, S.A. (1998) Males
and females use different distal cues in a virtual environment
navigation task. Cogn. Brain Res., 6: 351-360.
Sankar, R., Shin, D., Liu, H., Mazarati, A., Pereira de Vas-
concelos, A. and Wasterlain, C. (1998) Patterns of status
epilepticus-induced neuronal injury during development and
long-term consequences. J. Neurosci., 18: 8382-8393.
Sarkisian, M.R., Tandon, E, Liu, Z., Yang, Y., Hori, A., Holmes,
G.L. and Stafstrom, C.E. (1997) Multiple kainic acid seizures
in the immature and adult brain: ictal manifestations and long-
term effects on learning and memory. Epilepsia, 38: 1157-
1166.
Schmid, R., Tandon, E, Stafstrom, C.E. and Holmes, G.L. (1999)
Effects of neonatal seizures on subsequent seizure-induced
brain injury. Neurology, 53: 1754-1761.
Schoenfeld, J., Seidenberg, M., Woodard, A., Hecox, K., Inglese,
C., Mack, K. and Hermann, B. (1999) Neuropsychological and
behavioural status of children with complex partial seizures.
Dev. Med. Child Neurol., 41: 724-731.
Skelton, R.W., Bukach, C.M., Laurance, H.E., Thomas, K.G.
and Jacobs, J.W. (2000) Humans with traumatic brain in-
juries show place-learning deficits in computer-generated vir-
tual space. J. Clin. Exp. Neuropsychol., 22: 157-175.
Sperber, E., Haas, K., Stanton, E and Moshe, S. (1991) Resis-
tance of the immature hippocampus to seizure-induced synap-
tic reorganization. De~: Brain Res., 60: 88-93.
Sperber, E., Stanton, E, Haas, K., Ackermann, R. and Moshe,
S. (1992) Developmental differences in the neurobiology of
epileptic brain damage. Epilepsy Res., Suppl., 9: 67-81.
Sperber, E.E, Haas, K.Z., Romero, M.T. and Stanton, EK. (1999)
Flurothyl status epilepticus in developing rats: behavioral,
electrographic, histological and electrophysiological studies.
Dev. Brain Res., 116: 59-68.
Stafstrom, C.E., Thompson, J.L. and Holmes, G.L. (1992) Kainic
acid seizures in the developing brain: status epilepticus and
spontaneous recurrent seizures. Dev. Brain Res., 65: 227-236.
Stafstrom, C.E., Chronopoulos, A., Thurber, S., Thompson, J.L.
and Holmes, G.L. (1993) Age-dependent cognitive and behav-
ioral deficits after kainic acid seizures. Epilepsia, 34: 420-
435.
Stafstrom, C.E., Lynch, M. and Sutula, T.E (2000) Consequences
of epilepsy in the developing brain: implications for surgical
management. Semin. Pediatr. Neurol., 7: 147-157.
Sutula, T.E, Sayin, U., Sayin, Y. and Stafstrom, C.E. (2000)
Adverse long-term behavioral consequences of early postnatal
seizures. Epilepsia, 41(Suppl. 7): 42.
Tauck, D.L. and Nadler, J.V. (1985) Evidence of functional
390
mossy fiber sprouting in hippocampal formation of kainic
acid-treated rats. J, Neurosci., 5: 1016-1022.
Terry, A.V. (2001) Spatial navigation (water maze) tasks. In: J.J.
Buccafusco (Ed.), Methods of Behavioral Analysis in Neuro-
science. CRC Press, Boca Raton, FL, pp. 153-166.
Theodore, W. and Wasterlain, C.G. (1999) Do early seizures
beget epilepsy?. Neurology, 53: 898-899.
Thompson, K., Holm, A., Schousboe, A., Popper, P., Micevych,
P. and Wasterlain, C. (1998) Hippocampal stimulation pro-
duces neuronal death in the immature brain. Neuroscience, 82:
337-348.
Thurber, S., Chronopoulos, A., Stafstrom, C.E. and Holmes,
G.L. (1992) Behavioral effects of continuous hippocampal
stimulation in the developing rat. Dev. Brain Res., 68: 35-40.
Thurmond, J.B. (1975) Technique for producing and measuring
territorial aggression using laboratory mice. Physiol. Behav.,
14: 879-881.
Tremml, P., Lipp, H.P., Muller, U., Ricceri, L. and Wolfer,
D.P. (1998) Neurobehavioral development, adult open field
exploration and swimming navigation learning in mice with
a modified beta-amyloid precursor protein gene. Behav. Brain
Res., 95: 65-76.
Tupper, D.E. and Wallace, R.B. (1980) Utility of the neurological
examination in rats. Acta Neurobiol. Exp., 40: 999-1003.
Wall, P.M. and Messier, C. (2001) Methodological and con-
ceptual issues in the use of the elevated plus maze as a
psychological measurement instrument of animal anxiety-like
behavior. Neurosci. Biobehav. Rev., 25" 275-286.
Walsh, R.N. and Cummins, R.A. (1976) The open field test: a
critical review. PsychoL Bull., 83: 482-504.
Wasterlain, C. (1997) Recurrent seizures in the developing brain
are harmful. Epilepsia, 38: 728-734.
Whimbey, A.E. and Denenberg, V.H. (1967) Two independent
behavioral dimensions in open-field performance. J. Comp.
Physiol. Psychol., 63: 500-504.
Willingham, D.B. (1997) Systems of memory in the human
brain. Neuron, 18: 5-8.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 33

Recent experimental studies of the effects of seizures on

brain development

John W. S w a n n *

The Cain Foundation Laboratories, Department of Pediatrics and Division of Neuroscience, Baylor College of Medicine,
6621 Fannin Street, MC3-6365, Houston, TX 77030, USA

Abstract: Results from experimental studies in the past have suggested that early-life seizures have little consequence on
brain development. However, the creation of new animal models is altering this view. This chapter briefly summarizes
these new findings and suggests avenues for future study.

The developing brain is unusually susceptible to
seizures. In infancy, children are quite prone to
febrile convulsions and in early life animals are
extraordinarily sensitive to convulsant drugs. These
observations, coupled with the fact that many indi-
viduals with intractable complex partial epilepsy and
mesial temporal lobe sclerosis have a history of pro-
longed and complex febrile seizures, have led to the
suspicion that early-life seizures damage the devel-
oping brain, especially the hippocampus, resulting in
neuronal loss and intractable epilepsy. The cognitive
deficits that are often reported in these patients have
been suspected to be produced not only by prolonged
early-life seizure but also brief but recurring seizures
that occur in individuals whose seizures cannot be
controlled by anticonvulsant therapy.
In this regard, studies in developing animals have
always been surprising. Severe seizures can be eas-
ily produced in 1- and 2-weeks-old rats and mice
by relatively low doses of convulsant drugs, such
as kainic acid (Albala et al., 1984; Nitecka et al.,
* Correspondence to: J.W. Swann, The Cain Foundation
Laboratories, Department of Pediatrics, Baylor College of
Medicine, 6621 Fannin Street, MC3-6365, Houston, TX
77030, USA. Tel.: +1-832-824-3969; Fax: -I-1-832-825-
4217; E-mail: jswann@bcm.tmc.edu
1984). However, in adulthood these animals usually
are not epileptic, have no discernable neuronal loss
or learning deficits (Okada et al., 1984; Thompson et
al., 1992; Holmes, 1997). However, recent results in
new models developed in several laboratories have
begun to provide evidence that early-life seizures can
have adverse effects on normal brain development.
Results have confirmed the earlier findings that if
seizures kill developing hippocampal neurons they
are far less vulnerable than their mature counter-
parts. For instance, despite detailed cell counts no
discernable neuronal loss has been observed follow-
ing single prolonged febrile seizures (Toth et al.,
1998), or as a result of brief but recurring seizures
induced by either amygdala kindling, (Veligek and
Moshr, 2002, this volume) repeated exposure to the
volatile convulsant, flurothyl (Holmes et al., 1998),
or injection of tetanus toxin into the developing
hippocampus (Lee et al., 2001). One exception to
this observation is studies of a lithium pilocarpine
model where some cell loss is observed following
prolonged (several hours) status epilepticus on post-
natal day 15 (Sankar et al., 1998). However, far more
dramatic neuronal loss is observed 1 week later, con-
firming the observation that developing neurons are
less vulnerable to seizure-induced damage.
Nonetheless, early-life seizures have now been
clearly shown to permanently alter the developing
392
brain in other ways. Recurrent seizures induced
by intrahippocampal tetanus toxin and lithium pi-
locarpine status epilepticus have been shown to re-
sult in chronic epilepsy (Lee et al., 1995; Sankar
et al., 1998; Anderson et al., 1999). In addition,
prolonged febrile convulsions (Dube et al., 2000),
kindling (Mosh6 and Albala, 1982) and repeated
flurothyl exposures (Huang et al., 1999) have been
shown to produce enhanced seizure susceptibility in
adulthood. Moreover, brief but recurring seizures in-
duced by either intrahippocampal tetanus toxin (Lee
et al., 2001) or repeated daily flurothyl exposures
(Huang et al., 1999) in infancy and a single episode
of kainate-induced status in neonatal rats (Lynch et
al., 2000) have all been shown to produce dramatic
spatial learning deficits in adulthood.
Thus, results from a variety of models have es-
tablished that early-life seizures can have long-term
consequences, which may have substantial clinical
relevance. The next goal is to fully characterize
these effects and to begin the important task of un-
derstanding the underlying cellular and molecular
events that produce these changes. While in most
models hippocampal cell loss has been discounted as
an important contributing factor, neuronal death in
other brain areas has not been ruled out and should
be the focus of further investigation. On the other
hand, permanent forms of neuronal injury such as
dendritic damage resulting in decreases in dendritic
arbor complexity and spine loss (Jiang et al., 1998)
need to be explored as well as seizure-induced al-
terations in synaptogenesis that would produce long-
term alterations in synaptic connectivity. Accompa-
nying molecular changes, such as alterations in not
only subunits of neurotransmitter receptors but also
in ion channels that are often targeted to spatially
discrete dendritic domains need to be explored. Ul-
timately, such changes could be critical contributors
to the effects of early-life seizures. For instance, pro-
longed febrile seizures may alter the expression of
HCN subunits of h-channels that underlie Ih in cen-
tral neurons (Chen et al., 2001; Baram et al., 2002,
this volume).
While much work will be required to understand
the molecular events that underlie the long-term
effects of early-life seizures, it seems likely that
different mechanisms will be involved and may pro-
duce different adverse effects (e.g. changes in seizure
susceptibility versus learning deficits). Some of the
mechanisms may be the result of neuronal injury,
while others may be produced by disruptions in nor-
mal developmental programs. Furthermore, not all
the changes may be detrimental. Indeed, it seems
very likely that some changes may result from the
induction of homeostatic, compensatory mechanisms
that attempt to stem hyperexcitability and prevent the
recurrence of seizures and chronic epilepsy. Finally,
the models employed thus far have studied the ef-
fects of seizures in the normal developing brain. It
will be important to apply these methods of early-life
seizure induction to genetic models of inherited neu-
rodevelopmental abnormalities. Particularly relevant
would be studies that examine the effects of seizures
in infant mice with inherited neuromigrational ab-
normalities such as Lissencephaly.
In conclusion, we have entered an extremely
exciting era in the basic studies of the develop-
mental epilepsies. Investigators are now fully aware
that early-life seizures in experimental animals can
have long-term clinically relevant consequences.
One challenge will be to understand the contri-
butions that neuronal death, neuronal injury and
activity-dependent alterations in neurodevelopmental
programs play on these outcomes. Separating detri-
mental from homeostatic compensatory mechanisms
will be crucial. The development of new therapies
that are targeted to protect developing neurons from
adverse effects and possibly enhance normal home-
ostatic processes is now a clearly defined long-term
goal for preventing the evolution of chronic epilepsy
and accompanying learning disabilities.
References
Albala, B.J., Moshr, S.L. and Okada, R. (1984) Kainic acid
induced seizures: A developmental study. Dev. Brain Res., 13:
139-148.
Anderson, A.E., Hrachovy, R.A., Antalffy, B.A., Armstrong,
D.L. and Swann, J.W. (1999) A chronic focal epilepsy with
mossy fiber sprouting follows recurrent seizures induced by
intrahippocampal tetanus toxin injection in infant rats. Neuro-
science, 92: 73-82.
Baram, T.Z., Eghbal-Ahmadi, M. and Bender, R.A. (2002) Is
neuronal death required for seizure-induced epileptogenesis in
the immature brain? In: T. Sutula and A. Pitkanen (Eds.), Do
Seizures Damage the Brain. Progress in Brain Research, Vol.
135. Elsevier, Amsterdam, pp. 365-375.
Chen, K., Aradi, I., Thon, N., Eghbal-Ahmadi, M., Baram, T.Z.

and Soltesz, I. (2001) Persistently modified h-channels after
complex febrile seizures convert the seizure-induced enhance-
ment of inhibition to hyperexcitability. Nat. Med., 7: 331-
337.
Dube, C., Chert, K., Eghbal-Ahmadi, M., Brnnson, K., Soltesz,
I. and Baram, T.Z. (2000) Prolonged febrile seizures in the
immature rat model enhance hippocampal excitability long
term. Ann. Neurol., 47: 336-344.
Holmes, G.L. (1997) Epilepsy in the developing brain: lessons
from the laboratory and clinic. Epilepsia, 38(1): 12-30.
Holmes, G.L., Gairsa, J.-L., Chevassus-Au-Louis, N. and Ben-
Ari, Y. (1998) Consequences of neonatal seizures in the rat:
morphological and behavioral effects. Ann. NeuroL, 44: 845-
857.
Huang, L.-T., Cilio, M.R., Silveira, D.C., McCabe, B.K., So-
gawa, Y., Stafstrom, C.E. and Holmes, G.L. (1999) Long-term
effects of neonatal seizures: a behavorial, electrophysiological,
and historical study. Dev. Brain Res., 118: 99-107.
Jiang, M., Lee, C.L., Smith, K.L. and Swann, J.W. (1998) Spine
loss and other persistent alterations of hippocampal pyramidal
cell dendrites in a model of early-onset epilepsy. J. Neurosci.,
18: 8356-8368.
Lee, C.L., Hrachovy, R.A., Smith, K.L., Frost Jr., J.D. and
Swann, J.W. (1995) Tetanus toxin-induced seizures in infant
rats and their effects on hippocampal excitability in adulthood.
Brain Res., 677: 97-109.
Lee, C.L., Hannay, J., Hrachovy, R., Rashid, S., Antalffy, B.
and Swann, J.W. (2001) Recurrent seizures in infant rats
produced spatial learning deficits without a substantial loss of
hippocampal pyramidal cells. Neuroscience, 107:71-84.
393
Lynch, M., Sayin, U., Bownds, J., Janumpalli, S. and Sutula,
T. (2000) Long-term consequences of early postnatal seizures
on hippocampal learning and plasticity. Eur. Z Neurosci., 12:
2252-2264.
Mosh6, S.L. and Albala, B.J. (1982) Kindling in developing rats:
Persistence of seizures into adulthood. Dev: Brain Res., 4: 67-
71.
Nitecka, L., Tremblay, E., Charton, G., Bouillot, J.P., Berger,
M.L. and Ben-Ari, Y. (1984) Maturation of kainic acid seizure-
brain damage syndrome in the rat, II. Histopathological seque-
lae. Neuroscience, 13: 1072-1094.
Okada, R., Mosh6, S.L. and Albala, B.J. (1984) Infantile status
epilepticus and future seizures susceptibility in the rat. Dev.
Brain Res., 15: 177-183.
Sankar, R., Shin, D.H., Liu, H., Mazarati, A., de Vasconcelos,
A.P. and Wasterlain, C.G. (1998) Patterns of status epilepticus-
induced neuronal injury during developmental and long-term
consequences. J. Neurosci., 18: 8382-8393.
Thompson, S.M., Haas, H.L. and G~ihwiler, B.H. (1992) Com-
parison of the actions of adenosine at pre- and postsynaptic
receptors in the rat hippocampus in vitro. J. Physiol. (Lond.),
451 : 347-363.
Toth, Z., Yan, X.-X., Haftogluo, S., Ribak, C.E. and Baram,
T.Z. (1998) Seizure-induced neuronal injury: vulnerability to
febrile seizures in an immature rat model. J. Neurosci., 18:
4285-4294.
Veligek, L. and Mosh6, S.L. (2002) Effects of brief seizures
during development. In: T. Sutula and A. Pitk~nen (Eds.), Do
Seizures Damage the Brain. Progress in Brain Research, Vol.
135. Elsevier, Amsterdam, pp. 355-364.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Published by Elsevier Science B.V.
CHAPTER 34
Summary" Seizure-induced damage in development and
functional consequences
Thomas Sutula 1,2,, and Asla Pitk~inen 3,4
1 Department of Neurology and 2 Department of Anatomy, University of Wisconsin, Madison, WI 53792, USA
3 Epilepsy Research Laborator3; A.I. Virtanen Institute for Molecular Sciences and 4 Department of Neurology,
Kuopio University Hospital, Kuopio, Finland
As illustrated in Sections I, II and III, efforts to as-
sess the possible damaging effects of repeated brief
seizures on neural circuits in adults have proved chal-
lenging for both experimental and clinical research.
In the developing nervous system, the challenges
of addressing this question are even more diffi-
cult, and have provoked considerable controversy.
The difficulties in assessing the effects of seizures
in the developing nervous system are probably not
so surprising from the perspectives of developmen-
tal neurobiologists, who have long appreciated the
complexity of activity-dependent processes that con-
tribute to normal neural development. Indeed, many
processes in the normal development of neural cir-
cuits, such as neural birth, process outgrowth, axon
guidance, formation of synapses and connectivity,
and neural death by apoptosis, are profoundly in-
fluenced by ongoing neural activity. It would be
surprising if an extreme form of neural activity,
such as seizures, did not have significant effects
on these developmental processes, and on long-term
functional properties of neural circuits. Furthermore,
it should not be surprising that detecting possible
long-term effects of seizures, such as neuronal death
* Correspondence to: T. Sutula, Department of Neurology
H6/570, University of Wisconsin, Madison, WI 53792,
USA. Tel.: +1-608-263-5448; Fax: +1-263-0412;
E-mail: sutula @neurology.wisc.edu
and 'damage', might be particularly challenging in
developing circuits, where neurogenesis, apoptosis,
axon growth, synapse formation, and a variety of
activity-dependent cellular and molecular processes
are ongoing during embryogenesis and postnatally,
specifically in the hippocampus, and can persist into
adulthood.
Evidence for damaging effects of status epilepti-
cus and cognitive declines associated with the onset
of epilepsy in children are discussed in Chapter
28. There is substantial evidence that the onset of
epilepsy is often accompanied by functionally signif-
icant cognitive declines, which are influenced by the
type and severity of the underlying primary neuro-
logical disorder for which epilepsy is merely a symp-
tom. This clear association with etiology has not
proved universally reassuring to parents of epilep-
tic children, who still frequently inquire about the
possibility that seizures are causing 'brain damage',
broadly defined as intellectual deficits (Chapter 32).
Indeed, all of the uncertainties regarding the role of
etiology (or 'initial precipitating injury') and ongo-
ing seizures as contributors to damage or functional
declines in adult onset epilepsy (Chapters 5, 6, 8, 9,
19, 20, 24 and 25) are also encountered in assessing
the effects of repeated seizures during development.
Resolution of the question about possible cumula-
tively damaging effects of poorly controlled epilepsy
in childhood is similarly complicated by the con-
founding issues of anticonvulsants, social isolation,
396
disruption of educational opportunities, the poten-
tial influence of background genetic susceptibility to
damage, and the prolonged periods of observation
that may be necessary to detect cognitive declines
going well beyond childhood and adolescence and
into adulthood.
There is currently no conclusive evidence about
the damaging effects of repeated brief seizures in
childhood. With the potential, however, for adverse
outcomes as a consequence of poorly controlled
seizures in childhood, and the evidence that long-
term functional properties of neural circuits are pro-
foundly influenced by neural activity during devel-
opment, universal reassurance that seizures during
childhood are in themselves benign seems less pru-
dent than individualized assessment and emphasis on
the urgency and importance of seizure control for
particular epileptic syndromes.
In keeping with the viewpoint that clinical de-
cisions about when and how to treat seizures in
childhood must be individualized, the emerging per-
spective from experimental studies of seizures dur-
ing development is that seizure-induced effects are
model and age dependent (Chapter 33). The model
dependence of the long-term effects of seizures dur-
ing development, now increasingly apparent (Chap-
ters 28-33), probably accounts for some of the
controversy about whether seizures are damaging.
Previous studies in a model of electroconvulsive-
evoked seizures and more recent studies in lithium-
pilocarpine-evoked seizures have provided evidence
of seizure-induced damage in early development
(Chapters 28 and 29), but generally this damage,
at least as indicated by overt histological alteration,
is less than at later stages of development or in
adulthood. In other models, evidence for damage has
been elusive or non-existent, but long-term adverse
functional consequences are still observed (Chapters
30 and 31). As an example of the complexity inher-
ent in assessing neural damage during development,
repeated fluoroethyl seizures in early development
appear to reduce neurogenesis (Chapter 30). Might
this not be a form of 'damage'? In another model
of febrile seizures in early development, repeated
seizures do not appear to alter neurogenesis or apop-
tosis (Chapter 31), but produce silver staining of neu-
rons that is usually a sign of damage. Remarkably,
there are no persisting signs of damaged neurons
or overt morphological lesions when these animals
mature, yet seizures induced in experimental mod-
els by fluoroethyl, fever, or a variety of induction
processes produce significant long-term functional
abnormalities (Chapters 28-33).
While there is no question that the developing
brain manifests less evidence of o v e r t structural
damage after prolonged or brief seizures, emerging
experimental studies indicate that seizures induced
by a variety of methods in early life have long-term,
adverse effects on memory and other behaviorally
significant functions (Chapter 32), and should not be
regarded as benign. In some cases these behavioral
effects have been correlated with long-term phys-
iological alterations including cellular and synap-
tic functions such as long-term potentiation, which
is implicated in information storage and learning
(Lynch et al., 2000). Through the pervasive influ-
ence of neural activity in developing neural circuits,
seizures may induce alterations at many levels of
organization from receptor subunit composition to
dendritic structure and neural connectivity (Chapter
33). As noted, more work needs to be done to estab-
lish the clinical relevance of these seizure-induced
alterations. While overt seizure-induced brain dam-
age in development appears relatively inconspicuous
compared to adults, there are clearly many long-
term functional consequences of early life seizures
in experimental models that manifest in adulthood as
adverse behavioral and cognitive outcomes.
References
Lynch, M., Sayin, U., Bownds, J., Janumpalli, S. and Sutula,
T. (2000) Long-term consequences of early postnatal seizures
on hippocampal learning and plasticity. Eur. J. Neurosci., 12:
2252-2264.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 35

Progressive cognitive decline in adolescents and adults

with epilepsy

C a r l B. D o d r i l l *

Regional Epilepsy Center, Departments of Neurology and Neurological Surgery, University of Washington School of Medicine,
Seattle, WA 98104-2499, USA

Abstract: The effects of an accumulation of single seizures upon mental abilities in adolescents and adults is explored
through a selective review of the world's literature. The papers reviewed were divided up into cross-sectional and
longitudinal studies. Of 16 investigations meeting all requirements for inclusion, 12 produced results pointing to a
relationship between seizures and adverse cognitive change. The cross-sectional studies produced stronger results than
the longitudinal ones, no doubt because the effects of co-existing factors not related to seizure effects were included in
measures of cognitive decline. The longitudinal investigations showed mild but definite relationships between seizures and
mental decline. However, relationships could be found only with generalized tonic-clonic seizures and not with partial
attacks. Results of an original investigation were reported which were consistent with the literature review. Suggestions for
future research were offered.

Introduction Review of the literature on cognitive effects of

The possibility that seizures may damage the brain
has been entertained for decades, but the mere fact
that this conference was scheduled is an indication
that as of yet no clear answer to the question has been
forthcoming. This chapter is specifically designed
to address the question of cognitive decline due
to seizures themselves with a particular emphasis
upon multiple single seizures in adolescents and
adults. The literature will first be reviewed, and some
original data will also be presented.
*Correspondence to: C.B. Dodrill, Regional Epilepsy
Center (Box 359745), Harborview Medical Center, 325
Ninth Avenue, Seattle, WA 98104-2499, USA. Tel.: +1-
206-731-4230; Fax: +1-206-731-4409;
E-mail: cdodrill@ u.washington.edu
seizures
This review will take the form of citing selected
studies done over the past 60 years rather than at-
tempting to summarize all investigations which bear
on the topic at hand. Studies most likely to contribute
to the field were selected and others were omitted.
Studies included here had the following features:
(1) they routinely used formal measures of mental
abilities which were typically intellectual and neu-
ropsychological tests although ratings of mental sta-
tus were permitted in two exceptional circumstances;
(2) they were longitudinal rather than cross-sectional
in nature, or, if cross-sectional, they included specific
features which permitted inferences about changes
in mental abilities over time; and (3) they evalu-
ated adolescents and adults rather than children since
studies of children were covered elsewhere in this
conference. For all studies, providing an estimate of
the numbers and types of seizures experienced as
well as a non-seizure control group was desirable
but not required for inclusion in this review. Studies
400
merely providing correlations between mental abili-
ties and seizure history variables such as age at onset
of seizures, duration of the disorder, and seizure
type were omitted since these variables, even taken
in combination, have been shown to have limited
relationship with mental abilities, even with large
samples (Dodrill and Matthews, 1992; Strauss et al.,
1995).
The studies reviewed are divided into cross-
sectional and longitudinal investigations as the dif-
ferences between these types of inquiries are espe-
cially important.
Cross-sectional studies
The possibility has long been considered that
monozygotic twins discordant for epilepsy might
provide information about the effects of seizures.
In an early work of this type, Lennox and Collins
(1945) studied six twin pairs discordant for epilepsy
and failed to identify any consistent intellectual dif-
ferences between the twins who did and who did not
have epilepsy, much less intellectual changes related
to seizure frequency. However, they also noted that
the number of seizures experienced by the affected
twin were few in number or absence only, and thus
this study did not produce definitive information.
Lennox and Lennox (1960), in an historically im-
portant paper, made clinical judgments of whether
or not 1,471 patients seen in clinic were or were
not 'mentally impaired,' and then related these judg-
ments to estimates of lifetime numbers of epileptic
seizures. Although they did not take the position
that seizures cause mental deterioration, their data
showed quite a direct relationship with the num-
ber of convulsions experienced and the probabil-
ity of being identified as mentally impaired. With
less than 10 convulsions experienced in their life-
times, only 9% were considered mentally impaired,
but with more than 1,000 convulsions experienced,
54% were considered impaired. Furthermore, hav-
ing a second seizure type as well as generalized
tonic-clonic seizures was associated with a slightly
increased rate of mental impairment regardless of
the lifetime number of convulsions experienced. Al-
though this study suffers from being cross-sectional
by nature and from not having a formal test of men-
tal abilities, the reputation of the authors and the care
in which these data were likely gathered require our
attention. Not only is the type of seizure underscored
as important in presaging losses in mental abilities,
but the fact that they should be considered over the
lifetime of the patient is drawn to our attention.
Dodrill and Troupin (1976) studied monozygotic
twin girls from a family with a strong history of
epilepsy. The twins were normal at birth and normal
in development until the onset of seizures. Further-
more, at the age of 5 years, when Twin 2 had her first
seizure, their EEGs were essentially identical with
widespread synchronous polyspike wave discharges.
Twin 2's first seizure was a generalized tonic-clonic
seizure and in the 10 months that followed, she was
inadequately treated with various drugs and con-
sequently she had a number of generalized tonic-
clonic seizures as well as many classical absence at-
tacks. At the end of this time, Twin 1 spontaneously
began to have generalized tonic-clonic and absence
seizures, and the parents sought help from a special-
ized medical facility where the girls had similar drug
treatments with better seizure control. Nevertheless,
Twin 2 continued to have occasional generalized
tonic-clonic seizures while Twin 1 had only rare
tonic-clonic seizures. At the age of 19 years when
they were examined neuropsychologically, Twin 2
had experienced a lifetime total of exactly 37 tonic-
clonic seizures and Twin 1 a lifetime total of only
seven tonic-clonic seizures. Neither twin had expe-
rienced status epilepticus at any time.
The neuropsychological testing results on the
twins are presented in Table 1. Twin 1 was below av-
erage intellectually, somewhat behind academically,
and she demonstrated mild but definite generalized
impairment in brain functions. However, Twin 2 per-
formed more poorly on all tests than Twin 1, was
intellectually within the mildly retarded range, and
had 100% of her scores on the neuropsychological
test battery outside normal limits. Cognitive (and af-
fective) differences were obvious between the twins
which the parents insisted were not present before
their seizures started. The data provided 'suggestive
evidence' (Dodrill and Troupin, 1976, p. 607) of the
adverse effects of single tonic-clonic seizures upon
mental abilities.
Dikmen and Matthews (1977) studied the ques-
tion of seizure frequency with regard to generalized
tonic-clonic attacks in 72 patients. Patients were
 401

TABLE 1 in lifetime (average of 2 0 0 - 3 0 0 ) but no status; or (4)

Comparison of Twins 1 and 2 at the age of 19 years on various at least one episode of G T C status regardless of the
neuropsychological measures (Dodrill and Troupin, 1976) total number of individual GTCs experienced in life-
time (about 40 on average not counting the episodes
Test/variable Twin 1 Twin 2
of status). The complete WAIS was administered to
Wechsler Adult Intelligence Scale all patients as well as an expanded H a l s t e a d - R e i t a n
Verbal IQ 92 68
Performance 1Q 81 64 neuropsychological battery. Statistically significant
Full scale IQ 86 64 differences ( P < 0.001) were found on all IQ scores
and on the summary neuropsychological measures
Wide Range Achievement Test
Reading, grade equivalent 7.5 5.4 as well as on many subtest scores. Representative
Spelling, grade equivalent 7.0 4.0 findings are presented in Fig. 1.
Arithmetic, grade equivalent 6.5 2.3 A review of Fig. 1 reveals that there are no im-
Expanded Halstead-Reitan Neuropsychological Batter), portant differences in abilities with lifetime histories
Category Test (errors) 96 98 of fewer than 100 GTCs without a history of sta-
Tactual Performance Test tus. However, either a greater lifetime number of
Total time (min/block) 0.6 9.0 GTCs or a history of status epilepticus is associ-
Memory (number remembered) 6 5
Localization (number localized) 4 2 ated with diminished cognitive capacity. W h i l e this
Seashore Rhythm (number correct) 23 17 fundamental conclusion is consistent with clinical
Speech-sounds Perception (errors) 7 14 experience, attention must be drawn to the fact that
Finger Tapping, pref. (taps/10 s) 42 31 this is a cross-sectional study and that cohort factors
Halstead Impairment Index 0.71 1.0
are likely contaminated with the cognitive findings.
The result m a y be an overstatement of seizure effects

classified as having low, moderate, or high seizure

frequencies " . . . in consecutive time periods over (.3
Z b.I
the span of the disorder" (p. 22). The final index
of seizure frequency consisted of the average of -3
,,~
nr L)
O3
m o -3
the ranks. By this method, a relative rather than n,- 11~ -3
w w
an absolute estimate of lifetime generalized t o n i c - o_ u_
t06 - 106
clonic seizure frequency was made. Results showed
that higher seizure frequencies were associated with 104- 104
lower scores on the WAIS and on some but not all
102 - '102
measures from the H a l s t e a d - R e i t a n Neuropsycho- 03
logical Test Battery. The differences were of mod- I00- 100
erate magnitude and achieved statistical significance o
u~ 98- 98
at the 0.01 level on only two of 14 variables (WAIS
FSIQ, Trail Making Test Part B). 0 96- 96
U')
Dodrill (1986) evaluated 310 adults with epilepsy
94- 94
in a comprehensive epilepsy center and intensively
studied their lifelong histories of generalized t o n i c - 92- 92
clonic seizures (GTCs). He found that with a high
90- °°°%°°°°°°°°°°°°. . . . . . . . . . . . . 90
level of confidence he could classify 94 of these pa-
tients (30%) into one of the following categories (the 88- 88
other patients had seizure histories which were too LIFETIME NUMBER, GENERALIZED
TONIC-CLONIC SEIZURES
uncertain to permit confident classification): (1) 2 - ::>-10 . . . . . . . I 1 - 1 0 0 .... >100 . . . . . . STATUS
10 GTCs in lifetime (average of about 4) but no form Fig. l. Comparison of patients grouped by lifetime numbers of
of status epilepticus; (2) 11-100 GTCs in lifetime generalized tonic-clonic seizures on the Wechsler Adult Intelli-
(average of about 30) but no status; (3) > 100 GTCs gence Scale.
402
despite the extensive efforts made not to do so in the
study report.
Trimble (1988) reported on a study of 40 long
term residents at the Chalfont Centre in the UK.
Using psychological testing, an estimate was made
of premorbid IQ, and when this was contrasted with
IQ at the time of the study, it was determined that 21
of the 40 cases had lost more than 15 IQ points. De-
teriorating cases had more generalized tonic-clonic
seizures than non-deteriorating cases, had required
medical attention more frequently for head injury,
and were more commonly taking phenytoin and
phenobarbital. All these factors were thought to be
important. There were no differences on other EEG,
seizure history, and medication variables. The sub-
jects in this study apparently heavily overlapped
those in the study of Thompson et al. (1987) and
therefore that study will not be discussed indepen-
dently.
Helmstaedter and Elger (1999) studied 63 left
mesial temporal lobe epilepsy patients and compared
them with 125 matched healthy control persons. Al-
though the study was cross-sectional in nature, the
investigators showed that the two groups demon-
strated the same fundamental pattern of vocabulary
increasing with age but with verbal learning and
memory decreasing with age. They concluded that
there was no accelerated deterioration of memory
due to a progression of the disease.
Jokeit and Ebner (1999) evaluated 209 patients
for epilepsy surgery and divided them up by dura-
tion of habitual seizures. Using the German form of
the WAIS-R, they discovered in this cross-sectional
study that longer durations of seizures were asso-
ciated with diminished intelligence. Age, at onset
of seizures, and other variables differed remarkably
across the groups and complicated interpretation. In-
dividuals with higher educational attainment were
apparently brighter at the outset and typically had
epilepsy longer before falling below the normal
range in terms of FSIQ. However, the better ed-
ucated persons in the successively longer seizure
duration groups diminished intellectually as much as
did the less educated groups, but perhaps not quite
as rapidly. The authors concluded that uncontrolled
temporal lobe epilepsy gradually exacts a cognitive
toll if not brought under control.
Jokeit et al. (2000) evaluated 37 patients with re-
fractory complex partial seizures with a measure of
long-standing intellectual functioning (MWT-B) and
compared results with the FSIQ from the German
version of the WAIS-R. They found that the FSIQ on
the WAIS-R was significantly lower (90.8) than the
MWT-B (102) which suggested that an intellectual
loss had occurred. In addition, they discovered a sig-
nificant negative correlation (r = -0.37, P = 0.012)
between the difference between the WAIS-R and the
MWT-B and the duration of epilepsy.
Longitudinal studies
Arieff and Yacorzynski (1942), using the 1916 and
1937 forms of the Stanford-Binet Intelligence Scale,
found that over a 1-9-year period, adolescents and
adults deteriorated much more (an average loss of 6
IQ points) if they had a clearly identifiable cause of
their epilepsy than if they did not have such a cause
(average gain of 0.7 IQ points). This study is of
value today by drawing our attention to the fact that
intellectual deterioration cannot be expected to be
the same in all groups of people with epilepsy. The
study included no information on seizure frequency
between testings.
Rodin (1968) reported data on 56 adolescents
and adults who had been tested using (apparently)
the Wechsler-Bellevue Intelligence Scale on two
occasions at least 5 years apart and 7 years apart
on average. At follow-up, 60% of patients who had
been seizure free for 2 years or more had an increase
in their Full Scale IQ scores. In contrast, 25% of
patients who were improved in seizure frequency
but not seizure-free had increased Full Scale IQ
scores, and only 15% of patients whose seizure
frequency was the same or worse had improved
IQ scores. Overall, changes in seizure frequency
were significantly correlated with changes in Full
Scale IQ scores (r = 0.33, P < 0.02). This study is
important because it was among the first to provide
a longitudinal design with actual testing of mental
abilities at the beginning and at the end of the study.
Types of seizures experienced during the study were
not clearly distinguished and the follow-up interval
was somewhat variable, but the work is nevertheless
an important one.
Seidenberg et al. (1981) used the WAIS to eval-
uate adults with epilepsy on two occasions approx-

imately 18 months apart. One group consisted of
22 patients who had improvement in their seizure
frequencies over the interval, while a second group
of 25 persons had essentially the same seizure fre-
quency or got worse. The group with improved
seizures had an improved VIQ of 3 points, an im-
proved PIQ of 10 points, and an improved FSIQ of
7 points. Changes in the seizure-unimproved group
were - 1 , +4, and +1 IQ points, respectively. The
authors concluded that changes in scores on the
WAIS are related to changes in seizure frequency.
This investigation also shows that practice effects
must be taken into account in evaluating the results
of studies of this type; a failure to gain with retest
may in fact constitute a loss, or at least an inability
to keep up with other people.
Kalska (1991) evaluated 69 adults with epilepsy
on two occasions approximately 10 years apart.
These patients had various epilepsy diagnoses and
were originally part of a group of 161 persons who
had participated in a vocational rehabilitation pro-
gram in Helsinki. The patients were extensively de-
scribed. Administered at the beginning and at the end
of the study were the Wechsler Adult Intelligence
Scale (WAIS) and several other neuropsychological
tests. Intellectually, 67% of the cases did not change
on the typical test variable (performances within one
standard deviation) while improvement was noted in
25% and deterioration in 8%. Similar results were
found on other types of variables except for memory
where losses were often found in 15-20% of the
cases. The seizure frequency of patients who lost
abilities was difficult to determine.
Dodrill and Wilensky (1992) administered the
WAIS and the Neuropsychological Battery for
Epilepsy to 36 adults on two occasions 5 years apart.
The patients had experienced very few seizures be-
tween the testings and had been selected because
they had been on exactly the same drug regimens
throughout the 5-year period. No changes were
found on the tests beyond that expected on the
basis of chance and practice effects. In particular, no
losses in mental abilities were noted.
Selwa et al. (1994) evaluated 28 adults with tem-
poral lobe epilepsy on two occasions averaging 2.3
years apart. Typically, the second evaluation was
requested due to patient complaints of memory dys-
function. Nevertheless, no changes were found from
403
the first testing to the second on the WAIS-R or the
Wechsler Memory Scale (Form I) beyond those that
would be expected with normal adults.
Holmes et al. (1998) studied 35 adults with in-
tractable partial seizures over a 10-year period and
administered an extensive battery of neuropsycho-
logical tests at the beginning and the end of that pe-
riod along with waking and sleep EEGs. The EEGs
were quite similar over the 10-year period, although,
in two cases, epileptiform patterns which were orig-
inally unilateral became bilateral by the end of the
study. Also, during the course of the study, two
patients who had never before experienced GTCs
began to have them. On the WAIS-R, the Perfor-
mance IQ was slightly increased upon retesting,
likely due to practice or retest effects which can be
found on the Wechsler scales even after several years
(Dodrill, 1983). Of 17 neuropsychological variables
from the Neuropsychological Battery for Epilepsy,
it was noted that average scores were statistically
significantly (P < 0.05) worse on six. Diminished
scores were found in the areas of visual memory,
attention, psychomotor problem solving, and percep-
tual functioning.
Aikia and Kalviainen (1999) followed 58 new
cases with epilepsy for 5 years and performed neu-
ropsychological testing at the beginning and at the
end of the study. All had partial seizures and all
were well-controlled during the 5-year period with
only occasional seizures at worst. Neuropsychologi-
cal testing included the WAIS and a number of other
measures. Results showed slight improvement over
the 5 years on 12 of 24 test variables.
Helmstaedter et al. (2000) treated 47 adult tempo-
ral lobe epilepsy cases conservatively with medicine
only and performed initial and follow-up neuropsy-
chological testing an average of 56 months later
(range 2-10 years). They found no changes in verbal
memory over this period, but figural memory did
show a loss (P < 0.05).
Bjornaes et al. (2001) evaluated 17 adults with
refractory epilepsy with the WAIS on two occasions
an average of 6.0 years apart (SD 4.8). These people
were primarily individuals who were evaluated upon
entrance into a major epilepsy program for assistance
in dealing with their seizures and then at a later
point when being considered for epilepsy surgery.
On average, the IQ scores on the WAIS all improved
404

(VIQ 4 points, PIQ 8 points, FSIQ 6 points) with the
changes being statistically significant for PIQ ( P <
0.01) and FSIQ (P < 0.05). No losses in intelligence
were indicated, and the improvements were likely
the products of practice or retest effects.
One area outside the realm of epilepsy has of-
ten been thought to be relevant to the effects of
convulsions upon cognition. This is the use of elec-
troconvulsive therapy (ECT) for the treatment of
depression. The effects of this treatment upon mem-
ory have been studied on multiple occasions, and one
review nearly 20 years ago summarized 39 investi-
gations, many of which had longitudinal components
(Taylor et al., 1982). From this review and from
other more recent papers (Squire and Slater, 1983;
Hoch et al., 1994; Calev et al., 1995), it is evi-
dent that both memory and non-memory cognitive
functions are adversely impacted by ECT. However,
most of the cognitive concerns reportedly dissipate
over a few months in the typical case and lessened
depression counterbalances the cognitive losses to
some degree in terms of cognitive efficiency. Never-
theless, most investigators are unable to rule out the
possibility of very mild but persisting cognitive con-
sequences of ECT, especially in the area of memory.
Unfortunately, this overall finding does not assist us
substantively in providing new insights into the cog-
nitive effects of seizures; it is a finding which is not
greatly different than that commonly arising from
the study of epileptic seizures themselves.
Conclusions for literature review
The studies selected for review in this paper were
deliberately chosen to be the best available. In three
of these investigations (Lennox and Collins, 1945;
Dodrill and Wilensky, 1992; Aikia and Kalviainen,
1999), the patients being studied had so few seizures
that no changes in cognition could be expected, and
in each case no changes were found. The results
of the remaining 16 investigations are summarized
in Table 2. Taken together, in 12 of the 16, results
were reported which fundamentally supported the
conclusion of a loss in mental abilities due to an
accumulation of single seizures. These seizures were
routinely GTC by nature.
A further review of Table 2 reveals that there are
differences in outcome dependent upon study design.
In general, cross-sectional studies produced results
which were more strongly supportive of a relation-
ship between the occurrence of single seizures and
decline in mental abilities than longitudinal studies.

TABLE 2
Summary of selected studies of the relationships between accumulations of single seizures and adverse changes in mental abilities
Study type/investigators
Cross-sectional studies
Lennox and Lennox (1960)
Dodrill and Troupin (1976)
Dikmen and Matthews (1977)
Dodrill (1986)
Trimble (1988)
Helmstaedter and Elger (l 999)
Jokeit and Ebner (1999)
Jokeit et al. (2000)
Longitudinal studies
Arieff and Yacorzynski(1942)
Rodin (1968)
Seidenberg et al. (1981)
Kalska (199 I)
Selwa et al. (1994)
Holmes et al. (1998)
Helmstaedter et al. (2000)
Bjornaes et al. (2001)
Relationship between seizures and Comments
changes in mental abilities
Strong relationship found Ratings of abilities used
Strong relationship found Study of twins
Moderate relationship found Frequency of GTCs studied
Strong relationship found Lifetime number of GTCs
Mild relationship found Estimated premorbid IQ
No relationship found Normal changes in memory
Moderate relationship found Study of seizure duration
Mild relationship found Estimated premorbid IQ
Mild relationship found Approximately 5-year follow-up
Mild relationship found Approximately 7-year follow-up
Mild relationship found 1.5-year follow-up
No definite relationship found I 0-year follow-up
No relationship found 2.3-year follow-up
Mild relationship found 10-year follow-up
Mild relationship found 4.7-year follow-up
No relationship found 6.0-year follow-up

No doubt this is due to the fact that the effects con-
taminating factors (e.g., age at onset of seizures, du-
ration of seizure disorder, antiepileptic medications,
etc.) are likely to be included in the measurements of
the effects of seizures in cross-sectional research es-
pecially. Investigators using cross-sectional designs
have made extensive efforts to minimize these ef-
fects, but they are undoubtedly still present at least
to a slight degree and to that degree they do inflate
the apparent effects of seizures upon mental abilities.
The most accurate conclusions appear to arise
from the longitudinal investigations. Routinely, mild
relationships between GTC seizures and changes in
mental abilities are reported. In one of the studies
where this relationship was not found (Selwa et al.,
1994), the test-retest interval was quite short (2.3
years) and may not have allowed for the effects of
seizures to accumulate. Taken together, the best stud-
ies available today provide suggestive although not
truly conclusive evidence for losses in mental abili-
ties associated with the repeated appearance of single
seizures. It may, of course, be that concomitant con-
ditions such as the taking of AEDs may contribute to
the diminished scores as well.
Why cannot more definitive conclusions be
reached about the effects of single seizures upon cog-
nition? The reasons relate to the limitations of exist-
ing studies which prominently include the following:
(1) the common use of cross-sectional designs which
can never definitively answer the question at hand;
(2) the frequent omission of data on seizure type and
frequency during the test-retest interval in longitudi-
nal studies so that seizures cannot be tied to changes
in test scores; (3) the routine omission of a normal
control group in all types of studies so that it is not
possible to clearly describe how people with epilepsy
change over time differently than normals; and (4)
the use of test-retest intervals in longitudinal studies
which are too short to provide a reasonable estimate
of the effects of seizures over the lifetime of an adult.
In connection with this last point, probably 25 years
or longer is needed to accurately evaluate the effects
of seizures in humans, and the longest study that is
currently available in the world's literature utilized a
10-year follow-up period.
405
Original investigation
To help address the deficiencies in the field, the au-
thor assembled data which he had at hand which
were collected with the major assistance of a col-
league (Linda M. Ojemann, M.D., Neurologist).
These data have been unpublished heretofore. A
summary of these data is presented here. A group of
35 adults with active partial seizures with or without
secondary generalization was matched with a group
of 35 normal controls with no history of any type
of medical problem. The groups were highly similar
for age, sex, and education, and both groups were
evaluated with the Neuropsychological Battery for
Epilepsy (Dodrill, 1978) both initially and then after
10 years (-t-6 months). The test battery included the
complete WAIS and an expanded Halstead-Reitan
neuropsychological test battery. A total of 20 test
variables was obtained on each testing. Change
scores from the first to the follow-up testing were
compared across the two groups of subjects using
the Student t statistic applied to each test variable.
The epilepsy cases had detailed evaluations of
their seizure frequencies during the 10-year period
and many had been treated by us throughout the 10
years. The mean number of partial seizures (SPS
and CPS) recorded during that time was 1,109 (SD
2,512) and the median was 410. The mean number
of GTCs recorded during that time was 61 (SD 103)
and the median was 8. Four patients had experi-
enced GTC status epilepticus (30 rain of continuous
or repetitive seizures without the regaining of con-
sciousness) during the 10-year period.
Results on the neuropsychological battery showed
that relative to the epilepsy group, the normal group
had favorable and statistically significant changes in
test scores on the Stroop Test (reading of color
word names, P = 0.040), Trail Making Part A
(P = 0.043), and WAIS PIQ (normal group im-
proved 7 points, epilepsy group improved 3 points,
P = 0.005). There were no changes favoring the
epilepsy group over the normal group except for Fin-
ger Tapping where it appeared that an unusual set
of scores obtained by the normal group on initial
testing resulted in a change favoring the epilepsy
group (P = 0.012). Whereas both groups were only
approximately 30 years of age at the start of the
study, both actually lost visual memory (Wechsler
406
Memory Scale Form 1 Visual Reproduction) over
the next 10 years. Were not a normal control group
included which showed a loss ( P = 0.001), the loss
in the epilepsy group ( P = 0.014) might have been
misinterpreted as being due to seizures.
Because of non-normality in seizure frequencies,
the frequencies were converted to ranks prior to
analysis. Correlations of 10-year partial seizure to-
tals with changes on the 20 test score variables
in the epilepsy group did not render a single sta-
tistically significant Pearson correlation coefficient.
GTCs correlated with changes in test scores rendered
statistically significant relationships for Trail Making
Part B (r = - 0 . 4 8 , P = 0.028) and for WAIS FSIQ
(r = 0.44, P = 0.047) with adverse changes in test
scores being associated with increasing numbers of
convulsions. Although only four patients had def-
initely experienced generalized tonic-clonic status
epilepticus, it was of interest to note that this small
group suffered statistically significant losses in both
verbal memory (WMS-I Logical Memory, immedi-
ate: P = 0.018) and visual memory (WMS-I Visual
Reproduction, immediate: P = 0.037).
Taken together, the results of this study provide
evidence for inferring a mild but only a mild re-
lationship between changes in mental abilities and
GTCs, especially when they occur in clusters. No ev-
idence was found for relationships between changes
in mental abilities and partial seizures, but attention
is drawn to the fact that this study was only for a 10-
year period of time and that this period may not have
been long enough to evaluate the true effects of par-
tial seizures. Also, even though seizure counts were
done as accurately as possible, in many cases they
were estimates rather than precise counts and espe-
cially so for partial seizures. Thus, the full effects
of partial seizures may not have been appreciated in
this investigation.
Conclusions and recommendations
Based on all the information at hand, it is concluded
that losses in mental abilities do occur with an accu-
mulation of isolated GTCs. It is likely that the num-
ber that must accumulate varies from one patient to
the next and that cognitive deficits likely occur more
quickly in some patients than in others. The reason
for this is unknown. In many patients, it is believed
that there is evidence for some deficit when 100 con-
vulsive episodes have been experienced. There is a
general consensus that convulsive status epilepticus
produces at least some cognitive deficits. Although it
is possible that a very large number of seizures other
than generalized tonic-clonic attacks might eventu-
ally be associated with cognitive loss, there is no
clear evidence for this at the present time.
To more definitively answer the major questions
in the field in the future, the major limitations in ex-
isting studies will need to be addressed directly and
deliberately. In particular, longitudinal prospective
investigations are needed which include recording
the numbers of GTC and other seizures experienced
throughout the study. It is also of importance that
such studies include normal groups closely matched
with the epilepsy samples for age and education at
the beginning of the study. Finally, it is likely that
long study periods (at least 25 years) will be required
before the true cognitive effects of single seizures
in the lifetime of our patients can be adequately
assessed. While these investigations will certainly
prove to be laborious, their value to our patients will
be great, and it is essential that they be undertaken.
References
Aikia, M. and Kalviainen, R. (1999) Five-year follow-up of
cognitive performance of adult patients with well-controlled
partial epilepsy. Epilepsia, 40(Suppl. 2): 100-101.
Arieff, A.J. and Yacorzynski, G.K, (1942) Deterioration of pa-
tients with organic epilepsy. J. Nerv. Ment. Dis., 96: 49-55.
Bjornaes, H., Stabell, K., Henriksen, O. and Loyning, Y. (2001)
The effects of refractory epilepsy on intellectual functioning
in children and adults. A longitudinal study. Seizure, 10: 250-
259.
Calev, A., Gaudino, E.A., Squires, N.K., Zervas, I.M. and Fink,
M. (1995) ECT and non-memory cognition: a review. Br. J.
Clin. Psychol., 34: 505-515.
Dikmen, S. and Matthews, C.G. (1977) Effect of major mo-
tor seizure frequency upon cognitive-intellectual functions in
adults. Epilepsia, 18: 21-29.
Dodrill, C.B. (1978) A neuropsychological battery for epilepsy.
Epilepsia, 19: 611-623.
Dodrill, C.B. (1983) Long-term reliability of the Wonderlic Per-
sonnel Test. J. Consult. Clin. Psychol., 51: 316-317.
Dodrill, C.B. (1986) Correlates of generalized tonic-clonic
seizures with intellectual, neuropsychological, emotional, and
social function in patients with epilepsy. Epilepsia, 27: 399-
411.
Dodrill, C.B. and Matthews, C.G. (1992) The role of neuropsy-

chology in the assessment and treatment of persons with
epilepsy. Am. Psychol., 47:1139-1142.
Dodrill, C.B~ and Troupin, A.S. (1976) Seizures and adaptive
abilities: a case of identical twins. Arch. Neurol., 33: 604-607.
Dodrill, C.B. and Wilensky, A.J. (1992) Neuropsychological
abilities before and after 5 years of stable antiepileptic drug
therapy. Epilepsia, 33: 327-334.
Helmstaedter, C. and Elger, C.E. (1999) The phantom of pro-
gressive dementia in epilepsy. Lancet, 354: 2133-2134.
Helmstaedter, C., Kurthen, M., Lux, S., Johanson, K., Quiske,
A., Schramm, J. and Elger, C.E. (2000) Temporal lobe
epilepsy: longitudinal clinical, neuropsychological and psy-
chosocial follow-up of surgically and conservatively managed
patients (in German). Nervenarzt, 71(63): 629-642.
Hoch, D.B., Hill, R.A. and Oas, K.H. (1994) Epilepsy and
mental decline. Neurol. Clin., 12: 101-113.
Holmes, M.D., Dodrill, C.B., Wilkus, R.J., Ojemann, L.M. and
Ojemann, G.A. (1998) Is partial epilepsy progressive? Ten-
year follow-up of EEG and neuropsychological changes in
adults with partial seizures. Epilepsia, 39:1189-1193.
Jokeit, H. and Ebner, A. (1999) Long-term effects of refractory
temporal lobe epilepsy on cognitive abilities: a cross-sectional
study. J. Neurol. Neurosurg. Psychiatry, 67: 44-50.
Jokeit, H., Luerding, R. and Ebner, A. (2000) Cognitive impair-
ment in temporal-lobe epilepsy. Lancet, 355: 1018-1019.
Kalska, H. (1991) Cognitive changes in epilepsy: a ten-year
follow-up. Commentationes Scientiarum Socialium, 44, Soci-
etas Scientiarum Fennica, Helsinki, pp. 1-85.
Lennox, W.G. and Collins, A.L. (1945) Intelligence of normal
and epileptic twins. Am. J. Psychiatry, 101: 764.
407
Lennox, W.G. and Lennox, M.A. (1960) Epilepsy and Related
Disorders. Little, Brown, Boston.
Rodin, E.A. (1968) The Prognosis of Patients with Epilepsy.
Charles C. Thomas, Springfield, IL.
Seidenberg, M., O'Leary, D.S., Berent, S. and Boll, T. (1981)
Changes in seizure frequency and test-retest scores on the
Wechsler Adult Intelligence Scale. Epilepsia, 22: 75-83.
Selwa, L.M., Berent, S., Giordani, B., Henry, T.R., Buchtel, H.A.
and Ross, D.A. (1994) Serial cognitive testing in temporal
lobe epilepsy: longitudinal changes with medical and surgical
therapies. Epilepsia, 35: 743-749.
Squire, L.R. and Slater, P.C. (1983) Electroconvulsive therapy
and complaints of memory dysfunction: a prospective three-
year follow-up study. Br. J. Psychiatry, 142: 1-8.
Strauss, E., Loring, D., Chelune, G., Hunter, M., Bermann, B.,
Perrine, K., Westerveld, M., Trenerry, M. and Barr, W. (1995)
Predicting cognitive impairment in epilepsy: findings from the
Bozeman Epilepsy Consortium. J. Clin. Exp. Neuropsychol.,
17: 909-917.
Taylor, J.R., Tompkins, R., Demers, R. and Anderson, D. (1982)
Electroconvulsive therapy and memory dysfunction: is there
evidence for prolonged defects?. Biol. Psychiatry, 17: 1169-
1193.
Thompson, P.J., Sander, J.W.A.S. and Oxley, J. (1987) Intellec-
tual deterioration in severe epilepsy. In: P. Wolf, M. Dana, D.
Janz and F.E. Dreifuss (Eds.), Advances in Epileptology, Vol.
16, Raven Press, pp. 611-614.
Trimble, M.R. (1988) Cognitive hazards of seizure disorders.
Epilepsia, 29(Suppl. 1): S19-$24.
T. Sutula and A. Pitk~inen (Eds.)
Progressin Brain Research,Vol, 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 36

Progressive cognitive decline in epilepsy: an indication of

ongoing plasticity

H. Stefan * and E. Pauli

Department of Neurology, Epilepsy-Center University Erlangen-Niirnberg, Schwabachanlage 6, 91054 Erlangen, Germany

Abstract: In addition to the identification of epileptic syndromes associated with cognitive decline, the influence of
suppression of secondarily generalized seizures on IQ is reviewed. Our own data concerning cognitive function in temporal
lobe epilepsy show a decrease of IQ and verbal memory with long duration of epilepsy and frequent tonic-clonic seizures,
but not with simple or complex partial seizures. The use of a 'nucleus shell structure model' may be helpful to visualize the
dynamic changes ('running up') in seizure structures in the long-term course of epilepsies. In addition to the localization
and extent of structural changes, functional monitoring of cognition and pathology of MR spectroscopy is now available
for long-term studies in progressive epileptic disorders. Concepts for memory storage and consolidation and mechanisms
of plasticity concerning epileptic activity as well as modification of long-term potentiation for plasticity with regard to
memory functions are also discussed.

