Journal Pre-proof

Dental plaque microbiota profiles of children with caries-free and

caries-active dentition

Muawia A. Qudeimat (Conceptualization) (Methodology)

(Validation) (Formal analysis) (Data curation) (Writing - original
draft) (Visualization) (Project administration) (Funding acquisition),
Asma Alyahya (Formal analysis) (Data curation) (Writing - review
and editing), Maribasappa Karched (Conceptualization)
(Methodology) (Validation) (Formal analysis) (Data curation)
(Writing - original draft) (Visualization) (Funding acquisition), Jawad
Behbehani (Data curation) (Writing - original draft), Nathanael O.
Salako (Conceptualization) (Methodology) (Writing - review and
editing) (Funding acquisition)

PII: S0300-5712(20)30287-6
DOI: https://doi.org/10.1016/j.jdent.2020.103539
Reference: JJOD 103539

To appear in: Journal of Dentistry

Received Date: 30 December 2019

Revised Date: 18 November 2020
Accepted Date: 23 November 2020

Please cite this article as: Qudeimat MA, Alyahya A, Karched M, Behbehani J, Salako NO,
Dental plaque microbiota profiles of children with caries-free and caries-active dentition,
Journal of Dentistry (2020), doi: https://doi.org/10.1016/j.jdent.2020.103539
This is a PDF file of an article that has undergone enhancements after acceptance, such as
the addition of a cover page and metadata, and formatting for readability, but it is not yet the
definitive version of record. This version will undergo additional copyediting, typesetting and
review before it is published in its final form, but we are providing this version to give early
visibility of the article. Please note that, during the production process, errors may be
discovered which could affect the content, and all legal disclaimers that apply to the journal
pertain.

© 2020 Published by Elsevier.

Dental plaque microbiota profiles of children with caries-free and caries-active

dentition

Short Title: Dental plaque microbiota profile

a
Muawia A. Qudeimat, a Asma Alyahya, b Maribasappa Karched, c Jawad Behbehani, d
Nathanael O. Salako

of
a
Department of Developmental and Preventive Sciences, Kuwait University, Kuwait
b

ro
Department of Bioclinical Sciences, Kuwait University, Kuwait
c
Department of Restorative Sciences, Kuwait University, Kuwait
d
Department of Pediatric Dentistry, The University of Texas Health Science Center at Houston,
USA

-p
re
Corresponding Author:
lP

Muawia A. Qudeimat
Department of Developmental and Preventive Sciences
Faculty of dentistry
na

P.O.Box: 24923
Safat-13110, Kuwait
Tel: +965- 2463-6747
ur

Fax: +965-2463-26049
e-mail: mqudeimat@hsc.edu.kw
Jo

ABSTRACT

1
Objective: Microbiota comparisons between healthy and diseased dental tissues have accentuated

the importance of cultivating and identifying bacterial species that play a role in the initiation

and progression of dental caries. The objective of this study was to evaluate the bacterial

community composition in caries-active and caries-free children. Methods: Supragingival plaque

samples were collected from 64 caries-active and 64 caries-free Middle Eastern children. The

hypervariable V3–V4 of the bacterial 16S rRNA gene was sequenced with Human Oral Microbe

Identification using Next Generation Sequencing. Microbial community structure and

of
composition analyses were performed by processing operational taxonomic units. Bioinformatic

ro
analyses, including analysis of similarity, alpha and beta diversities, and principal coordinate

analysis, were carried out. Results: Diversity indices did not find differences between the caries-

-p
active and caries-free groups (p>0.05). Similarity analysis demonstrated that the microbiota
re
composition did not differ between the two groups. Comparative analysis at the species level

revealed a significantly higher relative abundance of Leptotrichia shahii, Prevotella

lP

melaninogenica, Veillonella dispar, Leptotrichia HOT 498, and Streptococcus mutans in caries-

active children (p<0.05). Corynebacterium matruchotii, Lautropia mirabilis, Neisseria elongata,

na

and Corynebacterium durum were relatively more abundant in the caries-free group (p<0.05).

Species belonging to the Leptotrichia, Prevotella, and Veillonella genera were significantly
ur

predominant in the caries-active subjects. Conclusion: In view of the lack of a clear association

between Corynebacterium spp. and dental caries status in the literature, the predominance of
Jo

these species in caries-free children warrants further research to understand their possible role in

a health-associated microbial community.

2
Clinical Significance: Understanding the relationship between specific bacteria present in dental

biofilms and health and disease is essential for preventing and combating dental caries. Using

advanced next generation sequencing techniques, the present study demonstrated the complexity

of the caries microbiome and identified species/genera whose virulence or protective properties

should be further explored.

of
KeyWords: Caries, Plaque, HOMINGS, Microbiomes, Bacteria, Children

ro
-p
re
lP
na
ur
Jo

3
INTRODUCTION
Dental caries is a multifactorial disease caused by the interaction of four primary factors:

cariogenic microorganisms, substrate, host factors, and time [1]. The isolation of Streptococcus

mutans and Lactobacillus acidophilus from caries lesions led to these organisms being targeted

as the bacterial species responsible for caries [2]. However, it has been shown that caries can

occur in the absence of these two organisms and that the S. mutans count has been found to be

of
low even when caries is present, suggesting that other species may be responsible for caries

development [3]. In addition, it has been demonstrated that many other bacteria and fungi in the

ro
oral cavity can cause dental caries [4]. More recently, Keijser et al. [5] estimated that there may

be over 19,000 phylotypes inhabiting the oral cavity. These other bacteria include non-mutans

-p
streptococci such as Streptococcus sanguinis, Streptococcus mitis, and Streptococcus