Introduction associated with possible cognitive decline (Bour-

Epilepsies are dynamic disorders. Changes in cogni-
tion and the development of memory problems are
not infrequently reported. In the first step of this
study, the aim was to find out if cognitive decline
can be observed during the course of the illness and
in which epileptic syndromes this could be observed.
A second step was performed to find out whether
cognitive decline is due to a progressive epileptic
disorder. The last step concerns a possible relation-
ship between cognitive decline and plasticity from a
clinical point of view.
Cognitive decline in epileptic syndromes
Clinical observations during the course of epilep-
sies show that there are distinct epileptic syndromes
*Correspondence to: H. Stefan, Department of Neu-
rology, Epilepsy-Center University Erlangen-Niirnberg,
Schwabachanlage 6, 91054 Erlangen, Germany. Tel.:
+49-9131-853-4541; Fax: +49-9131-853-6469;
E-mail: hermann.stefan @neuro.med.uni-erlangen.de
geois et al., 1983; Farwell et al., 1985; Rodin et al.,
1986; Neyens et al., 1999). Syndromes with ongo-
ing cognitive declines are: continuous spike-wave
during slow-wave sleep syndrome, Sturge-Weber
syndrome, Rasmussen encephalitis, temporal lobe
epilepsies and different metabolic or genetic syn-
dromes (e.g. progressive myoclonic epilepsies etc.).
In temporal lobe epilepsies, different subtypes and
various causes of possible cognitive decline have to
be considered. Possible causes for cognitive decline
include lesions or encephalopathies, neural epileptic
or glial disturbances, exotoxic effects or environ-
mental or reactive psychological mechanisms (Man-
delbaum and Barack, 1997). In these syndromes, the
cognitive decline may be at least partially reversible
due to several facts. One interesting observation is
that an improvement of cognitive function can be
obtained by antiepileptic drug treatment (benzodi-
azepines and steroids) in patients with continuous
spike-waves during slow-wave sleep (Chiron and
Dulac, 2001). In the case of Sturge-Weber syn-
drome, there are hints that preventional treatment,
even in cases without seizures, decreases incidence
410
Total IQ (HAWlE-R) dependent on frequency
of tonic clonic seizures and duration of epilepsy
130 '~ , ,
120 •
110
100,
O
90 " ',
80"
70"
60"
50 "
N= 64 12
< 27 y e a r s
Duration of epilepsy
Fig. 1. The contributionof duration of epilepsy and tonic-clonic (TC) seizurefrequencyfor cognitivedecline.
of mental retardation (Chiron et al., 2000; Ville
et al., 2001). An improvement of mental functions
can be obtained by hemispherectomy in Rasmussen
encephalitis. A disconnection can stop the disease
(Vining et al., 1997). Because there may be the
risk that the contralateral hemisphere becomes func-
tionally impaired in partial epilepsies with cortical
malformations. Other clinical observations concern
status epilepticus, which may cause severe cognitive
decline. A remission of seizures and the prediction
of intractability in long-term follow-up is discussed
by Sillanpaa (1993). ACTH reverses encephalopathic
disorders in progressive myoclonic epilepsies (Tassi-
nari et al., 1992).
The age at onset and seizure frequencies may
correlate with poor outcome in specific syndromes
(Bergmann et al., 1983). An example was given by
Bulteau et al. (2000) demonstrating that IQ decreased
with the duration of epilepsy in cryptogenic and
symptomatic generalized epilepsies. By preventing
the secondary generalization in symptomatic epilep-
sies (e.g. tuberous sclerosis) the outcome (IQ) could
TC frequency
1 <10peryear
> 10 per year
20 6
> 27 y e a r s
be improved. This leads to the requirement that
neuropsychological examinations are very important
parts of the initial evaluation of patients with epilepsy
in the course of their illness. Dodrill (2002, this
volume) reported that repeated generalized tonic-
clonic seizures and status epilepticus were associ-
ated with decreased intellectual, neuropsychological,
emotional and psychosocial function in epilepsy. Our
results confirm these observations showing that long-
lasting focal epilepsies in combination with a high
frequency (> 10/year) of tonic-clonic seizures leads
to a cognitive deterioration (Fig. 1).
Concepts of memory storage and consolidation
In temporal lobe epilepsies, ipsi- and contralateral
involvement of the functional disorders also have
to be considered in addition to mesial and lateral
compartments. Precise data on the amount of cog-
nitive decline in temporal lobe epilepsies are not
available. The consolidation processes for memory
are of interest with regard to a possible cognitive
 411

Left Temporal Lobe Epilepsy:

Verbal memory dependent on duration and TC frequency
2,5"t
2,0
1,5 . . . . . . . . . .

- - o(~.~__ . . . . . . . . . . .

O 1,0 ,
O
,5
N
v
0,0 , m imln- m mmlllll- ~ II ~ m INI~. II U I I mm

o %5
E
-1,0 ,
E ........
-1,5 i TC frequency
.£3 .......................... I
-2,0
> m < 10 per year
-2,5
-3,0 > 10 per year
193
-3,5 m

N= 38 5 lo 4

< 27 years > 27 years

Duration of epilepsy
Fig. 2. Verbal memory is increasingly impaired with duration of epilepsy and frequency of TC seizures.

decline. Consolidation processes for episodic mem- connects the cortical from the hippocampal system.
ory are strictly dependent on the mesial temporal Basic mechanisms for the transformation of short-
lobe structures. The lateral temporal neocortex is im- term into long-term changes by learning mediated
portant for language and acoustic processing. Squire neuronal plasticity are discussed by Cole (2000). In
and Alvarez (1995) discuss slower neocortical con- this study, patients with left temporal lobe epilepsy
solidation mediated by synchronous hippocampal- showed accelerated long-term memory loss. When
neocortical interaction. A survey of the literature on interpreting long-term memory loss, several facts
cognitive decline associated with epilepsy is pro- have to be considered: non-specific parameters (age,
vided by Dodrill (2002, this volume). Our own data seizure frequency, medication, structural damage),
show a decline in verbal memory functions depen- memory deficits secondary to other cognitive defects
dent on duration of epilepsy and frequency of tonic- (Mayeux et al., 1980) or even negative mood (Cor-
clonic seizures (Fig. 2). This does not hold true for coran and Thompson, 1992). It is of interest, that
complex partial seizures in our series. In addition to in the case of unilateral focal epilepsies, impaired
consolidation, a further interesting aspect is acceler- or erroneous perception can occur over the sensoric
ated memory loss in patients with epilepsy (Blake et region ipsi- and contralaterally (Knecht et al., 1996).
al., 2000). A possible interpretation of the long-term Single spikes are likely to disturb working mem-
memory loss could be that a fast hipppocampal based ory processes in the case of mesial temporal spike
learning system may be intact at the beginning of the activity (Kraus et al., 1997).
manifestation of the epileptic event. Epileptic activ- Of course, one must consider that distinct tempo-
ity degrades the process of synchronous activation ral lobe epilepsies may have a progressive character.
of neocortical self-assemblies or functionally dis- A typical cause of mesial temporal lobe epilepsy
412
may occur as follows: a provoking event in infancy
(e.g. febrile convulsion) occurs and is followed by a
'silent period' of several years. Finally, often during
or after puberty, in adolescence or adulthood, mesial
temporal lobe epilepsy occurs. Basic mechanisms
which are discussed in the epileptic genesis of such
temporal lobe epilepsies include loss of neuronal
cells in the hippocampal area followed by mossy-
fiber sprouting, synaptic reorganization (Sutula et
al., 1989; Babb et al., 1991) and the mechanism
where N-methyl D-aspartate (NMDA)-mediated de-
polarization facilitates glutamate effects at dendritic
spines (Isokawa and Levesque, 1991). Findings in
patients show striking similarities to those in animal
models, which means that the same key elements
of a signal transduction process may exist in hu-
mans. The extent of the neuronal loss and sclerosis
may be expressed as uni- or bilateral dysfunctions
of memory (Sass et al., 1990). Uncontrolled seizures
may lead to dysfunction involving other areas of
the brain (Girvin, 1992). Verbal memory impairment
is attributable to hippocampal neuron loss in CA3
and the hilar area in left temporal lobe epilepsy
(not in the neocortex) (Sass et al., 1992). If addi-
tional secondary generalized tonic-clonic seizures
occur, then CA4 also shows additional neuronal loss
in addition to hippocampal sclerosis (Meencke et
al., 1996). The question arises whether hippocampal
sclerosis is a developmental disorder which exists
a priori in the patients. The next question is if
the so-called 'silent period' really is silent or if
mechanisms of plasticity might be active, leading
later to the manifestation of seizures and epilep-
sies. If secondary generalized tonic-clonic seizures
in this phase of the illness occur, then additional
CA4 neuronal loss may cause additional sprouting
and induce further mechanism of plasticity. This
could lead to progressing memory decline. Such
changes of memory can be correlated with struc-
tural findings (MRI volumetry). An overview was
provided by Chelune (1995) and Duncan (2002, this
volume).
Progression of seizure disorders
What does clinical experience tell us concerning the
progression of seizure disorders?
In the next step, the progression of epilepsies
shall be discussed with special regard to its clini-
cal evidence. The progression of epileptic disorders
is not proved in all types of seizures, but possi-
bly, as for some subtypes of temporal lobe epilepsy
(TLE), where in some cases a so-called 'running
up' with respect to the increase in seizure frequency
is noticeable. Special syndromes have already been
discussed earlier. Now the question arises of how
epileptic activity (seizure frequency or seizure struc-
ture; nucleus shell, structure model) correlates to
progression. Therefore, a view to neurobiological
changes at the mature and developmental brain and
progressive lesions as well as to treatment including
associated functional deficit is necessary. According
to the experience of Annegers et al. (1979), many
patients have a remission. Shorvon and Reynolds
(1982) stated that the medium number of tonic-
clonic seizures has no influence on remission. Cam-
field et al. (1993) concluded that children with less
than 10 seizures prior to treatment were likely to
have remission and more likely to have complex par-
tial seizures only. Other publications stated, that not
the frequency, but the type of seizures determine the
prognosis (Cockerell et al., 1995a,b). Patients with
long-lasting secondary generalized seizure disorders
showed a decrease of intellectual function (Trim-
ble, 1988; Jokeit and Markowitsch, 1999). A further
important aspect of progression is secondary epilep-
togenesis. Morrell (1985) described mirror foci in
patients with intractable focal epilepsies. The re-
versibility of contralateral mirror foci was discussed
in relation to the duration of epilepsies. An increase
of involved brain areas with increased duration of
epilepsy was shown by means of EEG analysis
(Hughes et al., 1961). Bi-temporal spikes as a sign
of the progressive nature of epilepsy were also dis-
cussed by Gupta et al., 1993). There has been a
controversial discussion concerning the relationship
between the duration of epilepsy and possible sec-
ondary epileptogenesis. Morrell (1985) postulated
such a relation, while Gilmore et al. (1994) dis-
counted the idea. The role of secondary epilepto-
genesis in humans was questioned by Goldensohn
(1984) and Holmes et al. (1998). The presence of
contralateral hippocampal sclerosis was not related
to the decrease of neuronal density in CA4. Only
the occurrence of tonic-clonic seizures determined
the occurrence of CA4 neuronal loss (Meencke et

all, 1996). Spanedda et al. (1997) observed, that con-
tralateral seizure spread correlates with atrophy in
the target regions of the spread. Long-term follow-up
EEG investigations during the course of epilepsies
showed that there was no marked change over years.
For the discussion of progression and secondary
epileptogenesis one has to consider that even in
kindling different stages (e.g. epileptogenesis versus
fully manifested seizure) may have different under-
lying neuronal mechanisms and different phases of
excitability. This means that studies of each phase of
an illness in the course of its evolution is necessary.
Each phase of the illness may have its own respon-
sivity, so different treatments (pharmacotherapies)
may be required (Postma et al., 2000).
In order to analyze the phases of ictal activity
during one epileptic seizure a simple model can
be used. The temporal course of the seizure semi-
ology in such a model is used to identify seizure
signs (initial signs indicating the nucleus of seizure
activity) and clusters of following ictal signs indicat-
ing shells due to propagation in different functional
systems of the brains. For example in the case of
temporal lobe epilepsy, the initial ictal sign may
be an epigastric aura (simple partial seizure; nu-
cleus of seizure structure close to temporal focus).
The next ictal signs can be stare gaze, oral automa-
tisms or clouding of consciousness (complex partial
seizure; first shell of seizure structure due to prop-
agation in temporal lobes) and another ictal sign
complex can be tonic-clonic symptoms with un-
consciousness (tonic-clonic seizure; second shell of
seizure structure due to generalization during prop-
agation). The nucleus shell model can be used for
a concise description of changes in seizure semi-
ology in the course of epilepsies and especially
during treatment (Stefan, 1998). A typical example
shows a running down phenomenon after surgery
for epilepsy, with a transition of the remaining
seizures from the nucleus shell structure to a lower
shell (e.g. nucleus = aura). In a selected seizure
group of patients with pharmacoresistant temporal
lobe epilepsies, patients with simple partial seizures
evolving to complex partial seizures but without fol-
lowing secondary generalized tonic-clonic seizures
(only nucleus and first shell) showed a tendency
towards increased seizure frequency (runnung up).
The time interval of at least a 6-year follow-
413
up period before epilepsy surgery was analyzed
(Schmidt and Stefan, 2001, unpublished, Fig. 3).
Indication of plasticity
An extensive discussion about epilepsy and plasticity
is provided by Stefan et al. (2000). In the discussion
of the topic of plasticity, one has to differentiate
between reorganization in homologous ipsi- or con-
tralateral regions of the brain and synaptic activations
(long-term potentiation). Factors influencing reorga-
nization are: (a) the maturity of the brain at the time
of injury, and (b) locus and extent of brain dam-
age and bilaterality. Are the cognitive functions in
question dependent on hippocampal function and the
role of epileptic activity or medication? In the case
of temporal lobe dysfunction, contra- or ipsilateral
shifts to other cortical or subcortical regions may
occur (Gadian et al., 1999). Examples are, for exam-
ple, brain adjustment for language (Rasmussen and
Milner, 1977; Pauli et al., 1999). In cases of early
acquired epileptic lesions, shifts of speech domi-
nance to the right temporal lobe are described. In
the case of early acquired left temporal lobe lesions,
we have observed shifts of the verbal memory to
the right temporal lobe without a shift of language
dominance. A very important topic is the role of
synaptic plasticity in memory processing. High fre-
quency stimulation induces LTP analogous to long-
lasting memory (Bliss and Collingridge, 1993). The
activation of NMDA receptors increase postsynap-
tic Ca 2+ concentrations in the hippocampal region,
which may lead to long-term potentiation. Synaptic
potentiation can be induced in human hippocam-
pal synapses. In the hippocampal epileptic seizure
focus (hippocampus), reduced synaptic potentiation
capacity resulting in impaired information process-
ing was demonstrated (Beck et al., 2000). Outside
the seizure focus, the LTP has the same effect as
in controls. Beck et al. (2000) showed that activity-
dependent synaptic plasticity is available for infor-
mation storage in the human hippocampus. Because
both verbal memory processes and synaptic plastic-
ity are impaired by a hippocampal seizure focus,
they suggest that impaired synaptic plasticity may
contribute to a deficient declarative memory in hu-
man temporal lobe epilepsy. LTP is an expression of
neuronal plasticity which has been correlated with
414

RUNNING UP
average seizure frequency
SP(=nucleus) evolving to CP(=first shell)

c- 8,
t-
O
E 6}
51
g 4~
g 31
* SPS
t~ 2~ + CPS
>
< SPS+CP
O~ q '+ ' ' ~ I
c- r'-' ¢- ¢- c- a'- ¢- t- ¢-
O O O O O O O
0 0 0 0 0 ~. 0 0 0
O. 0.. O. O- O_ O. 0.. O.

preoperative epochs postoperative

surgery
Fig. 3. Preoperative'running up' phenomenonof seizures with nucleus (simplepartial) evolvesto first shell (complexpartial seizures).

learning. According to Moore et al. (1993), seizure-
like activity disrupts LTP in vitro. The blocking of
NMDA receptors causes special learning deficits and
prevents LTP induction (Bannermann et al., 1995).
Hippocampal NMDA receptors are necessary for
repetition/recognition effects of limbic event related
N 400 potentials (Grunwald et al., 1999). The sub-
strate of memory - - the cortical engram - - is a
widely distributed group of neurons, predominantly
located in the inferior temporal cortex and operat-
ing with plastic HEBB-like synapses (Merzenich and
Sameshima, 1993). For possible therapeutic strate-
gies influencing plasticity in epilepsies, the observa-
tion made by Bach et al. (1999) is of interest. They
describe agents enhancing cAMP signaling, and LTP
leading to reversibility of memory defects. The ques-
tion arises whether this could be a treatment option
for impaired plasticity and memory deficit?
Summarizing the knowledge on possible indica-
tions of ongoing plasticity, one could state, that brief
episodes of neuronal dysfunction could perhaps be
converted into long-term functional changes. The re-
sults of molecular-biological changes and network
reorganization indicate possible mechanisms of plas-
ticity in temporal lobe epilepsies.
The clinical available data - - though providing
anecdotic hints - - are not yet sufficient to prove
the theoretical concepts that small seizures (e.g. SP,
CP) beget seizures. An important aspect for clini-
cal investigations with regard to cognitive function
in epilepsies is the influence of histopathological
changes and their correlation to memory. Verbal
memory impairment correlates with hippocampal
pyramidal cell density (Sass et al., 1990). Dis-
cussing the neural-psychological symptom complex
of mesial temporal lobe epilepsy (MTLE), Hermann
et al. (1997) stated that memory correlates with hip-
pocampal pathology in a grading system. In addition,
distinctive subgroups of histological changes in tem-
poral lobe epilepsy were differentiated by Goos et
al. (2000). Two groups are differentiated: one (clas-
sical MTLE) with neuronal loss in CA1; CA3 and

C A 4 sparing C A 2 a n d several gliosis and granular
cell dispersion; a n d a s e c o n d with o n l y moderate to
severe n e u r o n a l loss in C A 1 - C A 4 .
T h e superposition of the d a m a g e caused by sepa-
rate events m a k e s it difficult to differentiate the indi-
vidual courses of pathologies in the possible cascade
of a progressive disorder like T L E . The correlation of
temporal lobe pathology and its relation to cognitive
i m p a i r m e n t requires a c l i n i c a l - n e u r o b i o l o g i c a l view.
The c o m b i n a t i o n of high resolution M R I techniques
and n e u r o p s y c h o l o g i c a l m e a s u r e s are an innovative
approach to investigating b r a i n - b e h a v i o r relations
and issues of plasticity. High resolution M R spec-
troscopy in particular permits increased sensitivity
for the detection of h i p p o c a m p a l pathologies in tem-
poral lobe epilepsies ( G a d i a n et al,, 1999; Stefan
et al., 2000; Pauli et al., 2000). M R spectroscopy,
n e u r o p s y c h o l o g i c a l findings a n d histopathological
findings have to be investigated in serial l o n g - t e r m
follow-up investigations in the future.
References
Annegers, J.E, Hauser, W.A. and Elveback, L.R. et al. (1979)
Remission of seizure and relapse in patients with epilepsy.
Epilepsia, 20(6): 729-737.
Babb, T.L., Kupfer, W.R., Pretorius, J.K., Crandall, RH. and
Levesque, M.E et al. (1991) Synaptic reorganization by mossy
fibers in human epileptic fascia dentata. Neuroscience, 42(2):
351-363.
Bach, M.E., Barad, M., Son, H., Zhou, M., Lu, Y.E and Shih,
R. et al. (1999) Age-related defects in spatial memory are
correlated with defects in the late phase of hippocampal long-
term potentiation in vitro and are attenuated by drugs that
enhance the cAMP signaling pathway. Proc. Natl. Acad. Sci.
USA, 96(9): 5280-5285.
Bannermann, M.E., Good, M.A., Butcher, S.P., Ramsay, M.
and Morris, R.G.M. et al. (1995) Distinct components of
spatial learning revealed by prior training and NMDA receptor
blockade. Nature, 378: 182-185.
Beck, H., Goussakov, I.V., Lie, A., Helmstaedter, C. and Elger,
C.E. (2000) Synaptic plasticity in the human dentate gyrus. J.
Neurosci., 20(18): 7078-7086.
Bergmann, I., Painter, M.I., Hirsch, R.P., Crumrine, P.K. and
David, R. (1983) Outcome of neonates with convulsions
treated in an intensive care unit. Ann. Neurol., 14: 642-647.
Blake, R.V., Wroe, S.J., Breen, E.K. and McCarthy, R.A. (2000)
Accelerated forgetting in 483 patients with epilepsy: evidence
for an impairment in memory consolidation. Brain, 123(3):
472.
Bliss, T.V.R and Collingridge, G.L. (1993) A synaptic model of
memory: longterm potentiation in the hippocampus. Nature,
361: 31-39.
415
Bourgeois, B.E, Prensky, A.L., Palkes, H.S., Talent, B.K., Busch,
S.G. (1983) Intelligence in epilepsy: a prospective study in
children. Ann. Neurol., 14(4): 438-444.
BuReau, C., Jambaque, I., Viguier, D., Kieffer, V., Dellatolas,
G. and Dulac, O. (2000) Epileptic syndromes, cognitive as-
sessment and school placement: a study of 251 children. Dev.
Med. Child Neurol., 42(5): 319-327.
Camfield, C., Camfield, P., Gordon, K., Smith, B. and Dooley,
J. (1993) Outcome of childhood epilepsy: a population-based
study with simple predictive scoring system for those treated
with medication. J. Pediatr., 122(6): 861-868.
Chelune, G.J. (1995) Hippocampal adequacy versus functional
reserve: predicting memory functions following temporal
lobectomy. Arch. Clin. Neuropsychol., 10: 413-432.
Chiton, C. and Dulac, O. (2001) Early invitation in childhood
onset catastrophic epilepsies. Unpublished.
Chiron, C., Marchand, M.C., Tran, A., Rey, E., d'Athis, P.
and Vincent, J. et al. (2000) Stiripentol in severe my-
oclonic epilepsy in infancy: a randomised placebo-controlled
syndrome-dedicated trial. STICLO study group. Lancet,
356(9242): 1638-1642.
Cockerell, O.C., Johnson, A.L., Sander, J.W., Hart, Y.M. and
Shorvon, S.D. (1995a) Remission of epilepsy: results from
the National General Practice Study of Epilepsy. Lancet,
346(8968): 140-144.
Cockerell, O.C., Sander, J.W. and Shorvon, S.D. (1995b) Remis-
sion of epilepsy. The NGPS. National General Practice Study
of Epilepsy. Lancet, 346(8984): 1228.
Cole, AJ. (2000) Is epilepsy a progressive disease? The neu-
robiological consequence of epilepsy. Epilepsia, 41(Suppl. 2):
13-22.
Corcoran, R. and Thompson, P. (1992) Memory failure in
epilepsy: retrospective reports and prospective recordings.
Seizure, 1(1): 37-42.
Dodrill, C.B. (2002) Progressive cognitive decline in adolescents
and adults with epilepsy. In: T. Sutula and A. Pitk~inen(Eds.),
Do Seizures Damage the Brain. Progress in Brain Research,
Vol. 135. Elsevier, Amsterdam, pp. 399-407.
Duncan, J.S. (2002) MRI studies. Do seizures damage the brain?
In: T. Sutula and A. Pitk~inen (Eds.), Do Seizures Damage
the Brain. Progress in Brain Research, Vol. 135. Elsevier,
Amsterdam, pp. 253-261.
Farwell, T.R., Dodrill, L.B. and Batzel, L.W. (1985) Neuropsy-
chological ability of children with epilepsy. Epilepsia, 26:
395-400.
Gadian, D.G., Mishkin, M. and Vargha-Khadem, E (1999) Early
brain pathology and its relation to cognitive impairment: the
role of quantitative magnetic resonance techniques. Adv. Neu-
rol., 81: 307-315.
Gilmore, R., Morris lIl, H., Van Ness, P.C., Gilmore-Pollak,
W. and Estes, M. (1994) Mirror focus: function of seizure
frequency and influence on outcome after surgery. Epilepsia,
35(2): 258-263.
Girvin, J.P. (1992) Is epilepsy a progressive disorder?. J.
Epilepsy, 5: 94-104.
Goldensohn, E.S. (1984) The relevance of secondary epilepto-
416
genesis to the treatment of epilepsy: kindling and the mirror
focus. Epilepsia, 25(Suppl. 2): 156-173.
Goos, A., Gut, C., Yasargil, G., Yonekawa, Y. and Wieser, H.G.
(2000) Distinctive subgroups of mesial temporal lobe epilepsy.
Epilepsia, 41(Suppl.): 19.
Grunwald, T., Beck, H., Lehnertz, K., Blumcke, I., Pezer, N.
and Kurthen, M. et al. (1999) Evidence relating human verbal
memory to hippocampal N-methyl-D-aspartate receptors. Proc.
Natl. Acad. Sci. USA, 96(21): 12085-12089.
Gupta, S.K., Satishchandra, P., Venkatesh, A. and Subbakrishna,
D.K. (1993) Prognosis of single unprovoked seizure. J. Assoc.
Phys. India, 41(11): 709-710.
Hermann, B.P., Seidenberg, M., Schoenfeld, J. and Davies, K.
(1997) Neuropsychological characteristics of the syndrome of
mesial temporal lobe epilepsy. Arch. Neurol., 54(4): 369-376.
Holmes, M.D., Dodrill, C.B., Wilkus, R.J. and Ojemann, G.A.
(1998) Is partial epilepsy progressive? Ten-year follow-up of
EEG and neuropsychological changes in adults with partial
seizure. Epilepsia, 39(11): 1189-1193.
Hughes, I.R., Schlagenhauff, R.E., Curtin, M.J. and Brown, V.P.
(1961) Electronica correlation in temporal lobe epilepsy with
emphasis on inter-areal analysis of the temporal lobe. Elec-
troencephalogr. Clin. Neurophysiol., 13: 333-339.
Isokawa, M. and Levesque, M.F. (1991) Increased NMDA re-
sponses and dendritic degeneration in human epileptic hip-
pocampal neurons in slices. Neurosci. Lett., 312(2): 212-216.
Jokeit, H. and Markowitsch, H.J. (1999) Aging limits plasticity
of episodic memory functions in response to left temporal lobe
damage in patients with epilepsy. Adv. NeuroL, 81: 251-258.
Knecht, S., Henningsen, H., Deppe, M., Osinska, L., Diehl, B.
and Stodieck, S. et al. (1996). Neurosci. Lett., 271(1): 66-68.
Kraus, G.L., Summerfield, M., Brandt, J., Breiter, S. and
Ruchkin, D. (1997). Neurology, 49(4): 975-980.
Mandelbaum, D.E. and Barack, G.D. (1997) The effect of seizure
type and medication on cognitive and behavioral functioning
in children with idiopathic epilepsy. Dev. Med. Child Neurol.,
39:731-735.
Mayeux, R., Brandt, J., Rosen, J. and Benson, D.E (1980) .
Neurology, 30(2): 120-125.
Meencke, H.J., Veith, G. and Lund, S. (1996) Bilateral hip-
pocampal sclerosis and secondary epileptogenesis. Epilepsy
Res. Suppl., 12: 335-342.
Merzenich, M.M. and Sameshima, K. (1993) Cortical plasticity
and memory. Curt'. Opin. Neurobiol., 3(2): 187-1296.
Moore, S.D., Ban:, D.S. and Wilson, W.A. (1993) Seizure-like
activity disrupts LTP in vitro. Neurosci. Lett., 163(1): 117-
119.
Morrell, F. (1985) Secondary epileptogenesis in man. Arch. Neu-
rol., 42(4): 318-335.
Neyens, L.G., Aldenkamp, A.P. and Meinardi, H.M. (1999)
Prospective follow-up of intellectual development in children
with a recent onset of epilepsy. Epilepsy Res., 34: 85-90.
Pauli, E., Pickel, S., Schulemann, H., Buchfelder, M. and Stefan,
H. (1999) Neuropsychologic findings depending on the type
of the resection in temporal lobe epilepsy. Adv. Neurol., 81:
371 377.
Pauli, E., Eberhardt, K.W., Schafer, I., Tomandl, B., Huk, W.J.
and Stefan, H. (2000) Chemical shift imaging spectroscopy
and memory function in temporal lobe epilepsy. Epilepsia,
41(3): 282-289.
Postma, T., Krupp, E., LI, X.L., Post, R.M. and Weiss, S.R.
(2000) Lamotrigine treatment during amygdala-kindled seizure
development fails to inhibit seizure and diminishes subsequent
anticonvulsant efficacy. Epilepsia, 41(12): 1514-1521.
Rasmussen, T. and Milner, B. (1977) The role of early left
brain injury in determining lateralization of cerebral speech
functions. Ann. New York Acad. Sci., 299: 355-369.
Rodin, E.A., Schmaltz, S. and Twitty, G. (1986) Intellectual
functions of patients with childhood-onset epilepsy. Dev. Med.
Child Neurol., 28: 25-33.
Sass, K.J., Spencer, D.D., Kim, J.H., Westerveld, M., Novelly,
R.A. and Lencz, T. (1990) Verbal memory impairment cor-
relates with hippocampal pyramidal cell density. Neurology,
40(11): 1694-1697.
Sass, K.J., Sass, A., Westerveld, M., Lencz, T., Novelly, R.A.
and Kim, J.H. et al. (1992) Specificity in the correlation of
verbal memory and hippocampal neuron loss: dissociation of
memory, language, and verbal intellectual ability. J. Clin. Exp.
Neuropsychol., 14(5): 662-672.
Schmidt, C., Stefan, H. (2001) Klassifikation epileptischer An-
f~ille vor und nach epilepsiechirurgischme Eingriff. Unpub-
lished.
Shorvon, S.D. and Reynolds, E.H. (1982) Early prognosis of
epilepsy. Br. Med. J. (Clin. Res. Ed.), 285(6356): 1699-1701.
Sillanpaa, M. (1993) Remission of seizure and predictors of
intractability in long-term follow-up. Epilepsia, 34(5): 930-
936.
Spanedda, E, Cendes, F. and Gotman, J. (1997) Relations be-
tween EEG seizure morphology, interhemispheric spread, and
mesial temporal atrophy in bitemporal epilepsy. Epilepsia
38(12): 1300-1314.
Squire, L.R. and Alvarez, P. (1995) Retrograde amnesia and
memory consolidation: a neurobiological perspective. Curr.
(?pin. NeurobioL, 5(2): 169-177.
Stefan, H. (1998) The challenge epilepsy treatment. In: H. Ste-
fan, G. Kramer and B. Hamdi (Eds.), Challenge Epilepsy,
Neoantiepileptic Drugs. Blackwell Science, Berlin, pp. 1-4.
Stefan, H., Andermann, E, Chauvel, P. and Shorvon, S.D. (2000)
Plasticity and epilepsy: an outline of the problem. In: Ad-
vances in Neurology, Vol. 81, Lipincott, Williams and Wilkins,
Philadelphia, PA, pp. I-5.
Sutula, T., Cascino, G., Cavazos, J., Parada, I. and Ramirez, L.
(1989) Mossy fibre synaptic reorganization in the epileptic
human temporal lobe. Ann. Neurol., 26(3): 321-330.
Tassinari, C.A., Bureau, M., Dravet, C., Dalla-Bernardina, B. and
Roger, J. (1992) Epilepsy with continuous spikes and waves
during slow sleep - - otherwise described as ESES. In: J.
Rosen, M. Bureau, C. Dravet, F.E. Dreifuss, A. Perret and P.
Wolf (Eds.), Epileptic Syndromes in Infancy, Childhood and
Adolescence. John Libbey, London, pp. 245-256.
Trimble, M.R. (1988) Cognitive hazards of seizure disorders.
Epilepsia, 29(Suppl. 1): 19-24.
Ville, D.E.O., Chiron, C. and Dulac, O. (2001) Prophylactic
antiepileptic treatment in Sturge-Weber disease. In preparation.
 417

Vining, E.R, Freeman, J.M., Pillas, D.J., Uematsu, S., Carson, - - the John Hopkins experience: 1968 to 1996. Pediatrics,
B.S. and Brandt, J. et al. (1997) Why would you remove half 100(2): 163-171.
a brain? The outcome of 58 children after hemispherectomy
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 37

Progressive behavioral changes in children with epilepsy t

Joan K. Austin 1,, and David W. D u n n 2

1 School of Nursing and 2 School of Medicine, Indiana University, 1111 Middle Drive, NU492, Indianapolis, IN 46202-5107, USA

Abstract: Children with epilepsy are known to have high rates of mental health problems. The role of seizures in the devel-
opment of these problems is not known primarily because of difficulties in separating the effects of seizures from the three
other potential causal factors: (a) poor child and family response to the condition, (b) side effects of antiepileptic medica-
tion, and (c) neurological dysfunction that causes both the seizures and the behavioral problems. Although cross-sectional
studies focusing on children with chronic epilepsy show associations between behavior problems and each of these causal
factors, it is not possible to isolate the effects of any one causal factor using this design. A stronger approach is to conduct
prospective studies of children with new-onset seizures. Recent research on children with new-onset seizures suggests that
side effects of antiepileptic medication and poor child and family response do not play major roles in the development
of behavior problems. Results from a prospective study in children with new-onset seizures show an association between
seizures and behavior problems. Separating effects of seizures from effects of neurological dysfunction on behavior
problems, however, will be difficult even in prospective studies of children with new-onset seizures. Transient cognitive
impairment (TCI) from interictal epileptiform discharges is proposed as an alternative explanation for behavior problems.

Introduction been cross-sectional, there is evidence from studies

Children with epilepsy are known to have high
rates of mental health problems such as anxiety,
depression, attention problems, and behavioral dis-
ruptions (Hoare, 1984a; Ettinger et al., 1998; Dunn
and Austin, 1999). They are almost 5 times more
likely to have mental health problems than children
from the general population (Rutter et al., 1970;
McDermott et al., 1995). Moreover, children with
epilepsy appear to differ even from other groups of
chronically ill children in that they fare substantially
worse psychologically. Although most research has
*Correspondence to: J.K. Austin, Indiana University
School of Nursing, 1111 Middle Drive, NU492, Indi-
anapolis, IN 46202-5107, USA. Tel.: +1-317-274-8254;
Fax: + 1-317-278-1811; E-mail: joausti@iupui.edu
Preparation of this paper was supported by grants PHS
R01 NS22416 from the National Institute of Neurological
Disorders and Stroke and PHS R01 NR04536 from the
National Institute of Nursing Research to the first author.
in chronic childhood illness to suggest that children
with epilepsy have both the risk associated with a
chronic condition and the risk associated with a cen-
tral nervous system disorder. The risk for psychiatric
disorder appears to be about 2.5 times higher for
children with epilepsy than for children with other
physical disorders not involving the central nervous
system. For example, in a major epidemiological
study, Rutter et al. (1970) found the prevalence of
behavior problems to be 6.6% in the general pop-
ulation, 11.6% in children with chronic conditions
not involving the central nervous system, 28.6% in
children with idiopathic epilepsy, 37.5% in children
with neurological damage, and 58.3% in children
with both neurological damage and seizures. These
findings suggest that seizures somehow are related to
the development of such problems.
The role that seizures play in the development of
behavioral problems is not known. A large number of
cross-sectional studies have investigated the relation-
ship between particular seizure variables and behav-
420
ioral problems. Seizure variables related to behavior
problems include early age of onset, poor seizure
control, long duration of epilepsy, high seizure fre-
quency, and multiple seizure types (Hoare, 1984a;
Austin, 1988; Hermann et al., 1989; Austin et al.,
1994). The most consistent finding, however, has
been a link between more frequent seizures and
more mental health problems (Hartlage and Green,
1972; Hoare, 1984a; Austin, 1988; Hermann et al.,
1989; Austin et al., 1992). The association between
seizure frequency and mental health problems is un-
expected because the relationship between frequency
of symptoms and psychological functioning is gen-
erally weak in childhood chronic conditions (Drotar
and Bush, 1985). However, studies by Austin and
colleagues showed seizure frequency to be a signifi-
cant predictor of behavior problems in children with
epilepsy; in contrast, frequency of asthma attacks
was unrelated to behavior problems in children with
asthma (Austin et al., 1992, 1996). This association
suggests that seizures might have an effect on behav-
ior problems independent of disruptions from illness
symptoms.
It is difficult, however, to separate effects of
seizures from other causal factors. In addition to
seizures, three broad categories of variables have
been identified as potential causes of these behav-
ioral problems: (a) poor child and family response to
the condition, (b) side effects of antiepileptic medi-
cations, and (c) neurological dysfunction that causes
both the seizures and the behavioral problems. More-
over, there is substantial agreement that more than
one factor contributes to the development of men-
tal health problems and that these factors interact
with each other, which further reduces the ability
to isolate their respective effects. Empirical support
for the association between each of these potential
causal factors and behavior problems in children
with epilepsy is briefly reviewed. In this paper there
is a particular emphasis on the authors' work that is
relevant to showing possible effects of seizures on
behavior problems, including research in progress.
Poor child and family response
Most past research focusing on child and family re-
sponse has been based on the assumption that mental
health problems in the child with epilepsy result
from difficulties inherent in living with a chronic
condition. Some authors propose that a maladap-
rive family environment contributes to problems. For
example, negative family responses to the epilepsy
such as parental over-control and perceptions of
stigma associated with the epilepsy are proposed to
lead to behavior problems in children with epilepsy
(Carlton-Ford et al., 1997).
The few empirical studies exploring the relation-
ship between family environment variables and be-
havior problems in children with epilepsy do show a
relationship. For example, Hoare and Kerley (1991)
found family stress and lower socioeconomic sta-
tus to be associated with child behavior problems.
Dunn et al. (1999) found child satisfaction with fam-
ily relationships to be associated with depression in
adolescents. The few studies on parenting support
its relationships to mental health outcomes in chil-
dren with epilepsy. Lothman et al. (1990) observed
mother-child interactions and found parental praise
to be related to child competence and child positive
affect. In contrast, intrusive and over-controlling par-
enting behaviors were related to decreased autonomy
and confidence in these children with epilepsy. Other
studies showed that both family and seizure vari-
ables were significantly associated with child mental
health problems. For example, Austin et al. (1992)
found family variables (family stress and fewer fam-
ily resources) and seizure variables (high seizure
frequency) to be significant predictors of behavior
problems.
The cross-sectional nature of this past research,
however, makes it difficult to determine if families
are reacting to problems in the child, if the child
is influenced by the parent's maladaptive response
to the child's epilepsy, or if both the child and the
family are coping poorly with the child's seizures.
Recent studies suggest that both children with new-
onset seizures and their parents have many concerns
and fears related to seizures. For example, Brown
(1994) found that about one half of the children
with seizures felt helpless, scared, and different from
others. In another study parents were found to have
many concerns and fears related to their child's
seizures including death, brain damage, loss of intel-
ligence, and the possible presence of a brain tumor
(Shore et al., 1998). Recent studies of psychosocial
care needs of children with new-onset seizures and

their parents showed that approximately one third to
one half of parents were not satisfied with explana-
tions about epilepsy given to them and desired more
information (Shore et al., 1998; Webb et al., 1998).
These findings suggest that new-onset seizures in
children can be very stressful for both children and
parents and that this stress could lead to maladaptive
coping responses in both the child and the family.
Moreover, it is logical to propose that more frequent
seizures would lead to increased stress.
Side effects of antiepileptic medication
The case that antiepileptic medications can lead to
emotional and behavioral disorders in people with
epilepsy has some empirical support (Reynolds,
1991), although it is likely that such effects are
limited. Behavioral problems were associated with
polypharmacy in a study by Hermann et al. (1989).
In contrast, Austin et al. (1992) did not find
polypharmacy to be significantly associated with be-
havior problems in a study of children with chronic
epilepsy. Children treated with phenobarbital were
described by Brent et al. (1990) to have depression
and suicidal ideation. It is difficult to separate effects
of seizures from side effects of antiepileptic med-
ication in children with chronic epilepsy because
children who have more seizures are more likely to
be on either more medications or on higher doses of
medications.
Two approaches have been used to explore the
role of side effects of medications in relation to
behavior problems: measuring behavior before and
after initiation of medications in children with new-
onset seizures and measuring behavior before and
after withdrawal of medication in children whose
seizures are well controlled. Both types of prospec-
tive studies have suggested that antiepileptic med-
ications may have minimal effect on cognitive and
behavioral functioning. For example, in a prospective
study of children with recent onset seizures Mandel-
baum and Burack (1997) found no significant de-
terioration over a 12-month period in cognitive and
behavioral performance related to the initiation of
antiepileptic medication. In a similar study Williams
et al. (1998) also did not find significant differences
in behavioral disruptions between children with new-
onset epilepsy and controls during the first 6 months
421
following initiation of antiepileptic medication. Sim-
ilar results on cognition and behavior were found in
two recent withdrawal studies. For example, out of
eight areas studied for differences after drug with-
drawal, children reported improvements only in the
area of tiredness (Aldenkamp et al., 1998). In this
same study parents reported improvements in ar-
eas of activation (e.g., alertness, drowsiness, and
concentration disorders) but not in behavioral prob-
lems (e.g., depression and aggressiveness). In the
second study focusing on six cognitive function-
ing areas only improvements in psychomotor speed
could be attributed to antiepileptic drug withdrawal
(Aldenkamp et al., 1993). In general, findings using
either approach are consistent with the hypothesis
that underlying neurological dysfunction might play
a more important role in the development of behav-
ior problems than do side effects from antiepileptic
medications (Corbett et al., 1985; Mandelbaum and
Burack, 1997).
Neurological dysfunction
Some researchers have proposed that underlying
neurological dysfunction causes both seizures and
behavior problems. Support for this hypothesis
comes from cross-sectional studies indicating that
children with chronic neurological conditions have
higher rates of behavior problems than children with
chronic conditions that do not involve the brain
(Breslau, 1985; Howe et al., 1993). For example,
Austin et al. (1994)found children with epilepsy to
have higher scores for both internalizing and exter-
nalizing behavior problems as measured by parents'
ratings on the Child Behavior Checklist (CBCL,
Achenbach, 1991a) than those with chronic asthma.
Behavioral ratings in this study by teachers on the
Teacher's Report Form of the CBCL (TRF, Achen-
bach, 1991b) also showed children with epilepsy to
have higher rates of internalizing behavior problems
than children with asthma. In addition, empirical
studies show that children with epilepsy who have
accompanying deficits in neurological functioning
are at increased risk for poor mental health outcomes
(Hermann, 1981, 1982; Rutter, 1981).
The few available cross-sectional studies of chil-
dren with new-onset seizures also indirectly suggest
that underlying neurological dysfunction might play
422
an important role in the development of behavior
problems. Hoare (1984a,b) investigated psychiatric
disturbance across several groups of children, in-
cluding those with new-onset epilepsy, new-onset di-
abetes, and controls. He found 45% of children with
new-onset epilepsy to already have mental health
problems. In contrast, only 17% of the children
with new-onset diabetes and only 10% of controls
were found to have mental health problems. Authors
investigating the effects of initiating antiepileptic
medications in children with new-onset epilepsy also
have noted higher than expected rates of behavior
problems in children. Stores et al. (1992) noted that
children had behavior problems prior to medica-
tion treatment and hypothesized that these problems
were due to the epileptic process. Williams et al.
(1998) rated children's behavior problems on the day
they were diagnosed with epilepsy, prior to initiation
of antiepileptic medication, and found internalizing
behavior problems to be substantially higher than
norms.
Only a few prospective studies of children with
new-onset epilepsy have been conducted. Dunn et al.
(1997) investigated behavior problems in 42 children
with new-onset seizures. Children were recruited
into the study within 6 weeks of their initial seizure
and parents were asked at the first interview (base-
line) to rate their child's behavior in the 6-month
period prior to the child's first recognized seizure.
The children's behavior was rated a second time 4
months later (follow-up) by the same parent. Seizure
severity at baseline was rated as high, moderate, or
low based on type of seizure, duration of the initial
seizure, additional number of seizures, and place-
ment on medication. Mean scores were the highest at
baseline for those children in the high seizure sever-
ity group. All three groups tended to improve from
baseline to follow-up, and scores for those in the low
and moderate seizure severity groups were near the
population average. In contrast, even at follow-up
the mean score for those in the high seizure severity
group was approximately one-half standard devia-
tion above the population mean. Although children
with higher seizure severity had more behavior prob-
lems, it was not possible to separate out effects of
seizures (either the length of the initial seizure or the
number of repeated seizures) from other factors such
as side effects of medication because the calculation
of the seizure severity score included seizure type
and treatment with antiepileptic medication.
As part of a larger prospective study Austin et
al. (2001) continued to study behavior problems in
children with first-recognized seizures. Recruitment
of participants was within 6 weeks of the first rec-
ognized seizure. Data on behavior problems were
collected four times: baseline, 6 months, 12 months,
and 24 months. At each data collection point the
major caregiving parent rated the child's behavior
during the prior 6 months. Importantly, this included
the baseline collection, when the parent rated the
child's behavior during the 6 months prior to the
child's first-recognized seizure. To control for family
factors parents also rated the behavior of the sibling
who was nearest in age to the child with the seizure.
In this study parents also were systematically inter-
viewed to determine if the child had had any prior
seizure-like episodes that had not been recognized
as such before the seizure that led to their being
enrolled into the study. Parents of approximately
one third of the children responded that their child
had prior episodes that were most likely seizures.
Parents' ratings showed higher than expected rates
of behavior problems in the 6 months prior to the
first-recognized seizure in the total seizure sample,
with approximately one third being in the clinical or
at-risk range (Austin et al., 2001). However, rates of
behavior problems were highest in the group of chil-
dren who had had prior seizures, with almost 40%
being in the clinical or at-risk range. Children with
no prior seizures had fewer behavior problems than
children with prior unrecognized seizures. Compar-
isons with siblings showed the children with seizures
to have more internalizing, attention, thought, and
somatic complaint problems than their nearest-in-age
healthy siblings (Austin et al., 2001). Interactions of
previously unrecognized seizures with gender (boys
were doing the worst) and seizure type (children
with partial seizures were doing the worst) were also
found.
Because a limitation of most past research of be-
havior problems in this population is the reliance on
parents' ratings of the children's behavior, ratings
of the child in this study also were obtained from
the child's teacher using the teacher's form of the
CBCL (Teacher's Report Form, TRF, Achenbach,
1991b). Results were similar for teachers' ratings

of the children's behavior. The mean total behavior
problem score was higher for children with prior
seizures than for children without prior seizures. In
comparison to children with no prior seizures, the
children with prior seizures also had more prob-
lems in the area of internalizing, somatic complaints,
anxious/depressed, thought problems, and attention
problems (Dunn et al., 2002).
A limitation of this study is that little information
was obtained about the prior seizures. It is possi-
ble that some children had prior seizures that went
unrecognized or that children who were thought to
have prior seizures based on parents' descriptions
did not have them. Differences in behavior problems
between the prior and no-prior seizure groups also
might be a result of children with prior unrecognized
seizures having less involved parents than children
whose seizures were recognized by their parents.
The fact that baseline ratings of behavior were
made for the period prior to the child being placed on
medication substantially reduces the possibility that
side effects of medication accounted for the behavior
problems. In addition, the higher rates of problems
in children who had prior unrecognized seizures also
reduces the possibility that poor child and family
adjustment to seizures accounted for the behavior
problems. The higher rates of behavior problems in
children with prior unrecognized seizures, however,
might reflect that these children worried because
they were aware that something was happening to
them and no one was noticing it.
Finally, a recent study of children having epilepsy
surgery supports the link between removal of epilep-
tic focus, seizure reduction, and changes in behavior
problems. Lendt et al. (2000) found significant re-
ductions in behavior problems within three months
following epilepsy surgery in a study of children
aged 4 to 16 years. Behavior problems were mea-
sured before and after surgery in 28 children who had
pharmacoresistant focal epilepsy. The control group
was a sample of 28 children with focal epilepsy
who were conservatively treated with antiepilep-
tic medication. The two groups did not differ on
demographic variables (age, sex, or IQ), seizure
characteristics (type or frequency), or on number
of medications at baseline. Behavior problems were
measured using parents' ratings on the Child Behav-
ior Checklist (CBCL, Achenbach, 1991a). Baseline
423
CBCL scores did not significantly differ between the
two groups. At the 3-month follow-up the surgical
group had significantly lower internalizing problems,
externalizing problems, thought problems, and atten-
tion problems than the control group. Within-group
analyses showed that behavior problems improved in
the surgery group and tended to become worse in
the control group. Within the surgery group, greater
improvements in the total behavior problem score
from before to after surgery were strongly associated
with greater reduction in seizures. These authors
propose that the epileptic focus directly causes be-
havior problems. Limitations of the study include
the lack of random assignment to surgery and con-
trol groups and the failure to consider any other
psychosocial factors that might have been related to
behavioral improvement. Although these authors did
not address the possible effects of repeated seizures,
findings suggest that behavior problems in epilepsy
are linked to abnormal brain tissue and to electrical
discharge.
It is difficult to separate effects of seizures on
behavior from the other causal factors in samples
of children with chronic epilepsy. A stronger ap-
proach is to study children with new-onset seizures.
Measuring the child's behavior prior to the first-
recognized seizure helps to control for the variables
of poor parent response to the seizures and side ef-
fects of medication. Prospective studies of children
with new-onset seizures are needed to identify if
there are changes in behavior problems in children
who have additional seizures.
Prospective study
To explore further the effects of seizures on the
development of behavior problems we conducted
a prospective study of behavior problems in 212
children (ages 4-14 years) with new-onset seizures
(Austin et al., 2002). Behavior problems were
measured using the caregiving parent's ratings on
the Child Behavior Checklist (CBCL, Achenbach,
1991a). The CBCL has 118 behavioral items on
which parents rate how well the behavior describes
their child's behavior on 3-point scales: 0 (not true),
1 (somewhat or sometimes true), and 2 (very true or
often true). The scale yields a total behavior problem
score as well as subscale scores that are normed
424
based on child age and gender; results for the total
behavior problem scores will be discussed here. To
reduce the possibility that parents might rate seizure
activity as a behavior, parents were cautioned to
not include any behaviors that might be seizures or
related to seizures in their ratings. Data on behav-
ior problems were collected four times: baseline, 6
months, 12 months, and 24 months.
To help control for family environment factors
parents also rated the behavior of the sibling (n =
135) who was nearest in age to the child with the
seizure on the CBCL. Siblings were similar in age
and gender to the child with the seizure. In an effort
to reduce bias in parent ratings because they knew
the child had had a seizure, the child's teacher also
was asked to rate the child's behavior using the
teacher's form of the CBCL (Teacher's Report Form,
TRF, Achenbach, 1991b) three times: baseline, 12
months, and 24 months. Data were analyzed using
descriptive statistics and two-sample t-tests.
At the 24-month data collection period 117 chil-
dren (55%) had no additional seizures and 95 (45%)
had at least one additional seizure. At baseline, on
average both groups of children had similar total be-
havior problems scores that were approximately one-
half standard deviation above the population mean.
At the 24-month visit, the group without further
seizures had decreased about 2 points on average,
while children with at least one additional seizure
over the 24-month period had stable mean behavior
problem scores. Results were similar for teachers'
ratings of the children's behavior. The consistency
of findings between parents' and teachers' ratings
of the children supports the validity of the parents'
ratings.
Score differences in behavioral problems between
children with a first-recognized seizure and their
healthy siblings were explored for the two seizure
groups: those with additional seizures during the
24-month period and those who had no additional
seizures. We hypothesized that, if seizures were af-
fecting behavior, those who had additional seizures
would show increasingly worse behavior problems
compared to their siblings. Likewise, we hypothe-
sized that those children who had no further seizures
would show fewer differences from their siblings
over the 24-month period. Although children with
no additional seizures had more behavioral prob-
lems than their siblings throughout the whole study
period, there was a tendency for the difference to de-
crease over time. In contrast, the group with at least
one additional seizure had higher behavior problems
scores than their healthy siblings throughout the 24-
month period and there was a tendency for this
difference to increase. These results supported our
hypotheses.
In this prospective study of behavior problems in
children with new-onset seizures there are two major
findings that bear on our understanding of the possi-
ble effects of seizures on behavioral disruptions: (a)
children who had additional seizures were found to
have higher total behavior problem scores on average
than children who did not have additional seizures,
and (b) children who had additional seizures showed
increasingly more behavior problems compared to
their siblings than children who did not have addi-
tional seizures. Taken as a whole these findings show
a positive association between the seizure occurrence
and behavior problems.
Even in this prospective study, however, it was
not possible to isolate effects of the seizures from the
other presumed causes. It is highly likely that chil-
dren who have more severe neurological dysfunction
also would be more likely to have additional seizures
during the 2-year period than those with a less severe
neurological dysfunction. Children who had addi-
tional seizures also might be more likely to have
side effects of antiepileptic medication because they
would more likely be on higher doses of medica-
tions compared to children who had no additional
seizures. Compared to children who had no addi-
tional seizures those with additional seizures would
have been more likely to be given the diagnosis of
epilepsy. As a result, during this period these chil-
dren and their families would be experiencing the
ramifications of living with a chronic condition that
has an associated stigma.
Transient cognitive impairment
Aicardi (1996) suggests that epilepsy is more per-
vasive in some children and that both seizures and
behavior problems are a manifestation of epilepsy.
An explanation for the pattern of findings related to
behavior problems in this prospective study is that of
transient cognitive impairment (TCI) caused by sub-

clinical seizures. Interictal epileptiform discharges
are proposed to lead to transient cognitive impair-
ment, which in turn leads to changes in behavior
(Aicardi, 1996). It is logical to propose that children
who had additional seizures would be more likely to
have interictal epileptiform discharges than children
who did not have additional seizures. It might be that
TCI is one mechanism through which subclinical
interictal epileptiform discharges both influence be-
havior and lead to seizures. Because different causes
will presumably have different treatments, it would
be important to investigate if TCI leads to behavior
problems.
There is limited empirical support that episodes
of TCI can influence behavior. Binnie (1993, 2001)
proposes that episodes of TCI can adversely affect
interpersonal interactions by causing the child to
miss important cues during interactions with his or
her peers. For example, if a child experiences in-
terruptions in the flow of conversations because of
TCIs, it could lead to the child failing to respond
appropriately. There is some support for these hy-
potheses. During recording of abnormal discharges,
impaired cognitive performance has been observed
for neuropsychological skills such as abstract rea-
soning (Siebelink et al., 1988).
Future research should investigate if TCI ad-
versely affects behavior in children with seizures.
If behavioral disruptions are found to be associated
with TCI, then the effect of treating subclinical inter-
ictal epileptiform discharges with antiepileptic med-
ication (Binnie, 2001) should be explored in future
research. If future research supports this hypothesis,
then treatment of seizures with antiepileptic medica-
tion or removal of epileptiform tissue might be con-
sidered. In one small study pharmaceutical treatment
of children with subclinical seizures was shown to
reduce electroencephalographic epileptiform abnor-
malities, which in turn resulted in improved cogni-
tive and emotional-behavioral functioning (Marston
et al., 1993).
Summary and conclusion
There are four potential causal factors for the high
rate of behavior problems found in children with
epilepsy: (a) effect of seizures, (b) poor child and
family response to the condition, (c) side effects of
425
antiepileptic medication, and (d) neurological dys-
function that causes both the seizures and the be-
havioral problems. Although cross-sectional studies
of children with chronic epilepsy consistently show
a link between seizure frequency and behavior prob-
lems, it is not possible to isolate effects of seizures
from the other possible causes. Recent studies of
children with new-onset seizures suggest that neither
poor child and family response nor side effects of
antiepileptic medication plays a major role in the
development of behavior problems. Results from a
prospective study in children with new-onset seizures
show that children who had additional seizures over
a 24-month period exhibit an increase in behavior
problems. Separating effects of seizures from effects
of neurological dysfunction on behavior problems,
however, is not possible even in prospective studies
of children with new-onset seizures. Transient cog-
nitive impairment (TCI) from interictal epileptiform
discharges is offered as one possible mechanism
through which interictal epileptiform discharges can
directly disrupt behavior. If behavior problems are
caused by TCI in some children, then treatments that
reduce these subclinical seizures should be investi-
gated.
References
Achenbach, T.M. (1991a) Manual for the Child Behavior
Checklist~4-18 and 1991 Profile. University of Vermont De-
partment of Psychiatry, Burlington, VT.
Achenbach, T.M. (1991b)Manual for the Teacher's Report Form
and 1991 Profile. University of Vermont Department of Psy-
chiatry, Burlington, VT.
Aicardi, J. (1996) Epilepsy as a non-paroxysmal disorder. Acta
Neuropediatr., 2: 249-257.
Aldenkamp, A.E, Alpherts, W.C.J., Blennow, G., Elmqvist,
D., Heijbel, J., Nilsson, H.L., Sandstedt, P., Tonnby, B.,
Wahlander, L. and Wosse, E. (1993) Withdrawal of antiepilep-
tic medication in children - - effects on cognitive function: the
multicenter Holmfrid study. Neurology, 43: 41-50.
Aldenkamp, A.E, Alpherts, W.C.J., Sandstedt, E, Blennow,
G., Elmqvist, D., Heijbel, J., Nilsson, H.L., Tonnby, B.,
Wahlander, L. and Wosse, E. (1998) Antiepileptic drug-related
cognitive complaints in seizure-free children with epilepsy be-
fore and after drug discontinuation. Epilepsia, 39(10): 1070-
1074.
Austin, J.K. (1988) Childhood epilepsy: child adaptation and
family resources. J. Child Adolesc. Psychiatric Ment. Health
Nurs., 1: 18-24.
Austin, J.K., Risinger, M.W. and Beckett, L. (1992) Correlates
426
of behavior problems in children with epilepsy. Epilepsia, 33:
1115-1122.
Austin, J.K., Smith, M.S., Risinger, M.W. and McNelis, A.M.
(1994) Childhood epilepsy and asthma: comparison of quality
of life. Epilepsia, 35: 608-615.
Austin, J.K., Huster, G.A., Dunn, D.W. and Risinger, M.W.
(1996) Adolescents with active or inactive epilepsy or asthma:
a comparison of quality of life. Epilepsia, 37: 1228-1238.
Austin, J.K., Harezlak, J., Dunn, D.W., Huster, G.A., Rose, D.E
and Ambrosius, W.T. (2001) Behavior problems in children
before first recognized seizures. Pediatrics, 107:115-122.
Austin, J.K., Dunn, D.W., Caffrey, H., Harezlak, J., Perkins, S.,
Ambrosius, W.T., and Rose, D.E (2002). Recurrent seizures
and behavior problems in children with first recognized
seizures: A prospective study. (in preparation)
Binnie, C.D. (1993) Significance and management of transitory
cognitive impairment due to subclinical EEG discharges in
children. Brain Dev., 15: 23-30.
Binnie, C.D. (2001) Cognitive performance, subtle seizures, and
the EEG. Epilepsia, 42(Suppl. 1): 16-18.
Brent, D.A., Crumine, P.K., Varrna, R., Brown, R.V. and Al-
lan, M.J. (1990) Phenobarbital treatment and major depressive
disorder in children with epilepsy: a naturistic follow-up. Pe-
diatrics, 85: 1086-1091.
Breslau, N. (1985) Psychiatric disorder in children with physical
disabilities. J. Am. Acad. Child Psychiatry, 24: 87-94.
Brown, S.W. (1994) Quality of life: a view from the playground.
Seizure, 3: 11-15.
Carlton-Ford, S., Miller, R., Nealeigh, N. and Sanchez, N. (1997)
The effects of perceived stigma and psychological over-control
on the behavioural problems of children with epilepsy. Seizure,
6: 383-391.
Corbett, J.A., Trimble, M.R. and Nichol, T.C. (1985) Behavioral
and cognitive impairments in children with epilepsy: the long-
term effects of anticonvulsant therapy. J. Am. Acad. Child
Psychiatry, 24: 17-23.
Drotar, D. and Bush, M. (1985) Mental health issues and ser-
vices. In: N. Hobbs and J.M. Perrin (Eds.), Issues in the Care
of Children with Chronic Illness. Jossey-Bass, San Francisco,
CA, pp. 514-550.
Dunn, D.W. and Austin, J.K. (1999) Behavioral issues in pedi-
attic epilepsy. Neurology, 53(Suppl. 2): $96-S100.
Dunn, D.W., Austin, J.K. and Huster, G.A. (1997) Behavior
problems in children with new-onset epilepsy. Seizure, 6:
283-287.
Dunn, D.W., Austin, J.K. and Huster, G.A. (1999) Symptoms of
depression in adolescents with epilepsy. J. Am. Acad. Child
Adolesc. Psychiatry, 38: 1132-1138.
Dunn, D.W., Harezlak, J., Ambrosius, W.T. and Austin, J.K.
(2002) Teacher assessment of behavior in children with new-
onset seizures. Seizure (in press).
Ettinger, A.B., Weisbrot, D.M., Nolan, E.E., Gadow, K.D., Vi-
tale, S.A., Andriola, M.R., Lenn, N.J., Novak, G.P. and Her-
mann, B.P. (1998) Symptoms of depression and anxiety in
pediatric epilepsy patients. Epilepsia, 39: 595-599.
Hartlage, L.C. and Green, J.B. (1972) The relation of parental
attitudes to academic and social achievement in epileptic chil-
dren. Epilepsia, 13: 21-26.
Hermann, B.P. (1981) Deficits in neuropsychological functioning
and psychopathology in persons with epilepsy: a rejected
hypothesis revisited. Epilepsia, 22: 161-167.
Hermann, B.P. (1982) Neurological functioning and psy-
chopathology in children with epilepsy. Epilepsia, 22: 703-
710.
Hermann, B.P., Whitman, S. and Dell, J. (1989) Correlates of
behavior problems and social competence in children with
epilepsy, aged 6-11. In: B. Hermann and M. Seidenberg
(Eds.), Childhood Epilepsies: Neuropsychological, Psychoso-
cial and Intervention Aspects. Wiley, New York, NY, pp. 143-
157.
Hoare, P. (1984a) The development of psychiatric disorder
among school children with epilepsy. Dev. Med. Child Neurol.,
26: 3-13.
Hoare, P. (1984b) Psychiatric disturbance in the families of
epileptic children. Dev. Med. Child Neurol., 26: 14-19.
Hoare, P. and Kerley, S. (1991) Psychosocial adjustment of
children with chronic epilepsy and their families. Dev. Med.
Child Neurol., 33: 201-215.
Howe, G.W., Feinstein, C., Reiss, D., Molock, S. and Berger, K.
(1993) Adolescent adjustment to chronic physical disorders,
I. Comparing neurological and non-neurological conditions. J.
Child Psychol. Psychiatry, 34:1153-1171.
Lendt, M., Helmstaedter, C., Kuczaty, S., Scbramm, J. and Elger,
C.E. (2000) Behavioural disorders in children with epilepsy:
early improvement after surgery. J. Neurol. Neurosurg. Psychi-
atry, 69: 739-744.
Lothman, D.J., Pianta, R.C. and Clarson, S.M. (1990) Mother-
child interaction in children with epilepsy: relations with child
competence. J. Epilepsy, 3: 157-163.
Mandelbaum, D.E. and Burack, G.D. (1997) The effect of seizure
type and medication on cognitive and behavioral functioning
in children with idiopathic epilepsy. Dev. Med. Child Neurol.,
39: 731-735.
Marston, D., Besag, E, Binnie, C.D. and Fowler, M. (1993)
Effects of transitory cognitive impairment on psychosocial
functioning of children with epilepsy: a therapeutic trail. Dev.
Med. Child NeuroL, 35: 574-581.
McDermott, S., Mani, S. and Krishnaswami, S. (1995) A
population-based analysis of specific behavior problems as-
sociated with childhood seizures. J. Epilepsy, 8:110-118.
Reynolds, E.H. (1991) Interictal psychiatric disorders: neuro-
chemical aspects. In: D.B. Smith, D.M. Treiman and M.R.
Trimble (Eds.), Advances in Neurology. Vol. 55, Raven Press,
New York, NY.
Rutter, M. (1981) Psychological sequelae of brain damage in
children. Am. J. Psychiatry, 138: 1533-1544.
Rutter, M., Graham, P. and Yule, W. (1970) A neuropsychiatric
study in childhood. Clin. Dev. Med., 35/36: 1-265.
Shore, C., Austin, J., Musick, B., Dunn, D., McBride, A. and
Creasy, K. (1998) Psychosocial care needs of parents of chil-
dren with new-onset seizures. J. Neurosci. Nurs., 30: 169-
174.
Siebelink, B.M., Bakker, D.J., Binnie, C.D. and Kasteleijn-Nolst

Trenite, D.G.A. (1988) Psychological effects of subclinical
epileptiform discharges: general intelligence tests. Epilepsy
Res., 2: 117-121.
Stores, G., Williams, P.L., Styles, E. and Zaiwalla, Z. (1992)
Psychological effects of sodium valproate and carbamazepine
in epilepsy. Arch. Dis. Child., 67: 1330-1337.
Webb, D.W., Coleman, H, Fielder, A. and Kennedy, C.R. (1998)
427
An audit of pediatric epilepsy care. Arch. Dis. Child., 79:
145-148.
Williams, J., Bates, S., Griebel, M.L., Lange, B., Mancias,
P., Pihoker, C.M. and Dykkman, R. (1998) Does short-term
antiepileptic drug treatment in children result in cognitive or
behavioral changes?. Epilepsia, 39: 1064-1069.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 38

The neurodevelopmental impact of childhood onset

temporal lobe epilepsy on brain structure and function
and the risk of progressive cognitive effects

Bruce E Hermann 1,,, Michael Seidenberg 2 and Brian Bell 1

I Department of Neurology, University of Wisconsin, Madison, W1 53792, USA

2 Department of Psychology, Chicago Medical School, North Chicago, 1L 60064-3095, USA

Abstract: The purpose of this study is to explore the possibility of progressive neuropsychological decline in chronic
temporal lobe epilepsy (TLE) and determine how this vulnerability may be associated with the neurodevelopmental impact
of the disorder. 53 patients with TLE and 62 healthy controls underwent quantitative MRI volumetric imaging of total
brain tissue and hippocampal volumes as well as assessment of intelligence and memory function. In addition to reduced
hippocampal volume, childhood onset (<14 years) but not adult onset TLE was associated with significantly reduced
total brain tissue that was generalized in nature and extended into extratemporal regions. In addition to this adverse
impact on brain structure, there was significantly reduced intellectual status as well as memory function in childhood
onset TLE patients, consistent with the generalized nature of the MRI volumetric abnormalities. Finally, cross-sectional
correlational analyses indicated that increasing duration of epilepsy in childhood onset patients was associated with
declining performance across both intellectual and memory measures, suggestive of progressive cognitive effects. We
propose that childhood onset TLE is associated with an adverse neurodevelopmental impact on brain structure and
function which represents an early acquired vulnerability, effectively reducing cerebral reserve, placing patients at risk for
progressive cognitive decline in the context of chronic and unremitting epilepsy.

Introduction cal and unresolved question with important implica-

Experimental studies in chronic rodent models of
focal temporal lobe epilepsy have shown kindled
seizures to induce progressive cellular alterations,
neuronal loss, increasing susceptibility to evoked
and spontaneous seizures, and cognitive deficits that
worsen as a function of the cumulative number of
seizures (Sutula and Hermann, 1999). Whether a
similar relationship exists in humans remains a criti-
* Correspondence to: B.R Hermann, Department of Neu-
rology, University of Wisconsin, 600 N. Highland Ave.,
Madison, WI 53792, USA. Tel.: +1-608-263-5430; Fax:
+1-607-265-0172; E-mail: Hermann@neurology.wisc.edu
tions for treatment as well as for understanding the
pathophysiology of temporal lobe epilepsy (TLE)
(Camfield, 1997; Sutula and Hermann, 1999).
The most prominent cognitive deficit in TLE in-
volves memory function, due to the effects of the pri-
mary temporal lobe epileptogenic lesion (Chelune,
1995). However, it has become apparent that more
diffuse and generalized cognitive impairments are
evident, findings that cannot be explained by the pri-
mary temporal lobe disturbance (Glosser et al., 1997;
Hermann et al., 1997; Schoenfeld et al., 1999). In ad-
dition, abnormalities in blood flow, metabolism and
brain structure have been found to extend beyond the
epileptogenic temporal lobe (Ney et al., 1994; Jokeit
et al., 1997; Marsh et al., 1997; Sisodiya et al., 1997;
430
Bohnen et al., 1998; Briellmann et al., 1998; DeCarli
et al., 1998; Lee et al., 1998; Henry, 2000). The crit-
ical unresolved issue is whether these extratemporal
structural and functional abnormalities represent the
cumulative neurobiological consequences of poorly
controlled seizures, the static effects of initial eti-
ologic insults, or an interaction between the cause
and course of epilepsy. In the material to follow, the
literature regarding progressive changes in cognition
is very briefly reviewed. We then present findings
from a cross-sectional study of TLE subjects which
examined changes in neuropsychological function as
a function of increasing years of epilepsy. Findings
will be discussed in the context of a working model
that considers the effects of epilepsy on the devel-
oping brain and the concept of cerebral reserve to
understand adverse progressive cognitive changes in
chronic TLE.
Progressive cognitive impairment in TLE
There is a limited literature regarding the progres-
sive effects of TLE on cognition. We have identified
25 prospective investigations of neuropsychologi-
cal status in chronic epilepsy dating back to 1924
(available from the authors). Over half the studies
were published prior to 1970, and only 2 of the
25 investigations focused predominantly on TLE.
There are obvious limitations associated with find-
ings emerging from the existing literature (Lesser
et al., 1986). Patient groups were often mixed or
poorly characterized in regard to seizure type and
etiology, derived from very selected settings such
as institutions, test-retest intervals were variable,
pediatric and adult patients were often combined,
and control groups were infrequently used. Thus,
it has proven difficult to generate a reliable pro-
file regarding the presence and extent of cognitive
deterioration. Findings are mixed with 13 studies
reporting evidence for deterioration in at least a
subset of patients with chronic epilepsy while 12
report no evidence of cognitive decline. More recent
test-retest studies (from 1980 to present) also have
produced inconsistent findings with evidence both
supporting (Rodin, 1968; Seidenberg et al., 1981;
Corbett et al., 1985; Rodin et al., 1986) and failing
to support (Selwa et al., 1994; Holmes et al., 1998)
the notion of progressive cognitive deterioration. It is
possible that other important variable(s) co-vary with
the simple duration of epilepsy and are predictive of
cognitive decline. For example, progressive cognitive
decline has been frequently, but not unequivocally,
associated with poor seizure control (Rodin, 1968;
Seidenberg et al., 1981; Corbett et al., 1985) and
aspects of antiepilepsy medication treatment (Sei-
denberg et al., 1981; Rodin et al., 1986; Trimble,
1988).
Working hypotheses
Based on our cross-sectional findings to be pre-
sented, we suggest that childhood onset TLE is
associated with an adverse generalized neurodevel-
opmental impact on the immature brain character-
ized by reduced brain tissue volumes compared to
healthy controls and patients with late onset epilepsy.
This adverse impact on brain structure is associated
with, or results in, a generalized pattern of cognitive
compromise with neuropsychological difficulties not
limited to memory function. This early adverse neu-
rodevelopmental impact on brain structure and func-
tion effectively reduces cerebral reserve at an early
age. As a consequence, childhood onset TLE carries
an increased vulnerability to cognitive decline in the
context of chronic intractable epilepsy and aging.
This manuscript represents a synthesis and update
of this overall working hypothesis, the details of
which are reported elsewhere (Hermann et al., 2002;
Seidenberg et al., 2002).
Methods
Subjects
Study participants (n = 115) included patients with
temporal lobe epilepsy (n = 53) and healthy controls
(n = 62). Initial selection criteria for the epilepsy pa-
tients included the following: (a) chronological age
from 14 to 60 years; (b) complex partial seizures of
definite or probable temporal lobe origin; (c) absence
of MRI abnormalities other than atrophy on clinical
reading; and (d) no other neurological disorder. Each
patient was classified as having either definite tempo-
ral lobe epilepsy defined by continuous video/EEG
confirmation of temporal lobe seizure onset, or prob-
able temporal lobe epilepsy determined by review of

clinical semiology with features reported to reliably
identify complex partial seizures of temporal lobe
origin versus onset in other regions (e.g. frontal)
in conjunction with interictal EEGs, neuroimaging
findings, and developmental and clinical history. The
results to be presented did not differ between patients
with definite and probable temporal lobe epilepsy
and the groups were combined.
Selection criteria for healthy controls included the
following: (a) chronological age from 14 to 60; (b)
either a friend or family member of the patient; (c)
no current substance abuse, medical or psychiatric
condition that could affect cognitive functioning;
and (d) no psychotropic medications, LOC >5 min,
or history of developmental learning disorder.
All participants underwent comprehensive neu-
ropsychological assessment and high-resolution MRI
with quantitative volumetric processing. Epilepsy pa-
tients were dichotomized into early (n ----37) and late
(n -----16) age of onset groups based on a median split
of epilepsy onset age (14 years) in the larger database
of temporal lobe epilepsy patients from which this
sample was selected. The current consecutive sam-
ple was selected for study because quantitative MRI
volumetric processing had been completed. Late age
of onset patients with clear histories of early initial
precipitating injuries (n = 7) were not included as
we were interested in the effects of age of onset of
recurrent seizures on brain structure and cognition,
although secondary analyses examined the potential
relevance of early initial precipitating injuries.
In terms of chronological age, the mean age of pa-
tients with early onset temporal lobe epilepsy (31.4
years) and healthy controls (33.4 years) did not dif-
fer, but both were significantly younger than late
onset patients (39.6 years). Early onset temporal
lobe epilepsy patients had significantly less educa-
tion (12.4 years) than both healthy controls (13.6
years) and late onset patients (13.7 years). Compar-
ing the temporal lobe epilepsy groups, early onset
patients had a significantly earlier age of onset as
expected (7.8 vs. 23.3 years, P = 0.001), and both
temporal lobe epilepsy groups suffered from chronic
epilepsy as evident from the long duration of seizures
in each group (23.6 and 16.2 years), with signif-
icantly longer duration in the early onset patients
(P -----0.04). There was no significant difference in
gender distribution across the groups ( P - = 0.39).
431
The analyses to be described controlled for these
demographic and clinical characteristics.
Quantitative MRI volumetrics
Images were obtained on a 1.5 Tesla GE Signa
MRI scanner. Sequences acquired for each sub-
ject included the following. (1) Tl-weighted, three-
dimensional SPGR acquired with the following pa-
rameters: TE = 5, TR = 24, flip angle = 40, NEX
= 2, FOV = 26, slice thickness = 1.5 mm, slice
plane = coronal, matrix = 256 x 192. (2) Proton
density (PD). (3) T2-weighted images acquired with
the following parameters: TE = 36 ms (for PD) or
96 ms (for T2), TR = 3000 ms, NEX = 1, FOV =
26, slice thickness = 3.0 mm, slice plane = coronal,
matrix = 256 x 192, and an echo train length = 8.
MRIs were acquired at the University of Wisconsin
and transferred to the Image Processing Laboratory
of the Mental Health Clinical Research Center at the
University of Iowa where they were processed using
a semi-automated software package, i.e., Brain Re-
search: Analysis of Images, Networks, and Systems
(BRAINS) (Andreasen et al., 1992, 1993; Magnotta
et al., 1999b). University of Iowa staff was blinded to
the clinical and sociodemographic characteristics of
the subjects. The BRAINS software and procedures
have been shown to be of high inter-rater reliability,
intra-rater reliability, and scan-rescan reproducibil-
ity, particularly for the MRI indices that are the focus
of the current study (Andreasen et al., 1992, 1993;
Harris et al., 1999; Magnotta et al., 1999a). MRI
regions of interest for this investigation included to-
tal (supratentorial) cerebrum tissue volume including
segmented gray and white matter volumes and total
CSE Total lobar tissue volumes and segmented gray
and white matter volumes were also examined.
Neuropsychological assessment
Patients and healthy controls were administered a
comprehensive test battery and for the purposes of
this chapter we report performance on standard clin-
ical measures of intelligence (Wechsler, 1997) and
verbal and nonverbal memory function (Buschke,
1973; Buschke and Fuld, 1974).
432

Results ferences between controls and late onset epilepsy

Childhood onset TLE patients exhibit significantly
poorer performance on measures of lQ and memory
The effect of age of onset of temporal lobe epilepsy
on cognitive status was analyzed by MANCOVA
with age, gender, and education as covariates. Ta-
ble 1 provides the age-adjusted mean scores and
results of pair-wise post-hoc comparisons. The child-
hood onset temporal lobe epilepsy group performed
significantly worse than controls across all three in-
dices of psychometric intelligence and both verbal
and nonverbal memory indices, and were signifi-
cantly worse than late onset TLE subjects on all
measures of intelligence and memory. There were
fewer differences between the controls and late on-
set patients despite the fact that the latter group
had chronic epilepsy for an average of 16 years.
In summary, evidence was obtained indicating that
childhood onset TLE patients exhibit generalized
cognitive abnormalities (e.g. IQ), suggesting that
these effects extend to domains beyond that typically
attributed to temporal lobe function (e.g. memory).
Childhood onset temporal lobe epilepsy is
associated with an adverse impact on global brain
structure
The effect of age of onset of temporal lobe epilepsy
on whole brain quantitative MRI volumes and hip-
pocampal volumes was analyzed by MANCOVA
with age, gender and height as covariates. Compared
to healthy controls, early onset patients had signifi-
cantly smaller total cerebrum (supratentorial) tissue
volume; however, there were no significant MRI dif-
patients. Total hippocampal volume was also sig-
nificantly smaller in early onset Patients compared
to both late onset TLE patients and controls, while
late onset TLE and controls did not differ in total
hippocampal volume. The volumetric reductions ob-
served in the childhood onset and late onset TLE
groups are shown in Fig. 1. It is quite evident that
the percent reductions in total tissue and hippocam-
pal volumes are considerably more striking for the
childhood onset group. Because childhood onset pa-
tients had a longer duration of epilepsy than late
onset patients (23.6 vs. 16.2 years), MRI volumetric
differences between early and late onset groups were
compared via MANCOVA with duration of epilepsy
(as well as gender and height) as covariates. This
was done to rule out the possibility that reduced
volumes in early onset patients were attributable to
longer duration of epilepsy.
Furthermore, the reduction in total tissue volume
observed in the childhood onset group is not merely
due to focal temporal lobe atrophy. Fig. 2 demon-
strates that the childhood onset TLE subjects ex-
hibit significant reductions in adjusted (age, gender,
height) tissue volumes across frontal (6.9%), tempo-
ral (7.7%), parietal (7.6%) and occipital (6.2%) lobes
compared to healthy controls.
In summary, evidence was obtained indicating
that early onset TLE is associated with significant
quantitative MRI volumetric abnormalities extend-
ing outside the epileptogenic temporal lobe. This
significant brain tissue volume loss is widespread in
nature and is evident across all lobar regions. Thus,
these findings suggest that early onset TLE is asso-
ciated with an adverse neurodevelopmental impact,
generalized in nature, on brain structure.

TABLE 1
Neuropsychological results

Early onset (EO) T L E Late onset (LO) T L E Healthy controls (C) E O vs. C L O vs. C EO vs. LO

Verbal IQ 87.7 (2.2) 97.0 (2.5) 103.4 (1.6) ** ns *

Performance IQ 91.3 (2.3) 103.1 (2.6) 109.7 (1.7) ** ns **
Full-scale IQ 90.0 (2.3) 99.6 (2.6) 106.6 (1.7) ** ns **
Nonverbal SRT 43.6 (1.7) 54.9 (2.7) 62.1 (1.3) ** * **
Verbal SRT 43.2 (1.4) 51.0 (2.2) 52.1 (l.1) ** ns **

*, P < 0.05, **, P < 0.01.

Adjusted for age, gender, education.
 433

// I
/ i

.E
[] Early onset
[] Late onset

Total Tissue Hippoeampus

Fig. 1. Percent reductions in total cerebral tissue and hippocampal volumes in childhood and adult onset temporal lobe epilepsy groups
compared to healthy controls.

Increasing duration of epilepsy is associated with duration is directly related to cognition and the effect
greater cognitive impairment (progressive effects) of age of onset is statistically controlled. Table 2
for childhood onset TLE patients shows that increasing chronicity of epilepsy is asso-
ciated with declining performance across measures
It has been shown that patients with childhood onset of memory function and some, although not all,
TLE are at increased risk for both diffuse structural measures of general intellectual ability. Further dis-
brain changes and cognitive impairment, and we now cussion and analyses of epilepsy progression effects
turn to the issue of progression of cognitive impair- across a wider range of cognitive measures, control-
ment in this group of patients. We examined partial ling for the effects of normal age-related changes on
correlations between duration of epilepsy and verbal cognition, are provided in Seidenberg et al. (2002).
and visual memory as well as general intellectual
ability using gender, education, and age of onset as Discussion
covariates. The advantage of this approach is that
We have presented data comparing both quantitative
TABLE 2 MRI volumetric measures and assessment of mem-
Association between increasing years of temporal lobe epilepsy ory and intelligence in early and late onset TLE
and cognitive status patients and age-matched healthy controls. Within
Duration the context of the limitations associated with a cross-
sectional design, these data provide the opportunity
Verbal IQ -0.20
Performance IQ -0.54**
to address the issue of potential adverse and progres-
Full-scale IQ -0.40** sive effects of chronic TLE.
Nonverbal SRT -0.37** The major findings emerging from this study are
Verbal SRT -0.38** as follows. First, compared to both healthy con-
**, P < 0.01 trols and late onset patients, childhood onset TLE
434
-(
.S 4
-1
¢
Frontal Parietal
Lobe Lobe
Fig. 2. Percent reductions in total lobar tissue volumes in childhood and adult onset temporal lobe epilepsy groups compared to healthy
controls.
is associated with evidence of impaired memory
as well as more generalized intellectual function.
Second, childhood onset TLE patients showed sig-
nificant volumetric reduction in total cerebrum tis-
sue and hippocampus compared to controls and late
onset TLE patients. The volumetric reduction abnor-
malities in the childhood onset group were evident
outside the temporal lobe, observed in all total lo-
bar volumetric measurements, consistent with the
profile of generalized cognitive impairment. Third,
in the face of increasingly chronic TLE, there was
increasing impairment on both memory and IQ mea-
surements. These findings and their potential impli-
cations for understanding the progressive impact of
chronic epilepsy on cognition and brain structure in
TLE are discussed below.
Neuropsychological function in TLE
There has been a long-standing debate concerning
the possibility of progression of cognitive impair-
ments with increasing duration of epilepsy (Lesser et
al., 1986). The literature to date has produced mixed
results on this issue. Our data suggest that childhood
onset TLE is a risk factor for generalized cognitive
• Early onset
U 1.ate onset
Temporal Oecipital
Lobe Lobe
impairment. As a group, childhood TLE patients per-
formed significantly worse than controls across mea-
sure of memory and more general intellectual status.
This generalized cognitive vulnerability is entirely
consistent with previous findings demonstrating that
earlier age of recurrent seizure onset is associated
with poorer cognitive status in both adult (O'Leary
et al., 1981) and pediatric samples (Schoenfeld et al.,
1999). Furthermore, in the face of increasing chronic
epilepsy, childhood onset TLE patients showed ex-
acerbation of cognitive difficulties.
MRI volumetrics in TLE
Early onset TLE patients showed a substantial re-
duction in whole brain volume compared to both
late onset TLE patients and healthy controls, volu-
metric reductions that extended to regions outside
the epileptogenic temporal lobe. Thus, these find-
ings confirm and extend initial reports implicating
substantial extratemporal brain volume loss in TLE
(e.g. Marsh et al., 1997; Sisodiya et al., 1997).
Furthermore, these data point to the increased risk
associated with an early onset of chronic epilepsy in
extratemporal brain regions.
436
consistent with this neurodevelopmental hypothesis.
First, cognitive impairment is reported among newly
diagnosed TLE subjects compared to age-matched
controls (e.g. Kalviainen et al., 1997) and general-
ized cognitive impairment is also evident among a
pediatric sample of early onset epilepsy with rel-
atively few years of epilepsy duration (O'Leary et
al., 1981, 1983; Schoenfeld et al., 1999). In addi-
tion, recent MRI findings have found evidence for
substantial whole brain volume reduction in pediatric
samples of epilepsy subjects (Lawson et al., 2000a,b)
with a relatively short duration of epilepsy.
Additional considerations
Several limitations of the current study must be ac-
knowledged. First, we used a cross-sectional design
to investigate the issue of progression in TLE, an
issue that is best suited for longitudinal study. Direct
evidence relevant for the neurodevelopmental pro-
posal suggested here awaits a longitudinal investiga-
tion of both brain structure and cognitive function in
subjects with TLE.
Second, structural MRI cannot identify the neuro-
biological mechanisms (number of neurons, number
or complexity of synaptic connections, myelination
of fiber tracts) that could contribute to the brain
volume reduction evident in childhood onset TLE
patients. More detailed investigation using various
neuroimaging modalities (e.g. PET, diffusion ten-
sor imaging, and fMRI) could prove quite valuable
in providing information concerning the underly-
ing pathophysiological disturbances that characterize
childhood onset TLE and which set the stage for the
hypothesized neurodevelopmental impact on cogni-
tive functioning.
Conclusion
Childhood onset TLE appears to be associated with
an adverse neurodevelopmental impact on brain
structure and function, an impact that is generalized
in nature and extends outside the primary epilepto-
genic region. Whether these generalized anomalies
in brain structure and function are present prior
to childhood epilepsy onset or represent a conse-
quence of recurrent seizures (and their treatment)
on brain growth as demonstrated in animal studies
(Wasterlain et al., 1999) remains to be determined. A
complete characterization of this neurodevelopmen-
tal impact on quantitative MRI segmented volumes
and comprehensive neuropsychological status is pre-
sented elsewhere (Hermann et al., 2002). These early
neurodevelopmental effects appear to represent an
early acquired vulnerability that places childhood
onset patients at increased risk for further cogni-
tive decline in the context of increasing duration
of epilepsy. Increasing years of intractable temporal
lobe epilepsy appear associated with further declines
in neuropsychological status in general, including
abilities that extend outside the epileptogenic tem-
poral lobe in particular, the details of which are
available elsewhere (Seidenberg et al., 2002). Thus,
findings from our cross-sectional study would sug-
gest that progressive effects of intractable TLE on
cognition are evident and that patients may be made
especially vulnerable to these consequences by the
neurodevelopmental impact of childhood onset TLE
on brain structure and function.
Acknowledgements
Supported in part by NIH 37738 and MO1 RR03186.
References
Andreasen, N.C., Chen, G.C., Harris, G., Parkkinen, J., Rezai,
K. and Swayze, V.W. (1992) Image processing for the study
of brain structure and function: Problems and programs. J.
Neuropsychiatry Clin. Neurosci., 4: 125-133.
Andreasen, N.C., Cizadlo, T., Harris, G., Swayze, V., O'Leary,
D.S., Cohen, G., Ehrhardt, J. and Yuh, W.T. (1993) Voxelpro-
cessing techniques for the antemortemstudy of neuroanatomy
and neuropathology using magnetic resonance imaging. J.
Neuropsychiatry Clin. Neurosci., 5: 121-130.
Bohnen, N., O'Brien, T., Mullan, B. and So, E. (1998) Cerebellar
changes in partial seizures: clinical correlations of quantitative
SPECT and MRI analysis. Epilepsia, 39: 640-650.
Briellmann, R., Jackson, G., Kalnins, R. and Berkovic, S. (1998)
Hemicranial volume deficits in patients with temporal lobe
epilepsy with and without hippocampal sclerosis. Epilepsia,
39: 1174-1181.
Buschke, H. (1973) Selective reminding for analysis of memory
and learning. J. Verbal Learning Verbal Behav., 12: 543-550.
Buschke, H. and Fuld, P.A. (1974) Evaluating storage, retention,
and retrieval in disordered memory and learning. Neurology,
24: 1019-1025.
Camfield, P. (1997) Recurrent seizures in the developing brain
are not harmful. Epilepsia, 38: 735-737.

It is widely appreciated that animal studies
have shown the pathophysiological consequences of
seizures in the developing brain to differ from those
in the mature brain. While the immature brain is far
more prone to seizures than the mature brain, de-
veloping neurons appear less vulnerable to neuronal
damage and cell loss, with different consequences
of seizures in the mature compared to the imma-
ture brain (see Holmes and Ben-Aft, 1998, 2001
and Lado et al., 2000 for reviews). However, an in-
triguing set of evidence suggests that early seizures
may have an adverse effect on brain growth and de-
velopment. Dwyer and Wasterlain (1982) examined
the effects of ECT-induced seizures (2 per day for
10 days) in rats at different developmental stages
(2-11 days, 9-18 days, 19-28 days). Animals were
later sacrificed and differences in brain growth and
other characteristics were examined. Wasterlain and
colleagues demonstrated that repeated ECT-induced
seizures in the immature rat reduced brain growth
and resulted in a reduction of synaptic markers in
the absence of markers of neuronal cell body loss.
In addition, they reported curtailment of myelin and
selectively and permanently affected myelin-specific
lipids. These effects on brain growth and develop-
ment were dependent on the developmental stage of
the animal when seizures were induced, again more
severe when seizures occurred at younger ages, these
brain changes being evident in the absence of histo-
logic lesions (Wasterlain and Plum, 1973; Jcrgensen
et al., 1980; Wasterlain and Sankar, 1993; Waster-
lain et al., 1999). Thus, animal investigations have
demonstrated a vulnerability of the immature brain
to insults that affect markers of growth and develop-
ment. Until now, this issue has not been examined
in human epilepsy. The findings reported here, and
elaborated elsewhere (Hermann et al., 2002), are
consistent with the general theme of the reviewed
animal findings. Early onset epilepsy appears to be
associated with markers of adverse neurodevelop-
ment as reflected by quantitative MRI volumetrics as
well as associated with a generalized adverse effect
on cognitive function.
Cerebral reserve and early onset TLE
The notion that brain-reserve capacity or 'cerebral
reserve' may mediate the cognitive effects of neuro-
435
logic insults has been a topic of considerable interest.
According to this hypothesis, individuals have differ-
ent thresholds for exhibiting neuropsychological and
behavioral symptoms in the face of seemingly simi-
lar cerebral insults (Satz, 1993). Persons with greater
brain-reserve capacity are hypothesized to be able
to sustain more neurobiological insults before man-
ifesting cognitive symptoms than persons with less
cognitive reserve. The concept of cerebral reserve
has been traditionally applied to attempts to under-
stand the risk for cognitive decline across a variety
of adult onset neurologic disorders (Satz, 1993). Re-
cently, Dennis et al. (2000) extended the concept of
cerebral reserve to understanding risk for age-related
decline among people who have suffered an early
childhood brain insult. Specifically, they suggested
that an early brain insult confers an increased risk for
accelerated aging effects on cognition due to reduced
reserve.
A recent paper (Jokeit et al., 2000) suggested that
the concept of cerebral reserve might also be a useful
construct in understanding the risk of cognitive de-
terioration in TLE. They found that duration-related
declines in intellectual functioning were related to
low education level. In contrast, intellectual ability
was considerably more stable among TLE patients
with higher education levels.
The current study offers additional support for
the notion that cerebral reserve may be an important
concept in understanding the mechanisms underlying
cognitive impairment in TLE. We found significantly
reduced total brain volume for childhood TLE com-
pared to healthy controls and late onset TLE patients.
Thus, early onset of temporal lobe epilepsy may be
associated with an adverse neurodevelopmental im-
pact on brain structure, an impact that may constitute
an early-acquired neurobiological vulnerability for
progressive cognitive decline in the face of ongo-
ing chronic epilepsy. That is, early onset TLE may
render patients with less cerebral reserve (i.e. to-
tal brain tissue volume) with which to ultimately
withstand increasing years of epilepsy and even nor-
mal age-related brain changes. This may result in a
progression of cognitive impairment over time. Ac-
cordingly, it is not simply the duration of epilepsy
that determines risk, but the timing and occurrence of
the initial insult and age of onset of chronic epilepsy.
Recent data from other cross-sectional studies are

Chelune, G. (1995) Hippocampal adequacy versus functional re-
serve: predicting memory functions following temporal lobec-
tomy. Arch. Clin. Neuropsychol., 10: 413-432.
Corbett, J.A., Trimble, M.R. and Nichol, T.C. (1985) Behavioral
and cognitive impairments in children with epilepsy: the long-
term effects of anticonvulsant therapy. J. Am. Acad. Child
Psychol., 24: 17-23.
DeCarli, C., Hatta, J., Fazilat, S., Fazilat, S., Gaillard, W.D. and
Theodore, W.H. (1998) Extratemporal atrophy in patients with
complex partial seizures of left temporal origin. Ann. Neurol.,
43: 41-45.
Dennis, M., Speilger, B.J. and Hetherington, R. (2000) New
survivors for the millennium: cognitive risk and reserve in
adults with childhood brain insults. Brain Cogn., 42: 102-105.
Dwyer, B.E. and Wasterlain, C.G. (1982) Electroconvulsive
seizures in the immature rat adversely affect myelin accu-
mulation. Exp. Neurol., 78: 616-628.
Glosser, G., Cole, L.C., Saykin, A.J. and Sperling, M. (1997)
Predictors of intellectual performance in adults with temporal
lobe epilepsy. J. Int. Neuropsychol. Soc., 9: 252-259.
Harris, G., Andreasen, N. and Cizadlo, T. et al. (1999) Improving
tissue classification in MRI: a three-dimensional multispectral
discriminant analysis method with automated training class
selection. J. Comput. Assist. Tomogr., 23: 144-154.
Henry, T. (2000) PET: cerebral blood flow and glucose metabo-
l i s m - presurgical localization. Adv. Neurol., 83: 105-121.
Hermann, B., Seidenberg, M., Schoenfeld, J. and Davies, K.
(1997) Neuropsycfiological characteristics of the syndrome of
mesial temporal sclerosis. Arch. Neurol., 54: 369-376.
Hermann, B., Seidenberg, M., Bell, B., Rutecki, E, Sheth, R.,
Wendt, G., O'Leary, D. and Magnotta, V. (2002) The neurode-
velopmental impact of childhood onset temporal lobe epilepsy
on brain structure and function. Epilepsia, in review.
Holmes, G.L. and Ben-Ari, Y. (1998) Seizures in the developing
brain: perhaps not so benign after all. Neuron, 21:1231-1234.
Holmes, G.L. and Ben-Ari, Y. (2001) The neurobiology and
consequences of epilepsy in the developing brain. Pediatr.
Res., 49: 320-325.
Holmes, M.D., Dodrill, C.B., Wilkus, R.J. and Ojemann, G.A.
(1998) Is partial epilepsy progressive? Ten-year follow-up of
EEG and neuropsychological changes in adults with partial
seizures. Epilepsia, 39:1189-1193.
Jokeit, H., Seitz, R.J., Markowitsch, H.J., Neumann, N., Witte,
O.W. and Ebner, A. (1997) Prefrontal asymmetric interictal
glucose hypometabolism and cognitive impairment in patients
with temporal lobe epilepsy. Brain, 120: 2283-2294.
Jokeit, J., Luerding, R. and Ebner, A. (2000) Cognitive impair-
ment in temporal lobe epilepsy. Lancet, 355: 1018-1019.
JCrgensen, O.S., Dwyer, B. and Wasterlain, C.G. (1980) Synaptic
proteins after electroconvulsive seizures in immature rats. J.
Neurochem., 35: 1235-1237.
Kalviainen, K., Partanen, K., Aikia, M., Mervaala, E., Vainio,
E, Riekkinen, EJ. and Pitkanen, A. (1997) MRI-based hip-
pocampal volumetry and T2 relaxometry: correlation to verbal
memory performance in newly diagnosed epilepsy patients
with left-sided temporal lobe focus. Neurology, 48: 286-287.
Lado, EA., Sankar, R., Lowenstein, D. and Moshe, S.L.
437
(2000) Age-dependent consequences of seizures: relationship
to seizure frequency, brain damage, and circuitry reorganiza-
tion. Ment. Retard. Dev. Disabil. Res. Rev., 6: 242-252.
Lawson, J.A., Vogrin, S., Bleasel, A.F., Cook, M.J., Burns, L.,
McAnally, L., Pereira, J.K. and Bye, A.M. (2000a) Predictors
of hippocampal, cerebral and cerebellar volume reduction in
childhood epilepsy. Epilepsia, 41: 1540-1545.
Lawson, J.A., Vogrin, S., Bleasel, A.E, Cook, M.J. and Bye,
A.M. (2000b) Cerebral and cerebellar volume reduction in
children with intractable epilepsy. Epilepsia, 41: 1456-1462.
Lee, J., Andermann, F., Dubeau, E, Bernasconi, A., MacDonald,
D., Evans, A. and Reutens, D. (1998) Morphometric analysis
of the temporal lobe in temporal lobe epilepsy. Epilepsia, 39:
727-736.
Lesser, R.E, Luders, H., Wyllie, E., Dinner, D.S. and Mor-
ris, H.H. (1986) Mental deterioration in epilepsy. Epilepsia,
27(Suppl. 2): S105-123.
Magnotta, V.A., Heckel, D., Andreasen, N.C., Cizadlo, T., Cor-
son, P.W. and Ehrhardt, J.C. et al. (1999a) Measurement of
brain structures with artificial neural networks: two- and three-
dimensional applications. Radiology, 211: 781-790.
Magnotta, V., Andreasen, N. and Schultz, S. et al. (1999b)
Quantitative in vivo measurement of gyrification in the human
brain: Changes associated with aging. Cereb. Cortex, 9: 151-
160.
Marsh, L., Morrell, M., Shear, P., Sullivan, E., Freeman, H.,
Marie, A., Lim, K. and Pfefferbaum, A. (1997) Cortical
and hippocampal volume deficits in temporal lobe epilepsy.
Epilepsia, 38: 576-587.
Ney, G.C., Lantos, G., Barr, W.B. and Schaul, N. (1994) Cere-
bellar atrophy in patients with long-term phenytoin exposure
and epilepsy. Arch. Neurol., 51: 767-771.
O'Leary, D.S., Seidenberg, M., Berent, S. and Boll, T.J. (1981)
Effects of age of onset of tonic-clonic seizures on neuropsy-
chological performance in children. Epilepsia, 22: 197-204.
O'Leary, D.S., Lovell, M.R., Sackellares, J.C., Berent, S., Gior-
dani, B., Seidenberg, M. and Boll, T.J. (1983) Effects of age
of onset of partial and generalized seizures on neuropsycho-
logical performance in children. J. Nerv. Ment. Dis., 171: 624-
629.
Rodin, E.A. (1968) The Prognosis of Patients with Epilepsy.
Charles C. Thomas, Springfield, IL.
Rodin, E.A., Schmaltz, S. and Twitty, G. (1986) Intellectual
functions of patients with childhood-onset epilepsy. Dev. Med.
Child Neurol., 28: 25-33.
Satz, P. (1993) Brain reserve capacity on symptom onset af-
ter brain injury: a formulation and review of evidence for
threshold theory. Neuropsychology, 7: 273-295.
Schoenfeld, J., Seidenberg, M., Woodard, A., Hecox, K., Inglese,
C., Mack, K. and Hermann, B. (1999) Neuropsychological and
behavioral status of children with complex partial seizures.
Dev. Med. Child Neurol., 41: 724-731.
Seidenberg, M., O'Leary, D.S., Berent, S. and Boll, T. (1981)
Changes in seizure frequency and test-retest scores on the
Wechsler Adult Intelligence Scale. Epilepsia, 22: 75-83.
Seidenberg, M., Hermann, B.E, Bell, B., Dow, C., Rutecki,
E, Seth, R., Woodard, A.R., Wendt, G., Magnotta, V. and
438
O'Leary, D. (2002) Progressive changes in cognition and
quantitative MRI in childhood onset temporal lobe epilepsy.
Neuropsychology, in review.
Selwa, L.M., Berent, S., Giordani, B., Henry, T.R., Buchtel,
H.A. and Ross, D.A. (1994) Serial cognitive tests in temporal
lobe epilepsy: longitudinal changes with medical and surgical
therapies. Epilepsia, 35: 743-749.
Sisodiya, S.M., Moran, N., Free, S.L., Kitchen, N.D., Stevens,
J.M., Harkness, EJ., Fish, D.R. and Shorvon, S.D. (1997)
Correlation of widespread preoperative magnetic resonance
imaging changes with unsuccessful surgery for hippocampal
sclerosis. Ann. Neurol., 41: 490-496.
Sutula, T. and Hermann, B. (1999) Progression in mesial tempo-
ral lobe epilepsy. Ann. NeuroL, 45: 553-556.
Trimble, M.R. (1988) Cognitive hazards of seizure disorders.
Epilepsia, 29: S19-$24.
Wasterlain, C.G. and Plum, E (1973) Vulnerability of developing
rat brain to electroconvulsive seizures. Arch. Neurol., 29: 38-
45.
Wasterlain, C.G. and Sankar, R. (1993) Excitotoxicity and the
developing brain. In: G. Avanzini, R. Fariello, U. Heinemann
and R. Mutani (Eds.), Epileptogenic and Excitotoxic Mecha-
nisms. Libbey and Company, London, pp. 135-151.
Wasterlain, C.G., Thompson, K.W., Kornblum, H., Mazarati,
A.M., Shirasaka, Y., Katsumori, H. et al. (1999) Long-term
effects of recurrent seizures on the developing brain. In: A.
Nehlig, J. Motte, S.L. Mosh6 and E Plouin (Eds.), Childhood
Epilepsies and Brain Development. Libbey and Company,
London, pp. 237-254.
Wechsler, D. (1997) WA1S Ill/WMS llI Technical Manual. The
Psychological Corporation, San Antonio, TX.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vo|. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAFFER 39

Effects of chronic epilepsy on declarative memory systems

C. Helmstaedter*

Department of Epileptology, University of Bonn, 53105 Bonn, Germany

Abstract: Memory is systematically affected by temporal lobe epilepsy. Since surgery is a promising alternative to
pharmacological treatment the questions which memory system is affected and what the long-term prognosis of memory is
are more relevant than ever. We address these issues by cross-sectional and longitudinal analysis of memory performance in
large series of patients with temporal lobe epilepsy (TLE). The findings indicate that episodic memory rather than semantic
memory is impaired in TLE, in particular in TLE with mesial temporal pathology. With the exception that mesial functions
appear increasingly affected by chronic non-mesial TLE, memory decline in TLE is not different from that observed
in healthy control subjects. However, since patients perform poorer than controls at any age, normal senescence brings
patients to nmesic disability at a younger age. Semantic memory seems unaffected by this process but early cortical lesions
appear to interfere with knowledge acquisition. Longitudinal data come to a different conclusion regarding the contribution
of epilepsy/seizures to memory decline. Conservative treatment is associated with significant decline in figural memory
and 37% of the patients experience some memory decline in the long run. Surgery partly anticipates the decline observed
with conservative treatment, but losses are most marked after left temporal lobe surgery. After surgery, quite stable memory
or even late recovery from surgery is indicated. Leaving aside the surgical intervention, the data provide evidence that the
longitudinal memory outcome in TLE is determined by seizure control, seizure severity, mental reserve capacities, and the
retest interval. Thus early and efficient seizure control and the prevention of any cerebral damage from the beginning of
epilepsy are demanded.

Introduction therefore self-evident that memory deficits represent

Memory is one of the most essential higher brain
functions since it provides continuity in time, per-
sonal history, and awareness. Theoretically declara-
tive memory, that is the encoding and explicit re-
trieval of new information, is separated from non-
declarative memory which comprises skill-oriented
learning, conditioning and priming processes and
which can be driven automatically and implicitly.
Neuroanatomically, declarative memory is strongly
associated with temporo-mesial structures. It is
* Correspondence to: C. Helmstaedter, University Clinic
of Epileptology, Sigmund Freud Strasse 25, 53105
Bonn, Germany. Tel.: -t-49-228-287-6108; Fax: +49-
228-287-6294; E-mail: C.Helmstaedter@uni-bonn.de or
C.Helmstaedter @web.de
the major cognitive impairment in focal epilepsies
which directly affect these structures, i.e. the tem-
poral lobe epilepsies (TLE) (Hermann et al., 1997).
Since TLE represents the majority of chronic fo-
cal epilepsies - - about 80% in the Bonn series - -
and since memory is the function which is directly
affected by temporal lobe lesions and functional
disturbances, the question of how chronic epilepsy
affects declarative memory systems will be discussed
in relation to this particular type of epilepsy. Other
focal epilepsies (frontal, parietal, occipital, etc.) will
not be explicitly addressed but a distinction between
mesial and non-mesial, cortical temporal lobe epilep-
sies will be made. In terms of disease progression
and functional reserve capacities the non-mesial tem-
poral lobe epilepsies can be assumed to share many
features with other cortically located epilepsies.
440
Declarative memory in temporal lobe epilepsy
In recent years great efforts have been made to
specify memory problems in TLE and to establish
the neuroanatomical and functional basis of these
problems (Helmstaedter and Kurthen, 2001). Within
the declarative memory system, a basic distinction
is made between 'episodic memory' and 'semantic
memory' (Tulving, 1984). 'Episodic memory' means
the memory for time- and context-dependent infor-
mation (the car you own) and semantic memory
refers to memory for context- and time-independent
(world-) knowledge (what a car is in general).
As for TLE and 'episodic memory', material-
specific verbal or nonverbal memory impairment can
be diagnosed dependent on whether the language
dominant or nondominant hemisphere is affected,
(Jones-Gotman et al., 1993). In accordance with neu-
robiological suggestions (Eichenbaum et al., 1992;
Squire, 1992), we and other groups have shown that
left-sided mesial pathology in TLE correlates well
with impairment of verbal long-term consolidation
and retrieval. In contrast, cortical temporo-lateral
pathology is associated rather with impaired verbal
learning, short-term or working memory. This pattern
has been demonstrated in detail also by correlation
of intracranial, subdurally and intra-hippocampally
recorded event-related potentials to measures of
memory, by different effects of mesial and cortical
pathology on memory, and by different memory out-
come after various types of temporal lobe surgery
(Elger et al., 1997; Helmstaedter et al., 1997b).
For semantic memory in TLE patients, the find-
ings are less consistent. In a study of confrontative
naming after temporal lobectomy, Bell et al. (2000)
found naming performance deficits dependent on age
at acquisition (greater loss of names acquired later)
but not on semantic attributes (living/nonliving) of
the object names. Studies on semantic word flu-
ency come to inconsistent conclusions as to whether
category-specific impairment can be discerned in
TLE or not. Jokeit et al. (1998) report category-
specific impairment in naming as dependent on the
lateralization of seizure focus. In contrast, Gleil3ner
and Elger (2001) report general but no category-
specific deficits in semantic fluency in TLE which
appeared related to mesial pathology. One of our own
studies on relational memory processing demon-
strated that patients with left TLE show increasing
memory problems with greater relational (semantic)
distances between memory contents (Helmstaedter
et al., 1997a). We interpreted this finding as in-
dicative of deficits in semantic relational memory
processing. Recently, impairment of remote autobi-
ographical episodic memory has also been reported
in TLE (Viskontas et al., 2000). In contrast, personal
semantic memory appears unaffected (Bergin et al.,
2000). In summary, there is some evidence that pa-
tients with TLE indeed have problems with semantic
memory processing but it needs to be examined in
more detail to which degree deficits in the acquired
semantic network and knowledge system architec-
ture or impaired retrieval processes are responsible
for these problems.
Originally, episodic and semantic memory were
thought to represent only two aspects of a unitary
declarative memory system which become equally
impaired with temporo-mesial lesions. This must be
doubted since there is evidence from semantic de-
mentia that semantic memory is more closely related
to cortical structures and the permanent repository of
knowledge (Garrard and Hodges, 2000). While en-
coding and retrieval of episodic information strongly
depend on mesial functions, semantic knowledge
can become independent from hippocampal func-
tional integrity (Nadel et al., 2000). Independence
of semantic memory acquisition from hippocampal
functioning is suggested by Varhga-Khadem et al.
(1997) who found that semantic knowledge had been
acquired in spite of the presence of severe episodic
memory impairment in single patients with very
early damage of mesial structures. From a theoreti-
cal point, the dissociation of semantic and episodic
memory may be an answer to the ongoing 'chicken-
egg discussion' of whether impaired episodic mem-
ory hinders acquisition of semantic knowledge or
vice versa (Squire and Zola-Morgan, 1996; Eichen-
baum, 1997; Tulving and Markowitsch, 1998).
Longitudinal studies of memory in chronic TLE
Now that epilepsy surgery has become a serious
and very successful alternative to medical treatment,
patients with chronic epilepsy have a legitimate in-
terest in knowing their cognitive prognosis with the
respective treatment.
 441

TABLE 1
Longitudinal studies on cognition in focal epilepsies

Study Nr. of groups Interval Seizure JQ Memory Non-memory

outcome
(seizure free)

Selwa et al., 28 conserv. 1-8 conserv, no no change in no change in conserv.

1994 (TLE) years change conserv. patients
31 surgery 2-17 surgery 64% better after improvement after
(TLE) months right-sided right-sided surgery
surgery
Rausch et al., 20 surgery >9 short- and long-term losses
1994 (TLE) years in verbal memory after
left-sided surgery
Holmes et al., 25 conserv. 10 years improvement improved logical memory unchanged worsened speed
1998 (partial 33% performance and visual spatial
epilepsies) functions
Helmstaedter et 47 conserv. 2-10 surgery 64% worse verbal memory after improved attention
al., 2000 (TLE) years left- than right-sided surgery after surgery
114 surgery conserv. 24% stable course after surgery
(TEE) worsened figural memory
with conservative treatment
Aikia et al., 20 conserv. 5 years 100% stable verbal learning and
2001 (TLE) even improved delayed
recall

In general, the following factors can be suggested
to cause mental decline in chronic epilepsy: (1) pre-
existing structural lesions including surgical defects;
(2) progression of the disease underpinning epilepsy;
(3) progression of epilepsy (secondary epileptoge-
nesis, kindling, etc.); (4) accumulation of lesions
secondary to epilepsy (trauma, intoxication, status
epilepticus, etc.); (5) physiological or pathological
aging.
There are two essential questions regarding the
prognosis of memory in TLE. Firstly, what is the
risk of memory decline in chronic medically treated
epilepsy as compared to the risk of memory decline
after successful surgery (to say nothing of those pa-
tients who do not become seizure free after surgery),
and secondly, what are the additional effects of aging
on cognitive function in both groups. We evaluated
these questions with a cross-sectional and longitudi-
nal study approach, the latter findings being reported
first. (An overview over cross-sectional and longi-
tudinal studies and a discussion of the differences
between these approaches are provided by Dodrill,
2002, this volume.)
Longitudinal studies, which address the issue of
long-term changes of episodic memory performance
in chronic epilepsy span intervals ranging from 2
to 10 years (see Table 1). These studies have in-
dicated quite stable memory performance when pa-
tients are treated conservatively with antiepileptic
drugs (Selwa et al., 1994; Holmes et al., 1998; ,~iki~i
et al., 2001). Our own evaluation (Helmstaedter et
al., 2000) of 47 patients with TLE (mean retest
interval 56 4- 26 months), indicates significant deteri-
oration of figural memory performance (see Figs. 1
and 2). The study of Holmes et al. (1998) revealed
mild deterioration in speed and, interestingly, also
in visuo-spatial functions. When classified accord-
ing to reliability of change indices, our data show
that about 20% of the conservatively treated patients
significantly decline in verbal or figural memory,
only 5 to 10% of the patients had improved memory
functions (see Table 2). Taking together both ver-
bal and figural learning, 37% of the conservatively
treated patients showed a significant deterioration in
memory in the long run. So far the high number of
patients who show individual decline in either verbal
or figural memory supports the assumption of an ac-
cumulation of lesions over time. The finding of a sig-
nificant deterioration particularly of figural memory
is of interest since it directs attention to the widely
442

figural memory [standard values]

120
i-p<o.os1 Fp<O.OS7
110 -

100 -

80

70
II test times

iT1
60 ~
[ ~ T2

50 i i i
iT3
conservative right surgery left surgery
47 51 63
Fig. l. Box plot of figural memory performance (standard value with mean = 100, SD = 10) in design learning in conservatively
and operatively treated patients with temporal lobe epilepsy. For conservative patients results at two (initial and long-term follow-up
evaluation [2-10 yrs, 56-4-26 months]) and for operated patients results at three test times (preoperative, one year postoperative and
long-term follow-up evaluation [2-10 yrs, 58-4-28 months) are displayed. Significance levels result from t-tests for dependent measures.
The data indicate significant losses in conservative patients and after right temporal surgery.

neglected right hemisphere. Our current working hy-
pothesis is that this finding may reflect compensatory
sacrifice of right hemisphere functions for preserva-
tion of verbal functions as observed in patients with
right hemisphere language representation and early
acquisition of left hemisphere lesions (Helmstaedter
et al., 1994). From surgical patients who underwent
left amygdalo-hippocampectomy at least we have
evidence that, after surgery, right mesial structures
compensate verbal memory functions which were
associated to the left mesial lobe before surgery
(Grunwald et al., 1998).
In contrast to the course of memory function
in conservatively treated patients, epilepsy surgery
often marks a significant step in regard to cog-
nitive performance. While temporal lobe epilepsy
surgery is very successful in permanently controlling
seizures, deterioration of memory is very likely when
brain tissues are removed which are still involved in
memory function (Helmstaedter and Kurthen, 2001).
As regards verbal memory, baseline performance to-
gether with age at surgery are powerful predictors
of the postoperative outcome (Helmstaedter and E1-
ger, 1996; Davies et al., 1998; Helmstaedter, 1999).

Fig. 2. Box plot of verbal memory performance (standard value with mean = 100, SD = 10) in list learning in conservatively and
operatively treated patients with temporal lobe epilepsy: (a) learning over 5 trials; (b) loss of learned items after 1/2 h delay). For
conservative patients results at two (initial T1 and long-term follow-up evaluation T3) and for operated patients results at three test times
(preoperative T1, one year postoperative T2 and long-term follow-up evaluation T3) are displayed. Significance levels result from t-tests
for dependent measures. The data indicate significant losses in verbal learning after left surgery and stable performance at the long-term
follow-up. After right-sided surgery reversible loss in verbal delayed recall is indicated.
 443

verbal learning trials 1 to 5 [standard value]

120-

100-

60-
I i
II test times

~T1

~T2
Lp<o.ooIJ
(a) L p<O.Ol J T3
40 i i i

conservative right surgery left surgery

47 51 63

verbal memory loss in free recall [standard value]

120

100

||
80

Lp<o.ol-J
test times
60.
BT1

~T2
(b)
40 i i i
BT3
conservative right surgery left surgery
47 51 63
444

TABLE 2
Long-term memorychange in conservativelyand surgicallytreated patients with TLE
Group Verbal learning Figural learning Total (verbal and figural)
baseline- postop.- baseline- postop.- baseline- postop.- baseline-
postop, long-term postop, long-term postop, long-term long-term
loss/gain loss/gain loss/gain loss/gain loss/gain loss/gain loss/gain
(%) (%) (%) (%) (%) (%) (%)
Conservative - 20/6 - 22/9 - 37/9
Right-sided surg. 18/4 16/4 12/6 8/16 25/4 24/4 33/12
LeR-sided surg. 37/2 8/6 21/15 5/14 48/0 10/6 44/12
Individual changes according to reliability of change indices (p = 0.1).
Postoperative memory changes (baseline-postop.), changes from postoperative to long-term follow-up in surgical patients and from
baseline to long-term follow-up in conservative patients (postop.-long-term),and changes from baseline to long-term (baseline-long-
term). Numbers indicate the percentage of patients who, according to reliability of change indices, showed significantly deteriorated or
improved performancein the respective aspects of memory.

Losses due to surgery are most marked when patients
are operated at an age beyond of 30 years, when
fluent intelligence starts to stagnate and when capac-
ities for behavioral compensation are beginning to
deteriorate (regarding fluid/crystallized intelligence
see: Cattell, 1957). Much better outcome is achieved
when surgery is performed at an age before puberty,
when functional plasticity can compensate surgical
damage (Helmstaedter, 1999).
Accepting that surgery can cause significant ad-
ditional memory impairment and accepting that
episodic memory functions like other functions of
'fluid intelligence' (Cattell, 1957) deteriorate with
normal aging (Balota et al., 2000; Zacks et al., 2000),
one may hypothesize that in operated patients, even
when seizures are controlled, severe amnesic syn-
dromes will become evident with an advanced age.
Preliminary long-term follow-up data of memory
performance after left temporal lobe surgery which
were presented by R. Rausch at the annual AES
meeting in 1994, strongly supported this assumption,
in that verbal memory was found to have declined
further when patients were re-evaluated 10 years
after surgery.
Our long-term data of 114 operated patients with
TLE, however, lead to a different conclusion. The
results clearly demonstrate the known initial impact
of surgery on memory at the follow-up evaluation
one year postoperatively. As can be seen in Fig. 1
figural learning is affected by right temporal surgery
and verbal learning (the more cortical aspect) but not
loss of learned words in delayed recall (the more
mesial aspect) are affected by left temporal surgery
(Fig. 2).
Taking together verbal and figural learning, 48%
of the left temporal and 25% of the right tempo-
ral resected patients showed a significant decline in
performance at the one-year postoperative follow-
up evaluation. From this time on, however, relatively
stable courses of verbal and figural memory were ob-
served in follow up-intervals up to 10 years (Figs. 1
and 2, Table 2). Individual losses and gains over
this period were largely balanced and by part even
indicated long-term recovery after surgery. Aggre-
gating verbal and figural memory 24% of the fight
temporal resected patients and only 10% of the left
temporal resected patients showed further losses in
memory. Finally, when considering the whole time
interval from baseline to the long-term follow-up
evaluation, 44% of the left and 33% of the fight
temporal resected patients show a significant mem-
ory loss as compared to 37% of the conservatively
treated patients (Table 2).
Looking at the long-term memory outcome in
conservative and operated patients without consider-
ation of the changes caused by surgery, the following
variables turn out to be significant predictors of
the course of memory performance: baseline perfor-
mance, degree of seizure control and frequency of
secondarily generalized seizures, duration of retest
interval, and verbal IQ (estimated by a vocabulary
test) (Table 3). Going into more detail, only 17%
of the seizure-free patients showed an individually
significant memory decline as compared to 21% of

TABLE 3
Predictors of long-term changes in memory
ANOVA Predictors
Greater loss F = 13.1, better baseline
in (verbal/ p < 0.001 performance
nonverbal) R 2 = 0.27 greater number of
memory i generalized seizures
longer retest interval
lower IQ
poorer overall
seizure control
Stepwise regression performed for all patients with TLE (n =
151).
*, p < 0.05; ***, p < 0.001.
l Difference in non-operated patients: long-term follow-up minus
baseline performance. Difference in operated patients: long-term
follow-up minus performance 1 year after surgery.
those with 2-12 seizures per year and 38% of those
with more than 12 seizures per year.
Summarizing the long-term data, the results show
that a considerable number of conservatively treated
patients experience memory decline in the long run.
Mean group data indicate that in this group major
losses are observed in figural memory performance.
Surgery partly anticipates the changes observed with
conservative treatment by causing a marked decline
in verbal learning or figural learning directly after
surgery. In the following years a significantly more
stable performance is indicated than with conserva-
tive treatment. However, immediate and longitudinal
losses after left temporal lobe surgery exceed those
observed with conservative treatment. The sponta-
neous course of memory in TLE is determined by
seizure control, seizure severity, cognitive reserve
capacities, and the time interval. In this respect it
is important to note that 64% of the operated pa-
tients became seizure free as compared to 23% of
the conservatively treated patients and that only 20%
of those who were seizure free remained on a poly-
therapy as compared to more than 70% of those who
still had seizures.
Cross-sectional studies on m e m o r y in chronic
TLE
Longitudinal studies cover relatively short time in-
tervals as compared to an average lifespan. Hence
445
inferences on longer intervals must be drawn from
cross-sectional evaluations. There is a large num-
ber of cross-sectional studies addressing the question
t-test
of mental deterioration in chronic epilepsy. These
t = 5.0*** studies mostly focus on intelligence indicating that
an earlier onset of epilepsy and a longer duration
t = 3.5***
of epilepsy may be associated with poor intellec-
t = 2.2* tual attainment. A recent study by Jokeit and Ebner
t = 2.2* (1999) demonstrated that with a duration of epilepsy
t = 2.1' exceeding 30 years, mental decline can be expected,
and that this deterioration can be delayed in pa-
tients with higher levels of education. Although not
explicitly discussed by the authors, their findings
suggest that this relation becomes particularly evi-
dent with measures of 'fluid intelligence' since the
relation between 'duration of epilepsy' and 'intel-
lectual decline' becomes more pronounced when the
WAIS short-form IQ is subtracted from 'crystallized
vocabulary IQ' (Jokeit et al., 2000). From a method-
ological point of view the conclusion of a superiority
of the factor 'duration of epilepsy' over the fac-
tor 'age' is questionable because regression analyses
were calculated using IQ data, which are already
corrected for age (see also Hermann et al., 2002, this
volume, and Jokeit and Ebner, 2002, this volume).
In 1995, the Bozeman Epilepsy Consortium, which
represents eight major epilepsy centers in the USA,
examined the contribution of age, age at seizure onset,
duration of epilepsy, focus laterality and other vari-
ables not only to IQ but also to memory performance
in 1141 patients with pharmacoresistant epilepsy. In
contrast to Joker and Ebner (1999) and Jokeit et al.
(2000), this study revealed earlier onset of epilepsy as
the only factor of poor performance in both domains
(Strauss et al., 1995).
One must be cautious when trying to predict lon-
gitudinal courses of performance on the basis of
cross-sectional data because one needs to control
possible cohort effects. With respect to epilepsy, im-
provement of diagnosis and treatment regimens, as
well as the introduction of the 'new' AEDs must be
taken into account as potential causes of cohort ef-
fects. In any case, with temporal lobe epilepsies and
mesial temporal lobe epilepsy in particular we face
the additional problem that most of these epilepsies
start early in life and that the duration of epilepsy is
therefore strongly correlated with chronological age.
In contrast, when patient samples with a wider range
446

of epilepsy onsets are evaluated, a different etiology TABLE 4

of epilepsies must be considered and controlled for. Subject characteristics
In order to solve this methodological problem we
Patients Patients Healthy F/X 2
conducted a study on aging and episodic/semantic mTLE n m T L E controls significance
memory in a homogeneous group of patients with
left mesial temporal lobe epilepsy (with hippocam- n 63 87 125
Sex (m/f) 34/29 37/50 80/45 1.9 n.s.
pal sclerosis/atrophy) and compared age regression Age (years) 32/9.2 27.8/8.4 27.2/8.7 9.8**
of memory in these patients with that obtained in Handedness 0.01 n.s.
patients with non-mesial temporal lobe epilepsy (i.e. - right 84% 64% -
no hippocampal sclerosis/atrophy). Furthermore, in - left 9% 10% -
contrast to other cross-sectional studies, age regres- - ambidextrous 7% 6% -
Age at onset of 9.8/7.6 12.6/7.2 - 5.3**
sions in the patient groups were compared with those epilepsy (years)
in an age-matched group of healthy subjects (see Duration of 22.6/11.6 15.2/9.3- 18.5"*
also Helmstaedter and Elger, 1999a,b; Helmstaedter, epilepsy (years)
2000). We hypothesized, that effects of chronic Pathology:
epilepsy on memory, i.e. accelerated memory de- - no finding 23%
- HS 1 0 0 % - -
m

cline, may be evidenced by different age regressions - tumor 4 3 %

m

in patients and healthy control subjects. The study - DNT 5% m

comprised 63 patients with mesial (mTLE) and 87 - cort. dyspl. 10%

patients with non-mesial left temporal lobe epilep- - other 19% - m

sies (nmTLE) who were evaluated with respect to
word list learning (episodic memory), passive vocab-
ulary (semantic knowledge), and semantic decision
making. Memory and vocabulary were also eval-
uated in 125 age-matched healthy volunteers (see
Table 4). Verbal episodic memory was assessed by
the VLMT (Verbaler Lern- und Merkf~ihigkeits test)
a German test which in analogy to the AVLT re-
quires serial list learning and recall over five trials,
recall after distraction, 30 min delayed recall and
recognition (Helmstaedter et al., 2001a). Vocabu-
lary was assessed by the Mehrfachwahl-Wortschatz-
Intelligenztest (MWT-B) which requires selection of
words with increasing difficulty and decreasing fre-
quency of occurrence out of alternative non-words
(Lehrl, 1978). Verbal reasoning was assessed by
a sub-test of a German intelligence test (IST =
Intelligenz-Struktur-Test), which requires selection
of a word out of five alternatives which have another
connotation or do not belong to the same semantic
field as the target word (e.g. sitting, lying, going,
kneeling, standing) (Amthauer, 1973).
For a better comparability, all scores were trans-
formed into standard values (mean 100, SD 10).
Group differences between patients with mTLE and
nmTLE were calculated by multivariate analysis of
variance. Data analysis (MANOVA) indicated that,
as a trend, mTLE patients performed more poorly on
n.s., not significant; **, p < 0.01.
the tests than nmTLE patients (F = 2.24, p = 0.054).
Univarate analysis showed highly significant group
differences in measures of episodic verbal learn-
ing and memory ( F between 5.6 and 8.2 with p-
values between <0.05 and 0.01) but not for vocab-
ulary (F = 1.1, p = 0.31) or reasoning ( F = 0.001,
p = 0.95). Mean standard values ranging between
90 and 100 indicate that semantic knowledge is
relatively preserved in left TLE (Table 5). Poor in-
tercorrelations between performance on episodic and
semantic memory indicated that these measures were
independent rather than redundant.
Age regressions show that episodic memory per-
formance (learning and recognition) deteriorates
equally with aging in healthy persons and patients
(Table 5 and Fig. 3). In contrast, semantic functions
are positively correlated to age indicating gains over
time. Only in nmTLE patients delayed recall was
negatively related to age. Since learning is more
closely associated with cortical structures and de-
layed recall is more closely associated with mesial
structures, the latter appear at particular risk of be-
coming increasingly affected in chronic nmTLE. In
nmTLE but not in mTLE, semantic memory is re-
lated positively to the age at onset of epilepsy in-
 447

3erformance [standard value]

130.
rn TEE I (a)
120.
| m •
[]

110 '1 • • • ......

1oo.1 ...... --. . . . . . . + - ' ~ . . ~ l

. ,~•~ •
L ..... . .+,~...~.P.-_,i'i"-,-i'm.,,,.,,. .m •
,'-• •
" ,, " I
90'+ m ~ • lit -I ....... l

8o,1 ".i'..'-
.... m e m o r y in controls
60 vocabulary in controls • •
memory in patients •
50 / • vocabulary in patients
lO io io 4:o ~o 60
chronological age [yrs.]
performance [standard value]
13o llnm TEEm (b)
120 ] i • | •
! [] um
m | m
110 "1 " ,m ,m m. ......... I
r .... in_m_
~ .m ,ram,mjmei
m mu
- m.m m ~ i m•~ im
._
IN
...... m
1 O0 I 1%-m,_t.~..,l --" • • • •
~ q ~ ~ - ~ . ~. • m m I

I " m = m - - ~ U in • "',..,.m.
90 I •'--P m : i ' l ~ - ~ . . . . . . . 1._ I
80 I • 1111 11 • • • |
• • • II
• IN I

70 •
.... memory in controls
60 . . . . vocabulary in controls
memory in patients
vocabulary in patients
50
1o :~o ~;o ,(o .~o 60
chronological age [yrs.]
Fig. 3. Age regressions of verbal memory (learning over 5 trials) and vocabulary in (a) 63 patients with left mesial (from Helmstaedter
and Elger, 1999a) and (b) 87 patients with left non-mesial (cortical) temporal lobe epilepsy as compared to age regressions obtained in
125 healthy subjects. Results show comparable regressions despite principal differences in performance levels.
448

TABLE 5
Group performance and correlations to chronological age and age at the onset of epilepsy
Performance Group n Mean/SD Standardvalue Correlationto age Correlation to onset of epilepsy J
(m = 100;
SD = 10)
Measures of semantic knowledge
Vocabulary (IQ) mTLE 61 98.2/11 98.9 0.45** 0.01 n.s.
nmTLE 87 98.7/12 99.2 0.09 n.s. 0.38**
(controls) (125) (104/14) 100 (0.22*) (-)
Reasoning mTLE 61 93.6 0.34** 0.26*
nmTLE 87 92.4 0.18 n.s. 0.22*
(-) (-) (-) 100 (-) (-)
Measures of episodic verbal memory
Learning mTLE 61 42.5/8.1 84.6 0.37** 0. l 1
nmTLE 87 47.3/8.3 90.6 0.29** 0.16
(controls) (125) (53.6/8.4) 100 (0.34**) (-)
Delayed recall (loss) mTLE 61 4.2/2.1 82.2 0.01 n.s. 0.00
nmTLE 87 3.2/2.2 87.6 0.28** 0.12
(controls) (125) (1.6/1.8) 100 (0.00 n.s.) (-)
Recognition memory mTLE 61 12.5/4.0 90.0 0.23* 0.03
nmTLE 87 12.9/2.3 99.5 0.33** 0,12
(controls) (125) (12.6/2.6) 100 (0.23*) (-)
l Pearson correlation coefficient (r) with levels of (two-tailed) significance: n,s., not significant; *, p < 0.05; **, p < 0.01.

dicating that less semantic knowledge has been ac-
quired by patients with earlier onset cortical lesions
(Table 5 and Fig. 4).
These results are of importance in four respects.
The data firstly emphasize the decisive contribution
of the mesial structures and hippocampal damage to
the impairment of episodic memory in TLE (Her-
mann et al., 1997). Semantic memory, in contrast,
appears rather unaffected by TLE.
Secondly, there is evidence that episodic memory
declines over time in patients and healthy subjects
as well and that age regressions are not different.
That is to say that patients perform more poorly
than controls at any age and that it is the interaction
of cerebral damage with normal aging rather than
progressive epilepsy which brings patients closer to
disabling memory impairment at older age. However,
this concerns the more cortical aspects of verbal
memory so far. An exception must probably be made
for patients with nonmesial temporal lobe epilepsies,
in whom chronic epilepsy may lead to progressive
affection of mesial functions.
Thirdly, there is no evidence from our data that
episodic memory impairment affects the acquisi-
tion of semantic knowledge. This finding is in line
with Varhga-Khadem et al. (1997) who suggest that
episodic and semantic memory differentially depend
on mesial structures.
Finally, there is evidence that early onset of
cortical lesions but not of mesial lesions hinders
knowledge acquisition. This finding provides fur-
ther evidence for the aforementioned suggestion that
episodic and semantic memory are driven by differ-
ent brain structures or systems.
Cross-sectional results on age regression of
m e m o r y before and after surgery
The results of our cross-sectional study suggest that
memory impairment in TLE and in mesial TLE in
particular becomes evident early in the course of
the disease and that further memory decline can be
expected to continue at the same rate as in healthy
individuals. Studies in newly diagnosed patients with
focal epilepsy support the suggestion of an initial
lesion (Pulliainen et al., 2000; Aiki~i et al., 2001).
Thus the cross-sectional data demand prevention of
any further cerebral damage which might acceler-
ate progressive mental aging from the beginning of
epilepsy.
 449

>erformance [standard value]

130
rn TLE ] (a)
120
R S

t
110 m • t
• M I U • I a m

100 " s | I • I m • w
~ l l . . ~ 'l' m m m m m ~ u m m ~ m

• m i i i i i • W • i |
i R N i I ! m • l I
• ~ a •
nn ml i m • i • •
~u i ~ mm • • •
~,-..L, m • • • •
• • • - ~ u
80 • • • •
• •
• •
• • • •

70 •

60 • •
memory
vocabulary
5O
0 1'0 2'0 30
a g e at the onset of epilepsy [yrs.]

)erformance [standard value]

130
nm TLEI (b)
120 M i i

M E
I
D
110 '
• •
~. • m m m • ___,..,.

m - m ml ,, • _m-----------m- J
100"( m • m m • • _ _ • ~ - - • _
n • -_. __-~_.mm----'-'--- • • - m m
| ),~m~Bm.i,,-----m i iN -- am ) mum •
~ i i ~ i i -- I l ) • •
I
•
- - um _m m i
_
~
u
~ m ~
i
m i
• - •
90 ] i • " i • • i m ~ i . . i . . ~
• • m
• m •
•
•
u i - -

• m • • • •
80'
•
I •
•
• •
| • • •
• •
• •
70'

60'
memory
vocabulary
50
0 10 2b 30
age at the onset of epilepsy [yrs.]
Fig. 4. Regression of the age at the onset of epilepsy and verbal memory (learning over 5 trials) and vocabulary in (a) 63 patients with
left mesial and (b) 87 patients with left non-mesial (cortical) temporal lobe epilepsy. Results show poorer performance in vocabulary
with an earlier onset of epilepsy in the nonmesial group.
450

~erformance [standard value]

120
L TLE .. memory before surgery

• • • • • • • memory 1 yr. after surgery

110 mm •
• • • • l • -. healthy controls
~ m • • [] •
• • • • i~ J
II.__ • • • •
• • •
I00- • • • mm - ~ . m - ~ • • • • • •
mm • mm • -&_~ • mm • •
• • mm mmm mr .,,__ • mmm
mm mmmmm mm r ~ •
• • mmm mm mm • ~ m
mm|mmmmm • • mmm " - . ~ m
90 . ~ " 1 1 ~ m ~
m •
# • mmmm •
•
• m • ~.
~
• m ~ mmmm • ~
• & mm m m m ~ • • • • -.,.,
• mm • m •
mm mm m ~ m | mmmm ~ •
• mmm ~ m m|l mmm
mm • mm mm ~ • mm • •
80. • ,• , m , '•m m , • m m
m'." I"• • ~ m
mm nmmmmmm mmm • m m m m mm i m ~ mm •
mm • • mm mm mm • • m ~ •
• • mm ,nnm • mmmm m ~ • •
mmmmmmm • i mmm •
70" "
•
mm
•
•
•
R
rmm
• •
•
• mm
~ I
mm mm
• • • mm • • •
• m
•m •
• • • • • • • •
• •
nm • m
60
• nm
• •

50 , i i ,

10 20 30 40 50 60
chronological a g e [yrs.]
Fig. 5. Age regressionof verbal memory(learningover 5 trials) in 245 patients with left temporal lobe epilepsybeforeand one year after
epilepsy surgeryas comparedto age regression of verbal memoryin 125 healthy controlpersons. While the preoperativeage regression
parallels that in controls, the significantlysteeperpostoperativeregressionindicatesacceleratedmemorydecline.

Since temporal lobe epilepsy surgery often ative patients run largely in parallel, confirming the
achieves seizure control at the risk of additional mem- findings which have above been reported for smaller
ory impairment, the obvious question is of whether groups of patients with mesial and nonmesial TLE
additional brain damage due to surgery may change (Helmstaedter and Elger, 1999a). The difference be-
the long-term prognosis of memory at an older age tween the pre- and postoperative age-related memory
(Helmstaedter et al., 2001b). decline shows that memory performance of a 33-
Fig. 5 demonstrates data from a large sample of year-old non-operated patient with left temporal lobe
245 patients with left temporal resections. 62% of epilepsy is equivalent to that of a 60-year-old healthy
these patients were completely seizure free (Engel subject. After surgery, performance of a 21-year-old
category: Ia) and losses in verbal memory were patient corresponds to that of a 60-year-old control
highly significant (learning over 5 trials: t = 6.9, person!
p < 0.0001). Thus, when bringing the fact that losses after
Age regression of verbal memory performance surgery are greater in older patients together with
changes significantly from before surgery (r = the fact that memory declines with aging, it seems
-0.287, p < 0.001) to one year after surgery that surgery not only changes the performance level
(r--0.387, p < 0.001), i.e. postoperatively, age but also accelerates cognitive aging. This example
regression is significantly steeper than the preopera- impressively demonstrates how additional lesions in
tive one (p < 0.01). the course of chronic epilepsy can change the long-
Age regressions in the healthy group and preoper- term prognosis of memory.

Summary
TLE typically affects declarative memory. Follow-
ing Tulving's differentiation of episodic and seman-
tic memory, it is the time- and context-dependent
episodic memory, which is particularly found to be
impaired. Episodic memory appears strongly linked
to the functional integrity of the temporo-mesial
structures. There is evidence that in TLE patients
also impairment of semantic memory processing can
be observed, but different from episodic memory
impairment it seems to be more related to cortical
temporal lesions and less if any to mesial hippocam-
pal damage. Conclusive with these suggestions, the
presented data show that functions indicative for
semantic memory are less affected in TLE than
episodic memory. Chronological age, age at epilepsy
onset, and duration of epilepsy have obviously a dif-
ferent impact on episodic and semantic memory as
dependent on whether epilepsy originates in cortical
or mesial structures. As regards the long-term prog-
nosis of semantic memory in TLE, cross-sectional
data show that gains in semantic knowledge can
be achieved over time despite of episodic memory
impairment. Early acquisition of cortical lesions or
early onset of non-mesial epilepsy, however, seem to
interfere with the acquisition of semantic knowledge.
This finding is consistent with those demonstrating
poorer intelligence with earlier onset epilepsy.
Cross-sectional data provide striking evidence
that there is a progressive decline of episodic verbal
memory which preferentially affects the more corti-
cal aspects of verbal learning and memory. However,
contrary to findings on intelligence, this decline ap-
pears to result from an interaction of early cerebral
damage with normal aging rather than from pro-
gressive epilepsy. Thus, the more severe the initial
damage the earlier disabling memory problems can
be expected. An exception must probably be made
for non-mesial TLE in which increasing affection
of the mesial aspects of memory with longer dura-
tion is indicated. Different from the cross-sectional
data the longitudinal data suggest deterioration of
memory in the course of chronic TLE due to un-
controlled and more severe seizures. Dependent on
seizure frequency 17% to 38% the patients experi-
ence significant memory decline in a time interval
ranging from 2 to 10 years. Complete and per-
451
manent seizure control can be achieved in more
than 60% of the operated patients but additional
memory impairment due to surgery and associated
changes of the long-term prognosis of memory with
aging necessitate a careful and individual counsel-
ing of the patient. With conservative treatment 37%
of the patients experience a significant decline in
memory. Surgery anticipates the memory decline ob-
served with conservative treatment, but left temporal
surgery specifically and permanently impairs ver-
bal memory. Deterioration of verbal memory after
left temporal resection significantly exceeds that in
conservative treatment. Regarding the relevance of
this finding one may well discuss that verbal mem-
ory impairment is of greater importance for every
day life than figural memory. The brain has limited
capacities to restitute and compensate damage and
the final conclusion from the presented findings is
as simple as it could be: memory can be protected
with achievement of early and efficient seizure con-
trol and with the prevention of any kind of cerebral
damage from the beginning of epilepsy. Thus early
neuroprotection and more safe and memory spar-
ing treatment will be important future issues in the
treatment of chronic TLE.
Acknowledgements
This work was supported by the Deutsche
Forschungsgemeinschaft DFG: EL 122-6.
References
,~iki~i, M., Salmenper~i, T., Partanen, K. and K~ilvi~iinen, R.
(2001) Verbal memory in newly diagnosed patients and pa-
tients with chronic left temporal lobe epilepsy. Epilepsy Be-
hav., 2(1): 20-27.
Amthauer, R, (1973) lntelligenz-Struktur-Test 1ST 70. Verlag
Hogrefe, Grttingen.
Balota, D.A., Dolan, P.O. and Duchek, J.M. (2000). Memory
changes in healthy older adults. In: E. Tulving and EI.M.
Craik (Eds.), The Oxford Handbook of Memory. University
Press, Oxford, pp. 395-410.
Bell, B.D., Davies, K.G., Hermann, B.P. and Waiters, G. (2000)
Confrontation naming after anterior temporal lobectomy is
related to age of acquisition of the object names. Neuropsy-
chologia, 38(I): 83-92.
Bergin, P.S., Thompson, P.J., Baxendale, S.A., Fish, D.R. and
Shorvon, S.D. (2000) Remote memory in epilepsy. Epilepsia,
41(2): 231-239.
452
Cattell, R.B. (1957) Personality and Motivation; Structure and
Measurement. World Book, Yonkers-on-Hudson, NY.
Davies, K.G., Bell, B.D., Bush, A.J. and Wyler, A.R. (1998)
Prediction of verbal memory loss in individuals after anterior
temporal lobectomy. Epilepsia, 39(8): 820-828.
Dodrill, C.B. (2002) Progressive cognitive decline in adolescents
and adults with epilepsy. In: T. Sutula and A. Pitk~inen (Eds.),
Do Seizures Damage the Brain. Progress in Brain Research,
Vol. 135. Elsevier, Amsterdam, pp. 399-407.
Eichenbaum, H. (1997) How does the brain organize memories?.
Science, 277: 330-332.
Eichenbaum, H., Cohen, N.J., Otto, T. and Wible, C. (1992)
Memory representation in the hippocampus: functional domain
and functional organization. In: L.R. Squire, G. Lynch, N.M.
Weinberger and J.L. McGaugh (Eds.), Memory: Organization
and Locus of Change. Oxford University Press, New York, pp.
163-204.
Elger, C.E., Grunwald, Th., Lehnertz, K., Kutas, M., Helm-
staedter, C., Van Roost, D., Mangun, G.R. and Heinze, H.J.
(1997) Human temporal lobe potentials in verbal learning and
memory. Neuropsychologia, 35: 657-668.
Garrard, P. and Hodges, J.R. (2000) Semantic dementia: clinical,
radiological and pathological perspectives. J. Neurol., 247:
409-422.
GleiBner, U. and Elger, C.E. (2001) The hippocampal contribu-
tion to verbal fluency in patients with temporal lobe epilepsy.
Cortex, 37(1): 55-63.
Grunwald, T., Lehnertz, K., Helmstaedter, C., Kutas, M., Pezer,
N., Kurthen, M., Van Roost, D. and Elger, C.E. (1998) Limbic
ERPs predict verbal memory after left-sided hippocampec-
tomy. Neuroreport, 9(15): 3375-3378.
Helmstaedter, C. (1999) Prediction of memory reserve capacity.
Adv. Neurol., 81: 271-279.
Helmstaedter, C. (2000) Cognitive impairment in temporal-lobe
epilepsy - - reply. Lancet, 355(9208): 1019.
Helmstaedter, C. and Elger, C.E. (1996) Cognitive consequences
of two-thirds anterior temporal lobectomy on verbal memory
in 144 patients: a three-month follow-up study. Epilepsia,
37(2): 171-180.
Helmstaedter, C. and Elger, C.E. (1999a) The phantom of pro-
gressive dementia in epilepsy. Lancet, 354(9196): 2133-2134.
Helmstaedter, C. and Elger, C.E. (1999b) Episodic memory and
semantic knowledge in left temporal lobe epilepsy with and
without mesial hippocampal sclerosis. Epilepsia, 40(Suppl. 7):
48.
Helmstaedter, C. and Kurthen, M. (2001) Memory and epilepsy:
characteristics, course, and influence of drugs and surgery.
Curr. Opin. Neurol., 14(2): 211-216.
Helmstaedter, C., Kurthen, M., Linke, D.B. and Elger, C.E.
(1994) Right hemisphere restitution of language and memory
functions in right hemisphere language-dominant patients with
left temporal lobe epilepsy. Brain, 117(4): 729-737.
Helmstaedter, C., Gleissner, U., Di Perua, M. and Elger, C.E.
(1997a) Relational verbal memory processing in patients with
temporal lobe epilepsy. Cortex, 33(4): 667-678.
Helmstaedter, C., Lehnertz, K., Grunwald, Th., Gleigner, U.,
Schramm, J. and Elger, C.E. (1997b) Differential involvement
of left temporo-lateral and temporo-mesial structures in verbal
declarative learning and memory: evidence from temporal lobe
epilepsy. Brain Cogn., 35(1): 110-131.
Helmstaedter, C., Kurthen, M., Lux, S., Johanson, K., Quiske,
A., Schramm, J. and Elger, C.E. (2000) Temporal lobe
epilepsy: longitudinal clinical, neuropsychological and psy-
chosocial follow-up of surgically and conservatively managed
patients (in German). Nervenarzt, 71: 629-642.
Helmstaedter, C., Lendt, M. and Lux, S. (2001a) VLMT: Verbaler
Lern und Merkfiihigkeitstest. Testhandbuch. Beltz Test GmbH,
Gtttingen, 2001.
Helmstaedter, C., Reuber, M. and Elger, C.E. (2001b) Does
epilepsy surgery accelerate cognitive aging? Epilepsia, 42:
301.
Hermann, B.P., Seidenberg, M., Schoenfeld, J. and Davies, K.
(1997) Neuropsychological characteristics of the syndrome of
mesial temporal lobe epilepsy. Arch. Neurol., 54(4): 369-376.
Hermann, B.P., Seidenberg, M. and Bell, B. (2002) The neurode-
velopmental impact of childhood onset temporal lobe epilepsy
on brain structure and function and the risk of progressive
cognitive effects. In: T. Sutula and A. Pitk~inen (Eds.), Do
Seizures Damage the Brain. Progress in Brain Research, Vol.
135. Elsevier, Amsterdam, pp. 429-438.
Holmes, M.D., Dodrill, C.B., Wilkus, R.J., Ojemann, L.M. and
Ojemann, G.A. (1998) Is partial epilepsy progressive? Ten-
year follow-up of EEG and neuropsychological changes in
adults with partial seizures. Epilepsia, 39:1189-1193.
Jokeit, H. and Ebner, A. (1999) Long term effects of refractory
temporal lobe epilepsy on cognitive abilities: a cross sectional
study. J. Neurol. Neurosurg. Psychiatry, 67(1): 44-50.
Jokeit, H. and Ebner, A. (2002) Effects of chronic epilepsy on
intellectual functions. In: T. Sutula and A. Pitk~inen (Eds.), Do
Seizures Damage the Brain. Progress in Brain Research, Vol.
135. Elsevier, Amsterdam, pp. 455-463.
Jokeit, H., Heger, R., Ebner, A. and Markowitsch, H.J. (1998)
Hemispheric asymmetries in category-specific word retrieval.
Neuroreport, 9(10): 2371-2373.
Jokeit, H., Luerding, R. and Ebner, A. (2000) Cognitive im-
pairment in temporal-lobe epilepsy. Lancet, 355(9208): 1018-
1019.
Jones-Gotman, M., Smith, M.L. and Zatorre, R.J. (1993) Neu-
ropsychological testing for localization and lateralization of
the epileptogenic region. In: J. Engel Jr. (Ed.), Surgical Treat-
ment of the Epilepsies. Raven Press, New York, NY, pp. 245-
262.
Lehrl, S. (1978) Mehrfachwahl-Wortschatz-lntelligenztest MWT-
B. Verlag Dr. med. Straube, Erlangen.
Nadel, L., Samsonovich, A., Ryan, L. and Moscovitch, M.
(2000) Multiple trace theory of human memory: computa-
tional, neuroimaging, and neuropsychological results. Hip-
pocampus, 10(4): 352-368.
Pulliainen, V., Kuikka, P. and Jokelainen, M. (2000) Motor and
cognitive functions in newly diagnosed adult seizure patients
before antiepileptic medication. Acta NeuroL Scand., 101: 73-
78.
Rausch, R., Lee, A.J., Frane, M., Passaro, E. and Vickery, B.
(1994) Long-term persistence of verbal learning deficits fol-

lowing left temporal lobe surgery. Epilepsia, 35(Suppl. 8):
81.
Selwa, L.M., Berent, S., Giordani, B., Henry, T.R., Buchtel, H.A.
and Ross, D.A. (1994) Serial cognitive testing in temporal
lobe epilepsy: longitudinal changes with medical and surgical
therapies. Epilepsia, 35(4): 743-749.
Squire, L.R. (1992) Memory and the hippocampus: a synthesis
from findings with rats, monkeys and humans. Psychol. Rev.,
99(2): 195-231.
Squire, L.R. and Zola-Morgan, S. (1996) Structure and function
of declarative and nondeclarative memory systems. Proc. Natl.
Acad. Sci. USA, 93: 13515-13522.
Strauss, E., Loring, D., Chelune, G., Hunter, M., Hermann, B.P.,
Perrine, K., Westerveld, M., Trenerry, M. and Barr, W. (1995)
Predicting cognitive impairment in epilepsy: findings from the
Bozeman Epilepsy Consortium. J. Clin. Exp. Neuropsychol.,
17(6): 909-917.
453
Tulving, E. (1984) Precis of elements of episodic memory. Be-
hav. Brain Sci., 7: 223-268.
Tulving, E. and Markowitsch, H.J. (1998) Episodic and declara-
tive memory: role of the hippocampus. Hippocampus, 8: 198-
204.
Varhga-Khadem, F., Gadian, D.G., Watkins, K.E., Conelly, A.,
Van Paesschen, W. and Mishkin, M. (1997) Differential effects
of early hippocampal pathology on episodic and semantic
memory. Science, 277: 376-380.
Viskontas, I.V., McAndrews, M.P. and Moscovitch, M. (2000)
Remote episodic memory deficits in patients with unilateral
temporal lobe epilepsy and excisions. J. Neurosci., 20(15):
5853-5857.
Zacks, R.T., Hasher, L. and Li, K.Z.H. (2000) Human memory.
In: F.I.M. Craik and T.A. Salthouse (Eds.), The Handbook of
Aging and Cognition. Lawrence Erlbaum Associates Publish-
ers, Mahwah, NJ, pp. 293-357.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 40

Effects of chronic epilepsy on intellectual functions

Hennric Jokeit 1,2,, and Alois Ebner 2

1 Swiss Epilepsy Center, Bleulerstrasse 60, CH-8008 Ziirich, Switzerland

2 Epilepsy Center Bethel, Epilepsy Surgery Program, Maraweg 21, D-33617 Bielefeld, Germany

Abstract: Intractable epilepsy is related to various transient and chronic brain electric and neurochemical disturbances.
There is increasing evidence that long-lasting chronic epilepsy may induce secondary neuronal loss and metabolic
dysfunctions. Still a matter of controversy is, however, whether cognitive abilities of patients deteriorate with increasing
duration of intractable epilepsy. We present results from two independent cross-sectional studies dealing with measures of
global cognitive performance in two different ways. The first study investigated in 78 patients with refractory temporal
lobe epilepsy (TLE) the influence of duration of epilepsy on the difference between an estimated measure of former or
pre-morbid intelligence and the current performance in an intelligence test. The second study aimed at duration of epilepsy-
dependent effects on current IQ measures of 209 patients with refractory TLE. Both studies showed that the duration of
epilepsy contributes to the explanation of interindividual variability in IQ measures of adult TLE patients to a higher degree
than age and age of epilepsy onset. Similar to several studies on hippocampal neuronal density, hippocampal volume,
and glucose metabolism, the presented cross-sectional data demonstrate that a duration of chronic epilepsy exceeding two
decades is associated with worse cognitive abilities. Consequently, refractory TLE seems to induce a very slow but ongoing
cognitive deterioration. It is assumed that epilepsy-related noxious events and agents exhaust the compensatory capacity of
brain functions. A high cognitive reserve capacity, however, might delay the onset of deterioration.

Introduction sures (Hermann et al., 1997). The probable reason

Patients with refractory temporal lobe epilepsy
(TLE) are at higher risk for mental and cognitive
impairment than healthy controls (Hermann et al.,
1987, 1997; Trimble, 1988). Typically patients with
right-sided temporal lobe epilepsy are frequently
impaired in visuo-spatial retention tasks; patients
with left-sided temporal lobe epilepsy may exhibit
deficits of verbal memory (Ivnik et al., 1988). Be-
cause of frequent and prominent memory deficits it
is sometimes neglected that many TLE patients per-
form below healthy control subjects in a variety of
neuropsychological tests including intelligence mea-
* Correspondence to: Hennric Jokeit, Swiss Epilepsy Cen-
ter, Bleulerstrasse 60, CH-8008 Ztirich, Switzerland. Tel.:
+41-1-387-3611; Fax: +41-1-387-6397;
E-mail: h.jokeit@gmx.ch
is that the temporal epileptogenic zone is not only
malfunctioning but also adversely influences remote
cerebral structures resulting in additional cognitive
deficits (Engel et al., 1991; Ltiders and Awad, 1991).
One of our recent studies confirmed that assumption
(Jokeit et al., 1997).
We investigated 96 TLE patients by FDG-PET
and neuropsychological assessment who had a corre-
sponding unilateral temporal hypometabolism, left-
hemisphere speech dominance, full-scale IQ of >70
and no extra-temporal lesion in MRIs. The regional
glucose metabolism was determined in each patient
in homologous regions including the prefrontal cor-
tex. A multivariate analysis of variance revealed that
the observed prefrontal metabolic disturbances, that
are remote from the temporal epileptogenic zone,
were associated with impaired intellectual abilities.
Patients who demonstrated prefrontal metabolic dis-
turbances did perform worse in verbal as well as
456
performance IQ measures than patients without pre-
frontal metabolic disturbances. Although patients
who demonstrated prefrontal metabolic disturbances
had an earlier epilepsy onset, the revealed associ-
ation with cognitive impairment was unrelated to
the age at onset. Nevertheless age at epilepsy on-
set is a well documented risk factor for cognitive
impairment (Bourgeois et al., 1983; Glosser et al.,
1997). It is assumed that an early epilepsy onset con-
siderably affects the maturation of brain functions
and structures as well as the acquisition of complex
knowledge and abilities.
One of the most frequent questions asked by
epilepsy patients and their relatives is whether
seizures are destructive and contribute to progres-
sive decline of intellectual abilities. Generally, de-
mentia is a very rare symptom in TLE patients and
does not represent the typical course of refractory
TLE. However, a growing number of clinical and
experimental studies suggest a slow but ongoing pro-
gression of symptoms with increasing duration of
refractory TLE or total number of lifetime seizures.
A long duration of intractable epilepsy is related to a
considerable number of focal or generalized seizures,
pathological interictal electric brain activity, chronic
and transient metabolic disturbances (Theodore et
al., 1989; Arnold et al., 1996; Savic et al., 1997), and
chronic antiepileptic medication with usually high
serum levels (Hermanns et al., 1996). It is suggested
that these noxious factors may induce secondary
neurophysiological and structural long-term changes
(Ben-Aft and Represa, 1990; Multani et al., 1994;
Beach et al., 1995; Bengzon et al., 1997; Jokeit et
al., 1997; Marsh et al., 1997; Tasch et al., 1999;
Theodore et al., 1999; Theodore and Gaillard, 1999).
A few neuropsychological studies have been
aimed at elucidating this question whether the cog-
nitive abilities of patients deteriorate with increasing
duration of intractable epilepsy. But neither short-
term longitudinal nor cross-sectional studies demon-
strated a convincing relationship between psycho-
metric intelligence and the duration of epilepsy in
samples of adult patients (Seidenberg et al., 1981;
Bourgeois et al., 1983; Rodin et al., 1986; Brown
and Vaughan, 1988; Trimble, 1988; Dodrill and
Wilensky, 1992; Selwa et al., 1994; Strauss et al.,
1995; Brown, 1996). On the one hand the absence
of an evident duration effect suggests that probably
no dramatic cognitive changes occur within peri-
ods of some years in adult TLE patients. On the
other hand methodological restrictions, for example,
a limited time range of longitudinal studies which
rarely exceeds a decade, an undetected cohort bias
in cross-sectional studies, or confounded variables
might cover possible duration effects. Additionally,
in studies with small sample sizes the possibility
of a type-two error is frequently neglected. Espe-
cially the results of densiometric and volumetric
cross-sectional studies in TLE patients demonstrate
that differences in these measures became signif-
icant only if patients differed in decades of the
duration of epilepsy (Multani et al., 1994; Mathern
et al., 1995a,b,c; Barr et al., 1997; Breier et al.,
1997; Salmenper~i et al., 1998; Jokeit et al., 1999).
Moreover, these studies indicate that neuronal injury
within and beyond the temporal lobes continues to
occur with ongoing seizure activity in TLE patients.
However, it is well known that the brain possesses
a large degree of redundancy, plasticity, and com-
pensatory mechanisms that may prevent or postpone
a cognitive decline due to small but ongoing brain
damage (Lewin, 1980; Calne et al., 1986). There-
fore, the individual brain reserve or spare capacity
may considerably influence the course of cognitive
changes also in patients with refractory TLE.
Results of cross-sectional studies
There are different approaches to infer cognitive
changes along the time axis. From a scientific as
well as methodological point of view prospective
longitudinal studies are generally superior to cross-
sectional studies. Clinical observations and results
of longitudinal studies suggest that there is, if any,
no rapid cognitive decline in patients with refrac-
tory TLE. Consequently, longitudinal studies in TLE
patients are confronted with the problem of proba-
bly small effect sizes. Hence, to provide statistical
evidence large samples of patients have to be ob-
served over long periods of time probably exceeding
decades. In contrast cross-sectional studies allow to
recruit large sample sizes. However, the existence of
a duration effect only can be inferred from interindi-
vidual differences in the duration of illness. Hence,
the interpretation of duration effects strictly presup-
poses that the patients were recruited from the same

population. Otherwise a cohort bias might consider-
ably affect the results. Although conclusions drawn
from cross-sectional studies are limited in some re-
spects they may reveal trends that might be covered
in longitudinal studies restricted by time and sample
size.
Also dependent variables, usually intelligence
measures, can be treated differentially as we demon-
strate by the following studies that are based on
independent samples. In the first study we consid-
ered differences between an estimated measure of
former or pre-morbid intelligence and the current
performance in an intelligence test as a function
of duration of epilepsy. This seems to be the only
way to infer individually a cognitive decline using
psychometric instruments during a single neuropsy-
chological investigation. In the second study we
related directly the duration of epilepsy with the cur-
rent IQ test results. However, this approach is only
appropriate for sample studies.
Study I
Neuropsychological investigations of a patient fre-
quently include so-called intelligence trace tests to
estimate the former intelligence in order to compare
it with current test results. Several studies showed
that most patients with cerebral lesions or early de-
mentia are unimpaired in intelligence trace tests,
whereas the same patients do worse in standard IQ
tests. The difference between the intelligence trace
test and standard IQ tests is considered to be a
measure of cognitive decline. If intellectual abilities
deteriorate with increasing duration of epilepsy the
difference between both measures should become
larger (Jokeit et al., 2000). In our study we used
the passive vocabulary-intelligence test (MWT-B) as
an intelligence trace test (Lehrl, 1995). In this test,
patients have to identify a real word among four
pseudo-words in rows of increasing difficulty.
To test our hypothesis we analyzed test results
of 78 consecutive patients (36 men) with refractory
TLE (41 left-sided) using the MWT-B intelligence
trace test (mean IQ: 1044-13 sd) and a full-scale
IQ measure derived from the German version of the
Wechsler Adult Intelligence Scale - Revised (WAIS-
R, mean full-scale IQ: 95.44-19) (Wechsler, 1981;
Tewes, 1991). All patients had a unilateral TLE
457
2O
0
U.l
_.1
< 10
0
_.J
_J
"..:
1.1_
U.I
0
z
U.l
n~ -20.
W
-30. ° "
• O
-40
0 10 20 30 40 50
DURATION OF EPILEPSY (YEARS)
Fig. I. Difference values of the estimated WAIS-R full-scale
IQ minus MWT-B-IQ (vocabulary intelligence), as a function
of the duration of epilepsy. Data of 78 patients with refractory
temporal lobe epilepsy are shown. The linear regression function
confirms a negative correlation between the difference value and
the duration of epilepsy. The 95% confidence interval for the
regression curve also is shown.
diagnosed during a comprehensive presurgical eval-
uation. The duration of epilepsy (19.5-4-12 years)
resulted from the difference between age at investi-
gation (35.6 ± 11 years) and the age at epilepsy onset
(16.3 4- 10.2 years). Patients with less than 9 years of
formal education were excluded.
Correlating the difference between the WAIS-R-
IQ and the estimated MWT-B-IQ with the dura-
tion of epilepsy we found a negative correlation
(r = -0.39, p < 0.000, single-tailed). Generally, IQ
values were based on normative data of age-matched
controls. Therefore, the negative correlation cannot
be attributed to age effects. Fig. 1 shows the differ-
ence values of the 78 patients as a function of the
duration of epilepsy. To control whether the negative
correlation between IQ difference and duration of
epilepsy is influenced by clinical and demographic
variables we performed a multiple regression analy-
sis. A stepwise variable selection procedure showed
that duration of epilepsy explained a significant pro-
portion of variance (/3 = -0.42, p < 0.000). The
458
variables sex, side of seizure onset, education, age,
and age of epilepsy onset did not contribute to a
further explanation of variance. Therefore, it is less
likely that the underlying pathology simply acceler-
ates the symptoms of aging or that there is no decline
but developmental lesions are of predominant influ-
ence. Otherwise age and age of epilepsy onset should
explain more variance than the variable duration of
epilepsy. Patients with a long duration of epilepsy
more frequently demonstrated a considerable differ-
ence between both IQs compared to patients with a
shorter duration of TLE.
Study II
In this larger study, we examined the effects of du-
ration of epilepsy on the performance in a standard
IQ test as an indicator of global cognitive abili-
ties and integrity of higher brain functions (Jokeit
and Ebner, 1999). Furthermore, the influence of the
variable education on psychometric intelligence and
its interaction with the duration of epilepsy were
investigated. Epidemiological studies identified that
education as an indicator of brain reserve modifies
the clinical expression of dementia and Alzheimer's
disease (Zhang et al., 1990; Satz, 1993; Stern et al.,
1994; Evans et al., 1997; Schmand et al., 1997).
We studied 209 consecutive patients of our
epilepsy surgery program with temporal lobe
epilepsy who fulfilled the following criteria: seizures
of unilateral temporal origin as demonstrated by
continuous interictal and ictal video/EEG monitor-
ing, unilateral lesions within the temporal lobes as
demonstrated by MRIs, and full-scale intelligence
quotient (FSIQ) greater than 55 to exclude severe
mentally impaired patients. Detailed information on
clinical and demographic variables are given in the
original study. Patients underwent a neuropsycho-
logical evaluation designed for patients with TLE.
To have a comprehensive psychometric measure of
global cognitive abilities which is well normed to
age-matched healthy controls we used the FSIQ
from the German version of the WAIS-R (Wechsler,
1981; Tewes, 1991). The FSIQ was estimated from
the subtests Information, Comprehension, Similari-
ties, Digit Symbol, Picture Completion, and Block
Design. First a data set Of 16 independent variables
for each patient was submitted to a linear multiple
regression analysis. The set included the variables:
sex, side of seizure origin, age at testing, age at first
seizure, age at epilepsy onset, duration of epilepsy,
education, ranked seizure frequency, ranked fre-
quency of generalized seizures, presence or absence
of generalized seizures in patient's history, ranked
frequency of interictal epileptiform discharges, pres-
ence or absence of temporal lesions beyond the
mesio-temporal structures in MRI scans, serum level
of carbamazepine, phenytoin, and phenobarbital, and
AED mono- or polytherapy. Multiple regression
analyses on FSIQ revealed significant contributions
by the variables education (p < 0.01,/~ = 0.543) and
duration of epilepsy (p < 0.01, /~ = -0.195) after
stepwise selection. The equation explained 34.61%
of total variance (adjusted, p < 0.01). No further
variable contributed significantly.
To reveal possible factor interactions and to ex-
clude linear effects of covariates in a one-way
ANOVA model, the continuous variable duration of
epilepsy was recoded into three values: < 15 years =
0; 15-30 years ---- 1; > 30 years of refractory epilepsy
---- 2. The side of seizure origin was submitted as the
second factor (left, right). The presence or absence
of lesions beyond mesio-temporal structures in MRI
scans was submitted as the third factor (0, 1). Ed-
ucation, age at epilepsy onset, ranked frequency of
interictal epileptiform discharges, ranked frequency
of habitual seizures, presence of secondarily general-
ized seizures in a patient's history, ranked frequency
of secondarily generalized seizures within the last
year, serum level for carbamazepine, phenytoin, and
phenobarbital, and AED mono- or polytherapy were
controlled as covariates. Only the covariate educa-
tion was significantly related to FSIQ (p < 0.01).
After removing linear effects of covariates the fac-
tor duration of epilepsy was significant (p < 0.01).
The factors side of seizure onset and presence or
absence of temporal lesions beyond mesio-temporal
structures did not reach significance. No interactions
reached significance. Post hoc contrasts adjusted by
covariates revealed that patients with a duration of
epilepsy of more than 30 years performed worse
than patients with less than 15 years of epilepsy
(p < 0.01) and patients with 15 to 30 years of
epilepsy (p < 0.05). Patients with less than 15 years
of epilepsy did not differ from patients with 15 to 30
years in FS1Q.
 459

Since it is known that the variable education ex- 110

o
plains a considerable amount of variance of FSIQ uJ
,_1
values, we computed an ANOVA with the factors
duration of epilepsy (0, 1, 2) and education (low,
o<
09
._1 100
high) to reveal possible interactions and to specify ,_1
;D
the effect of the variable education. The educational LL
level was dichotomized into low (patients who did Z
<
not attend or finished a secondary school, Realschule LU
90
in Germany, N = 109) and high (patients who fin-
ished at least a secondary school, N = 100). The
side of seizure origin, presence or absence of lesions
beyond mesio-temporal structures, age at epilepsy 80
onset, ranked frequency of interictal epileptiform EDUCATION

discharges, ranked frequency of habitual seizures,

1 'OW
presence of generalized seizures in a patient's his-
tory, ranked frequency of secondarily generalized 70 1 HIGH
seizures within the last year, serum level for carba- < 15 15 - 30 > 30

mazepine, phenytoin, and phenobarbital, and AED

mono- or polytherapy were controlled as covariates.
The ANOVA revealed effects of the factors education
and duration of epilepsy on the FSIQ (p < 0.01). The
interaction between both factors did not reach sig-
nificance (p = 0.14). No covariate was significantly
related to FSIQ. Fig. 2 shows mean FSIQ values for
both educational groups as a function of duration
of TLE. Contrasts adjusted for covariates revealed
that the mean FSIQ values of groups with less than
15 years and 15-30 years of TLE did not differ in
patients with high educational attainment. However,
patients with more than 30 years of TLE performed
worse than patients with less than 15 years (p < 0.01,
one-tailed) or 15-30 years of epilepsy (p < 0.01,
one-tailed). Patients with 10w educational attainment
and less than 15 years of TLE performed better than
patients with 15-30 years of TLE (p < 0.05, one-
tailed) and patients with more than 30 years of TLE
(p < 0.01, one-tailed). But there was no significant
difference between patients with 15-30 years and
more than 30 years of TLE in the low-education
group. Although not confirmed by an ANOVA inter-
action these contrasts suggest a duration-dependent
difference in mean FSIQ values of patients with low
and high educational attainment. The absence of a
significant ANOVA interaction probably results from
a similar decremental trend of the duration effect in
low- and high-educated patients.
DURATION OF EPILEPSY HEARS)
Fig. 2. Mean full-scale IQ values of patients with low (N = 109)
and high (N = 100) educational attainment for groups with a
duration of epilepsy < 15 years, 15-30 years, and >30 years.
Factors education and duration of epilepsy were significant (p <
0.01). Asterisks (*, p < 0.05; **, p < 0.01, one-tailed) indicate
significant contrasts between adjacent duration groups adjusted
for covariates.
Discussion
Both studies demonstrate that patients with a long
history of intractable TLE were at higher risk of
cognitive impairment than patients with a shorter du-
ration of TLE. Interestingly, in patients with higher
educational attainment the mean FSIQ was stable
for a longer duration of TLE than in less educated
patients.
We revealed that the educational level and the
duration of epilepsy were the best predictors for psy-
chometric intelligence. Then we provided evidence
that only a long duration of TLE (>30 years) was
related to impaired psychometric intelligence in the
total sample. The linear influence of the variables age
at epilepsy onset, the educational level of patients,
the patient's serum level of first-line antiepileptic
drugs, polypharmacy, the frequency of habitual and
secondarily generalized seizures, and the frequency
of interictal epileptiform discharges on psychome-
tric intelligence were statistically controlled. Age
at testing controlled for duration of TLE was not
460
significantly related to FSIQ. The factors side of
TLE and presence or absence of lesions beyond the
mesio-temporal structures did not show main effects
or interactions. Therefore, the effect of duration of
epilepsy cannot be attributed to those covariates and
factors. The patient's educational level captured the
most amount of FSIQ variance in study II. This could
explain why, in contrast to other studies (Strauss
et al., 1995), the remaining covariates (e.g. age at
epilepsy onset) did not reach significance. In study I
educational effects had no influence because both IQ
measures equally correlated with education.
It is reasonable to assume that human brains
develop a functional reserve or have a spare ca-
pacity to cope with a stepwise neuronal loss by
efficiency, redundancy, plasticity, and reorganization
(Lewin, 1980; Meier-Ruge et al., 1991; Stern et al.,
1996). Studies on different degenerative brain disor-
ders (e.g. Parkinson disease, vascular and Alzheimer
dementia) suggest that a functional decline be-
comes apparent only if a certain amount of brain
parenchyma is insulted (Tomlinson et al., 1970;
Hornykiewicz, 1988; Boone et al., 1992; Small et al.,
1995; Pasquier and Leys, 1997). A long duration of
intractable TLE is related to a considerable number
of focal or secondarily generalized seizures, patho-
logical interictal electric brain activity, chronic and
transient metabolic disturbances due to morpholog-
ical lesions (Arnold et al., 1996), seizures (Savic et
al., 1997), and antiepileptic medication (Theodore et
al., 1989), and chronic antiepileptic medication with
usually high serum levels (Hermanns et al., 1996).
It is suggested that each of these factors may sep-
arately adverse cognitive functioning (Lesser et al.,
1986; Dreifuss, 1992). The presence of reactive mi-
croglia (Beach et al., 1995), reduced dendritic spine
density, dendritic swellings (Multani et al., 1994)
and senile plaques (Mackenzie and Miller, 1994) in
ATL specimens suggests that neuronal injury contin-
ues to occur with ongoing seizure activity in TLE
patients. Multani et al. (1994) firstly demonstrated a
correlation between decreased dendritic spine den-
sity remote from the epileptogenic zone and duration
of seizure history. In patients with mesial TLE den-
siometric techniques showed secondary declines in
hippocampal neuron densities with long histories of
habitual seizures (Mathern et al., 1995a,b,c, 1996).
Recent studies suggested a secondary decline of hip-
pocampal volume and temporal lobe metabolism in
refractory TLE patients (Barr et al., 1997; Breier
et al., 1997; Salmenper~ et al., 1998; Joker et al.,
1999). Hermann et al. (1997) reported that patients
with hippocampal sclerosis had more generalized
cognitive impairment, a significant longer history
of intractable TLE, and a lower educational level
than TLE patients without significant hippocampal
sclerosis. We assume that a cumulation of small
neuro-degenerative effects of noxious neurochemical
agents, abnormal brain electric events, and metabolic
disturbances during decades of chronic epilepsy ac-
companied by aging may increase the probability
that the functional brain reserve or spare capacity
is exhausted at a surprisingly young age (in study
II mean age of patients with TLE duration > 30
years was 44 years) and deterioration of cognitive
functions may begin (Meier-Ruge et al., 1991; Stern
et al., 1996; Mori et al., 1997). The extent of func-
tional reserve and therefore the vulnerability of brain
functions may vary considerably between persons.
It was suggested that higher educational attainment
is related to a higher reserve against cognitive im-
pairment due to stepwise ongoing brain injury (Satz,
1993; Timiras, 1995). Our results of analyses in pa-
tients with lower and higher educational attainment
are in accordance with findings of epidemiological
studies on dementia and Alzheimer's disease (Zhang
et al., 1990; Satz, 1993; Stern et al., 1994; Evans
et al., 1997; Schmand et al., 1997). In patients with
higher educational attainment the mean FSIQ was
stable for a longer duration of TLE than in less ed-
ucated patients. Higher educational attainment as an
indicator of higher cognitive reserve might delay the
onset of cognitive decline in patients with intractable
TLE.
The fact that we found significant effects in the
whole-sample analysis only in patients with a his-
tory of intractable epilepsy lasting longer than three
decades may question conclusions drawn from nega-
tive findings of studies on adverse effects of duration
of refractory TLE (Selwa et al., 1994; Mackenzie
et al., 1996). Based on our results only prospec-
tive long-term studies which exceed three decades
might reveal the causes of a presumable decline
in cognitive functioning of patients with intractable
TLE. Such studies may solve the important question
whether certain epileptic syndromes are progressive

disorders (Lesser et al., 1986; Sutula et al., 1989;
Gloor, 1991; Girvin, 1992; M a t h e r n et al., 1996;
Sadzot, 1997). H o w e v e r , today w e l l c o n t r o l l e d cross-
sectional studies c o m p a r i n g different w e l l defined
epileptic s y n d r o m e s and i n c l u d i n g re-test m e a s u r e s
to c o m p a r e different t r e a t m e n t strategies m a y help to
isolate a d v e r s e factors and to identify patients with
i n c r e a s e d risk o f c o g n i t i v e decline and s y m p t o m
progression.
References
Arnold, S., Schlaug, G., Niemann, H., Ebner, A., Ltiders, H.
and Witte, O.W. et al. (1996) Topography of interictal glucose
hypometabolism in unilateral mesiotemporal epilepsy. Neurol-
ogy, 46: 1422-1430.
Barr, W.B., Ashtari, M. and Schanl, N. (1997) Bilateral reduc-
tions in hippocampal volume in adults with epilepsy and a
history of febrile seizures. J. Neurol. Neurosurg. Psychiatry,
63: 461-467.
Beach, T.G., Woodhurst, W.B., MacDonald, D.B. and Jones,
W.M. (1995) Reactive microglia in hippocampal sclerosis as-
sociated with human temporal lobe epilepsy. Neurosci. Lett.,
191: 27-30.
Ben-Ari, Y. and Represa, A. (1990) Brief seizure episodes in-
duce long-term potentiation and mossy fibre sprouting in the
hippocampus. Trends Neurosci., 13: 312-318.
Bengzon, J., Kokaia, Z., Elmer, E., Nanobashvili, A., Kokaia, M.
and Lindvall, O. (1997) Apoptosis and proliferation of dentate
gyrus neurons after single and intermittent limbic seizures.
Proc. Natl. Acad. Sci. USA, 94: 10432-10437.
Boone, K.B., Miller, B.L., Lesser, I.M., Mehringer, C.M., Hill-
Gufierrez, E. and Goldberg, M.A. et al. (1992) Neuropsycho-
logical correlates of white-matter lesions in healthy elderly
subjects. Arch. Neurol., 49: 549-554.
Bourgeois, B.F.D., Prensky, A.L., Palkes, H.S., Talent, B.K. and
Busch, S.G. (1983) Intelligence in epilepsy: a prospective
study in children. Ann. Neurol., 14: 438-444.
Breier, J.L,, Mullani, N.A., Thomas, A.B., Wheless, J.W.,
Plenger, P.M. and Gould, K.L. et al. (1997) Effects of du-
ration of epilepsy on the uncoupling of metabolism and blood
flow in complex partial seizures. Neurology, 48: 1047-1053.
Brown, S.W. (1996) Epilepsy dementia: Intellectual deterioration
as a consequence of epileptic seizures. Epilepsia, 37(Suppl.
4): 122-123.
Brown, S.W. and Vaughan, M. (1988) Dementia in epileptic
patients. In: M.R. Trimble and E.H. Reynolds (Eds.), Epilepsy,
Behaviour and Cognitive Function. Wiley, Chichester, pp.
177-188.
Calne, D.B., Eisen, A., McGeer, E. and Spencer, P. (1986)
Alzheimer's disease, Parkinson's disease, and motoneurone
disease: abiotrophic interaction between ageing and environ-
ment?. Lancet, 2(8515): 1067-1070.
Dodrill, C.B. and Wilensky, A.J. (1992) Neuropsychological
461
abilities before and after 5 years of stable antiepileptic drug
therapy. Epilepsia, 33: 327-334.
Dreifuss, E.F. (1992) Cognitive function - - victim of disease or
hostage to treatment?. Epilepsia, 33(Suppl. 1): $7-S12.
Engel Jr., J., Brandler, R., Griffith, N.C. and Caldecott-Hazard,
S. (1991) Neurobiological evidence for epilepsy-induced inter-
ictal disturbances. Adv. Neurol., 55:97-111.
Evans, D.A., Hebert, L.E., Becket, L.A., Scherr, P.A., Albert,
M.S. and Chown, M.J. et al. (1997) Education and other mea-
sures of socioeconomic status and risk of incident Alzheimer
disease in a defined population of older persons. Arch. Neurol.,
54: 1399-1405.
Girvin, J.P. (1992) Is epilepsy a progressive disorder?. J.
Epilepsy, 5: 94-104.
Gloor, P. (1991) Mesial temporal sclerosis: historical background
and an overview from a modern perspective. In: H.O. Ltiders
(Ed.), Epilepsy Surgery. Raven Press, New York, NY, pp. 689-
703.
Glosser, G., Cole, L.C., French, J.A., Saykin, A.J. and Sperling,
M.R. (1997) Predictors of intellectual performance in adults
with intractable temporal lobe epilepsy. J. Int. Neuropsychol.
Soc., 3: 252-259.
Hermann, B.R, Wyler, A.R. and Richey, E.T. (1987) Epilepsy
frontal lobe, and personality. Biol. Psychiatry, 22: 1055-1057.
Hermann, B.P., Seidenberg, M., Schoenfeld, J. and Davies, K.
(1997) Neuropsychological characteristics of the syndrome of
mesial temporal lobe epilepsy. Arch. Neurol., 54: 369-376.
Hermanns, G., Noachtar, S., Tuxhorn, I., Holthansen, H., Ebner,
A. and Wolf, P. (1996) Systematic testing of medical in-
tractability for carbamazepine, phenytoin, and phenobarbital or
primidone in monotherapy for patients considered for epilepsy
surgery. Epilepsia, 37: 675-679.
Hornykiewicz, O. (1988) Neurochemical pathology and the eti-
ology of Parkinson disease. Mt. Sinai J. Med., 55:11-20.
Ivnik, J.R., Sharbrough, EW. and Laws, E.R. (1988) Anterior
temporal lobectomy for control of partial complex seizures:
information for counseling patients. Mayo Clin. Proc., 63:
783-791.
Jokeit, H. and Ebner, A. (1999) Long term effects of refractory
temporal lobe epilepsy on cognitive abilities: a cross sectional
study. J. Neurol. Neurosurg. Psychiatry, 67: 44-50.
Jokeit, H., Seitz, RJ., Markowitsch, H.J., Neumann, N., Witte,
O.W. and Ebner, A. (1997) Prefrontal asymmetric interictal
glucose hypometabolism and cognitive impairment in patients
with temporal lobe epilepsy. Brain, 120: 2283-2294.
Jokeit, H., Ebner, A., Arnold, S., Antke, C., Huang, Y. and
Schtiller, M. et al. (1999) Bilateral depressions of hippocanapal
volume, glucose metabolism, and Wada hemispheric memory
performance are related to the duration of mesial temporal
lobe epilepsy. J. Neurol., 246: 926-933.
Jokeit, H., Luerding, R. and Ebner, A. (2000) Cognitive impair-
ment in temporal-lobe epilepsy. Lancet, 355: 1018-1019.
Lehrl, S. (1995) Mehrfachwahl-Wortschatz-lntelligenztest MWT-
B [multiple-choice vocabulary intelligence test]. Perimed-
spitta, Balingen.
Lesser, R.P., Ltiders, H., Wyllie, E., Dinner, D.S. and Morris
462
III, H.H. (1986) Mental deterioration in epilepsy. Epilepsia,
27(Suppl. 2): S105-S123.
Lewin, R. (1980) Is your brain really necessary?. Science, 210:
1232-1234.
Ltiders, H.O. and Awad, I. (1991) Conceptual considerations. In:
H.O. Ltiders (Ed.), Epilepsy Surgery. Raven Press, New York,
NY, pp. 51-62.
Mackenzie, I.R.A. and Miller, L.A. (1994) Senile plaques in
temporal lobe epilepsy. Acta Neuropathol., 87: 504-510.
Mackenzie, I.R.A., McLachlan, R.S., Kubu, C.S. and Miller, L.A.
(1996) Prospective neuropsychological assessment of nonde-
mented patients with biopsy proven senile plaques. Neurology,
46: 425-429.
Marsh, L., Morrell, M.J., Shear, P.K., Sullivan, E.V., Freeman, H.
and Marie, A. et al. (1997) Cortical and hippocampal volume
deficits in temporal lobe epilepsy. Epilepsia, 38: 576-587.
Mathern, G.W., Babb, T.L., Vickrey, B.G., Melendez, M. and
Pretorius, J.K. (1995a) The clinical-pathogenic mechanism of
hippocampal neuron loss and surgical outcomes in temporal
lobe epilepsy. Brain, 118:105-118.
Mathern, G.W., Babb, T.L., Pretorius, J.K., Melendez, M. and
L6vesque, M.E (1995b) The pathophysiologic relationships
between lesion pathology, intracranial ictal EEG onsets, and
hippocampal neuron losses in temporal lobe epilepsy. Epilepsy
Res., 21: 133-147.
Mathern, G.W., Pretorius, J.K. and Babb, T.L. (1995c) Influence
of the type of initial precipitating injury and at what age it
occurs on course and outcome in patients with temporal lobe
seizures. J. Neurosurg., 82: 220-227.
Mathern, G.W., Babb, T.L., Leite, J.P., Pretorius, J.K., Yeoman,
K.M. and Kuhlman, P.A. (1996) The pathogenic and progres-
sive features of chronic human hippocampal epilepsy. Epilepsy
Res., 26: 151-161.
Meier-Ruge, W., Hunziker, O. and Iwangoff, P. (1991) Senile
dementia: a threshold phenomenon of normal aging? A contri-
bution to the functional reserve hypothesis of the brain. Ann.
NY Acad. Sci., 621: 104-118.
Mori, E., Hirono, N., Yamashita, H., Imamura, T., Ikejiri, Y. and
Ikeda, M. et al. (1997) Premorbid brain size as a determinant
of reserve capacity against intellectual decline in Alzheimer's
disease. Am. J. Psychiatry, 154: 18-24.
Multani, P., Myers, R.H., Blume, H.W., Schomer, D.L. and
Sotrel, A. (1994) Neocortical dendritic pathology in human
partial epilepsy: A quantitative Golgi study. Epilepsia, 35:
728-736.
Pasquier, E and Leys, D. (1997) Why are stroke patients prone
to develop dementia?. J. Neurol., 244: 135-142.
Rodin, E.A., Schmaltz, S. and Twitty, G. (1986) Intellectual
functions of patients with childhood-onset epilepsy. Dev. Med.
Child NeuroL, 28: 25-33.
Sadzot, B. (1997) Epilepsy: a progressive disease?. BMJ, 314:
391-392.
Salmenper~i, T., K~ilviainen, R., Partanen, K. and Pitk~inen, A.
(1998) Hippocampal damage caused by seizures in temporal
lobe epilepsy. Lancet, 351: 35.
Satz, P. (1993) Brain reserve capacity on symptom onset af-
ter brain injury: a formulation and review of evidence for
threshold theory. Neuropsychology, 7: 273-295.
Savic, I., Altshuler, L., Baxter, L. and Engel Jr., J. (1997) Pattern
of interictal hypometabolism in PET scans with fludeoxyglu-
cose F 18 reflects prior seizure types in patients with mesial
temporal lobe seizures. Arch. NeuroL, 54: 129-136.
Schmand, B., Smit, J.H., Geerlings, M.I. and Lindeboom, J.
(1997) The effects of intelligence and education on the devel-
opment of dementia. A test of the brain reserve hypothesis.
Psychol. Med., 27: 1337-1344.
Seidenberg, M., O'Leary, D.S., Berent, S. and Boll, T. (1981)
Changes in seizure frequency and test-retest scores on the
Wechsler Adult Intelligence Scale. Epilepsia, 22: 75-83.
Selwa, L.M., Berent, S., Giordani, B., Henry, T.R., Buchtel, H.A.
and Ross, D.A. (1994) Serial cognitive testing in temporal
lobe epilepsy: Longitudinal changes with medical and surgical
therapies. Epilepsia, 35: 743-749.
Small, G.W., Mazziota, J.C., Collins, M.T., Baxter, L.R., Phelps,
M.E. and Mandelkern, M.A. et al. (1995) Apolipoprotein E
type 4 allele and cerebral glucose metabolism in relatives at
risk for familial Alzheimer disease. JAMA, 273: 942-947.
Stern, R.A., Silva, S.G., Chaisson, N. and Evans, D.L. (1996) In-
fluence of cognitive reserve on neuropsychological functioning
in asymptomatic human immunodeficiency virns-1 infection.
Arch. Neurol., 53: 148-153.
Stern, Y., Gurland, B., Tatemichi, T.K., Tang, M.X., Wilder, D.
and Mayeux, R. (1994) Influence of education and occupation
on the incidence of Alzheimer's disease. JAMA, 271: 1004-
1010.
Strauss, E., Loring, D., Chelune, G., Hunter, M., Hermann, B.
and Perrine, K. et al. (1995) Predicting cognitive impairment
in epilepsy: Findings from the Bozeman Epilepsy Consortium.
J. Clin. Exp. Neuropsychol., 17: 909-917.
Sutula, T., Cascino, G., Cavazos, J., Parada, I. and Ramirez, L.
(1989) Mossy fiber synaptic reorganization in the epileptic
human temporal lobe. Ann. Neurol., 26: 321-330.
Tasch, E., Cendes, E, Li, L.M., Dubeau, E, Andermann, E and
Arnold, D.L. (1999) Neuroimaging evidence of progressive
neuronal loss and dysfunction in temporal lobe epilepsy. Ann.
Neurol., 45: 568-576.
Tewes, U. (1991) Manual des Hamburg- Wechsler lntelli genztest
fiir Erwachsene, Revision. Hans Huber, Bern.
Theodore, W.H. and Gaillard, W.D. (1999) Association between
hippocampal volume and epilepsy duration. Ann. Neurol., 46:
800.
Theodore, W.H., Bromfield, E. and Onorati, L. (1989) The ef-
fect of carbamazepine on cerebral glucose metabolism. Ann.
Neurol., 25: 516-520.
Theodore, W.H., Bahita, S. and Hatta, J. et al. (1999) Hippocam-
pal atrophy, epilepsy duration, and febrile seizures in patients
with partial seizures. Neurology, 52: 132-136.
Timiras, ES. (1995) Education, homeostasis, and longevity. Exp.
Gerontol., 30: 189-198.
Tomlinson, B.E., Blessed, G. and Roth, M. (1970) Observations
on the brains of demented old people. J. Neurol. Sci., 11:
205-242.
 463

Trimble, M.R. (1988) Cognitive hazards of seizure disorders. Zhang, M., Katzman, R., Salmon, D., Jin, H., Cai, G. and Wang,
Epilepsia, 29(Suppl. 1): 19-24. Z. et al. (1990) The prevalence of dementia and Alzheimer's
Wechsler, D. (1981) WAIS-R Manual. The Psychological Corpo- disease in Shanghai, China: impact of age, gender, and educa-
ration, New York, NY. tion. Ann. Neurol., 27: 428-437.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Published by Elsevier Science B.V.
CHAPTER 41
Summary: Neuropsychological consequences of
human epilepsy
Thomas Sutula 1,2,, and Asia Pitk~inen 3,4
I Department of Neurology and 2 Department of Anatomy, University of Wisconsin, Madison, W1 53792, USA
3 The Epilepsy Research Laboratory, A.I. Virtanen Institute for Molecular Sciences and 4 Department of Neurology,
Kuopio University Hospital, Kuopio, Finland
In Sections I-IV, evidence has been presented in
both experimental models and in human epilepsy
that prolonged and repeated brief seizures are as-
sociated with a variety of long-term structural and
functional alterations in neural circuitry. This vol-
ume has attempted to address whether some of the
long-term alterations associated with epilepsy are not
only caused by the primary etiology of the epileptic
syndrome, but may also be induced by the seizures
themselves. Seizure-induced alterations that are re-
garded as possible indicators of 'damage' include
molecular and cellular markers (e.g. TUNEL stain-
ing, Fluoro-Jade B staining, silver staining, etc.), and
morphological measures (e.g. reduction in numbers
or density of neurons in histological sections, or re-
duction in volume of a particular neural structure
by volumetric MRI). When these 'markers' are ob-
served in association with an evolving macroscopic
lesion following recent seizures, observers are gen-
erally comfortable in concluding that the seizures
played a causal role in the 'damage'. When the
'markers' are observed after seizures that are brief
and do not produce an overt macroscopic lesion
(Chapters 8, 9, 29, 31), there is less comfort or even
* Correspondence to: T. Sutula, Department of Neurology
H6/570, University of Wisconsin, Madison, WI 53792,
USA. Tel: +1-608-263-5448; Fax: +1-608-263-0412;
E-mail: sutula@neurology.wisc.edu
reluctance to conclude that damage has occurred.
When gradually evolving, cumulative adverse func-
tional effects are observed in people with poorly con-
trolled epilepsy experiencing repeated brief seizures,
should these effects be regarded as 'damage' even in
the absence of overt seizure-induced lesions?
A conclusive answer to this question would have
potentially important clinical implications. In ad-
dressing this question, what is the evidence in human
epilepsy that repeated brief seizures have cumulative
adverse effects? Neuropsychological assessment is
essential to address this question. As background
to assess how brief seizures might cumulatively
contribute to adverse long-term neuropsychologi-
cal performance, it is also useful to consider the
perspective provided by studies of neural plastic-
ity and the capacity of neural circuits to undergo
modification in response to neural activity. There is
abundant evidence that neural circuits in both de-
velopment and adulthood undergo numerous short-
term and long-term alterations in response to both
normal neural activity and synchronous neural ac-
tivity during seizures. These activity-dependent and
seizure-induced effects occur at virtually every level
of neural organization, from molecular to circuit al-
terations, and are important for normal function and
behavior. It is likely that some activity-dependent
and seizure-induced alterations may also contribute
to pathology and dysfunction, including cognitive or
behavioral dysfunction.
466
A great deal of attention in epilepsy research
has been placed on the role of pathology-associated
or seizure-induced alterations in neural circuits that
promote neuronal synchronization and epileptoge-
nesis. Relatively less attention has been paid to
how seizures can produce subtle alterations in neu-
ral circuits that may cumulatively result in 'sys-
tems level' dysfunction. Relatively subtle but cu-
mulative long-term alterations may be extremely
important in regard to the consequences of un-
controlled or repeated seizures, and may account
for the remarkable observation that brief seizures,
which typically last only seconds to minutes, can
produce prolonged disruption of normal functions
persisting beyond the seizures and disproportionate
long-term disability. Are 'systems level' neural func-
tions and cognitive/behavioral functions gradually
compromised by subtle cumulative long-term alter-
ations in neural circuits when seizures are repeated
or poorly controlled?
Neuropsychological studies are addressing this
question in people with epilepsy, and some of the
issues that are encountered in attempting to an-
swer this question are addressed in this section. A
substantial subset of people with epilepsy show ev-
idence of neurobehavioral dysfunction, which has
a significant impact on their daily functioning and
quality of life. There are undoubtedly marked indi-
vidual variations in the effects of seizures, proba-
bly as a result of genetic background (Chapter 12),
that are likely to influence relationships between
seizure frequency and cognitive dysfunction. Mul-
tiple cross-sectional studies have provided evidence
that the severity of cognitive impairment increases
as a function of the life-time number of generalized
tonic-clonic seizures (Chapter 35), but the possi-
bility that the primary etiology and other factors
may play a role in this effect cannot be excluded in
cross-sectional studies. In the relatively more lim-
ited number of longitudinal studies that are avail-
able, mild but definite relationships between seizures
and cognitive decline have been observed (Chapter
35). These relationships were noted only for gen-
eralized tonic-clonic seizures, which is of interest
given evidence in experimental models of a causal
relationship between number of secondary general-
ized seizures and memory dysfunction (Chapter 8)
and the MR spectroscopy evidence in humans of a
relationship between neuronal loss/dysfunction and
generalized tonic-clonic seizures (Chapter 25).
In studies of cognitive and memory function
in patients with intractable temporal lobe epilepsy,
cross-sectional studies have suggested that there is an
adverse generalized neurodevelopmental impact of
childhood onset temporal lobe epilepsy (Chapter 38)
and continuing slowly progressive cognitive decline
involving memory but also some other measures of
general intellectual ability that becomes evident with
long duration of epilepsy ('-~20-30 years; Chapters
38-40). This neuropsychological observation is rem-
iniscent of the phenomenon of initial precipitating
injury and slowly progressive cellular changes in in-
tractable human temporal lobe epilepsy (Chapter 21).
Patients with shorter durations of epilepsy show less
cognitive decline, and there is evidence that 'cerebral
reserve' or the effects of prior level of functioning
and prior educational experience may forestall or de-
lay the cognitive decline associated with duration of
temporal lobe epilepsy (Chapter 40). The indications
that there may be a phenomenon of 'cerebral reserve'
or a threshold for observation of cognitive decline in
chronic epilepsy is of interest, as the phenomenon
of 'cerebral reserve' has been noted in aging and
dementia (Chapter 40), and a threshold for seizure-
induced memory dysfunction has also been observed
in experimental animal models (Chapter 8).
Prospective studies with long duration of obser-
vation are necessary to address the cumulative long-
term effects of poorly controlled epilepsy. In the rela-
tively limited number of prospective studies, there is
accumulating evidence that implicates seizures in the
long-term cognitive declines (Chapter 39). Prospec-
tive studies using rating of behavioral problems in
children with new onset seizures have indicated that
children with multiple untreated seizures occurring
prior to the rating measure have worse behavior
problems than those whose initial rating measure
was obtained at the time of the first seizure (Chapter
37). While the possible contribution of anticonvul-
sant drugs to adverse cognitive performance is a
concern in cross-sectional studies, prospective stud-
ies have also indicated that the effects of antiepileptic
drugs on cognitive and behavior problems appear to
be negligible (Chapter 37).
Neuropsychological studies are critical for un-
derstanding the long-term consequences of poorly

controlled seizures. The increasing appreciation of
long-term adverse cognitive and behavioral effects
of seizures in experimental models (Chapters 8, 32)
and in human studies (Chapters 35-40) makes atten-
tion to this issue a necessary and compelling priority
for epilepsy research. In human studies, prospective
designs and long durations of observation are neces-
467
sary to address the issues of possible adverse cogni-
tive effects of repeated brief seizures. This is likely
to be challenging for both investigators and funding
agencies, but such studies are ultimately critical for
both clinical decision-making and understanding of
the personal and social impact of epilepsy.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Published by Elsevier Science B.V.
CHAPTER 42
Will brain damage after status epilepticus
be history in 2010?
D a v i d M. T r e i m a n *
Barrow Neurological Institute, 350 West Thomas Road, Phoenix, AZ, 85013, USA
Introduction
Will status still cause brain damage in 2010? The an-
swer is almost certainly yes, because we will still be
faced with an enormous treatment gap between de-
veloped societies and developing societies. Many of
the at least 3 million cases of status epilepticus (SE)
that currently occur in the world each year receive
little or no acute treatment with antiepileptic drugs.
By 2010 we will be doing very well to close this gap
in acute treatment. Neuroprotective agents likely will
not even be a consideration for much of the world.
This discrepancy in access to medical care clearly
is a social issue that will require much attention on
the part of the World Health Organization and In-
ternational League Against Epilepsy. However, for
purposes of this conference, the question we need to
address is whether by 2010 it will even be possible to
prevent status epilepticus from causing brain damage
if status is treated under optimal circumstances.
To try to answer this question we need to un-
derstand the mechanisms whereby status and other
insults to the brain cause neuronal injury, and po-
tential ways in which we might intervene in these
processes. However, as recent experience in clinical
trials of potential neuroprotective agents in stroke
* Correspondence to: D.M. Treiman, Barrow Neurological
Institute, 350 West Thomas Road, Phoenix, AZ 85013,
USA. Tel.: + 1-602-406-6921; Fax: ÷ 1-602-406-7161;
E-maih dtreiman@chw.edu
and traumatic brain injury have shown us, it may
not be easy to translate observations from in vitro
experiments and highly focused in vivo models to
successful outcomes in clinical trials. Thus we also
need to consider what will be necessary to get from
bench to bedside if we want to be there by 2010.
Current status of the treatment of status
epilepticus
The best way to prevent SE-induced brain damage
is to stop each episode of SE as quickly as possible
(Rowan and Scott, 1970; Fujikawa, 1996). However,
SE is not always easy to stop. In a large clinical trial
comparing four drug regimens in the initial treatment
of generalized convulsive status epilepticus (GCSE)
(Treiman et al., 1998) the most effective drug in the
treatment of overt GCSE was successful only 65%
of the time (Fig. 1). Data from this same trial also
make it clear that the longer the duration (Treiman
et al., 1992), the more subtle the presentation of
GCSE (Treiman et al., 1993), and the later the EEG
stage at the time of initial treatment (Treiman et
al., 2000), the harder GCSE is to treat. Even one
additional generalized convulsion makes experimen-
tal GCSE less responsive to diazepam (Walton and
Treiman, 1995). Furthermore, there is good evidence
from experimental studies that the longer SE lasts
the more neuronal damage will occur (McDonough
et al., 1995; Fujikawa, 1996; Gruenthal, 1998). Thus,
if SE is not treated early after its onset, or does not
respond fully to initial treatment, it becomes pro-
472
70 - 64.9
60 58.2 55.8
50 43.6
40
30 !i ii!!!!ill ill i fill
i!i i!i il ! iii!ii !i~ i~¸~!i~!
5~!~i ~I~
20
10 m II ..............
0
il]~i~iiii~ ili!iii!iliJ
LOR PB DZM+PHT PHT
Treatment Group
Fig. 1. Rate of successful treatment for each of four first-drug
regimens used in comparisons of initial intravenous treatments
within patients with overt (gray bars) or subtle (black bars)
generalized convulsive status epilepticus. Success was defined
as cessation of all behavior and electrical epileptiform activity
within 20 rain from the start of drug infusion, with no recurrence
during the next 40 min. In the overt patients, differences in fre-
quency of success among treatments were statistically significant
(P = 0.02) and in pair-wise comparisons lorazepam was effec-
tive more often than phenytoin (P = 0.002). Differences among
groups were not statistically significant in the subtle group.
The percent success rate for each treatment is indicated above
the bars. Treatment group abbreviations and doses: LOR = lo-
razepam (0.1 mg/kg); PB = phenobarbital (15 mg/kg); DZM
+ PHT = diazepam (0.15 mg/kg) followed by phenytoin (18
mg/kg); PHT = phenytoin (18 mg/kg). Modified from Treiman
et al. (1998), with permission.
gressively more refractory to pharmacological man-
agement and SE-induced brain damage is more and
more likely to occur. Because in the clinical setting
this will be the situation frequently, it is important
to develop neuroprotective strategies as an adjunct
to acute pharmacological management of SE aimed
solely at stopping ongoing seizure activity.
Excitotoxic mechanisms
The mechanism of status epilepticus-induced neu-
ronal damage is now largely understood in terms of
the role of the damaging effects of excitatory amino
acid neurotransmitters on postsynaptic neurons (O1-
ney, 1985; Olney et al., 1986). The excitatory role
of glutamate has been known since the seminal stud-
ies of Hayashi (1954). Fifteen years later Lucas and
Newhouse (1957) first showed that sustained expo-
sure to glutamate could kill retinal cells. Olney and
Sharpe (1969) and Olney et al. (1971) expanded this
observation to other excitatory amino acids acting on
central nervous system neurons and coined the term,
'excitotoxicity'. We now understand that excitatory
neurotoxicity involves two components: (1) an initial
influx of sodium, membrane depolarization and in-
flux of water leading to cell swelling; and (2) subse-
7.7 quently a delayed neuronal degeneration as the result
of excessive calcium influx (Choi, 1988), mediated
primarily by ionotropic receptors for N-methyl-D-
aspartate (NMDA), kainate, and c~-amino-3-hydroxy-
5-methylisoxazole-4-propionic acid (AMPA). Ex-
citotoxicity has been shown in in vitro studies
to be dependent on the presence of calcium in
the extracellular medium (Garthwaite et al., 1986;
Choi, 1987; Rothman et al., 1987). Activation
of the metabotropic receptor activates the inositol
polyphosphate second-messenger pathway intracel-
lularly and causes release of calcium from endo-
plasmic reticulum stores into cytoplasm (Nahorski,
1988). This in turn induces excessive production
of intracellular enzymes such as nitric oxide syn-
thase, protein kinase C, and various phospholipases,
proteases (including caspases and calpains), endonu-
cleases and phosphatases, with toxic consequences
for the neuron.
In status epilepticus a sustained release of glu-
tamate, aspartate, (and likely AMPA and kainate
as well) has been assumed to occur as a conse-
quence of the ongoing epileptic activity, but this
has been difficult to demonstrate (Lehmann et al.,
1985; Alabadi et al., 1999). This may be due to effi-
cient re-uptake of these neurotransmitters, or that the
synaptic contribution to the total amount of extracel-
lular fluid (ECF) is very small, and thus even large
increases in synaptic concentrations may not pro-
duce measurable changes in average ECF concen-
tration. However, administration of 7-nitroindazole,
a selective inhibitor of neuronal nitric oxide syn-
thase, during kainate-induced SE does produce an
increase in ECF glutamate collected by microdial-
ysis probe and measured by HPLC (Alabadi et al.,
1999). Neurons injured by ischemia or trauma have
been shown to release glutamate, even without in-
hibition of nitric oxide synthase, presumably as the
result of energy failure, injury-induced depolariza-
tion, or leakage through damaged cell membranes.
 473

Glutamate7

............ <1............................. ; : Na
:::::::::::::::::::::::: ::::!iiii~: re + ::::::::::::::::::::::::::::: ..................

'V ~ ~ l'---(o~'~-'--L~---.~J proteases

O2"- ....
eicosanoids [ ~202J ~
I Disruption
...........of
v Impaired ~y~uo~etuu
Lipid peroxidation } energy Damageto DNA
products ~ Peroxynitrite [ production Inactivationof
T ~ [ I syntheticenzymes
Destabilization Ib ~ ' ~ ~
of cell membranes I
Fig. 2. Some of the mechanisms that likely contribute to SE-induced excitotoxic neuronal injury, mGlu = metabotropic glutamate
receptor; NMDA = N-methyl-D-aspartate receptor; AMPA = AMPA/kainate type glutamate receptors; PL = phospholipids; PLA2 =
phospholipase A2; DAG = diacylglycerol; PLC = phospholipase C; PKC = protein kinase C; G = G protein; PIP2 = phosphatidylinositol
4,5-bisphosphate; IP 3 = inositol 1,4,5-triphosphate; N O - = nitric oxide; O F = superoxide radical; H202 = hydrogen peroxide; VSCC
= voltage-sensitive Ca 2+ channel. Modified from Dugan and Choi (1999), with permission.

Microdialysis studies have shown a six-fold increase Although a number of agents have been shown to
in ECF glutamate concentrations after fluid percus- have neuroprotective effects in experimental status
sion trauma in the rat (Faden et al., 1989; Katayama epilepticus (see Table 1), thus far none fulfills any
et al., 1990). of these criteria. Many require pretreatment to be ef-
Fig. 2 summarizes some of the mechanisms that fective. Others do appear to provide some degree of
have been implicated in excitotoxic neuronal damage neuroprotection, even when given after status epilep-
and death. This is only a partial sketch of what is ticus has been initiated, as would be necessary for
becoming a very complicated picture. It is increas- clinical use. However, there are as yet no clinical
ingly clear that, because there are multiple pathways data that support neuroprotective efficacy of any of
stimulated by excitotoxicity-induced excessive inter- these agents in human status epilepticus, for the tea-
cellular calcium concentrations that may cause neu-
ronal damage and death, blocking any one pathway
or even a group of pathways may not be sufficient TABLE l
to protect neurons from damage. It seems likely that Agents used to prevent SE-induced neuronal damage in animal
to be effective as a neuroprotective agent in status models
epilepticus an agent will need to (1) block glutamate
NMDA antagonists AP5, AP7, CPE CGP39551,
release or increase its re-uptake, or (2) prevent ex-
CGP40116, ketamine, MK-801, TCP
cessive entry of Ca 2+ into neuronal cells, or (3) be Non-NMDA antagonist NBQX
effective in a cocktail with a number of other agents, Caspase-3 inhibitor z-DEVD-fmk (pre- and post-SE)
each of which works at different neuroprotective Antiepileptic drugs GVG (pre-SE), REM (pre-SE),
sites, or (4) have multiple mechanisms of action and PNU-151774E, TPM
Other agents estradiol benzoate (pre-SE)
itself work at many different neuroprotective sites.
474
sons just cited as well as those outlined in the next
section.
F r o m bench to bedside
Although, as indicated above, a number of com-
pounds have been shown to have a neuroprotective
effect in various models of status epilepticus over
the last two decades, none have yet come to clin-
ical trial. There are a number of reasons for this.
A review of experience in clinical trials of putative
neuroprotective agents in stroke and traumatic brain
injury is instructive. A large number of agents have
been studied in both of these disorders, but thus far
few have been successful in Phase III trials, and
none sufficiently to proceed to clinical approval, de-
spite enormous expenditure of time and resources.
Doppenberg et al. (1997) outlined five requirements
for successful clinical trials in traumatic brain injury
(Table 2), and reviewed the ways in which many
recent trials have failed to fulfill these requirements.
In my view, these requirements are necessary, but
not sufficient, to enhance the probability of a suc-
cessful clinical trial of a neuroprotective agent. What
is missing is the demonstration of efficacy and safety
of a drug in an in-vivo whole-animal model that
closely approximates the human clinical condition
to be studied. The ideal model to study the mech-
anism of a pathophysiologic event and the potential
for a therapeutic intervention to alter that event in
a therapeutically beneficial way, is likely to be very
different from a whole-animal model of a clinical
disorder. A mechanism-focused model is ideally a
'clean' model, in which all biological variables ex-
cept the phenomenon under study are held constant.
Clinical disorders, however, occur in whole organ-
TABLE 2
Prerequisites for clinical trials of NP in traumatic brain injury
(1) Drug mechanism is demonstrated in animal models
(2) Mechanism is blocked by the drug
(3) Mechanism is demonstrated to occur in human head injury
(4) Brain penetration of drug is adequate to block the
mechanism
(5) Drug safety and tolerability is shown in human traumatic
brain injury
Modified from Doppenberget al. (1997).
isms, with multiple biological phenomena all operant
at the same time. Because drugs for therapeutic inter-
vention are inherently 'dirty', which is to say, have
many mechanisms of action, they are likely to have
multiple effects on a whole organism. Some of these
may counteract a single positive effect observed in
an in vitro model, where a single mechanism is
isolated for study.
Clinically relevant whole-animal models of clin-
ical conditions have not been easy to develop, and
most models have been developed to study spe-
cific mechanistic phenomena. In status epilepticus
research, only one model has been specifically devel-
oped to study treatment of status epilepticus. Walton
and Treiman (1988) described a model of secon-
darily generalized tonic-clonic status epilepticus in
the rat that closely approximates human secondar-
ily generalized convulsive status. A cobalt lesion is
made over the left motor strip in adult Sprague-
Dawley rats. In 5 - 7 days, when the rat is exhibiting
simple partial seizures manifested by twitches of the
right front paw and/or whiskers, secondarily gener-
alized status epilepticus is induced by intraperitoneal
injection of 5.5 mmol/kg homocysteine thiolactone.
Within 20-30 min a series of true secondarily gen-
eralized tonic-clonic seizures ensues. If untreated,
the electroencephalogram (EEG) evolves through the
series of five patterns described by Treiman et al.
(1987, 1990) in human generalized convulsive sta-
tus epilepticus and subsequently by Treiman and
others in ten models of experimental status epilep-
ticus (Lothman et al., 1989; Treiman et al., 1990;
Mikati et al., 1992; Handforth and Treiman, 1994;
Kim et al., 1997; Gruenthal, 1998; Koplovitz and
Skvorak, 1998), including one primate model (Mc-
Donough et al., 2001). Perhaps of most importance,
the same serum concentrations reported in the clini-
cal literature to be effective in the treatment of gen-
eralized convulsive status epilepticus for diazepam,
lorazepam, phenobarbital and phenytoin are effective
in this model (Walton and Treiman, 1996) (Table 3).
Furthermore, the effective concentration of valproic
acid against generalized convulsive status epilepticus
in this model Walton and Treiman (1992), is approx-
imately the same serum concentration now being
reported to be effective in humans.
This model has been used effectively in the study
of potential new antiepileptic drugs for the acute

TABLE 3
Serum concentrations effective against generalized tonic-clonic
seizures in the cobalt/homocysteine model of GTSE and in
human GTC status epilepticus
Drug EDs0 vs. GTCS in Clinicallyeffective
cobalt/homocysteine in GCSE
model
Phenytoin 26.2 p~g/ml 23.8 txg/ml
Diazepam 168 ng/ml 30-80 ng/ml*
30-200 ng/ml*
Phenobarbital 12.8 gg/ml 8.4 Ixg/ml
18.3 p~g/ml
Lorazepam 196 ng/ml 30-160 ng/ml
70-330 ng/ml
Valproic acid 260 p~g/ml ~240 Ixg/ml
*Primarily generalized convulsive SE only.
Modified from Walton and Treiman (1996).
management of generalized convulsive status epilep-
ticus. Its major advantages are (1) that it closely
approximates human secondarily generalized con-
vulsive status epilepticus behaviorally and electroen-
cephalographically, and (2) that it has been validated
on standard antiepileptic drugs. Thus this model pro-
vides a way for a new drug to be tested at relatively
low cost to determine potential clinical efficacy, tox-
icity, and optimal serum concentration before requir-
ing commitment to the very high cost necessary to
conduct a human clinical trial in status epilepticus.
The recently reported Department of Veterans Af-
fairs (DVA) Cooperative Trial on the treatment of
status epilepticus (Treiman et al., 1998) cost ap-
proximately $5 million during the 5 years of data
collection from 1990 to 1995, even with much of
the cost underwritten by the DVA system. For testing
of potential neuroprotective agents it would seem
desirable to utilize a model like the Walton/Treiman
cobalt/homocysteine model of secondarily general-
ized convulsive status epilepticus to conduct 'proof
of principle' whole-animal 'clinical trials' before
embarking on any large-scale clinical studies. The
advantage of such a model is that it could approx-
imate the clinical condition under study in a whole
animal where multiple biochemical pathways are op-
erating within neurons and multiple physiological
pathways are operating within the brain. Serum con-
centrations of a drug effective as a neuroprotective
agent in such an animal model (regardless of large
475
TABLE 4
Possible outcome parameters in a trial of neuroprotective agent
vs. placebo, added to the acute antiepileptic drug(s) used to stop
status epilepticus
(1) How fast SE stops
(2) Time to recovery to full consciousness
(3) Outcome at 30 days
(4) Evidence of brain atrophy on MRI (Compare immediate
post-SE MRI with late MRI for ventricular enlargement,
cortical atrophy, hippocampal volume)
(5) MR spectroscopy changes
(6) In de novo SE patients, development of subsequent epilepsy
(if willing to leave off AEDs)
differences in effective doses) can be expected to be
effective in human status epilepticus if the model is
a reasonable approximation of the human condition.
Thus, preliminary studies in animal models can be
used for dose finding, and then to obtain preliminary
estimates of efficacy and safety of the drug at serum
concentrations anticipated to be used in clinical tri-
als at far less cost and risk to patients than would
be necessary without this intermediate step in drug
development.
A critical aspect to be considered in the develop-
ment of such a model and in the conduct of clin-
ical trials will be the outcome parameters. Table 4
lists possible outcome parameters for evaluating the
potential of a neuroprotective agent for preventing
SE-induced brain damage. How fast SE stops during
the acute episode (Leppik et al., 1983; Shaner et al.,
1988; Chamberlain et al., 1997; Scott et al., 1999),
time to recovery to full consciousness (Treiman et
al., 1998), and outcome 30 days after the episode
(DeLorenzo et al., 1996; Logroscino et al., 1997;
Treiman et al., 1998) are parameters that have been
used in recent clinical trials and clinical studies of
status epilepticus. It is quite possible that the addition
of a neuroprotective agent to an antiepileptic drug
regimen would improve the outcome of acute treat-
ment directed at stopping SE, measured at the time of
acute treatment or at 30 days after the episode. How-
ever, the real goal of neuroprotection in the treatment
of SE is to prevent SE-induced neuronal damage. To
assess neuronal damage, neuroimaging techniques,
as discussed elsewhere in this symposium, are most
likely to be effective. Evidence of brain atrophy (as
measured by cortical atrophy, ventricular enlarge-
476
ment or hippocampal volume loss) on MRI imaging
will require comparison of early post-SE MRI im-
ages, obtained after SE-induced edema has subsided,
with subsequent MRI images, obtained long enough
after the episode that atrophy can be detected if it is
going to occur. On the other hand, MRI spectroscopy
changes may be detected early after an episode of
SE, but only persistent spectroscopy changes can be
taken as evidence of neuronal damage from SE. Fi-
nally, preventing the development of epilepsy in SE
patients who did not have epilepsy before the episode
would be a good indicator of neuroprotection. How-
ever, such an outcome parameter would require a
willingness on the part of clinicians to withhold the
use of antiepileptic drugs following an acute episode
of SE, and would require a long follow-up period to
detect the development of epilepsy in the untreated
group.
Essential to the design of any 'clinical trial',
whether it is a pilot 'model clinical trial' in rats, as
proposed above, or one actually conducted in human
patients, is the use of good, unambiguous operational
definitions. This has particularly been a problem for
status epilepticus treatment studies. Every neurolo-
gist believes he or she knows what status epilepti-
cus is, but few studies have prospectively specified
an operational definition of status epilepticus and
criteria for inclusion, or specified an unambiguous
operational definition of successful treatment. Es-
tablishment of such unambiguous operational defi-
nitions will be particularly important when dealing
with outcome parameters related to neuroprotection
from status epilepticus-induced neuronal damage, as
outlined in Table 4, as will be designing such trials
as properly controlled double-blind studies.
Challenges in emergency treatment clinical
research
Testing of agents with potential efficacy in the treat-
ment of medical emergencies poses a number of
problems that do not usually apply to other clin-
ical trial situations (Treiman, 1998). Many of the
drugs that appear promising for neuroprotection in
animal studies are only effective when given prior
to the induction of status epilepticus. However, for a
neuroprotective drug to be useful clinically, it must
have efficacy when given during ongoing status. This
creates an urgency to treat that impacts on patient
recruitment and informed consent issues. Identifica-
tion and recruitment of patients under emergency
conditions is difficult. As a generalization, those
situations that have the greatest availability of pa-
tients (e.g. a busy urban emergency room) are those
that also have the most chaos, which is an environ-
ment in which it is difficult to conduct controlled
clinical trials in an orderly manner. There is un-
derstandable reluctance on the part of emergency
physicians to take the extra time necessary to obtain
informed consent before randomly assigning a pa-
tient to one of two or more alternative treatments.
If there is any accepted therapy for the condition
under study, then ethical considerations preclude
the use of placebo-treated control patients. Many
physicians, especially when treating a seriously ill
patient under emergency conditions, are not com-
fortable rendering treatment in a blinded fashion.
Even if there is physician willingness, differences
in rates and volumes of drug administration (e.g.
diazepam vs. phenytoin) pose challenging problems
in drug packaging for a blinded study. Finally, there
are serious concerns regarding informed consent in
emergency treatment research. The principle of 're-
spect for persons', as outlined in the Belmont Report
(National Commission for the Protection of Human
Subjects of Biomedical and Behavioral Research,
1978) requires that any human participating in med-
ical research be fully informed of the potential risks
and benefits of the research procedures and have
the right then to freely decided whether or not to
participate in such research. Clearly such consent is
not possible for a patient being treated for any kind
of medical emergency involving impairment of con-
sciousness, including status epilepticus. Under such
circumstances, surrogate consent is deemed ethically
appropriate by some review boards. However, it is
not clear that it is truly possible for all of the risks
and benefits to be fully understood and consent to be
freely given under the pressure of a medical emer-
gency such as status epilepticus. Yet as a group, it
is in the interest of patients who suffer episodes of
status epilepticus to have the therapeutic value of
potential neurotherapeutic agents determined. Here
the principle of 'justice', also discussed in the Bel-
mont report, comes into consideration. Under this
principle, every class of patient has the right to ben-

efit f r o m a d v a n c e s in m e d i c a l care. T h i s t h e n c r e a t e s
a d i l e m m a , w h i c h m u s t b e r e s o l v e d b y c a r e f u l de-
l i b e r a t i o n s b y a p p r o p r i a t e r e v i e w b o d i e s , to i n s u r e
t h e p r o t e c t i o n o f i n d i v i d u a l h u m a n r i g h t s a n d at t h e
s a m e t i m e p r o v i d e a f r a m e w o r k in w h i c h e t h i c a l
human emergency treatment research can be con-
ducted. R e s o l u t i o n is i m p o r t a n t so t h a t a d v a n c e s
m a d e in the l a b o r a t o r y r e g a r d i n g h o w to p r o t e c t the
brain from status epilepticus-induced neuronal dam-
age c a n b e t e s t e d at t h e b e d s i d e , so t h a t p e r h a p s b y
2 0 1 0 b r a i n d a m a g e a f t e r status e p i l e p t i c u s i n d e e d
m i g h t b e history.
References
Alabadi, J.A., Thibault, J.L., Pinard, E., Seylaz, J. and Las-
bennes, F. (1999) 7-Nitroindazole, a selective inhibitor of
nNOS, increases hippocampal extracellular glutamate concen-
tration in status epilepticus induced by kainic acid in rats.
Brain Res., 839: 305-312.
Chamberlain, J.M., Altieri, M.A., Funerman, C., Young, G.M.,
Ochsenschlager, D.W. and Waisman, Y. (1997) A prospective,
randomized study comparing intramuscular rnidazolam with
intravenous diazepam for the treatment of seizures in children.
Pediatr. Emerg. Care, 13: 92-94.
Choi, D.W. (1987) Ionic dependence of glutamate neurotoxicity.
J. Neurosci., 7: 369-379.
Choi, D.W. (1988) Glutamate neurotoxicity and diseases of the
nervous system. Neuron, 1: 623-634.
DeLorenzo, R.J., Hauser, W.A., Towne, A.R., Boggs, J.G., Pel-
lock, J.M., Penberthy, L., Garnett, L., Fortner, C.A., Ko, D.
and Petlock, J. (1996) A prospective, population-based epi-
demiologic study of status epilepticus in Richmond, Virginia.
Neurology, 46: 1029-1035.
Doppenberg, E.M., Choi, S.C. and Bullock, R. (1997) Clinical
trials in traumatic brain injury. What can we learn from
previous studies?. Ann. N.Y. Acad. Sci., 825: 305-322.
Dugan, L.L. and Choi, D.W. (1999) Hypoxic-ischemic brain in-
jury and oxidative stress. In: G.J. Siegel, B.W. Agranoff, R.W.
Albers, S.K. Fisher and M.D. Uhler (Eds.), Basic Neurochem-
istry: Molecular, Cellular and Medical Aspects, 6th ed., ch.
34. Lippincott-Raven, Philadelphia, PA, pp. 711-729.
Faden, A.I., Demediuk, E, Panter, S.S. and Vink, R. (1989)
The role of excitatory amino acids and NMDA receptors in
traumatic brain injury. Science, 244: 798-800.
Fujikawa, D.G. (1996) The temporal evolution of neuronal dam-
age from pilocarpine-induced status epilepticus. Brain Res.,
725:11-22.
Garthwaite, G., Hajos, F. and Garthwaite, J. (1986) Ionic re-
quirements for neurotoxic effects of excitatory amino acid
analogues in rat cerebellar slices. Neuroscience, 18: 437-447.
Gruenthal, M. (1998) Electroencephalographic and histological
characteristics of a model of lirnbic status epilepticus permit-
477
ting direct control over seizure duration. Epilepsy Res., 29:
221-232.
Handfortb, A. and Treiman, D.M. (1994) A new, non-
pharmacologic model of convulsive status epilepticus induced
by electrical stimulation: behavioral/electroencephalographic
observations and response to phenytoin and phenobarbital.
Epilepsy Res., 19: 15-25.
Hayashi, T. (1954) Effects of sodium glutamate on the nervous
system. Keio J. Med., 3: 183-192.
Katayama, Y., Becker, D.E, Tamura, T. and Hovda, D.A. (1990)
Massive increases in extracellular potassium and the indis-
criminate release of glutamate following concussive brain in-
jury. J. Neurosurg., 73: 889-900.
Kirn, J.-M., Walton, N.Y. and Treiman, D.M. (1997) EEG pat-
terns of high-dose pilocarpine-induced status epilepticus in
rats (abstr.). Epilepsia, 38(Suppl. 8): 225-226.
Koplovitz, I. and Skvorak, J.E (1998) Electrocorticographic
changes during generalized convulsive status epilepticus in
soman intoxicated rats. Epilepsy Res., 30: 159-164.
Lehmann, A., Hagberg, H., Jacobson, I. and Hamberger, A.
(1985) Effects of status epilepticus on extracellular amino
acids in the hippocampus. Brain Res., 359: 147-151.
Leppik, I.E., Derivan, A.T., Homan, R.W., Walker, J., Ramsay,
R.E. and Patrick, B. (1983) Double-blind study of lorazepam
and diazepam in status epilepticus. JAMA, 249: 1452-1454.
Logroscino, G., Hesdorffer, D.C., Cascino, G., Annegers, J.E
and Hauser, W.A. (1997) Short-term mortality after a first
episode of status epilepticus. Epilepsia, 38: 1344-1349.
Lothman, E.W., Bertram, E.H., Bekenstein, J.W. and Perlin,
J.B. (1989) Self-sustaining limbic status epilepticus induced
by 'continuous' hippocarnpal stimulation: electrographic and
behavioral characteristics. Epilepsy Res., 3:107-119.
Lucas, D.R. and Newhouse, J.E (1957) The toxic effect of
sodium L-glutamate on the inner layers of the retina. Arch.
Ophthalmol., 58: 193-201.
McDonough Jr., J.H., Dochterman, L.W., Smith, C.D. and Shih,
T.M. (1995) Protection against nerve agent-induced neu-
ropathology, but not cardiac pathology, is associated with
the anticonvulsant action of drug treatment. Neurotoxicology,
16: 123-132.
McDonough, J.H. Jr., Capacio, B.R. and Shih, T.-.M. (2001)
Benzodiazepine dosage necessary to terminate soman-induced
seizures in a rhesus monkey model. Unpublished report pre-
sented at an Advanced Anticonvulsant System Focus Group
Meeting, U.S. Army Medical Material Development Activity.
Fort Detrick, MD July 17-18, 2001.
Mikati, M.A., Chronopoulos, A. and Holmes, G.L. (1992) Stages
of kainic acid (KA)-induced status epilepticus (SE) in the
prepubescent brain and response to phenobarbital (Ph) (abstr.).
Neurology, 42(Suppl. 3): 364.
Nahorski, S.R. (1988) Inositol polyphosphates and neuronal cal-
cium homeostasis. Trends Neurosci., 11 : 444-448.
National Commission for the Protection of Human Subjects
of Biomedical and Behavioral Research (1978) The Belmont
Report: Ethical Principles and Guidelines for the Protection of
Subjects of Research, DHEW Publication No. (OS) 78-0012,
478
Appendix I, DHEW Publication No. (OS) 78-0013, Appendix
II, DHEW Publication (OS) 78-0014, Washington, DC.
Olney, J.W. (1985) Excitatory transmitters and epilepsy-related
brain damage. Int. Rev. Neurobiol., 27: 337-362.
Olney, J.W. and Sharpe, L.G. (1969) Brain lesions in an infant
rhesus monkey treated with monosodium glutamate. Science,
166: 386-388.
Olney, J.W., Ho, O.L. and Rhee, V. (1971) Cytotoxic effects of
acidic and sulphur containing amino acids on the infant mouse
central nervous system. Exp. Brain Res., 14: 61-76.
Olney, J.W., Collins, R.C. and Sloviter, R.S. (1986) Excitotoxic
mechanisms of epileptic brain damage. Adv. NeuroL, 44: 857-
877.
Rothman, S.M., Thurston, J.H. and Hauhart, R.E. (1987) Delayed
neurotoxicity of excitatory amino acids in vitro. Neuroscience,
22: 471-480.
Rowan, A.J. and Scott, D.E (1970) Major status epilepticus: a
series of 42 patients. Acta Neurol. Scand., 46: 573-584.
Scott, R.C., Besag, F.M. and Neville, B.G. (1999) Buccal mida-
zolam and rectal diazepam for treatment of prolonged seizures
in childhood and adolescence: a randomised trial. Lancet, 353:
623-626.
Shaner, D.M., McCurdy, S.A., Herring, M.O. and Gabor, A.J.
(1988) Treatment of status epilepticus: a prospective com-
parison of diazepam and phenytoin versus phenobarbital and
optional phenytoin. Neurology, 38: 202-207.
Treiman, D.M. (1998) Clinical trials for status epilepticus. Adv.
Neurol., 76: 173-178.
Treiman, D.M., Walton, N.Y., Wickboldt, C. and DeGiorgio,
C.M. (1987) Predictable sequence of EEG changes during
generalized convulsive status epilepticus in man and three
experimental models of status epilepticus in the rat (abstr.).
Neurology, 7(Suppl. 1): 244.
Treiman, D.M., Walton, N.Y. and Kendrick, C. (1990) A pro-
gressive sequence of electroencephalographic changes during
generalized convulsive status epilepticus. Epilepsy Res., 5: 49-
60.
Treiman, D.M., Meyers, P.D., Walton, N.Y. and DVA Status
Epilepticus Cooperative Study Group (1992) Duration of gen-
eralized convulsive status epilepticus: relationship to clinical
symptomatology and response to treatment (abstr.). Epilepsia,
33(Suppl. 3): 66.
Treiman, D.M., Meyers, P.D., Walton, N.Y. and DVA Status
Epilepticus Cooperative Study Group (1993) Factors that pre-
dict prognosis in generalized convulsive status epilepticus (ab-
str.). Epilepsia, 34(Suppl. 6): 30.
Treiman, D.M., Meyers, P.D., Walton, N.Y., Collins, J.E,
Coiling, C., Rowan, A.J., Handforth, A., Faught, E., Calabrese,
V.P., Uthman, B.M., Ramsay, R.E. and Mamdani, M.B. (1998)
A comparison of four treatments for generalized convulsive
status epilepticus. N. Engl. J. Med., 339: 792-798.
Treiman, D.M., Walton, N.Y., Collins, J.E and DVA Status
Epilepticus Cooperative Study Group (2000) EEG pattern in
generalized convulsive status epilepticus (GCSE) predicts re-
sponse to treatment. Epilepsia, 41(Suppl. 7): 218.
Walton, N.Y. and Treiman, D.M. (1988) Experimental secon-
darily generalized convulsive status epilepticus induced by
D,L-homocysteine thiolactone. Epilepsy Res., 2: 79-86.
Walton, N.Y. and Treiman, D.M. (1992) Valproic acid treatment
of experimental status epilepticus. Epilepsy Res., 12: 199-205.
Walton, N.Y. and Treiman, D.M. (1995) Every seizure counts
in status epilepticus: an experimental comparison of treatment
after one and two generalized tonic-clonic seizures (abstr.).
Epilepsia, 36(Suppl. 4): 45.
Walton, N.Y. and Treiman, D.M. (1996) Rational polytherapy in
the treatment of status epilepticus. Epilepsy Res. Suppl., 11:
123-139.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 43

Is complete seizure control imperative?

Frederick Andermann *

McGill University, Montreal Neurological Hospital and Institute, 3801 University Street, Montreal, PQ, H3A 2B4, Canada

Abstract: Is complete control imperative? The answer depends on whether complete control is indeed possible, on the
possibility of achieving modifications of lifestyle, and on the type of epilepsy, with particular reference to the presence of
progressive dysfunction. This may be seen in patients with temporal lobe or other forms of focal epilepsy, in the epileptic
encephalopathies such as West and Lennox Gastaut Syndromes and even in some patients with idiopathic generalized
epilepsy. Progressive memory changes and global cognitive problems are examples. Progressive language deterioration,
secondary epileptogenesis and phenomena analogous to kindling are also important issues. How long treatment should
be continued depends on many factors, not least the preference of the patient and of the family. Weighing the benefits
of complete control versus the side effects and risks of medication or surgery is crucial. There are obvious benefits to
complete control; it is imperative if these benefits are greater than the cost.

One of the most important if not the most impor-
tant concern of patients and their families is whether
the patient's seizures will damage the brain. From an
empirical standpoint the answer depends on whether
the seizures can be controlled or not. The general
tendency has been to downplay the risks of recur-
rent seizures if, despite optimal medical and surgical
treatment, these cannot be satisfactorily controlled.
On the other hand, the tendency of neurologists, and
in particular epileptologists, is to attempt complete
seizure control and not to be satisfied with con-
tinuing seizures, even infrequent ones. The attitude
depends to some extent on the degree of special in-
terest of the physician but also on the expectations
of the patient and the family. Clearly, over the last
decade, the trend has been towards complete control
as far as possible. The advent of some of the more
recent antiepileptic medications such as Valproate
has changed the results of treatment to a point where
* Correspondence to: E Andermann, Montreal Neurolog-
ical Hospital and Institute, 3801 University Street, Mon-
treal, PQ, H3A 2B4, Canada. Tel.: +1-514-398-1976; Fax:
+1-514-398-8540; E-maih mida@musica.mcgill.ca
a greater number of patients, particularly those with
idiopathic generalized epilepsy, can now be fully
controlled.
A common problem is lack of control due to
poor compliance or an excessive lifestyle, particu-
larly lack of sleep but also intake of alcohol. In that
situation, complete control may well be expected
provided that changes in lifestyle are possible (Janz,
1985, 1989). When treating patients with these prob-
lems, elaborating on the risks of recurrent seizures
may well be essential before such behavioral adjust-
ments can be brought about. Here too, the explana-
tion should involve both the patient and family mem-
bers. There continues to be much discussion whether
such behavioral triggers are related to intrinsically
abnormal behavior patterns as Janz has suggested or
whether the recurrent seizures are merely the effect
of adolescent exuberance. In that case behavior may
be more easily modified by a learning process. Expe-
rience certainly suggests that such a learning process
is often successful particularly when the potential
ill effects of recurrent seizures are patiently and re-
peatedly explained. A return visit whenever another
unjustified seizure occurs is frequently helpful. The
approach of accepting recurrence of a seizure every
480
six months or every year was and still is common
in some patients with idiopathic generalized epilepsy
but such an approach is not acceptable at this time.
Of course attempts at complete control must be
tempered by awareness of medication side effects
and one must guard against attempting complete con-
trol at the cost of side effects which might outweigh
the potential ill effects of the seizures themselves.
Side effects are difficult to assess and frequently the
observations of family members are important in this
regard. A baseline neuropsychological evaluation is
of course valuable, but is not possible in every in-
stance. The patient's decision as to what side effects
to accept in return for complete or better seizure
control must be considered. A particular example is
encountered in patients receiving Topiramate (Mar-
tin et al., 1999). A significant number of individuals
are quite willing to accept some changes in memory
and language function in return for the much bet-
ter seizure control than otherwise available to them.
This may at first be somewhat surprising but con-
firms the perception of seriousness or gravity of the
effect of the seizures on the individual.
When considering the effect of seizures it is
worth examining some historical aspects of epilepsy.
It is comforting to patients and families, but also
to the pharmaceutical industry, that in the past
some famous people have had epilepsy and man-
aged to achieve a great deal in their lives despite
this (Temkin, 1971). Examples are Julius Caesar,
Napoleon and possibly Mohammed. In the absence
of effective antiepileptic medication at those times,
it is likely that they had a benign and possibly idio-
pathic epilepsy. This illustrates again the tremendous
variation which may exist in the severity of epilepsy
and implicitly the great variation in the effect of the
epilepsy on cognitive and other functions. A sim-
ilar situation prevails today in areas of the world
where the treatment gap is such that no effective
antiepileptic medication is available (Shorvon and
Farmer, 1988; Meinardi et al., 2001). Further case
control studies of the effect of epilepsy in this situa-
tion would certainly contribute to clarification of this
important issue.
There are certainly examples of individuals in
whom recurrent seizures have led to cognitive dete-
rioration and in some cases to what was previously
described as epileptic dementia (Andermann, pers.
observ.). A striking example was the son of a Uni-
versity Professor whose mother was convinced of
the ill effects of all antiepileptic medications and
refused the use of drugs in the treatment of her son.
This young man who initially had normal cognitive
development continued to have intractable seizures
at regular intervals and eventually developed demen-
tia. It was impossible to convince the mother that
antiepileptic medication was essential in order to
reduce or perhaps control her son's attacks, which
were related to very active bitemporal independent
epileptic foci. The treating epileptologist, a highly
skilled physician, was at his wit's end and quite
unable, as was this writer, to convince the mother
to permit the use of antiepileptic medication by her
son. Other examples of similar deterioration may be
seen in patients with recurrent, particularly untreated
attacks.
A relatively common and insufficiently recog-
nized problem is the recurrence of attacks in bouts,
for a variety of reasons, in patients with idiopathic
generalized epilepsy. The patients and their families
may become aware of increasing memory difficulty
and of other losses in cognitive function. These oc-
cur in the absence of a progressive brain disease
and appear to be clearly linked to the seizure recur-
rence which is sometimes due to lack of compliance,
emotional upheaval or other factors. These symp-
toms may be transient but one wonders whether
they ever disappear completely (Andermann, pets.
observ.). Further studies with objective neuropsy-
chological assessment and documentation in this sit-
uation should clarify the importance of this problem
and in particular to what extent recovery of function
is possible.
Impairment in language function, articulation or
behavior may be seen in parallel with the develop-
ment or increase in the severity of epilepsy. In pa-
tients with benign rolandic epilepsy the development
of language disturbance has been increasingly recog-
nized in recent years (Baglietto et al., 2001; Corda
et al., 2001). The patients with bilateral perisylvian
micropolygyria and active epileptic abnormality of-
ten have increasing difficulties in articulation and
this may be, at least to a point, reversible when
better seizure control can be obtained (Kuzniecky
et al., 1993, 1994). Deterioration in behavior may
be seen before or at the time of onset of temporal

lobe epilepsy and this can be well documented in
some children. It is, in some of these situations, not
entirely clear whether it is the underlying lesion, the
process of epileptogenesis itself, or indeed the activ-
ity of the epilepsy which is responsible for this type
of impairment. These changes are analogous to the
postictal paralysis described by Todd and which by
convention is limited to a matter of hours. One can,
however, observe much longer lasting impairment in
various functions following seizures, through mech-
anisms most likely analogous or identical to that of
the shorter postictal Todd's phenomenon. To what
extent these phenomena share a common mechanism
with the syndrome of hemiconvulsions, hemiplegia
and epilepsy (HHE) is still not entirely clear (Roger
et al., 1982; Kubota et al., 1991). Fortunately, phe-
nomena of this nature tend to be less frequent as im-
proved treatment of epilepsy becomes more widely
available.
When considering possible deleterious effects of
epileptic discharge or of epilepsy over time, one
must consider the phenomenon of secondary epilep-
togenesis. This was extensively studied by the late
Frank Morrell, not only in patients with lesional
temporal lobe epilepsy who develop contralateral
and independent epileptic discharge but also in other
situations (Morrell, 1989, 1991; Morrell and de
Toledo-Morrell, 1999). Interhemispheric secondary
epileptogenesis may also be present in frontal or oc-
cipital epilepsies, though this has less clearly been
identified. It certainly is more common in intra-
hemispheric processes particularly with inferomesial
temporal discharges and seizures occurring in pa-
tients with posterior temporal or occipital lesions.
This may also be seen in patients with posterior cin-
gulate or frontal abnormalities, again leading to the
development of inferomesial temporal epileptogenic
abnormalities and clinical events. These patients may
be said to suffer from pseudotemporal epilepsy. They
do not respond to resection of the epileptogenic fo-
cus, but only to ablation of the epileptogenic lesion,
often at a distance from the electrically demon-
strated abnormalities (Fish et al., 1991). In many
individuals there may also be dual pathology, that is
mesial temporal atrophy in addition to a more distant
epileptogenic lesion (Li et al., 1999). In that situation
resection of the lesion alone is not as likely to lead
to seizure control and resection of both the atrophic
481
mesial temporal structures and the lesion is required
for seizure control. What the mechanisms of sec-
ondary epileptogenesis are is still not entirely clear.
The secondary, often inferomesial temporal changes
may be reversible if the abnormalities are addressed
early enough. Whether in fact the contralateral dis-
charges do become self-perpetuating and clinically
significant, as Morrell (1991) has suggested, still
requires further confirmation.
The mechanism of secondary epileptogenesis has
a resemblance to the kindling phenomenon (Chan-
pattana et al., 2000). An example of kindling in
man is found in patients receiving maintenance ECT,
often in excess of 100 treatments over time. A strik-
ing example was found in a young woman with an
unusual form of psychosis who, after a large num-
ber of ECTs, developed epileptic seizures correlated
with bitemporal independent interictal abnormalities.
These were most likely related to the treatment rather
than to the original process. Epileptic foci may of
course also develop without clinical manifestations
in patients with maintenance ECT. Dependent on
the gravity of the underlying psychosis and its in-
tractability to other approaches, continuing mainte-
nance ECT may be preferable to allowing the often
severe psychosis to continue unabated.
It is now generally recognized that epilepsy is not
a static disorder but that important changes may take
place over time (Andermann, 1999). Whether these
changes are related to the recurrence of seizures or
whether they are related to the underlying epilep-
togenic process is still difficult to determine. A
striking example is seen in patients with temporal
lobe epilepsy. It is generally recognized by patients
and by their families and caregivers that increasing
memory loss over time may occur. This is particu-
larly evident in long-term follow-up. The degree of
postictal amnesia is also more evident after a long
history of temporal lobe epilepsy and such examples
as finding oneself at the end of the bus line having
had a seizure are not uncommon.
The development of chronic schizophreniform
psychosis also seems to be related to long duration
of temporal lobe epilepsy. This has been evaluated
by Slater and Beard (1965) to occur after an average
of 14 years of clinical manifestations. The psychotic
manifestations are mainly hallucinatory and the pa-
tients maintain the ability to function in their families
482
and to have relatively good social relationships. This
form of chronic schizophreniform psychosis, which
does not respond favorably to surgical treatment even
when the seizures are completely abolished, has been
recognized for a long time. It was the reason why
surgical treatment was not considered advisable in
patients with psychosis of this type. Eventually, how-
ever, it became clear that the quality of life improved
after cessation of seizures and reduction of the bur-
den of antiepileptic medication, even if the psychotic
manifestations were to continue. This approach has
been inspired by comments of Peter Fenwick (pers.
commun.) and demonstrated in a study by Reutens et
al. (1997).
Another example of progression in temporal
lobe epilepsy, possibly related to the recurrence of
seizures over a long period of time is encountered
in patients with temporal lobe drop attacks. This
change from a pattern of complex partial seizures to
drop attacks with or without an aura tends to occur
in patients who have a long history of temporal lobe
epilepsy. Occasionally this may occur in older indi-
viduals whose history of preexistent complex partial
seizures may not be very prolonged. Presumably this
mechanism is related to rapid spread from temporal
to frontal lobe structures and thus in a sense may be
analogous to the development of secondary epilep-
togenesis. (Gambardella et al., 1994). Whether these
changes are related to the epileptic attacks them-
selves or to changes in the substrate is continuously
being debated and several studies based on volume-
try of mesial temporal structures have addressed this
question. Several chapters in this volume address this
issue.
Certainly even brief bursts or single epileptic
seizures of temporal origin may lead to important
postictal changes, which are for the most part tran-
sient. An example is the development of postic-
tal psychosis, memory loss or depression. Whether
these patients are more prone to the development
of chronic manifestations in the respective areas
has not been conclusively demonstrated (Anson and
Kuhlman, 1993).
An important issue concerning the effect of
seizures and of the epileptogenic process is raised
by the study of memory in patients with tempo-
ral lobe epilepsy who have surgically been treated.
It has long been known that some improvement in
the memory function of the contralateral temporal
lobe may be found after surgical resection and this
has been traditionally attributed to the loss of in-
terference by the more active epileptic abnormality
in the resected temporal lobe (Williamson et al.,
1993; Schulz et al., 1995; Salanova et al., 1999; Le-
ung et al., 2000). This is often difficult to evaluate
clinically because of considerable variation which
exists between the documented neuropsychological
test results and the patient's perception of his own
memory function. These two results and views often
diverge. In some patients there is no obvious change
in memory function after mesial temporal resection
and recent studies have suggested that this may be
the case in patients who already have significant
atrophy of the temporal structures to be resected.
There is more concern in patients who have no atro-
phy prior to temporal resection and it is likely that
they have a greater tendency to develop some impair-
ment in memory function and at least to be aware
of such changes. In patients where there is bilateral
independent interictal and ictal epileptic discharge,
considerable caution is required to prevent resection
of mesial structures when the ones on the oppo-
site side are unable to sustain adequate memory.
Examinations with intracarotid amytal are required
to assess this and may be supplanted by functional
MRI studies in the future. It is furthermore not clear
whether it is the resection or the disconnection of
the mesial temporal structures which has the most
important effect on memory function. In particular
the role of structures other than the hippocampus is
in the process of being more fully investigated and
assessed.
In patients, usually children, who have secondary
generalized epilepsy, progressive deterioration may
also occur. This is common in West Syndrome,
Lennox Gastaut Syndrome or continuous generalized
epileptic discharge during sleep. In these situations
evidence is somewhat contradictory whether the de-
terioration is related to the seizures, to the often
ongoing electrographic abnormalities or to the un-
derlying epileptogenic process (Doose et al., 2001;
Hahn et al., 2001). It has long been known that con-
trol of the EEG abnormalities in patients with West
Syndrome does not reverse the deterioration, but
more recent results of treatment suggest that this is
by no means a homogeneous process and that early

and successful treatment may improve the cognitive
outcome in these patients. One awaits with interest
the results in children whose infantile spasms have
been successfully treated in early life by Vigabatrin
and whether their cognitive development is better
than was previously the case. In Lennox Gastaut
Syndrome the results of treatment with the newer
antiepileptic agents such as Lamotrigine and Topira-
mate although based on statistically significant study
results are disappointing in practice. Here again the
precise mechanism of deterioration is not clear; nei-
ther is the deterioration in children with continuous
spike and wave during sleep. These epileptic en-
cephalopathies represent one of the major challenges
in pediatric neurology. Attempts at preventing de-
terioration by surgical treatment in patients where
the process is one of secondary generalization have
been encouraging in some children with West Syn-
drome. Again it is not clear whether this improve-
ment is due to an effect on the seizures, reduction
of the electrographic abnormalities or the underlying
epileptogenic area.
When assessing the benefit of control of seizures
by antiepileptic medication or surgical treatment one
is inevitably faced with the issue of cost effective-
ness. There appears to be considerable variation in
people's perception of the importance and severity of
side effects and indeed these may be quite variable.
There are fortunate individuals who while receiv-
ing fairly heavy doses of antiepileptic medication,
deny side effects whereas others seem particularly
sensitive or perhaps particularly introspective and
observant. What the differences between these two
extreme types of individuals are has not been satis-
factorily studied or clarified. Secondly, the impact of
the seizures on the individual is also quite variable,
ranging from the negligible to the severely disabling.
This certainly affects their reaction to antiepilep-
tic drug treatment. An example is seen in patients
receiving Topiramate. The drug is quite effective,
often more so than previous antiepileptic agents used
and a number of patients are quite willing to ac-
cept some language or memory deficit which may
develop as side effects of the medication because
of their improved seizure control (Andermann, pers.
observ.). Others find the side effects intolerable. It
is unlikely that the intelligence or the occupation
of the patient alone explain this reaction, and this
483
is also an area deserving further study, A similar
interesting situation is found in patients receiving
long-term Phenobarbital. Many are quite aware of
the drowsiness accompanying the drug but others are
not. If despite their lack of obvious side effects the
medication is changed, they may become aware of
greatly increased cognitive functioning to their and
the families' delight.
By definition the benefits of a pharmacological
treatment should exceed the side effects or risks
of toxicity. The issue of the cost-benefit ratio is
of course also important when considering surgi-
cal treatment of epilepsy. Prejudice against surgical
treatment was common early on and was particularly
inversely related to the physician's or neurologist's
experience with such surgical treatment. The expres-
sion often quoted in Wilder Penfield's day was that
"no brain is better than bad brain". Though the prin-
ciples remain the same, this formulation has now
been replaced by less outspoken terminology. It has,
on the other hand become clear recently that incur-
ring some postoperative deficit may in some situa-
tions be preferable to the continuation of intractable
seizures. This may at times be the case in patients
with intractable occipital epilepsy who do not have
a clear field defect, or in patients with intractable
seizures involving the foot area in whom inducing
some increased motor and sensory disability may be
preferable to the continuation of more disabling at-
tacks. Obviously, these relatively rare problems must
be considered on an individual basis. In patients
with hemiparesis who are candidates for functional
hemispherectomy the possibility of increased motor
disability has to be weighed against the benefits. One
must be aware of the motor function possible after
hemispherectomy which in most instances is com-
patible with walking or use of the hand though not
with fine finger movements. Needless to say in all
these instances extensive discussions of the benefits
and risks are essential, including at times the pos-
sibility that in addition to the deficit seizures may
continue as well.
Finally in a discussion of whether complete
seizure control is imperative one must address the
issue of the psychological benefits of such control.
It is interesting to note that even before complete
control of seizures is achieved a common question
is whether or indeed when, the medication might
484
be diminished or discontinued. In patients whose
seizure control is complete there are two extremes
in people's views. Some much prefer to continue
to take the antiepileptic medication because of the
fear of recurrent attacks. Depending on the severity
of the epilepsy and the dose as well as the level of
antiepileptic medication it may be reasonable after
some time to consider reduction to an average or
low average level. There is always an unpredictable
risk in any reduction of the level o f medication. The
same applies also to consideration of changing to
a medication which may have lesser side effects.
At the opposite extreme there are patients who can
hardly wait to begin to reduce their medication or to
stop it even without the benefit of medical advice.
Attempts at quantifying or at proceeding by recipe
are not as useful as individual assessment of patients.
Certainly, knowledge of the epileptic syndrome and
the age of the patient are of great benefit in deciding
if and how medication should be adjusted. A particu-
lar situation arises in patients who have had surgical
treatment. It is, if at all possible, advisable to plan
postoperative medication before surgery since both
the surgeon and at times the neurologist are reluctant
to carry out adjustments of medication in the weeks
or months following surgery. Following surgery the
medication, hopefully monotherapy, is reduced to an
average or low average level and after another two
or three years one can envisage the possibility of
discontinuation.
Factors which are without doubt important in
peoples' attitudes towards continuation or discontin-
uation of medication are driving, ability to continue
working and of course the independence conferred
by seizure freedom.
An additional problem is the question of the
possibility of not regaining control even after the
medication is reinstituted. The reason why the medi-
cation is no longer as effective after it is reinstituted
following loss of control after stopping the medica-
tion is unclear. It is as if there were a kindling effect
of the returning seizures but what additional factors
may be present is difficult to assess. It is particularly
not clear whether this is more likely to happen in
patients with idiopathic generalized epilepsy or in
patients with focal seizures. Certainly this is an issue
which needs to be considered when discontinuation
of medication is suggested. Thus in considering the
decision of whether complete control of seizures is
imperative, the answer is unequivocally, yes, pro-
vided that this can be achieved without prohibitive
cost in side effects or risks.
References
Andermann, F. (1999) Epilepsy as a dynamic disorder: a clinical
perspective. In: H. Stefan, F. Andermann, E Chauvel and S.
Shorvon (Eds.), Advances in Neurology, Vol. 81. Lippincott
Williams and Wilkins, Philadelphia, PA pp. 7-10.
Anson, J.A. and Kuhlman, D.T. (1993) Post-ictal Kluver-Bucy
syndrome after temporal lobotomy. J. Neurol. Neurosurg. Psy-
chiatry, 56(3): 311-313.
Baglietto, M.G., Battaglia, EM., Nobili, L., Tortorelli, S., De Ne-
gri, E., Calevo, M.G., Veneselli, E. and De Negri, M. (2001)
Neuropsychological disorders related to interictal epileptic dis-
charges during sleep in benign epilepsy of childhood with
centrotemporal or Rolandic spikes. Dev. Med. Child Neurol.,
43(6): 407-412.
Chanpattana, W., Yatapootanon, W., Techakasem, E and
Chakrabhand, M.L. (2000) Seizure threshold in electrocon-
vu[sive therapy, III. A long-term study. J. Med. Assoc. Thai.,
83(7): 748-755.
Corda, D., Gelisse, E, Genton, E, Dravet, C. and Baldy-
Moulinier, M. (2001) Incidence of drug-induced aggravation in
benign epilepsy with centrotemporal spikes. Epilepsia, 42(6):
754-759.
Doose, H., Hahn, A., Neubauer, B.A., Pistohl, J. and Stephani,
U. (2001) Atypical 'benign' partial epilepsy of childhood or
pseudo-Lennox syndrome, Part II. Family study. Neuropedi-
atrics, 32(1): 9-13.
Fish, D., Andermann, E and Olivier, A. (1991) Complex partial
seizures and small posterior temporal or extratemporal struc-
tural lesions: surgical management. Neurology, 41(I 1): 1781-
1784.
Gambardella, A., Reutens, D.C., Andermann, E, Cendes, E,
Gloor, E, Dubeau, F. and Olivier, A. (1994) Late-onset drop
attacks in temporal lobe epilepsy: a reevaluation of the concept
of temporal lobe syncope. Neurology, 44(6): 1074-1078.
Hahn, A., Pistohl, J., Neubauer, B.A. and Stephani, U. (2001)
Atypical 'benign' partial epilepsy or pseudo-Lennox syn-
drome, Part I. Symptomatology and long-term prognosis. Neu-
ropediatrics, 32( l ): 1-8.
Janz, D. (1985) Epilepsy with impulsive petit mal (juvenile
myoclonic epilepsy). Acta Neurol. Scand., 72(5): 449-459.
Janz, D. (1989) Juvenile myoclonic epilepsy. Epilepsy with im-
pulsive petit real. Cleve. Clin. J. Med., 56(Suppl. Pt. 1): $23-
33; discussion pp. $40-42.
Kubota, Y., Morikawa, T., Yagi, K. and Seino, M. (1991)
Epilepsy associated with hemiplegia, 1. Seizure manifesta-
tions. Jpn. J. Psychiatry Neurol., 45(2): 458-460.
Kuzniecky, R., Andermann, E and Guerrini, R. (1993) Congen-
ital bilateral perisylvian syndrome: study of 31 patients. The
CBPS Multicenter Collaborative Study. Lancet, 341(8845):
608-612.

Kuzniecky, R., Andermann, E and Guerrini, R. (1994) The
epileptic spectrum in the congenital bilateral perisylvian syn-
drome. CBPS Multicenter Collaborative Study. Neurology,
44(3, Pt. 1): 379-385.
Leung, L.S., Ma, J. and McLachlan, R.S. (2000) Behaviors
induced or disrupted by complex partial seizures. Neurosci.
Biobehav. Rev, 24(7): 763-775.
Li, L.M., Cendes, E, Andermann, F., Watson, C., Fish,
D.R., Cook, M.J., Dubeau, E, Duncan, J.S., Shorvon, S.D.,
Berkovic, S.F., Free, S., Oliviel, A., Harkness, W. and Arnold,
D.L. (1999) Surgical outcome in patients with epilepsy and
dual pathology. Brain, 122(5): 799-805.
Martin, R., Kuzniecky, R., Ho, S., Hetherington, H., Pan, J.,
Sinclair, K., Gilliam, F. and Faught, E. (1999) Cognitive
effects of Topiramate, gabapentin, and lamotrigine in healthy
young adults. Neurology, 52(2): 321-327.
Meinardi, H., Scott, R.A., Reis, R. and Sander, J.W. (2001) The
treatment gap in epilepsy: the current situation and ways for-
ward. ILAE Commission on the Developing World. Epilepsia,
42(1): 136-149.
Morrell, F. (1989) Varieties of human secondary epileptogenesis.
J. Clin. Neurophysiol., 6(3): 227-275.
Morrell, F. (1991) The role of secondary epileptogenesis in
human epilepsy. Arch. NeuroL, 48(12): 1221-1224.
Morrell, F. and de Toledo-Morrell, L. (1999) From mirror focus
to secondary epileptogenesis in man: an historical review. Adv.
Neurol., 81:11-23.
Reutens, D.C., Savard, G., Andermann, E, Dubeau, E and
Olivier, F. (1997) Results of surgical treatment in temporal
485
lobe epilepsy with chronic psychosis. Brain, 120(11): 1929-
1936.
Roger, J., Dravet, C. and Bureau, M. (1982) Unilat-
eral seizures: hemiconvulsions-hemiplegia syndrome (HH)
and hemiconvulsions-hemiplegia-epilepsy syndrome (HHE).
Electroencephalogr. Clin. Neurophysiol., Suppl.(35): 211-221.
Salanova, V., Markand, O., Worth, R., Garg, B., Patel, H., As-
conape, J., Park, H.M., Hutchins, G.D., Smith, R. and Az-
zarelli, B. (1999) Presurgical evaluation and surgical outcome
of temporal lobe epilepsy. Pediatr. Neurol., 20(3): 179-184.
Schulz, R., Lfiders, H.O., Noachtar, S., May, T., Sakamoto, A.,
Holthausen, H. and Wolf, E (1995) Amnesia of the epileptic
aura. Neurology, 45(2): 231-235.
Shorvon, S.D. and Farmer, EJ. (1988) Epilepsy in develop-
ing countries: a review of epidemiological, sociocultural, and
treatment aspects. Epilepsia, 29(Suppl. 1): $36-54.
Slater, E. and Beard, A.W. (1965) The schizophrenia-like psy-
chosis of epilepsy, V. Discussion and conclusions. J. Neu-
ropsychiatry Clin. Neurosci., 7(3): 372-378; discussion pp.
371-372.
Temkin, O. (1971) The Falling Sickness: A History of Epilepsy
fi'om the Greeks to the Beginnings of Modern Neurology. Johns
Hopkins Press, Baltimore, MD, 2nd rev. ed.
Williamsou, ED., French, J.A., Thadani, V.M., Kim, J.H., Nov-
elly, R.A., Spencer, S.S., Spencer, D.D. and Mattson, R.H.
(1993) Characteristics of medial temporal lobe epilepsy, ll. ln-
terictal and ictal scalp electroencephalography, neuropsycho-
logical testing, neuroimaging, surgical results, and pathology.
Ann. Neurol., 34(6): 781-787.
T. Sutula and A. Pitkanen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Published by Elsevier Science B.V.

CHAPTER 44

Implications for neuroprotective treatments

Brian S. Meldrum*

GKT School of Biomedical Sciences, Henriette Raphael House, Guy's Campus, London SEI 1UL, UK

Abstract: Pharmacological neuroprotection against the consequences of seizures can be considered as primary neuropro-
tection where the object is to diminish the initial insult by suppressing the seizure activity or diminishing the associated
ionic fluxes (of which the entry of Na+ and Ca2+ are the most significant), and secondary neuroprotection where the
target is some later event in the chain linking ionic changes to altered brain morphology or function. Thus primary
neuroprotection is provided by antiepileptic drugs and compounds acting on voltage-sensitive Na + and Ca2+ channels
or on glutamate receptors (NMDA, AMPA/KA or Group I metabotropic). Secondary neuroprotection may be a result of
acting on the cascade leading to necrosis (e.g. free radical scavengers, NitricOxide synthase inhibitors, CycloOxygenase-2
inhibitors) or the cascades leading to apoptosis (e.g. MAP-kinase inhibitors, caspase-3 inhibitors). Other approaches may
diminish the long-term morphological and functional effects of seizures (e.g. neurotrophin-related therapies).
We need improved preclinical tests for identifying novel compounds with potential for providing secondary neuropro-
tection and antiepileptogenesis. Clinical trials of neuroprotective agents in chronic epilepsy in adults pose major practical
difficulties but the severe childhood epilepsies provide opportunities for aggressive testing of novel compounds.

Introduction Griffiths et al., 1984; Lemos and Cavalheiro, 1995;

The concept of 'neuroprotective treatments' cov-
ers two areas. One is the prevention of activity-
dependent cell death and the other the prevention of
all the delayed functional consequences of seizures
(such as cognitive deficits and altered seizure thresh-
old as discussed elsewhere in this volume). Obvi-
ously, prevention of the seizure discharge itself is the
ideal objective. Failing that, shortening the seizure
discharge can be seen as the first goal of neuropro-
tection. In experimental models of status epilepti-
cus shortening the seizure discharge by antiepilep-
tic drugs (AEDs) has been consistently shown to
provide protection of selectively vulnerable neurons
against ischaemic cell change (Evans et al., 1984;
*Correspondence to: B.S. Meldrum, GKT School of
Biomedical Sciences, Henriette Raphael House, Guy's
Campus, London SE1 1UL, UK. Tel.: +44-207-848-6420;
E-mail: brian.meldrum@kcl.ac.uk
Fujikawa, 1996). Beyond that it is our understanding
of the mechanisms that link the abnormal neuronal
activity during seizures to cell death that guides our
therapeutic endeavours. The severity and duration of
the ionic shifts during the burst discharges as re-
flected by the increase in [Ca2+]i and the progressive
calcium loading of mitochondria is the principal de-
terminant of cell death and is probably also respon-
sible for many of the long-term functional changes
in cells that survive. Both necrotic and apoptotic
cell death can be triggered via increases in cytoso-
lic [Ca 2+] (Zipfel et al., 2000); changes in K + and
C1- may also be important for apoptosis (Yu et al.,
2001). Necrosis and apoptosis may represent alter-
natives with apoptosis being optimal for the tissue
as a whole because of the reduced inflammatory
response. Activation of apoptotic mechanisms may,
through degradation of AMPA receptors by caspases,
be capable of reducing the likelihood of necrotic cell
death. Blocking apoptosis is potentially disadvan-
tageous if it leads to increased necrotic cell death
488
or if it leads to the survival of cells with impaired
function.
Primary neuroprotectiveagents
Primary neuroprotective agents are perceived as act-
ing directly on the ionic imbalances that initiate the
necrotic and apoptotic cascades producing acute cell
death. As Table 1 shows they act primarily on either
voltage-sensitive ion channels or on ligand-gated
ion channels. There is a clear overlap in molecular
targets and mechanisms for antiepileptic dugs and
primary neuroprotective agents.
Although it might seem that voltage-sensitive
(VS) calcium channels would be a better target than
VS sodium channels for neuroprotection, this has not
proved to be the case in in vivo models involving
cerebral ischaemia or traumatic brain injury. There
appear to be two main reasons for this. VS calcium
channel blockers tend to have significant cardiovas-
cular effects. Secondly the agents acting on sodium
channels that are effective antiepileptic drugs and
are neuroprotective in in vivo models (Taylor and
Meldrum, 1995) interact only with the inactive state
of the ion channel and thus show activity-dependent
TABLE 1
Primary neuroprotectiveagents
(1) Sodiumchannel inactivators: lamotrigine,sipatrigine,
phenytoin
(2) Voltage-sensitiveCa2+ channel blockers: SB 206284A,
ziconotide
(3) NMDA antagonists
(a) Competitive(glutamate):D-CPPene,selfotel(CGS19755)
(b) Competitiveglycinesite: licostinel(ACEA 1021),
GV150526A
(c) Open channel blockers: dizocilpine,memantine,cerestat
(d) Polyamineantagonists: eliprodil, ifenprodil,Ro 25-6981,
Ro 8-4304
(4) AMPA antagonists
(a) Competitive:NBQX, YM900
(b) Allosteric: GYKI 52466, talampanel
(5) Group I glutamatemetabotropicreceptorantagonists
AIDA, (RS)-1-aminoindan-1,5-dicarboxylicacid
LY367385, (S)-(+)-c~-amino-4-carboxy-2-methylbenzene-
acetic acid
MPEE 2-methyl-6-(phenylethynyl)pyridine
SIB 1893, 2-methyl-6-(2-phenylethynyl)pyridine
(6) GABAAreceptorpotentiators:benzodiazepines
effects that interfere very little with normal levels of
neuronal firing.
NMDA receptor antagonists are antiepileptic in
a variety of animal models, especially in the re-
flex epilepsy models (Meldrum and Chapman, 1994).
They have also repeatedly been shown to protect
against selective neuronal loss induced by kainate
or pilocarpine, even when they do not shorten the
total duration of the seizure discharge (Fariello et
al., 1989; Clifford et al., 1990; Lerner-Natoli et al.,
1991; Fujikawa et al., 1994). This is presumably be-
cause the Ca 2+ entry associated with the later phase of
each burst discharge is suppressed in the presence of
NMDA receptor antagonists. Compounds showing se-
lectivity among NMDA receptor subtypes may prove
to have better side effect profiles and might therefore
be more clinically acceptable (Kew et al., 1998).
AMPA antagonists are antiepileptic and protect
against hippocampal and cortical pathology in mod-
els of global and focal cerebral ischaemia (Chapman
et al., 1991; Rogawski and Donevan, 1999). Their
neuroprotective action in status epilepticus has been
little studied. Interestingly NBQX (2,3-dihydroxy°6-
nitro-7-sulfamoylbenzo[f]quinoxaline) given to P35
rats undergoing seizures induced by kainate de-
creases the resulting hippocampal damage, prevents
long-term impairment of visuospatial memory but
does not block the appearance of spontaneous recur-
rent seizures (Mikati et al., 1999).
Group I metabotropic receptor agonists are di-
rectly excitatory, potentiate NMDA and AMPA
receptor-mediated responses, promote necrotic cell
death and are epileptogenic when given focally
into the brain (Tizzano et al., 1995; Conn and
Pin, 1997; Bordi and Ugolini, 1999; Allen et al.,
2000). Group I receptor antagonists (such as AIDA,
LY367385, MPEP and SIB 1893) are antiepileptic in
a range of rodent models of epilepsy (Chapman et
al., 1999, 2000). Neuroprotective effects of Group
I antagonists have been described in in vitro sys-
tems (Strasser, 1998; Bruno et al., 1999; Pellegrini-
Giampietro et al., 1999; Allen et al., 2000) but have
not been explored in status epilepticus models.
Secondary neuroprotectiveagents
Secondary neuroprotection has various identifiable
goals (see Table 2). One very clear goal is block-

TABLE 2
Secondary neuroprotection
(1) Blocking the cascade to necrosis
(a) Free radical scavengers, antioxidants: tirilazad, nitrones
(PBN), vitamin E
(b) NO synthase inhibitors: aminoguanidine (iNOS)
(c) COX-2 inhibitors SC58125
(2) Blocking the cascade to apoptosis: caspase 3 inhibitors - tri-
and tetrapeptides 2-DEVD-fmk; BCL2 enhancement;
blockade of MAPkinases
(3) Blocking the inflammatory response: inflammatory cytokine
antagonists; IL6 polymorphism
(4) Complex secondary effects: PAF antagonists; group II
metabotropic agonists; neurotrophins and growth factors
(BDNE TGF-6)
ing the cascade that links the increase in [Ca2+]i to
necrotic cell death ('ischaemic cell change'). This
has been studied in contexts beyond status epilep-
ticus, including various in vivo models of cerebral
ischaemia and traumatic brain injury and in vitro
models of anoxia and 'excitotoxicity' (Sattler and
Tymianski, 2000).
The PAF receptors are a particularly intriguing
target for neuroprotection because of the multiplic-
ity of roles they play (see Bazan et al., 2002, this
volume). They not only influence excitotoxicity via
presynaptic glutamate release and apoptosis via the
permeability transition pore and cytochrome c re-
lease, but also influence the gene transcription of
enzymes such as COX-2 and prostaglandin endoper-
oxide synthase-2 that show sustained elevation fol-
lowing seizures (Marcheselli and Bazan, 1996). Thus
PAF antagonists have the potential of modifying not
only acute and subacute cell death but also the long-
term changes that contribute to the cumulative effect
of seizures on function.
The exact role of COX-2 in the cascades to necro-
sis and apoptosis is not clear. However, COX-2 ex-
pression is markedly elevated after seizures and sta-
tus epilepticus and produces superoxides and proin-
flammatory prostaglandins (see Bazan et al., 2002,
this volume). COX-2 inhibitors reduce excitotoxicity
in vitro (Hewett et al., 2000) and block the inflamma-
tory response in models of cerebral ischaemia. Other
anti-inflammatory approaches are beneficial in focal
cerebral ischaemia models. A tetracycline deriva-
tive, minocycline, given pre- or post-middle cere-
489
bral artery occlusion reduces activation of microglia
and reduces COX-2 expression and prostaglandin
E2 production (Yrjanheikki et al., 1999; Tikka and
Koistinaho, 2001).
COX-2 and calcium-poisoned mitochondria are
sources of superoxide and contribute to the oxida-
tive stress on lipids, proteins and DNA. Antioxidant
therapies involve either the administration of an-
tioxidants which may react with free radicals or
the strengthening of the endogenous antioxidant de-
fences by enhancing the activity of superoxide dis-
mutase, catalase and glutathione peroxidase. Antiox-
idants can give protection against excitotoxic cell
death in various in vitro systems, including selective
neuronal loss induced by burst discharges which can
be ameliorated by vitamin E (see Heinemann et al.,
2002, this volume). Antioxidants provide protection
against reperfusion injury in models of reversible
focal cerebral ischaemia, probably via an action
on endothelial cells (Hall, 1997). Poor penetration
of the blood-brain barrier is a problem with the
21-aminosteroids such as tirilazad and with several
other antioxidants (Gilgun-Sherki et al., 2001). This
may account for the relatively poor clinical response
in most trials in neurological disorders (Delanty and
Dichter, 2000). A double blind trial of vitamin E as
add-on therapy in children with epilepsy did however
report a reduction in seizure frequency (Ogunmekan
and Hwang, 1989).
There are 14 mammalian caspases, most of which
are constitutively expressed in the human brain. They
play a role both in apoptosis and in inflammation.
Some caspases (class I, initiator caspases: 2, 8, 9)
primarily act on other caspases, whereas some (class
II, effector caspases: 3, 6, 7) cleave non-caspase
substrates and provide the final stage of apoptosis.
Seizure activity can apparently induce apotosis either
via cytochrome c release and apoptosome assembly
involving Apafl and caspase-9 but also via death
receptor pathways involving activation of caspase-8
and expression of Fas and FADD (Henshall et al.,
2001a). Various tri- and tetra-peptide caspase in-
hibitors have been shown to block apoptosis in in
vivo and in vitro situations. Interpretation of such
effects can be complicated partly because the se-
lectivity of the inhibitors may be uncertain with
for example 'caspase-3 inhibitors' also being active
against caspase-6 or -7. Also blockade of one cas-
490
pase pathway may lead to compensatory activation
of other pathways (Zheng et al., 2000; Henshall
et al., 2001b). Other potential targets in the battle
against apoptosis include the death receptors and
MAPkinases (Behrens et al., 1999).
Blocking apoptosis may not always be desirable
because it may lead to either necrotic cell death or
the survival of a disabled cell.
In neuronal cultures protection against excito-
toxic cell death can be provided by agonists acting
on Group II or Group III receptors (Bruno et al.,
1996; Nicoletti et al., 1996). Protection by Group
II agonists may involve activation of mGlu3 recep-
tors on astrocytes leading to release of transform-
ing growth factor ~, which provides the neuropro-
tection (Bruno et al., 1998). Protection by Group
III agonists has been shown, in the case of (R,S)-
4-phosphonophenylglycine, to involve activation of
mGlu4 receptors (Bruno et al., 2000). A presynaptic
effect on glutamate release is probably significant
(Faden et al., 1997).
Effects on neurogenesis
In the rodent and in man cells in the subgranular
region of the dentate gyrus retain the ability to pro-
liferate and differentiate into the adult period. Using
BrdU labelling Parent et al. (1997) (see also Parent
and Lowenstein, 2002, this volume) have demon-
strated that seizures cause these precursor cells to
proliferate and contribute to the sprouting process.
Enhanced neurogenesis may be harmful in two ways,
either by providing enhanced excitatory feedback to
granule cells or by migrating into the endfolium
and becoming abnormally excitable (see Parent and
Lowenstein, 2002, this volume). Thus blocking neu-
rogenesis may prevent delayed effects on hippocam-
pal excitability.
Neurotrophins
The neurotrophins have attracted a great deal of
attention because of their role in long-term modifi-
cations in neuronal excitability and synaptic function
and their probable involvement in mechanisms of
neuroprotection and epileptogenesis (Binder et al.,
2001; Jankowsky and Patterson, 2001). The most
documented in the context of epilepsy is the brain-
derived neurotrophic factor (BDNF), but the nerve
growth factor (NGF) and transforming growth factor-
f3 (TGF-~) are also probably important in neuropro-
tection. It is clear that expression of BDNF is en-
hanced in the hippocampus as a result of seizures
or status epilepticus and that sustained changes are
associated with kindling. The course of kindling ap-
pears to be importantly modified by BDNF (Kokaia
et al., 1996; Osehobo et al., 1999; Reibel et al.,
2OOO).
In therapy delivery of neurotrophins to the brain
is problematic, but many indirect approaches are
possible, thus neotrofin modulates the release of
neurotrophic factors and idebenone stimulates NGF
synthesis. A neuroprotective and antiepileptic action
of environmental enrichment may rely on this mech-
anism (Young et al., 1999).
Many effects of neurotrophins on excitotoxic cell
death have been described in in vitro systems. Such
phenomena may be entirely separate from effects
on epileptogenesis. BDNF may be protecting the
developing hippocampus against cell loss, kainate or
seizures (Tandon et al., 1999). NGF and BDNF both
promote the expression of antioxidative enzymes and
thus can prophylactically protect against cell death
due to calcium overload of mitochondria.
Protection by preconditioning
It has long been known that an exposure to cere-
bral ischaemia that is subthreshold for inducing
neuronal necrosis can protect against a subsequent
suprathreshold episode of ischaemia (Kitagawa et
al., 1990; Chen and Simon, 1997). A similar pre-
conditioning effect has been reported for seizures.
Thus a moderately sustained (18 min) seizure in-
duced by bicuculline in rats protects against a further
exposure to bicuculline 3 days later (Sasahira et al.,
1995). A seizure induced by kainate in the rat pro-
tects against a further kainate seizure 3 days later
(Plamondon et al., 1999). Protection against the ef-
fects of kainate is also provided by pre-exposure
to 6 min of global ischaemia. Adenosine A1 re-
ceptors, KA~ channels and protein kinase C are
all postulated to contribute to the preconditioning
effect of ischaemia and of seizures (Plamondon et
al., 1999; Perez-Pinzon, 2000). This may be inter-
preted as an activation of the brain's defences against
492
c o g n i t i v e decline in adults with relatively severe
e p i l e p s y c o m p a r i n g the effect o f say lamotrigine,
tiagabine and topiramate. H o w e v e r , this is clearly
i m p r a c t i c a b l e as the data o f Dodrill (2002, this vol-
u m e ) indicate that 10 or p r e f e r a b l y 20 y e a r f o l l o w - u p
w o u l d be r e q u i r e d and m o n o t h e r a p y o v e r that period
w i t h c o n t i n u i n g seizures is not feasible. B e c a u s e of
the h i g h r e p r o d u c i b i l i t y that is now b e i n g a c h i e v e d
in v o l u m e t r i c i m a g i n g through co-registration pro-
cedures (see D u n c a n , 2002, this v o l u m e ) a m o r e
feasible alternative is to identify patients with severe
e p i l e p s y and initial e v i d e n c e o f cortical v o l u m e de-
crease and f o l l o w t h e m for perhaps 3 - 4 years with a
stable A E D r e g i m e .
References
Allen, J.W., Knoblach, S.M. and Faden, A.L. (2000) Activation
of group I metabotropic glutamate receptors reduces neuronal
apoptosis but increases necrotic cell death in vitro. Cell Death
Differ, 7: 470-476.
Arida, R.M., Scorza, F.A., Peres, C.A. and Cavalheiro, E.A.
(1999) The course of untreated seizures in the pilocarpine
model of epilepsy. Epilepsy Res., 34: 99-107.
Bazan, N.G., Tu, B. and Rodriguez de Turco, E.B. (2002) What
synaptic lipid signaling tells us about seizure-induced damage
and epileptogenesis. In: T. Sutula and A. Pitkanen (Eds.), Do
Seizures Damage the Brain. Progress in Brain Research, Vol.
135. Elsevier, Amsterdam, pp. 175-185.
Behrens, M.M., Strasser, U., Koh, J.Y., Gwag, B.J. and Choi,
D.W. (1999) Prevention of neuronal apoptosis by phorbol-
ester-induced activation of protein kinase C: blockade of p38
mitogen-activated protein kinase. Neuroscience, 94: 917-927.
Ben-Ari, Y. (1985) Limbic seizures and brain damage produced
by kainic acid: mechanisms and relevance to human temporal
lobe epilepsy. Neuroscience, 14: 375-403.
Binder, D.K., Croll, S.D., Gall, C.M. and Scharfman, H.E. (2001)
BDNF and epilepsy: too much of a good thing?. Trends
Neurosci., 24: 47-53.
Bordi, F. and Ugolini, A. (1999) Group I metabotropic glutamate
receptors: implications for brain disease. Prog. Neurobiol., 59:
55-79.
Bruno, V., Copani, A., Bonanno, L., Knoepfel, T., Kuhn, R.,
Roberts, P.J. and Nicoletti, F. (1996) Activation of group III
metabotropic glutamate receptors is neuroprotective in cortical
cultures. Eur. J. Pharmacol., 310: 61-66.
Bruno, V., Battaglia, G., Casabona, G., Copani, A., Caciagli, E
and Nicoletti, F. (1998) Neuroprotection by glial metabotropic
glutamate receptors is mediated by transforming growth
factor-[L J. Neurosci., 18: 9594-9600.
Bruno, V., Battaglia, G., Kingston, A., O'Neill, M.J., Cata-
nia, M.V., Di Grezia, R. and Nicoletti, E (1999) Neu-
roprotective activity of the potent and selective mGlula
metabotropic glutamate receptor antagonist, (÷)-2-methyl-
4-carboxyphenylglycine (LY367385): comparison with LY
357366, a broader spectrum antagonist with equal affinity
for mGlula and mGlu5 receptors. Neuropharmacology, 38:
199-207.
Bruno, V., Battaglia, G., Ksiazek, I., van der Putten, H., Cata-
nia, M.V., Giuffrida, R., Lukic, S. and Leonhardt, T. et al.
(2000) Selective activation of mGlu4 metabotropic glutamate
receptors is protective against excitotoxic neuronal death. J.
Neurosci., 20: 6413-6420.
Bullock, M.R. and Povlishock, J.T. (1996) The role of antiseizure
prophylaxis following head injury. J. Neurotrauma, 13: 731-
734.
Chapman, A.G., Smith, S.E. and Meldrum, B.S. (1991) The
anticonvulsant effect of the non-NMDA antagonists NBQX
and GYKI 52466 in mice. Epilepsy Res., 9: 92-96.
Chapman, A.G., Yip, P.K., Yap, J.S., Quinn, L.E, Tang, E., Har-
ris, J.R. and Meldrum, B.S. (1999) Anticonvulsant actions of
LY367385 ((+)-2-methyl-4-carboxyphenylglycine) and AIDA
((RS)-l-aminoindan-l,5-dicarboxylic acid). Eur. J. Pharma-
col., 368: 17-24.
Chapman, A.G, Nanan, K., Williams, M. and Meldrum, B.S.
(2000) Anticonvulsant activity of two metabotropic glutamate
Group I antagonists selective for the mGlu5 receptor: 2-
methyl-6-(phenylethynyl)-pyridine(MPEP), and (E)-6-methyl-
2-styryl-pyridine (SIB 1893). Neuropharmacology, 39: 1567-
1574.
Chen, J.C. and Simon, R. (1997) lschemic tolerance in the brain.
Neurology, 48:306-311.
Clifford, D.B., Olney, J.W., Benz, A.M., Fulle, T.A. and Zo-
rumski, C.F. (1990) Ketamine, phencyclidine, and MK-801
protect against kainic acid-induced seizure-related brain dam-
age. Epilepsia, 31: 382-390.
Conn, P.J. and Pin, J.P. (1997) Pharmacology and functions
of metabotropic glutamate receptors. Annu. Rev. Pharmacol.
Toxicol., 37: 205-237.
Delanty, N. and Dichter, M.A. (2000) Antioxidant therapy in
neurologic disease. Arch. Neurol., 57: 1265-1270.
Dodrill, C.B. (2002) Progressive cognitive decline in adolescents
and adults with epilepsy. In: T. Sutula and A. Pitk~inen (Eds,),
Do Seizures Damage the Brain. Progress in Brain Research,
Vol. 135. Elsevier, Amsterdam, pp. 399-407.
Dos Santos, N.F., Arida, R.M., Filho, E.M., Priel, M.R. and
Cavalheiro, E.A. (2000) Epileptogenesis in immature rats fol-
lowing recurrent status epilepticus. Brain Res. Rev., 32: 269-
276.
Dube, C., Chen, K., Eghbal-Ahmadi, M., Brunson, K., Soltesz,
I. and Baram, T.Z. (2000) Prolonged febrile seizures in the
immature rat model enhance hippocampal excitability long
term. Ann. Neurol., 47: 336-344.
Duncan, J.S. (2002) MRI studies. Do seizures damage the brain?
In: T. Sutula and A. Pitk~inen (Eds.), Do Seizures Damage
the Brain. Progress in Brain Research, Vol. 135. Elsevier,
Amsterdam, pp. 253-261.
Dtirmtfller, N., Craggs, M. and Meldrum, B. (1994) The effect
of the non-NMDA antagonists GYKI 52466 and NBQX and
the competitive NMDA receptor antagonist D-CPPene on the

excitotoxic insults (Sapolsky, 2001). Adenosine is
probably involved in the early phase of precondi-
tioning in the brain and heart. The later phase with
onset around 24 h, peak at 3 days and offset around 7
days is dependent on protein synthesis. Up-regulated
proteins include stress proteins (such as heat-shock
protein, hsp72), antioxidant enzymes (Toyoda et al.,
1997) and apoptosis-related proteins such as bcl-2.
Enhanced hsp72 expression does not consistently
correlate with preconditioning. A significant role for
bcl-2 is suggested by experiments showing abolition
of preconditioning protection of the striatum with
injections of a bcl-2 antisense probe (Shimizu et al.,
2001).
Interestingly, kindling is also able to protect
against kainic-acid-induced pathology in the pyri-
form cortex and hippocampus (Kelly and Mclntyre,
1994).
Clearly understanding the mechanisms of precon-
ditioning may identify novel therapeutic targets for
prevention of pathological consequences of seizure
activity.
Antiepileptogenesis
Epileptogenesis has been extensively studied in ani-
mal models (see Table 3).
We have a very substantial body of data concern-
ing pharmacological effects on epileptogenesis for
electrical kindling, some preliminary observations
for limbic status epilepticus models and essentially
no data for the other models. There is a notable
absence of experimental studies on epileptogenesis
following traumatic (concussive) brain injury (al-
though the effect of intracranial haemorrhage has
been studied). Electrical kindling with depth elec-
trodes has a major advantage in that it is possible to
distinguish antiepileptic from antiepileptogenic ef-
fects, which may be difficult or impossible in other
models. In electrical kindling the potent antiepilepto-
genic effect of NMDA receptor antagonists is clearly
established (Holmes et al., 1990; Dtirmtiller et al.,
1994). The kindling process as assessed by the
Racine seizure score can be markedly retarded by
an NMDA antagonist dose that does not shorten the
after-discharge duration. In contrast an apparently
similar effect on the Racine seizure score produced
by an antiepileptic drug is associated with an almost
491
TABLE3
Models of epileptogenesis
(1) Electricalkindling
(a) Implanted electrodesin amygdalaor hippocampus
(Goddard et al., 1969;Mohapelet al., 1996)
(b) Cornealelectrodes(Potschkaand Lrscher, 1999)
(2) Limbic status epilepticus
(a) Pilocarpineor Li/pilocarpine-inducedstatus epilepticus
(Arida et al., 1999; Dos Santos et al., 2000)
(b) Kainate-inducedstatus epilepticus (Pisa et al., 1980;
Ben-Aft, 1985)
(c) Electricallyinducedstatus epilepticus(Nissinen et al.,
2000; Halonenet al., 2001).
(3) Neonatal/infantileinitial precipitatinginjury
(a) Hypoxia(Jensen and Wang, 1996)
(b) Hyperthermicseizure (Dube et al., 2000)
(c) Focal tetanus toxin (Jefferys,1996)
(4) Cortical injury
(a) Undercutting(Princeand Tseng, 1993)
(b) Freezinginjury - polymicrogyria(Jacobs et al., 1996,
1999)
(c) Haematoma/iron(Willmoreet al., 1978;Kucukkayaet
al., 1998)
(5) Neuronalmigrationdisorder(MAM) (Germanoand Sperber,
1998; Holmeset al., 1990).
complete suppression of the after-discharge, indicat-
ing that a simple antiepileptic effect can account for
the apparent action on epileptogenesis (i.e. suppres-
sion of the after-discharge is an antiepileptic effect,
but in the absence of the after-discharge kindling
epileptogenesis cannot take place).
Clinical trials of antiepileptogenesis have been
largely negative (Bullock and Povlishock, 1996;
Temkin, 2001; Temkin et al., 2001) but they have
concerned only conventional antiepileptic drugs. Pre-
clinical studies are likely to identify potential novel
antiepileptogenic agents with mechanisms unrelated
to antiepileptic drug action.
Clinical trials of neuroprotection
It is clearly important to assess the neuroprotective
ability of antiepileptic drugs (AEDs), and primary
or secondary neuroprotective agents in patients with
severe epilepsy. However, the practical problems are
formidable. A prospective comparison of the neuro-
protective effect of AEDs with different mechanisms
of action that might have different potential for neu-
roprotection would seem desirable, e.g. a study of

development of amygdala kindling and on amygdala-kindled
seizures. Epilepsy Res., 17: 167-174.
Evans, M.C., Griffiths, T. and Meldrum, B.S. (1984) Kainic acid
seizures and the reversibility of calcium loading in vulnerable
neurons in the hippocampus. Neuropathol. Appl. Neurobiol.,
10: 285-302.
Faden, A.I., Ivanova, S.A., Yakovlev, A.G. and Mukhin, A.G.
(1997) Neuroprotective effects of Group III mGluR in trau-
matic neuronal injury. J. Neurotrauma, 14: 885-895.
Fariello, R.G., Golden, G.T., Smith, G.G. and Reyes, EF. (1989)
Potentiation of kainic acid epileptogenicity and sparing from
neuronal damage by an NMDA receptor antagonist. Epilepsy
Res., 3: 206-213,
Fujikawa, D.G. (1996) The temporal evolution of neuronal dam-
age from pilocarpine-induced status epilepticus. Brain Res.,
725:11-22.
Fujikawa, D.G., Daniels, A.H. and Kim, J.S. (1994) The compet-
itive NMDA receptor antagonist CGP 40116 protects against
status epilepticus-induced neuronal damage. Epilepsy Res., 17:
207-219.
Germano, I.M. and Sperber, E.E (1998) Transplacentally induced
neuronal migration disorders: an animal model for the study
of the epilepsies. J. Neurosci. Res., 51: 473-488.
Gilgun-Sherki, Y., Melamed, E. and Offen, D. (2001) Oxida-
tive stress-induced neurodegenerative diseases: the need for
antioxidants that penetrate the blood brain barrier. Neurophar-
macology, 40: 959-975.
Goddard, G.V., McIntyre, D.C. and Leech, C.K. (1969) A per-
manent change in brain function resulting from daily electrical
stimulation. Exp. Neurol., 25: 295-330.
Griffiths, T., Evans, M.C. and Meldrum, B.S. (1984) Status
epilepticus; the reversibility of calcium loading and acute
neuronal pathological changes in the rat hippocampus. Neuro-
science, 12: 557-567.
Hall, E.D. (1997) Brain attack. Acute therapeutic interventions.
Free radical scavengers and antioxidants. Neurosurg. Clin. N.
Am., 8: 195-206.
Halonen, T., Nissinen, J. and Pitkanen, A. (2001) Chronic el-
evation of brain GABA levels beginning two days after sta-
tus epilepticus does not prevent epileptogenesis in rats. Neu-
ropharmacology, 40: 536-550.
Heinemann, U., Buchheim, K., Gabriel, S., Kann, O., Kovacs,
R. and Schuchmann, S. (2002) Cell death and metabolic
activity during epileptiform discharges and status epilepticus
in the hippocampus. In: T. Sutula and A. Pitk~inen (Eds.), Do
Seizures Damage the Brain. Progress in Brain Research, Vol.
135. Elsevier, Amsterdam, pp. 197-210.
Henshall, D.C., Bonislawski, D.E, Skradski, S.L., Lan, J.-Q.,
Meller, R. and Simon, R.E (2001a) Cleavage of Bid may
amplify caspase-8-induced neuronal death following focally
evoked limbic seizures. Neurobiol. Dis., 8: 568-580.
Henshall, D.C., Skradski, S.L., Bonislawski, D.R, Lan, J.Q. and
Simon, R.E (2001b) Caspase-2 activation is redundant during
seizure-induced neuronal death. J. Neurochem., 77: 886-895.
Hewett, S.J., Uliasz, T.F., Vidwans, A.S. and Hewett, J.A.
(2000) Cyclooxygenase-2 contributes to N-methyl-D-aspartate-
493
mediated neuronal cell death in primary cortical cell culture.
J. Pharmacol. Exp. Ther., 293: 417-425.
Holmes, K.H., Bilkey, D.K., Laverty, R. and Goddard, G.V.
(1990) The N-methyl-D-aspartate antagonists aminophospho-
novalerate and carboxypiperazinephosphonate retard the devel-
opment and expression of kindled seizures. Brain Res., 506:
227-235.
Jacobs, K.M., Gutnick, M.J. and Prince, D.A. (1996) Hyper-
excitability in a model of cortical maldevelopment. Cereb.
Cortex, 6: 514-523.
Jacobs, K.M., Hwang, B.J. and Prince, D.A. (1999) Focal epilep-
togenesis in a rat model of polymicrogyria. J. Neurophysiol.,
81: 159-173.
Jankowsky, J.L. and Patterson, EH. (2001) The role of cytokines
and growth factors in seizures and their sequelae. Prog. Neu-
robiol., 63: 125-149.
Jefferys, J.G. (1996) Chronic epileptic loci induced by intracra-
nial tetanus toxin. Epilepsy Res. Suppl., 12:111-117.
Jensen, F.E. and Wang, C. (1996) Hypoxia-induced hyperex-
citability in vivo and in vitro in the immature hippocampus.
Epilepsy Res., 26: 131-140.
Kelly, M.E. and Mclntyre, D.C. (1994) Hippocampal kindling
protects several structures from the neuronal damage resulting
from kainic acid-induced status epilepticus. Brain Res., 634:
245-256.
Kew, J.N., Trube, G. and Kemp, J.A. (1998) State-dependent
NMDA receptor antagonism by Ro 8-4304, a novel NR2B
selective, non-competitive, voltage-independent antagonist. Br.
J. Pharmacol., 123: 463-472.
Kitagawa, K., Matsumoto, M., Tagaya, M., Hata, R., Ueda, H.,
Niinobe, M. and Handa, N. et al. (1990) 'Ischemic tolerance'
phenomenon found in the brain. Brain Res., 528: 21-24.
Kokaia, Z., Kelly, M.E., Elmer, E., Kokaia, M., McIntyre, D.C.
and Lindvall, O. (1996) Seizure-induced differential expres-
sion of messenger RNAs for neurotrophins and their receptors
in genetically fast and slow kindling rats. Neuroscience, 75:
197-207.
Kucukkaya, B., Ayer, R., Yuksel, M., Onat, E and Yalcin, A.S.
(1998) Low dose MK-801 protects against iron-induced oxida-
tive changes in a rat model of focal epilepsy. Brain Res., 788:
133-136.
Lemos, T. and Cavalheiro, E.A. (1995) Suppression of
pilocarpine-induced status epilepticus and the kate develop-
ment of epilepsy in rats. Exp. Brain Res., 102: 423-428.
Lerner-Natoli, M., Rondouin, G., Belaidi, M., Baldy-Moulinier,
M. and Kamenka, J.M. (1991) N-[l-(2-thienyl)cyclohexyl]-
piperidine (TCP) does not block kainic acid-induced status
epilepticus but reduces secondary hippocampal damage. Neu-
rosci. Lett., 122: 174-178.
Marcheselli, V.L. and Bazan, N.G. (1996) Sustained induction
of prostaglandin endoperoxide synthase-2 by seizures in hip-
pocampus: inhibition by a platelet-activating factor antagonist.
J. Biol. Chem., 271: 24794-24799.
Meldrum, B.S. and Chapman, A.G. (1994) Competitive NMDA
antagonists as drugs. In: G.L. Collingridge and J.C. Watkins
(Eds.), The NMDA Receptor, 2nd ed. Oxford University Press,
Oxford, pp. 455-466.
494
Mikati, M.A., Werner, S., Gatt, A., Liu, Z., Rahmeh, A.A.,
Rachid, R.A., Stafstrom, C.E. and Holmes, G.L. (1999)
Consequences of alpha-amino-3-hydroxy-5-methyl-4-hydroxy-
5-methyl-4-isoxazolepropionic acid receptor blockade during
status epilepticus in the developing brain. Brain Res. Dev.
Brain Res., 113: 139-142.
Mohapel, P., Dufresne, C., Kelly, M.E. and Mclntyre, D.C.
(1996) Differential sensitivity of various temporal lobe struc-
tures in the rat to kindling and status epilepticus induction.
Epilepsy Res., 23: 179-187.
Nicoletti, E, Bruno, V., Copani, A., Casabona, G. and Knoepfel,
T. (1996) Metabotropic glutamate receptors: a new target for
the therapy of neurodegenerative disorders. Trends Neurosci.,
19: 267-271.
Nissinen, J., Halonen, T., Koivisto, E. and Pitkanen, A. (2000)
A new model of chronic temporal lobe epilepsy induced b y
electrical stimulation of the amygdala in rat. Epilepsy Res., 38:
177-205.
Ogunmekan, A.O. and Hwang, P.A. (1989) A randomised
double-blind, placebo-controlled, clinical trial of D-alpha-
tocopherol acetate (vitamin E) as add on therapy for epilepsy
in children. Epilepsia, 30: 84-89.
Osehobo, P., Adams, B., Sazgar, M., Xu, Y., Racine, R.J. and
Fahnestock, M. (1999) Brain-derived neurotrophic factor in-
fusion delays amygdala and perforant path kindling without
affecting paired-pulse measures of neuronal inhibition in adult
rats. Neuroscience, 92: 1367-1375.
Parent, J.M. and Lowenstein, D.H. (2002) Seizure-induced neu-
rogenesis: are more new neurons good for an adult brain?
In: T. Sutula and A. Pitk~inen (Eds.), Do Seizures Damage
the Brain. Progress in Brain Research, Vol. 135. Elsevier,
Amsterdam, pp. 121-132.
Parent, J.M., Yu, T.W., Leibowitz, R.T., Geschwind, D.H.,
Sloviter, R.S. and Lowenstein, D.H. (1997) Dentate granule
cell neurogenesis is increased by seizures and contributes to
aberrant network reorganization in the adult rat hippocampus.
J. Neurosci., 17: 3727-3738.
Pellegrini-Giampietro, D.E. et al. (1999) 1-aminoindan-l,5-dicar-
boxylic acid and (S)-(+)-2-(3'-carboxybicyclo[1.1.1]pentyl)-
glycine, two mGlul receptor-preferring antagonists, reduce
neuronal death in in vitro and in vivo models of cerebral
ischaemia. Eur. J. Neurosci., 11: 3637-3647.
Perez-Pinzon, M.A. (2000) Differences in the time windows
for the induction of ischemic tolerance: putative mechanisms.
In: J. Krieglstein and S. Klumpp (Eds.), Pharmacology of
Cerebral lschemia 2000. Medpharm, Stutgart, pp. 345-352.
Pisa, M., Sanberg, RR., Corcoran, M.E. and Fibiger, H.C. (1980)
Spontaneous recurrent seizures after intracerebral injections of
kainic acid in rat: a possible model of human temporal lobe
epilepsy. Brain Res., 200: 481-487.
Plamondon, H., Blondeau, N., Heurteaux, C. and Lazdunski,
M. (1999) Mutually protective actions of kainic acid epileptic
preconditioning and sublethal global ischemia on hippocampal
neuronal death: involvement of adenosine A1 receptors and
KAZp channels. J. Cereb. Blood Flow Metab., 19: 1296-1308.
Potschka, H. and L6scher, W. (1999) Corneal kindling in mice:
behavioural and pharmacological differences to conventional
kindling. Epilepsy Res., 37: 109-120.
Prince, D.A. and Tseng, G.F. (1993) Epileptogenesis in chron-
ically injured cortex: in vitro studies. J. NeurophysioL, 69:
1276-1291.
Reibel, S., Larmet, Y., Le, B.T., Carnahan, J., Marescaux, C. and
Depaulis, A. (2000) Brain-derived neurotrophic factor delays
hippocampal kindling in the rat. Neuroscience, 100: 777-788.
Rogawski, M.A. and Donevan, S.D. (1999) AMPA receptors in
epilepsy and as targets for antiepileptic drugs. Adv. Neurol.,
79: 947-963.
Sapolsky, R.M. (2001) Cellular defences against excitotoxic in-
sults. J. Neurochem., 76: 1601-1611.
Sasahira, M., Lowry, T., Simon, R.P. and Greenberg, D.A. (1995)
Epileptic tolerance: prior seizures protect against seizure-
induced neuronal injury. Neurosci. Lett., 185: 95-98.
Sattler, R. and Tymianski, M. (2000) Molecular mechanisms of
calcium-dependent excitotoxicity. J. Mol. Med., 78: 3-13.
Shimizu, S., Nagayama, T., Jin, K.L., Zhu, L., Loeffert, J.E.,
Watkins, S.C., Graham, S.H. and Simon, R.P. (2001) bcl-2
antisense treatment prevents induction of tolerance to ocal
ischemia in the rat brain. J. Cereb. Blood Flow Metab., 21:
233-243.
Strasser, U. (1998) Antagonists for Group I mGluRs attenuate
excitotoxic neuronal death in cortical cultures. Eur. J. Neu-
rosci., 10: 2848-2855.
Tandon, P., Yang, Y., Das, K., Holmes, G.L. and Stafstrom, C.E.
(1999) Neuroprotective effects of brain-derived neurotrophic
factor in seizures during development. Neuroscience, 91: 293-
303.
Taylor, C.P. and Meldrum, B.S. (1995) Na + channels as targets
for neuroprotective drugs. Trends Pharmacol. Sci., 16: 309-
316.
Temkin, N.R. (2001) Antiepileptogenesis and seizure preven-
tion trials with antiepileptic drugs: meta-analysis of controlled
trials. Epilepsia, 42: 515-524.
Temkin, N.R., Jarell, A.D. and Anderson, G.D. (2001)
Antiepileptogenic agents: how close are we?. Drugs, 61:
1045-1055.
Tikka, T.M. and Koistinaho, J.E. (2001) Minocycline provides
neuroprotection against N-methyl-D-aspartate neurotoxicity by
inhibiting activation and proliferation of microglia. J. Neu-
rosci., 21: 2580-2588.
Tizzano, P., Griffey, K.I. and Schoepp, D.D. (1995) Induction
or protection of limbic seizures in mice by mGluR subtype
selective agonists. Neuropharmacology, 34: 1063-1067.
Toyoda, T., Kassell, N.E and Lee, K.S. (1997) Induction of
ischemic tolerance and antioxidant activity by brief focal is-
chemia. Neuroreport, 8: 847-851.
Willmore, L.J., Sypert, G.W. and Munson, J.B. (1978) Recurrent
seizures induced by cortical iron injection: a model of post-
traumatic epilepsy. Ann. Neurol., 4: 329-336.
Young, D., Lawlor, P.A., Leone, P., Dragunow, M. and During,
M.J. (1999) Environmental enrichment inhibits spontaneous
apoptosis, prevents seizures and is neuroprotective. Nat. Med.,
5: 448-453.
Yrjanheikki, Y., Tikka, T., Keinanen, R., Goldsteins, G., Chan,

P.H. and Koistinaho, J. (1999) A tetracycline derivative,
minocycline, reduces inflammation and protects against fo-
cal cerebral ischaemia with a wide therapeutic window. Proc.
Natl. Acad. Sci. USA, 96: 13496-13500.
Yu, S.P., Canzoniero, L.M. and Choi, D.W. (2001) Ion homeosta-
sis and apoptosis. Curr. Opin. Cell Biol., 13:405-411.
Zheng, T.S., Hunot, S., Kuida, K., Momoi, T., Srinivasan, A.,
495
Nicholson, D.W., Lazebnik, Y. and Flavell, R.A. (2000) De-
ficiency in caspase-9 or caspase-3 induces compensatory cas-
pase activation. Nat. Med., 6: 1241-1247.
Zipfel, G.J., Babcock, D.J., Lee, J.M. and Choi, D.W. (2000)
Neuronal apoptosis after CNS injury: the roles of glutamate
and calcium. J. Neurotrauma, 17: 857-869.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved
CHAPTER 45
Development of neuroprotective compounds in the
pharmaceutical industry: Where are we,
and where are we going?
N a n c y Santilli *
Elan Pharmaceuticals, 800 Gateway Blvd, South San Francisco, CA 94080, USA
Introduction
Central nervous system (CNS) destruction can oc-
cur from acute conditions, such as ischemia, hy-
poxia, traumatic brain injury, or seizures, or from
chronic conditions in degenerative illnesses, such as
Parkinson's disease. Although CNS disorders affect
a relatively small population, the results are often
devastating for patients and their families. The inves-
tigation and development of neuroprotective agents
offers hope for deciphering some of the central ner-
vous system's most complex mysteries.
The goals of neuroprotection are to:
(1) limit the extent of the central nervous system
damage;
(2) prevent epileptogenesis; and
(3) prevent worsening of epilepsy.
From an industry perspective, a better understand-
ing of the mechanisms behind neuronal injury and
loss may help in the development of effective strate-
gies for reaching these three goals. The obstacles are
many, however. Numerous mechanisms are thought
to be associated with neuronal damage, but these
* Correspondence to: N. Santilli, Elan Pharmaceuticals,
800 Gateway Blvd, South San Francisco, CA 94080,
USA. Tel.: -t-1-650-794-5726; Fax: -t-1-650-794-4252;
E-mail: Nancy.Santilli@ elan.com
are not fully understood due to their complexity. In
addition, neuronal injury data gathered from animal
model research does not always correlate with that
from actual human cases.
Although research and development of neuropro-
tective agents is a small, specialized area, there are
several processes that all drugs must undergo in or-
der to be used safely and effectively in the human
population.
Drug discovery
The discovery of a drug can occur in several ways
- - there is no standard route for drug development.
The discovery of a new compound may be a simple
matter of serendipity or the result of random drug
screenings of natural compounds and existing chem-
ical structures. During the latter process, researchers
synthesize many compounds and evaluate them for
potential activity. With the recent advances in bi-
ology, genetics, biochemistry, and information sys-
tems, targeted development is becoming much more
common. Analysis of a disease or condition is per-
formed to determine the related physiological pro-
cesses, and with that information, mechanism-based
development is implemented. Based on these mecha-
nisms, researchers may find, for instance, that devel-
oping a drug requires systematic structural modifica-
tion of an already existing compound.
498
Molecular modeling is another tool available to
researchers. In molecular modeling, X-ray crystal-
lography is utilized to capture the structure of the
target receptor. A molecule is then constructed de
novo in order to exert the desired effect onto the
receptor. Gene splicing offers the possibility of intro-
ducing a functioning gene into the somatic cells of
a patient in order to correct a defective gene, restor-
ing its original biological function (Ohlstein et al.,
2000). Given the staggering advances in the fields
of genetics and pharmaceutical development, in this
new millennium, more drug development through
genomic patterns via evaluation of gene expression
levels can be expected (Ohlstein et al., 2000).
Research targets
Pharmaceutical companies must consider more than
potential health benefits when deciding whether or
not to investigate a likely compound for new drug
development. Corporate, financial, legal, research,
manufacturing, and marketing components must all
be taken into account.
Determining the need in the marketplace for the
drug is a primary consideration. What disease states
does the drug compound address? Who will be tak-
ing the medication, and for how long? How much
research is required, and what will it cost? Are simi-
lar products already under development? What types
of clinical studies are necessary, and how will they
be carried out?
Assessing how the proposed drug fits into the
overall mission and growth strategy of the sponsor
company is an important determinant as well. Will
the drug enhance and support other company prod-
ucts that are already on the market? Does it make
sense to pursue the proposed course of research from
a financial and marketing point of view? If these
questions are answered affirmatively, the pharma-
ceutical company must still evaluate manufacturing
requirements for producing the new drug, conduct
literature and patent searches, and consider long-
range implications, such as the life expectancy of the
product. Only when the risk-benefit ratio appears
to support pursuing the drug's development, does
preclinical research begin.
Preclinical research: animal pharmacology and
toxicology studies
There are two primary goals for preclinical research:
to determine if the product is reasonably safe for ini-
tial use in humans, and to determine if the compound
exhibits pharmacologic activity that justifies com-
mercial development. In order to obtain the Investi-
gational New Drug Application (IND) required for
clinical testing, the pharmaceutical company spon-
soring a new drug must collect data establishing that
the product will not expose humans to unreason-
able risks when used in limited, early stage clinical
studies. This information is submitted to the Cen-
ter for Drug Evaluation and Research (CDER), the
division of the US Food and Drug Administration
(FDA) that approves all new drug clinical research
and commercial production (The CDER Handbook,
2001).
Preclinical studies I
Preclinical studies afford the first opportunity to
evaluate toxicity in vivo. Acute toxicity tests begin
with a single administration of the compound to
two animal species - - usually one rodent and one
nonrodent (i.e. canine). Detailed pharmacologic tests
study the compound's main effect, duration of effect,
side effects, and safety at different doses. Analyses
of the active substances and their stability are also
performed. In short, the initial preclinical studies
attempt to determine all significant ways that the
drug may affect the test body.
Preclinical studies H
The second phase of preclinical studies addresses
the effects the body has on the drug. Pharmacoki-
netic tests analyze rates of absorption, distribution,
how the compound is metabolized, and methods
of excretion. Metabolism studies determine whether
cytochrome P-450 and other significant enzymatic
or receptor interactions can be expected (Stave and
Joines, 1997). On occasion, these tests may even
indicate a different metabolite that will be more
effective than the one under investigation.
Subchronic toxicity is also a focus of the second
phase of preclinical studies. Two to 90 doses of the

drug are administered to two animal species. Repro-
duction toxicological studies are conducted to ascer-
tain the compound's effects on fertility, the potential
for teratogenicity, and peri- and postnatal toxicity.
Mutagenicity tests are also conducted to investigate
gene mutations and chromosomal aberrations.
Clinical protocols and investigator credentials
In addition to documenting all preclinical trials and
studies, the drug sponsor must provide the CDER
with detailed protocols for phase 1 clinical trials in
order to determine whether the studies will expose
human subjects to unnecessary health risks. Creden-
tials of the clinical investigators (generally physi-
cians) who will oversee the administration of the
experimental compound during clinical trials must
also be submitted.
Manufacturing the test drug
Preparing for production of the test drug to be used
in clinical trials is an important part of pre-IND ap-
plication groundwork. The pharmaceutical company
must demonstrate that it can produce and supply con-
sistent batches of the drug, and is required to supply
the CDER with information pertaining to composi-
tion, manufacturing processes, stability, and controls
used for manufacturing the drug substance and the
drug product (The CDER Handbook, 2001).
This is often a complex process. In order to
synthesize a sufficient quantity of the active drug
substances and final test product for clinical tri-
als, toxicology, pharmacology, and pharmacokinetic
testing, the pharmaceutical company may need to
develop a new chemical or biological pilot plant,
including new equipment, controls, and solutions for
novel plant safety issues (Stave and Joines, 1997).
Development of the final dosage form, ensuring its
stability, and production of clinical samples follows.
The Investigational New Drug Application
Submitting an Investigational New Drug Application
is a milestone in itself, because it is the result of
a successful preclinical development program. An
IND must be submitted for all experimental drug
studies prior to testing in humans. Technically, the
499
IND is a request for an exemption from the federal
statute that prohibits an unapproved drug from being
shipped in interstate commerce. Its main purpose,
however, is to detail data supporting the premise that
it is reasonable to proceed with certain human trials
of the drug (The CDER Handbook, 2001).
There are different types of INDs. A commercial
IND is used when the ultimate goal is to obtain
marketing approval for a new product. Most INDs,
however, are filed for noncommercial research, and
include Investigator INDs, Emergency Use INDs,
and Treatment INDs, which allow investigational
drugs to be used in expanded access protocols in
life-threatening situations (US Food and Drug Ad-
ministration, 1999c).
The IND review process
There are four departments of scientific review, as
well as a safety review team, that analyze the infor-
mation provided by the drug sponsor in the IND:
medical, chemical, pharmacology/toxicology, and
statistical review groups. They are composed of tech-
nical medical specialists well versed in the extensive
drug review process (Fig. 1).
The medical review
Medical/clinical reviewers are responsible for eval-
uating the clinical sections of IND submissions, in-
cluding the safety of the preclinical protocols and
the results of preclinical studies submitted to the
CDER. They determine if the participants in clini-
cal trials will be protected from unnecessary risks,
and if the proposed study design will provide data
relevant to the safety and effectiveness of the drug.
Clinical reviewers integrate the findings from the
toxicology, pharmacology and preclinical studies to
form an overview for a recommended agency action
on the application.
The chemistry review
A team of chemists examines the chemistry and
manufacturing control sections of drug applications
for issues related to drug identity, manufacturing
control, and analysis. It is their job to ensure that
the compound is adequately reproducible and stable.
500

Applicant(DrugSponsor)

,No I
÷
; Rev|ewbyCDER ;
Medical Chemistry I I Pharmacology/Toxicology Statistical
II
SafetyReview I < I Sponsor
NewDataSUbmits I

NO

Notify
Sponsor

NO t SponsorNotified !
ofDeficiencies
i

I NoDeficiencies I ,J (while
StudyOngoing
sponsor
answers I
"1, anydeficiencies)
Fig, 1. INDreviewprocess.

They also review any documentation pertaining to The pharmacology/toxicology review

chemistry and manufacturing differences between
the drug product proposed for clinical use and the Evaluating the results of animal testing is the re-
drug product used in the animal toxicology trials. sponsibility of the pharmacology/toxicology review
team. The reviewers attempt to relate animal drug

effects to potential effects in humans. The drug
sponsor is required to provide documentation, in-
cluding a description of the pharmacologic effects
and mechanism(s) of action (MOA) of the drug in
animals; information on the absorption, distribution,
metabolism, and excretion of the drug; and an in-
tegrated summary of the toxicologic effects of the
drug in animals and in vitro (The CDER Handbook,
2001).
The statistical review
The statistical review focuses on the statistical rel-
evance of the data provided by the drug sponsor.
The team evaluates the study methodology and the
procedures used to analyze the data.
The safety review
Following the four scientific reviews of an IND
submission, the CDER has 30 calendar days in which
to decide if it is safe to proceed to clinical trials. If
the review groups do not believe, or cannot confirm,
that the study can be conducted without unreasonable
risk to the participants, a clinical hold is put on the
IND. The drug sponsor must address the issue that is
the basis of the hold before the order is removed. If
the pharmaceutical company does not hear from the
CDER within the 30-day period, clinical trials may
begin immediately (The CDER Handbook, 2001).
TABLE 1
Clinical testing
Purpose
Phase 1 Safety in healthy volunteers
Phase 2 Efficacy and short-term safety in
patients with disease/condition
Phase 3 Safety, efficacy, and dosage in patients
with disease/condition
Q
501
Clinical trials
Each phase of clinical trials has a specific purpose,
as well as distinct parameters (Table 1). Phase 1,
2, and 3 studies occur prior to filing for a New
Drug Application (NDA). An average of 60 trials are
required to support a New Drug Application (Stave
and Joines, 1997). Phase 4/postmarketing studies are
performed after a drug is approved for marketing.
Phase 1 clinical trials
Phase 1 trials are the first drug studies performed in
humans. Their purpose is to investigate the safety,
tolerance, and pharmacokinetics of the trial com-
pound. Phase 1 studies involve small numbers of
healthy volunteer subjects (between 20 and 100)
who are given the test drug so that researchers may
study its metabolic and pharmacologic actions, and
assess the most common acute adverse events (AE)
in persons of good health (US Food and Drug Ad-
ministration, 1999d). Phase 1 studies also help re-
searchers evaluate the compound's structure-activity
relationship (SAR), mechanism of action, and maxi-
mum dose that patients can safely take. Phase 1 tests
generally last several months. About 70% of phase 1
studies have results that warrant moving to phase 2.
Phase 2 clinical trials
Phase 2 trials use comparative studies to determine
efficacy and safety in selected populations of patients
Parameters Results
• 20-100 subjects 70% of trial drugs successfully
• Several months duration complete phase 1 studies
• Metabolic and pharmacologic tests
• Up to several hundred subjects 33% successfully complete phase 2
• Several months to several years studies
duration
• Controlled studies
• Several hundred to several thousand 25-30% successfully complete phase 3
patients studies
• 1-4 years duration
• Controlled or uncontrolled
502
with the disease or condition for which the drug is
being investigated. Phase 2 studies are always con-
trolled clinical trials, and may include several hun-
dred patients. Dose and dosing regimens are assigned
for magnitude and duration of effect. The trials gen-
erally last from several months up to 2 years, and
data are used to evaluate short-term adverse effects
and risks, as well as efficacy. Controlled clinical
studies have a much lower success rate than phase
1 trials; only about 1 in 3 test drugs successfully
complete phase 2 studies.
Phase 3 clinical trials
During phase 3, expanded clinical trials are under-
taken to gather additional evidence and understand-
ing of effectiveness of the trial drug for specific indi-
cations. Several hundred to several thousand patients
with the disease or condition under investigation par-
ticipate in studies that last from 1 to 4 years. Phase 3
studies may be either controlled or uncontrolled, and
provide data that can be extrapolated to the general
population. The success rate of phase 3 studies is
25-30%. Thus, by the conclusion of phase 3 studies,
only about 1 in 4 trial drugs that successfully com-
pleted the IND review process are eligible to proceed
to the New Drug Application.
The New Drug Application
Successful completion of phase 1, 2, and 3 clini-
cal trials culminates in the filing of a New Drug
Application with the CDER. The NDA is the fi-
nal application in the FDA drug approval process.
Since 1938, every new drug has been required to
have an approved NDA before it can be commer-
cially distributed in the United States (US Food and
Drug Administration, 1999b). In addition to all ex-
perimental drugs, an NDA must also be submitted
for new indications for established drugs. The NDA
includes all data that support the efficacy and safety
of the drug, and may be as long as 100,000 pages.
(In a continuing effort to streamline the NDA ap-
proval process, FDA is working toward a completely
electronic submission and review process by 2002.)
Fundamentals of NDA submissions
The NDA contains all information known about the
new drug product. It is similar to the IND appli-
cation, but in addition to all preclinical evaluations,
the NDA also includes results of clinical studies,
biostatistical evaluation of clinical data, pharmacoki-
netic and pharmacodynamic data, pertinent literature
citations, foreign market experience, specific manu-
facturing information, and any foreign labeling in-
formation (Waiters, 1992).
The CDER classifies NDAs into one of seven
categories which reflects the type of drug being
submitted and its intended uses:
(1) New molecular entity
(2) New salt of previously approved drug
(3) New formulation of previously approved drug
(4) New combination of two or more drugs
(5) Already marketed drug product: duplication
(6) New indication for already marketed drug
(7) Already marketed drug product
The NDA review process
After a New Drug Application is received by the
CDER, it is screened to verify that sufficient data
and information have been submitted in each review
area. The categories of review are similar to those
for the IND, but include several additional areas:
medical, biopharmaceutical, pharmacology, statisti-
cal, chemistry, and microbiology (Fig. 2).
The medical review
Similar to the IND evaluation, the medical review
team takes a leading role in the CDER's NDA review
process. The medical officers are responsible for
evaluating the clinical sections of submissions and
for synthesizing the results of the animal toxicology,
human pharmacology, and clinical reviews.
The biopharmaceutical review
The biopharmaceutical review encompasses drug
formulations and pharmacokinetics. Pharmacokineti-
cists evaluate the rate and extent to which the drug's
active ingredient is made available to the body and
the way it is distributed in, metabolized by, and elim-
 503

Applicant(DrugSponsor) !I
+
I
I NDA i

.... Y E S : ,,

I ,, Medical i RevlewiyCDERt Blopharmaceutical

I
l' Pharmac°l°gy i I E Statistical I

,.-..~k;., J I ~ ._7"_Y'7~,. ~ sansf=ctow

11)Labelingmeansofficial
insbuctionsfor use I I
(2) Manufacturingsites and sites NDA Action
where significantclinicaltrials are
performed

Fig. 2. NDA review process.

inated from the human body (The CDER Handbook,
2001).
The pharmacology review
The pharmacology review team again reviews data
on animal testing, comparing preliminary preclinical
results with the pharmacologic effects and mecha-
nism(s) of action of the drug, as well as absorption,
distribution, metabolism, and excretion data docu-
mented in the clinical trials.
The statistical review
Statisticians evaluate the statistical relevance of the
data provided in the NDA. The team's main respon-
504
sibilities are to evaluate the study methodology and
the various formulas used to analyze the data. These
evaluations give the medical reviewers a better idea
of the power of the findings to be extrapolated to the
larger patient population in the country.
The chemistry review
The chemistry reviewers evaluate the test drug on
issues of drug identity, manufacturing and processing
procedures, production control, and product stability
to ensure that the drug can be safely and reliably
manufactured.
The microbiology review
Clinical microbiology information is required only
for anti-infective drugs. Data on the drug's in vivo
and in vitro effects on the target microorganisms are
studied to determine product efficacy.
Other NDA reviews
Several other processes occur before action is taken
by the CDER. All preliminary reviews are checked
for completeness and acceptability. If any of the ini-
tial review teams disagree with the conclusions of
clinical studies, the pharmaceutical company may be
requested to repeat the trials. The sponsor may also be
asked for a reanalysis or an extension of the analyses
performed. Finally, labeling information is carefully
reviewed, and manufacturing sites are inspected.
NDA actions
After evaluating the New Drug Application, the
CDER sends the sponsor an action package con-
taining one of three possible action letters, along
with any data, the CDER reviews and memos, or
other information supporting the reviewers' recom-
mendation. The three possible responses are:
• 'Not Approvable' letter with an explanation of
NDA deficiencies and why application cannot be
approved.
• 'Approvable' letter, meaning that the drug is ap-
proved provided that minor deficiencies are cor-
rected (e.g., labeling changes, possible request for
additional or post-approvable studies).
• 'Approval' letter stating that the drug is approved
for marketing in the United States.
Postmarketing]phase 4 studies
Clinical trials are frequently performed after a drug
has been approved for marketing. These phase 4, or
postmarketing, studies have a variety of purposes.
They may be initiated to determine incidence of ad-
verse events or long-term effects of a drug. They
may involve testing the drug with a new patient pop-
ulation, or for marketing comparisons against other
products and uses. Sometimes the CDER requests
follow-up studies to support data submitted in the
NDA.
In pursuit of neuroprotection
The research and development of neuroprotective
agents involves multiple, complex variables. Many
mechanisms of action are thought to be involved in
neuroprotection. The formation of free oxygen radi-
cals during reperfusion is believed to induce a chain
reaction breakdown of the neuronal cell membrane,
leading to generation of additional free radicals.
These free radicals are capable of causing damage to
the primary, as well as adjacent, neuronal cells.
Glutamate, a common metabolite of glucose and
an excitatory neurotransmitter, may play a large
role in neuronal loss. When activated, ionotropic
glutamate receptors (c~-amino-3-hydroxy-5-methyl-
isoxazoleproprionate (AMPA), kainic acid, and N-
methyl-D-aspartate (NMDA)) allow greater perme-
ability of the cell membrane to sodium and calcium
ions. This can start a chain of biochemical reactions
within the neuronal cell and eventually lead to cell
death via oxidative damage, cytoskeletal degenera-
tion, and microtubule dysfunction or protein aggre-
gation. Metabotropic receptors act indirectly on the
ion channel system via second-messenger systems
(Mosh6 and Decker, 1999).
Research indicates that antiepilepsy drugs (AEDs)
with numerous mechanisms of action may have im-
portant implications for the use of these agents in
neuroprotection. It is the multiple mechanisms of ac-
tion of AEDs that are thought to be effective against
the numerous pathways implicated with neurotoxic
insult (Table 2).

TABLE 2
Mechanisms for neuroprotection
Approaches to Antiepilepsy drugs (White, 1999)
neuroprotection
Sodium channel blockers Phenytoin, carbamazepine, valproic
acid, felbamate, gabapentin,
lamotrigine, topiramate,
oxcarbazepine, zonisamide
Selective calcium Ethosuximide, valproic acid,
channel blockers felbamate, gabapentin, lamotrigine,
topiramate, zonisamide
Glutamate inhibitors Felbamate, topiramate, zonisamide
(Zhu and Rogawski, 1999)
Nitric oxide inhibitors Zonisamide (Noda et al., 1999)
Free radical scavengers/ Zonisamide (Mori et al., 1998;
antioxidants Komatsu et al., 1995)
One of the greatest challenges the pharmaceuti-
cal company must face is the lack of predictable
experimental models. Currently, there is no gold
standard for measurement of neuroprotection, and it
is unclear which markers would adequately repre-
sent neuroprotective properties. In vitro biochemical
assays, such as GSK-3[3, MAP kinases, and Bcl-2
are currently being used; however, these markers do
not fully correlate with neuroprotection. In addition,
animal models are not always predictive of human
response. In the example of stroke, neuroprotective
agents effective in experimental animal cerebral in-
farction have shown to be poor predictors of clinical
outcome in human stroke (Jonas et al., 1999). With
these factors in mind, research in neuroprotection
must be approached with the greatest caution. A
considerable body of preclinical data must support
any proposed clinical studies.
The question for the pharmaceutical industry still
remains: When do you make the critical decision
to take a drug to clinical testing? With the cost
of bringing a new drug to market surpassing $350
million (Stave and Joines, 1997), a pharmaceutical
company must be able to determine when to con-
tinue developing a drug and when to cut its losses.
Although patent life of a drug is 20 years from the
time of application, the first 8-12 years of patent
coverage are usually spent in research and develop-
ment (Stave and Joines, 1997; US Food and Drug
Administration, 1999a). In addition to these consid-
erations, on average, only about one-fifth of all drugs
505
that have submitted IND applications are approved
for marketing by the CDER.
A case for z o n i s a m i d e
Zonisamide (ZNS) was discovered serendipitously in
1974 during routine testing for treatment of psychi-
atric conditions. It was found to have potent anticon-
vulsant activity in experimental animals. In Japan,
clinical development of ZNS started in September
1979, and ZNS was approved for the control of par-
tial seizures and generalized seizures in 1989. In the
United States, a NDA was submitted in March of
1997, and an 'Approvable' letter was issued by the
FDA in March 1998. Approved for marketing in the
United States in March 2000, ZNS is indicated for
adjunctive treatment of partial seizures in adults with
epilepsy.
In addition to zonisamide's anticonvulsant mecha-
nism of action, suppression of neural repetitive firing
through blockade of voltage-dependent sodium and
calcium (T-type) channels, ZNS appears to have
other neuroprotective properties as well. One such
mechanism is through glutamate inhibition. Zhu
and Rogawski (1999) investigated the effects of
ZNS on excitatory synaptic transmission in CA1
pyramidal neurons of the rat hippocampal slice.
They concluded that ZNS exerts a presynaptic,
use-dependent inhibitory action on the release of
glutamate-mediated excitatory transmitters, possibly
due to its modulation of sodium channels.
Zonisamide is also thought to be an inhibitor of
nitric oxide synthase (NOS), as well as a scavenger
of free radicals. In a study performed by Noda et
al. (1999), the effect of ZNS on NOS activity in the
rat hippocampus induced by NMDA with/without L-
buthionine-[S,R]-sulfoximine (BSO) was examined.
Results showed that ZNS reduced NOS activity,
accelerated by NMDA with/without BSO treatment,
to control levels in the hippocampus. This suggests
that ZNS may inhibit initiation and propagation of
seizures by inhibiting NOS activity, and that it may
also protect neurons from free radical damage caused
by hydroxyl radicals and nitric oxide.
There are also studies that support the scavenging
activities of zonisamide. Although ZNS showed no
scavenging activity on superoxide radicals, it has
shown activity against 1,1-diphenyl-2-picrylhydrazyl
506
(DPPH), hydroxyl, nitric oxide, and carbon-centered
radicals (Komatsu et al., 1995; Mori et al., 1998).
ZNS has also shown protection from brain dam-
age induced by ischemia/hypoxia in rats (Hayakawa
et al., 1994), inhibition of cerebral infarction after
occlusion of middle cerebral artery in rats (Minato et
al., 1997), and inhibition of delayed neural cell death
in hippocampus after transient cerebral ischemia in
gerbils (Owen et al., 1997) and mice (Fukuda et al.,
1988).
Zonisamide has a broad spectrum of pharmaco-
logic activity with extensive clinical experience and
safety data. It shows favorable preclinical neuro-
protection data in epilepsy, stroke, and neuropathic
pain. Zonisamide may have potential opportunities
for treating other neurological and psychiatric condi-
tions.
Conclusion
The search for neuroprotective agents is still un-
charted territory. As a result, pharmaceutical com-
panies are approaching this area with the greatest
caution. Currently, there is no gold standard for
measurement of neuroprotection. It is unclear which
markers adequately represent neuroprotective prop-
erties. As our understanding of the pathologic mech-
anisms involved in epilepsy evolves, however, we
appear to be moving closer to developing rational
strategies for neuroprotection (Mosh6 and Decker,
1999). Taking a closer look at broad-spectrum AEDs,
such as zonisamide, may bring medicine a step closer
to finding an effective agent to combat the catas-
trophic effects of brain damage and CNS disease.
Abbreviations
AE adverse event
AED antiepilepsy drug
AMPA c~-amino-3-hydroxy-5-methyl-
isoxazoleproprionate
BSO L-buthionine- [S,R]-sulfoximine
CDER Center for Drug Evaluation and Research
CNS central nervous system
DPPH 1,1-diphenyl-2-picrylhydrazyl
FDA US Food and Drug Administration
IND Investigational New Drug Application
MOA mechanism(s) of action
NDA New Drug Application
NMDA N-methyl-D-aspartate
NOS nitric oxide synthase
SAR structure-activity relationship
ZNS zonisamide
Acknowledgements
The author gratefully acknowledges MedLogix
Communications, LLC for their assistance in prepar-
ing this chapter.
References
The CDER Handbook (2001) New Drug Development and
Review. Available at www.fda.gov/cder/handbook. Accessed
July 17, 2001.
Fukuda, A., Akagik, Masuda, Y. and Zushi, K. (1998) Protective
effect of anticonvulsant drugs against cerebral hypoxia in
mice. J. Clin. Exp. Med., 144: 917-918.
Hayakawa, T., Yoshihisa, H., Nigami, H. and Hattori, H. (1994)
Zonisamide reduces hypoxic-ischemic brain damage in neona-
tal rats irrespective of its anticonvulsive effect. Eur. J. Phar-
macol., 257: 131-136.
Jonas, S., Ayigari, V., Viera, D. and Waterman, P. (1999) Neu-
roprotection against cerebral ischemia: a review of animal
studies and correlation with human trial results. Ann. New
York Acad. Sci., 890: 406-420.
Komatsu, M., Okamura, Y. and Hiramatsu, M. (1995) Free radi-
cal scavenging activity of zonisamide and its inhibitory effect
on lipid peroxide formation in iron-induced epileptogenic foci
of rats. Neuroscience, 21: 23-29.
Minato, H., Kikuta, C., Fujitani, B. and Masuda, Y. (1997)
Protective effect of zonisamide, an antiepileptic drug, against
transient focal cerebral ischemia with middle cerebral artery
occlusion-reperfusion in rats. Epilepsia, 38(9): 975-980.
Mori, A., Noda, Y. and Packer, L. (1998) The anticonvulsant
zonisamide scavenges free radicals. Epilepsy Res., 30: 153-
158.
Mosh& S.L. and Decker, J.E (1999) Neurology Treatment
Updates: Neuroprotection and Epilepsy. Available at:
http://neurology.medscape.com/treatment/neuroprotection.
Accessed July 20, 2001.
Noda, Y., Moil, A. and Packer, L. (1999) Zonisamide inhibits
nitric oxide synthase activity induced by N-methyl-D-aspartate
and buthionine sulfoximine in the rat hippocampus. Res. Com-
mun. Mol. PharmacoL, 105: 23-33.
Ohlstein, E.H., Ruffolo Jr., R.R. and Elliott, J.D. (2000) Drug
discovery in the next millennium. Annu. Rev. Pharmacol.
Toxicol., 40: 177-191.
Owen, A.J., Ijaz, S., Miyashita, H., Wishaart, T., Howlett, W. and
Shuaib, A. (1997) Zonisamide as a neuroprotective agent in an
adult gerbil model of global forebrain ischemia: a histological,

in vivo microdialysis and behavioural study. Brain Res., 770:
115-122.
Stave, G.M. and Joines, R. (1997) An overview of the pharma-
ceutical industry. Occup. Med., 12(1): 1-4.
US Food and Drug Administration (1999a) The beginnings: Lab-
oratory and animal studies. In: M.L. Trenter (Ed.), From Test
Tube to Patient: Improving Health Through Human Beings.
US Food and Drug Administration, Rockville, MD, pp. 14-
17.
US Food and Drug Administration (1999b) Benefit vs. risk: How
CDER approves new drugs. In: M.L. Trenter (Ed.), From Test
Tube to Patient." Improving Health Through Human Beings.
US Food and Drug Administration, Rockville, MD, pp. 33-
40.
US Food and Drug Administration (1999c) FDA finds new
ways to speed treatments to patients. In: M.L. Trenter (Ed.),
507
From Test Tube to Patient: Improving Health Through Human
Beings. US Food and Drug Administration. Rockville, MD,
pp. 29-32.
US Food and Drug Administration (1999d) Testing drugs in
people. In: M.L. Trenter (Ed.), From Test Tube to Patient:
Improving Health Through Human Beings. US Food and Drug
Administration, Rockville, MD, pp. 18-23.
Waiters, P.G. (1992) FDA's new drug evaluation process: a gen-
eral overview. J. Public Health Dent., 52(6): 333-337.
White, H.S. (1999) Comparative anticonvulsant and mechanis-
tic profile of the established and newer antiepileptic drugs.
Epilepsia, 40(5): $2-S10.
Zhu, W. and Rogawski, M.A. (1999) Zonisamide depresses exci-
tatory synaptic transmission by a presynaptic action. Epilepsia,
40(7): 245.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Elsevier Science B.V. All rights reserved

CHAPTER 46

So what can we c o n c l u d e - do seizures damage the brain?

Jerome E n g e l Jr. *

Departments of Neurology and Neurobiology and the Brain Research Institute, UCLA School of Medicine, Los Angeles, CA 90095, USA

Abstract: Evidence is presented, in this volume, for and against the thesis that single, self-limited seizures can damage
the brain. Consideration must be given to the fact that there are many different types of seizures, which undoubtedly
induce a variety of postictal consequences. Whether any of these consequences constitute brain damage depends upon
the definition of damage, which could range from enduring functional changes of single neurons or circuits, to actual
cell death. Although many seizure-induced mechanisms have been postulated, or even demonstrated, that can give rise
to persistent neuronal disturbances, including neuronal death, they are only of clinical concern if they result in interictal
neurological or cognitive dysfunction, developmental delay, or progressive epileptogenesis that makes seizures worse.
Although animal studies indicate it is very likely that some seizures, under some circumstances, do, in fact, damage the
brain in a clinically meaningful manner, the principal contribution of this volume is to identify areas of future basic and
clinical research designed to identify those seizures which present a risk of causing enduring neuronal disruption, the
circumstances under which these changes are likely to occur, their nature and effects on behavior, and, ultimately, rational
approaches to prevention.

This volume is intended to present evidence for
and against the proposition that single or repeated
self-limited epileptic seizures can produce enduring
structural or functional brain disturbances. The word
'damage' in the title is not specifically defined, and
its interpretation represents a continuum from cell
death at one extreme, to a potential to alter neu-
ronal function at the other. The word 'seizure' in
the title is also not defined, and answering the ques-
tion put to us is further confounded by the need
to superimpose on our incomplete understanding of
consequences, the fact that there are many differ-
ent types of epileptic seizures that reflect a variety
of neuronal mechanisms (Engel et al., 1997; Engel,
2001). Various ictal mechanisms could be associated
with more or less permanent sequelae, depending on
* Correspondence to: J. Engel Jr., Department of Neurol-
ogy, UCLA School of Medicine, 710 Westwood Plaza,
Los Angeles, CA 90095-1769, USA. Tel.: +1-310-825-
5745; Fax: +1-310-206-8461; E-mail: engel@ucla.edu
specific circumstances, including age, gender, geno-
typically determined predisposition, hormonal status,
chronobiological factors, co-morbidity, preictal neu-
ronal activity, and the brain area affected, including
differences between left and right hemispheres.
If epileptic seizures result in cell death, there is
no doubt that this represents a permanent effect.
Other seizure-induced changes, however, could be:
transient; enduring but reversible under certain con-
ditions; or irreversible. Such changes could include:
structural alterations of neuronal spine, dendrite, or
somatic morphology or ion channel distribution; ax-
onal sprouting or retraction; synaptic reorganization;
disturbances in neuronal gene expression, perhaps
leading to altered synaptic function due to changes in
neurotransmitter release or receptor subunit compo-
sition; glial activation and proliferation; or neoneu-
rogenesis (Engel et al., 2001). In addition, structural
or functional aberrations in the immature brain could
impair mechanisms of normal development, includ-
ing not only disruption of the formation of normal
neuronal connections, but pathological persistence
510
of inappropriate connections, because propagation of
epileptic activity across unnecessary synapses might
prevent the natural pruning process (Morrell et al.,
1995). Clinically relevant research would need to
demonstrate that such effects are, in fact, the direct
result of self-limited seizures, and that they do, in
fact, alter brain function and subsequent behavior in
a way that is detrimental to the patient. Even if ef-
fects as severe, and irreversible, as neuronal death are
unequivocally shown to result from a single seizure,
there would be no reason for concern if this cell loss
had no noticeable adverse effect on behavior.
Much has been written about interictal behav-
ioral disturbances among people with epilepsy, but
it has been clinically difficult to demonstrate that
these changes are progressive, and even more dif-
ficult to identify a relationship between any pro-
gressive changes and single or repeated seizures, as
opposed to effects of the underlying disease process,
antiepileptic drugs, or psychological and social in-
fluences (Engel et al., 1991). Progressive behavioral
disturbances include not only cognitive and neuro-
logic deficits, but also worsening of the epileptic
process itself. Seizures may become more frequent,
more severe, or more difficult to treat, and sec-
ondary epileptogenic areas may appear (Goddard
et al., 1969; Morrell, 1989). Interpretation of any
noted behavioral disturbances is further confounded
by the fact that seizures can adversely alter sleep
architecture (Shouse et al., 1997) and endocrine
function (Pritchard, 1997), which, in turn, disturb
cerebral activity. Also, seizures may alter cardiores-
piratory function, leading to the ultimate behavioral
disturbance, sudden unexplainable death (Lathers et
al., 1997). Furthermore, epileptic seizures induce
seizure-suppressing mechanisms, which are the nat-
ural homeostatic response to epileptic activation,
necessary to maintain the interictal state. It is rea-
sonable to assume that these mechanisms influence
normal neuronal activity, and therefore could have
an adverse effect on interictal behavior (Engel et
al., 1991). This is particularly important clinically
because if it is true, it would predict that epilepto-
genic regions that resolve spontaneously over time,
or are successfully treated by surgical removal,
would be associated with improvement or reversal
of some seizure-related interictal behavioral dis-
turbances, while pharmacotherapy which enhances
seizure-suppressing mechanisms without eliminat-
ing the epileptogenic abnormality might exacerbate
these interictal problems.
At the end of this volume, can we draw any con-
clusions as to whether epileptic seizures damage the
brain? Rather than review the data, which are already
well described in the preceding chapters, it may be
more appropriate to analyze how this information
might allow us to construct a logical approach to this
question that would focus future research.
To begin with, there is the question of whether
any injurious consequence could be the result of
a single self-limited seizure, or whether repeated
seizures are required. This would seem to be a non-
issue, because if measurable changes appear at some
point with repeated seizures, it is always possible
to go back and assert that they were the result of
the last seizure that occurred, thus the result of a
single seizure. Although it could be argued that this
seizure would not have caused measurable changes
if preceding seizures had not induced functional or
structural disturbances that predisposed the brain to
measurable injury, these unrecognized predisposing
changes should also be considered injurious effects
of a single seizure. More important, however, if
single seizures can induce alterations in neuronal
function or structure, at what point, if ever, do these
have enduring effects on behavior, and at what point,
if ever, do these effects become irreversible?
Perhaps the most burning question encompassed
within "do seizures injure the brain?" is whether
single, or repeated, self-limited seizures can cause
neurons to die. Dr. Sutula and colleagues have pre-
sented evidence that this does, in fact, occur in the
hippocampus of kindled rats (Kotloski et al., 2002,
this volume). If we accept this demonstration, then
we must conclude that s o m e self-limited seizures,
under s o m e circumstances, do, in fact, damage the
brain. Data presented here, for instance by Dr. Pitk~i-
nen and colleagues, that failed to detect cell death
in a different model of epilepsy (Pitk~inen et al.,
2002, this volume) do not negate this statement,
because these are o t h e r seizures, under o t h e r cir-
cumstances. Perhaps we should now ask the better
question "What types of seizures can damage the
brain, and under what circumstances?"
If we accept the conclusion that some seizures,
under some circumstances, can cause neuronal death,

what is the evidence that neuronal death in this case
results in sufficient functional or structural changes
to alter interictal behavior or make epileptic seizures
worse? It is reasonable to assume that cell death in
the hippocampus is a stimulus for the neuronal reor-
ganization seen in virtually all experimental models
of chronic hippocampal epilepsy, as well as with
hippocampal sclerosis in patients with mesial tempo-
ral lobe epilepsy (Sutula et al., 1988; Sutula et al.,
1989), and that these changes account, at least in
part, for the cognitive disturbances, and progressive
epileptogenicity, reported by many in this volume.
However, the answer to this question is that there
is a significant amount of circumstantial evidence,
but no definitive evidence, linking seizure-induced
neuronal loss to clinically relevant brain dysfunction.
More research is needed to prove this reasonable
assumption.
If we accept the very likely possibility that
seizure-induced cell loss, in some individuals, under
some circumstances, has clinically significant behav-
ioral consequences, then what are the risk factors
for this result: seizure type, age, gender, genetics,
and all the other variables discussed previously? It is
not only necessary to determine what circumstances
need to exist for seizures to cause neuronal loss
(or dysfunction, for that matter), but also for these
molecular, cellular or systems changes to ultimately
result in the manifestation of some clinically signif-
icant behavior. Studies to delineate these factors are
essential if the intention is to predict adverse con-
sequences of epileptic seizures and either prevent or
reverse them.
It is an undeniable fact that neuroscientists in our
field are not paid for answers, but for questions.
Testable hypotheses are necessary to obtain funding
for research that hopefully will provide useful in-
sights, but inevitably will also generate even more
questions and more grant proposals. Given the clin-
ical importance of the question posed as the title
of this volume, and the tremendous number of vari-
ables that might contribute to the possibility that
individual or repeated seizures could result in suf-
ficient brain injury to cause behavioral dysfunction,
or make seizures worse, there would appear to be
an infinite number of potential pathophysiological
mechanisms that could conceivably be the target of a
clinically useful intervention. The value of the chap-
511
ters in this volume, therefore, is not that they have
provided an answer to the question "Do seizures
damage the brain?", which perhaps they have not,
but that they have raised a number of critical is-
sues that should be productively explored. Not only
those who contributed in this volume, but anyone
with an interest in this subject who reads it, could
easily be inspired to pursue one or more of these
research directions. Funding for such research might
be expected from governments interested in avoid-
ing the costs to society of disability associated with
epilepsy, from drug companies interested in devel-
oping pharmaceutical agents that could prevent or
reverse seizure-induced brain disturbances, and from
organizations concerned with improving the quality
of life for people with epileptic seizures. Ideally, this
research should be carried out in both the animal
laboratory and with patients, using reiterative paral-
lel experimental designs, where possible, to establish
the clinical relevance of observations made in ani-
mal models, and to pursue in animals those insights
gained from clinical studies that are not amenable
to further human investigation. Productive commu-
nication between basic and clinical neuroscientists is
essential to move this area of research forward.
Finally, it is important to emphasize the need for
sensitivity to the fact that patients with epilepsy are
stigmatized by their disorder, and that their disability
often results more from the attitudes of society to-
wards them than from their actual seizures. Although
research into the mechanisms by which seizures may
damage the brain are essential to the development
of approaches that might eliminate a major cause
of disability among people with epilepsy, we must
be careful that the research we publish does not in-
advertently contribute to this disability by implying
that patients with epilepsy are doomed to progressive
cerebral deterioration. We must remain cognizant of
the fact that what we say, and how we say it, will
inevitably be repeated to people with epilepsy, and to
the general public, with whom they interact. Guard-
ing against the inappropriate interpretation of our
research may prove to be more difficult than carrying
out the research itself.
512
Acknowledgements
Original research reported by the author was sup-
ported in part by Grants NS-02808, NS-15654, and
NS-33310 from the National Institutes of Health.
References
Engel Jr., J. (2001) A proposed diagnostic scheme for people
with epileptic seizures and with epilepsy: report of the ILAE
Task Force on Classification and Terminology. Epilepsia, 42:
796-803.
Engel, J. Jr., Bandler, R., Griffith, N.C. and Caldecott-Hazard, S.
(1991) Neurobiological evidence for epilepsy-induced interic-
tal disturbances. In: D. Smith, D. Treiman, M. Trimble (Eds.),
Advances in Neurology, Vol. 55. Raven Press, New York, pp.
97-111.
Engel, J. Jr., Dichter, M. and Schwartzkroin, P. (1997) Basic
mechanisms of human epilepsy. In: J. Engel Jr. and T.A. Ped-
ley (Eds.), Epilepsy: A Comprehensive Textbook. Lippincott-
Raven, Philadelphia, PA, pp. 499-512.
Engel, J. Jr., Schwartzkroin, EA., Mosh6, S.L. and Lowenstein,
D.H. (Eds.) (2001) Brain Plasticity and Epilepsy: A Tribute to
Frank Morrell. Academic Press, San Diego, CA.
Goddard, G.V., McIntyre, D.C. and Leech, C.K. (1969) A per-
manent change in brain function resulting from daily electrical
stimulation. Exp. Neurol., 25: 295-330.
Kotloski, R., Lynch, M., Lauersdorf, S. and Sutula, T. (2002) Re-
peated brief seizures induce progressive hippocampal neuron
loss and memory deficits. In: T. Sutula and A. Pitkfinen (Eds.),
Do Seizures Damage the Brain. Progress in Brain Research,
Vol. 135. Elsevier, Amsterdam, pp. 95-110.
Lathers, C.M., Schraeder, EL. and Boggs, J.G. (1997) Sudden
unexplained death and automatic dysfunction. In: J. Engel Jr.
and T.A. Pedley (Eds.), Epilepsy: A Comprehensive Textbook.
Lippincott-Raven, Philadelphia, PA, pp. 1943-1955.
Morrell, E (1989) Varieties of human secondary epileptogenesis.
J. Clin. Neurophysiol., 6: 227-275.
Morrell, F., Whisler, W.W., Smith, M.C., Hoeppner, T.J.,
deToledo-Morrell, L., Pierre-Louis, S.J., Kanner, A.M.,
Buelow, J.M., Ristanovic, R., Bergen, D., Chez, M. and
Hasegawa, H. (1995) Landau-Kleffner syndrome: treatment
with subpial intracortical transection. Brain, 118:1529-1546.
Pitkfinen, A., Nissinen, J., Nairismagi, J., Lukasiuk, K., Gr6hn,
O.H.J., Miettinen, R. and Kauppinen, R. (2002) Progression
of neuronal damage after status epilepticus and during sponta-
neous seizures in a rat model of temporal lobe epilepsy. In: T.
Sutula and A. Pitk~inen (Eds.), Do Seizures Damage the Brain.
Progress in Brain Research, Vol. 135. Elsevier, Amsterdam,
pp. 67-83.
Pritchard, EB. III. (1997) Hormone changes in epilepsy. In: J.
Engel Jr. and T.A. Pedley (Eds.), Epilepsy: A Comprehensive
Textbook. Lippincott-Raven, Philadelphia, PA, pp. 1997-2002.
Shouse, M.N., Martins da Silva, A. and Sammaritano, M. (1997)
Sleep. In: J. Engel Jr. and T.A. Pedley (Eds.), Epilepsy: A
Comprehensive Textbook. Lippincott-Raven, Philadelphia, PA,
pp. 1929-1942.
Sutula, T., He, X.-X., Cavazos, J. and Scott, G. (1988) Synap-
tic reorganization in the hippocampus induced by abnormal
functional activity. Science, 239:1147-I 150.
Sutula, T., Cascino, G., Cavazos, J., Parada, I. and Ramirez, L.
(1989) Mossy fiber synaptic reorganization in the epileptic
human temporal lobe. Ann. Neurol., 26: 321-330.
T. Sutula and A. Pitk~inen (Eds.)
Progress in Brain Research, Vol. 135
© 2002 Published by Elsevier Science B.V.

CHAPTER 47

Summary: Implications for management

Thomas Sutula 1,2,, and Asla Pitk~inen 3,4

l Department of Neurology and 2 Department of Anatomy, University of Wisconsin, Madison, W153792, USA
3 Epilepsy Research Laborator3; A.1. Virtanen Institute for Molecular Sciences and 4 Department of Neurology,
Kuopio University Hospital, Kuopio, Finland

So what is a reasonable answer to the question
"Do seizures damage the brain?" The work described
in this volume, which is elegantly summarized in
Chapter 46, suggests that a simple universally appli-
cable response is not likely to be appropriate, and
that the question demands continuing scrutiny.
At this time, perhaps a most reasonable response
to the question is "in s o m e individuals, in s o m e
conditions, yes". For those who seek scientific 'cer-
tainty', this statement is likely to be unsatisfying,
and implies a need to define w h o are the vulnerable
individuals, and w h a t are the conditions. Given the
prevalence of epilepsy in both industrialized and de-
veloping societies, and the nearly universal tendency
for epilepsy to be minimized, concealed, or ignored,
the need for continuing research is not merely to gain
scientific certainty, but to address the human costs
and social burden. There is a need to advocate for the
social and human burden of epilepsy in the public
policy arena, where priorities for research funding
and health care are competitive. What are the conse-
quences of minimizing the effects of seizures?
For patients, families, and physicians, what is a
reasonable practical response given the uncertain-
ties? Waiting for definitive scientific conclusions is
clearly not a satisfying option. Given the evidence
about the long-term consequences of ineffectively
treated epilepsy, how appropriate are statements such
as "you are doing well, you only had a few seizures
this year"? Therapeutic decisions are always mat-
ters of relative risk and benefit in circumstances
with fragmentary or limited information. While ev-
ery seizure may not require a specific or aggressive
therapeutic response, the available data on the conse-
quences of epilepsy, both in experimental and human
studies, provides compelling reasons to promptly
institute effective treatment and achieve complete
control, and to seek new therapeutic strategies to
modify the consequences of epilepsy.

* Correspondence to: T. Sutula, Department of Neurology

H6/570, University of Wisconsin, Madison, WI 53792,
USA. Tel.: +1-608-263-5448; Fax: +1-608-263-0412;
E-mail: sutula @neurology.wisc.edu
 Subject Index

Abercrombie, 29, 44, 239 behavioral effects, 322, 329, 377-378, 382-383,
N-acetylcysteine, 207 387, 419--422, 424--425,465
acid fuchsin and damage, 357, 370 benign rolandic epilepsy, 228, 322
aconitase, 190 bicuculline, 5, 18, 192, 198
adverse effects of seizures, 378, 383, 396, 399, 465 blood-brain barrier, 489
afterdischarge, 103 brain damage, s e e damage
age dependent effects of seizures, 355, 367, 372, brain size, 309
385,441,444, 446, 456 bromodeoxyuridine, 117, 123, 326, 490
aging, 123, 237 brief seizures, 111,356, 358, 465
aggressive behavior, 381
allelic variation, 143 calcium, 6, 166, 187, 197, 329, 360, 472, 473, 487
allylglycine, 5 calcium channel, 7
Alzheimer's disease, 256, 460 caspases, 6, 111,116, 161,191,342, 344, 489
AMPA receptor, antagonists, 7,488 caudate nucleus and damage, 308
amygdala, 6, 67, 90, 115, 158, 161,255, 279, 359, cell counting, 237, 391
368 cell death, 141,329, 342, 359, 368, 377, 509
amygdalo-hippocampectomy, 442 cerebellum, 90, 157
anticonvulsants, s e e antiepileptic drugs cerebral damage, s e e damage
antiepileptic drugs, 310, 377, 391, 395, 405, 411, cerebral reserve, 429-430, 435,445, 455, 458, 460,
419, 420, 421,422, 424-425, 430, 445,459, 466, 466
474, 483,489, 491,504 chemoconvulsants, 14
antiepileptogenesis, 491 child behavior checklist, 421-422
antioxidant therapies, 192, 489 childhood absence epilepsy, 229
anxiety and seizure effects, 381,386, 419 childhood onset temporal lobe epilepsy, 432, 434,
apoptosis, 6, 96, 112, 166, 175, 190, 200, 335,342, 436
343, 349, 395,487, 489 clinical trials, 474, 501,504
arachidonic acid, 175 cognition and seizures, 89, 360-361,377, 382-383,
astrocyte or astrogliosis, 123, 162 391,395, 399, 406, 409, 429, 433,435,440, 455,
atrophy, 305-306, 336, s e e a l s o volume loss 479
attention problems and seizures, 419 collapsin response mediator protein, 4, 122
complex-partial seizures, 302, 306, 311, 431
baboon, 5, 86 complex febrile seizures, 222, 285
backcrossing, 145 conditional gene knockout, 145
basal dendrite, 128 consequences of seizures, 355, 361,379, 387, 395
basic fibroblast growth factor, 123 consolidation and memory, 440
Bax, 115, 167, 344, 350 convulsions, s e e seizures, status epilepticus
Bcl-2, 111, 115, 167 convulsive status epilepticus, 86
benzodiazepine receptors, 254 cortex, 90, 158
bias in cell counting, 27 corticotropin-releasing hormone (CRH), 370
brain derived neurotrophic factor (BDNF), 123,490 counting (cells, objects), 26, 43
516

COX-2, 7,489 electron transport, 187

cresyl violet, 98 elevated plus-maze, 381,385
cross-sectional studies, 300, 309, 317, 399, 404, emotionality and seizures, 386
419--420, 425,429-430, 435,439, 441,445, 448, endopiriform nucleus, 105
456, 466 energy depletion and neuronal damage, 350
cyclin dependent kinases, 343, 350 enriched environment and effects of seizures, 361
cycloheximide, 114 entorhinal cortex, 96, 105, 115, 158, 198, 279
cyclosporin A, 199 epidemiological studies, 85, 219, 221,315
cytochrome c, 6, 115, 189, 207, 350 epidermal growth factor, 123
cytokine, 180 epilepsy surgery, 423,442
epileptic dementia, 480
damage, 337, 377, 383, 386, 395-396, 420, 451,509 epileptic tolerance, 18
damage, model dependence, 306, 337, 338, 341, epileptogenesis, 53, 67, 162, 175, 219, 275, 341,360
367, 396 episodic memory, 439, 440, 446, 448, 451
declarative memory, 439, 440, 451 excitotoxicity, 111, 143, 181,472, 489
dementia, s e e epileptic dementia extracellular matri x, 124
dendrite, 6, 18 extratemporal epilepsy, 307, 317
2-deoxyglucose autoradiography, 141
depression, 420, 482 family responses and epilepsy, 420
developmental effects and damage, 268, 335, 336, 18F-fluorodeoxyglucose (FDG-PET), 254, 317, 455
339, 342, 350, 355, 356, 359, 361,365, 366, 367, febrile seizures, 221, 263, 306, 308, 336, 338,
377, 382-383, 387, 395-396, 430, 435,451,509 365-366, 371,392
diazepam, 6 febrile status epilepticus, 91
diffusion tensor imaging, 256 figural memory, 403, 439, 441,445
diffusion weighted imaging (DWI), 311 flanking gene, 145
disector, 45 Fluoro-Jade B, 67, 370, 465
DNA fragmentation, 342, 370 flurothyl seizures, 17, 326, 357-358, 386, 391,396
DNA laddering, 116 free fatty acid, 177
dopamine receptors, 254 free radical, 7, 187, 197
doublecortin, 122 frequency of seizures and effects, 302, 305-306,
drug discovery, 497 356, 377-378, 444
drug withdrawal, 421 fuchsin, s e e acid fuchsin
dual pathology, 162, 239 full scale IQ, 459
duration and effects of seizures, 86, 299, 300, 302, functional genomics, 161
306-307, 309, 316-317, 356, 378, 400, 402, 420, functional MRI, 256
429-435, 445,451,455,456, 457,458, 459,466 functional reserve, 460
duration of epilepsy, 74 fura-2, 199
dysfunction, s e e adverse effects
GABA, 372
early onset of epilepsy, 391,445 GABAA receptor, 7, 167
ectopic neurons, 127 GABAergic interneuron, 61
education and seizure effects, 458,459 GABA receptor, 21
eicosanoids, 175 gender and damage, 285
electrical status epilepticus during sleep, 226 gender-related performance differences, 381
electrochemical gradient, 187 gene expression and seizures, 156, 372
electroconvulsive seizures, 18, 177 generalized tonic-clonic seizures, 302, 306, 309,
electroconvulsive therapy (ECT), 404, 435, 481 399, 400, 404, 405,406, 409, 412, 466
electron microscopy, 25, 37, 47, 116, 121,349, 370 genetic background, 7, 139, 315,466
 517

genetic models, 14 kainic acid, 5, 17, 53, 311, 337, 357-358, 360,
genetic susceptibility, 273, 396 366-367, 382, 386, 391
genomics, 149, 161 Kaplan-Meier, 216
gliosis, 90 kinase activation, 17
glutamate, 472 kindling, 6, 95, 111, 121,226, 317, 355, 359, 360,
glutamate receptors, 167, 175 365, 387, 391,441,479, 481,490
glutathione, 193
granule cell development, 237 Landau-Kleffner syndrome, 226
laser micro-dissection, 161
Halstead-Reitan neuropsychological test battery, latent period, 54, 242
401,405 learning and memory, 123, 379
head trauma, 223 learning disabilities, 322
heat-shock protein, 20 Lennox-Gastaut syndrome, 327, 483
hippocampal sclerosis, 87, 298, 306, 367, 311,316, lenticular nucleus and damage, 308
391,446, 460 lipid peroxidation, 192
hippocampal volume, 429, 432 lipid signalling, 175
history of hippocampal damage, 3 locomotor activity, 379
Hoechst staining, 116 longitudinal studies, 253, 300, 309, 316-317, 399,
hybrid strains, 144 404, 419, 424, 430, 436, 439, 441,445,456, 466
hyperthermia, 5, 7, 17, 87 long-term effects 0f epilepsy, 329, 383,410, 444
hypoglycaemia, 87 low education level and damage, 435
hypometabolism, 305, 307 long term depression (LTD), 360
hypotension, 5 long term potentiation (LTP), 175, 360, 385,413
hypoxia, 3, 87, 358 look-up section, 31, 47

192-IgG-saporin, 18 magnesium, 197

immature brain, 18, 87, 115, 244, s e e a l s o
developmental effects
immediate early gene, 7, 157
immune system, 272
infantile spasms, 327
infection, 272, 285
inflammation, 7
inhibition, 329, 337,357, 385
initial precipitating injury, 237, 297-298, 316, 395,
430, 431,435,466
injury and seizures, 266, 305, 336, 342, 365-366,
369, 392
intellectual functions, 89, 432, 433,455
interactable TLE, 339, 436, 459
interictal epileptiform discharges, 226, 425, 431
interseizure interval, 226
investigational new drug application (IND), 498
IQ, 322, 402, 423,432, 434, 444, 445,455,458
ischemia, 489
Jnk family proteins, 115
juvenile myoclonic epilepsy, 229
magnetic resonance imaging (MRI), 67, 253, 263,
279, 305-306, 309, 429, 431, 432, 434, 465,
476
magnetic resonance spectroscopy (MRS), 68, 255,
297, 298, 299, 310, 317, 476
mamillary nucleus, 27
melatonin, 192
mental health problems and seizures, 419
memory, 89, 95, 377, 379-380, 381,386, 392, 430,
433--434, 441,479, 481,482
mesial temporal sclerosis, s e e hippocampal sclerosis
metabolic rate and neuronal damage, 336, 350
metabotropic receptors and agonists, 175,488
Meyer hypothesis, 4, 237
microarray (microchip), 7, 21,149, 161
midbrain, 158
migration, 121
mitochondria, 6, 38, 115, 187, 197, 342, 350, 487
mitogen-activated protein kinase, 177
model dependence of damage, 337, 338, 341,396
modifier gene, 143
monkey, 123
518

monozygotic twins and damage, 400 nucleolar count, 30

Morris water maze, 323,379 numerical aperture, 32
mortality, 88
mossy fiber sprouting, 14, 58, 121,272, 321, 324, olfactory bulb, 97, 122
357, 359, 368, 387 oligodendrocyte, 123
mother-child interaction and seizures, 420 oligonucleotide array, 150
motor ability and seizures, 378 open field testing, 358, 379, 385
mounting media, 33 opioid receptors, 254
multiple sclerosis, 256 optical disector, 25, 31, 71, 98
multiple seizure types and damage, 420 optical fractionator, 47
muscimol, 201 organotypic slice culture, 192, 197
oxidative stress, 187, 489
N-acetylaspartate (NAA), 255, 298-300, 310
NAA/Cr ratios, 68, 310 p53, 20, 143
NADH, 197 p75, 115
necrosis, 6, 111, 166, 175, 190, 335, 342-343, 349, PAF signalling, antagonists, 179, 489
487 pentylenetetrazol, 143, 156, 193, 357-358, 386
neocortical epilepsy, 299, 307, 308 perforant path stimulation model, 5, 6, 104, 337, 340
NeuN, 114, 299 pharmacoresistant temporal lobe epilepsies, 413
neurobehavioral dysfunction, 466 phenotype, 139
neurodevelopmental, 429, 432, 435-436, see also phospholipase, 7, 175
developmental phospholipids, 175
neurological dysfunction and seizures, 328, 421, physical disector, 25
424, 425 pilocarpine model, 6, 21, 54, 59, 97, 337, 340, 369,
neuronal damage, 301,366, 435,471 382, 391,396
neuronal death, 360, 372, 382, 383 piriform cortex, 115
neuronal density, 98, 237, 298 platelet activating factor, 175
neonatal seizures, 323 polysialylated form of neural cell adhesion molecule
neurogenesis, 7, 17, 79, 97, 105, 117, 121,176, 321, (PSA-NCAM), 122, 244
326, 341,356, 387, 396, 490 poorly controlled seizures, 430
neuronal loss, 316, 337, 356, 368-369, 387, 392, positron emission tomography (PET), 254, 305-306,
435,455 309
neuron-specific beta tubulin, 122 postictal changes, 482
neuron-specific enolase, 337 postictal imaging, 258
neuropeptide, 17 postoperative age-related memory decline, 450
neuroprotection, 142, 187, 471,473, 475, 487, 488, potassium, extracellular, 197
497, 504 potassium channels, 372, 392
neuropsychological, 480, 482 precursor cell, 122
neuropsychological tests, 399, 403, 405, 430-431, presynaptic thickening, 38
465 probability of remission, 226
neurotrophins, 123, 490 programmed cell death, 111
new onset epilepsy, 421,422, 425 progression, 441
nerve growth factor (NGF), 18, 490 progressive, 53, 243, 305, 307, 309, 310, 315, 317,
nitric oxide, 188 336, 359, 399, 419, 429, 433-434, 436
NMDA receptors and antagonists, 5, 359, 360, 488 progressive decline, 456
nonconvulsive status epilepticus, 86 progressive deterioration, 482
nondeclarative memory, 439 progressive neuronal dysfunction, 300, 302
nonverbal memory, 431 profile counting, 25
 519

prolonged febrile convulsion, 5, 7, 263 social adaptation and seizures, 381

propidium iodide, 113, 197 socioeconomic status and seizures, 420
proportional hazard model, 217 spatial learning and memory, 95, 386, 380,381,392
prostagladins, 489 species dependent effects of seizures, 337, 338
prospective studies, s e e longitudinal studies spectroscopy, s e e magnetic resonance spectroscopy
psychosis and seizures, 482 spine density, 357, 387, 392
Purkinje cell, 27, 90 spontaneous seizures, 53, 67
sprouting, 237, 323, 328, 329, 341,356, 366, 368,
radial arm maze, 95, 358, 380, 385 383, 387
radial glia, 122 Stanford-Binet Intelligence Scale, 402
recovery, 270 status epilepticus, 3, 53, 67, 85, 162, 315, 327, 335,
refractive index, 33 382-383, 391,401,406, 471,474, 475
region of interest, 299 stem cells, 121
reserve capacities, 439 stereological cell counting, 43, 57, 67, 95
respiratory chain, 190 strain (mouse, rat), 7, 140
retest interval, 439, 444 stress and damage, 421
retroviral reporter, 125 stroop test, 405
reverse transcription-polymerase chain reaction, 161 subventricular zone, 121
rhodamine- 123, 199 synaptic junction, 40
risk of seizure recurrence, 215 synaptic reorganization, s e e sprouting
rostral migratory stream, 122 synchronization, 315
rotarod testing, 378 systematic error, 28

salicylate, 193 T2 relaxometry, 72, 255, 263, 280

sampling, 27
sampling section, 31, 47
secondary epileptogenesis, 359, 412, 441, 481, 510
secondary generalized tonic-clonic seizures, 413,
444, 459
secondary neuroprotection, 488
seizure control, 420, 439, 445
seizure control and outcome, 479
seizure density, 215
seizure duration, 221,243
seizure frequency, 54, 73, 215,402, 411,420, 458
seizure interval, 57
seizure-induced damage, 158, 315
seizure number, 285
selzure-supressing mechanisms, 510
seizure suspectibility and genes, 140
semantic memory, 439, 440, 448, 451
semithin sections, 38
shrinkage, 29, 34
short term working memory, 440, s e e a l s o memory
silver staining, 44, 115, 141,357, 368-369, 465
single photon emission computed tomography
(SPECT), 254
sleep, 479
teacher's report form (TRF), 421,424
temporal lobe epilepsy, 365-366, 367, 384, 429,
430, 432, 433, 434, 435,439, 440, 444, 446, 456,
457, 482,
test-retest effects and cognitive assessment, 405,
430
test-retest reliability in MRI, 253
tetanus toxin model, 339, 357, 358, 386, 391-392
thalamus and damage, 90, 308, 338, 378
time couse of development of medial temporal
sclerosis, 273
time course of seizures, 226
Timm stain, 59, 78
tissue plasminogen activator, 167
c~-tocopherol, 197
tonic-clonic seizures, s e e generalized tonic-clonic
seizures
tonic-clonic status epilepticus, 85
trail making part A, 405
transcription, 149
transient cognitive impairment, 424, 425
TUNEL, 105, 111,163, 193, 343-344, 370, 465
twin studies, 224
two-hit models, 383, 386
520

variance in cell counting, 27 Wechsler-Bellevue Intelligence Scale, 402, 403

verbal learning and memory, 403,406, 442, 444, 446 West syndrome, 227
video-EEG monitoring, 54, 67, 86, 430 working memory, 380
visual memory, 405,406, 455
visual-spatial learning and memory, 380, 455 X-irradiation, 126
vitamin E, 194
volume loss, 305, 308, 432 z-axis measurement, 32
volumetric MRI, 96, 431,432, 434, 465 zinc, 168

WAIS, 401,402, 405,445,457,458

water maze, 358, 379, 382, 386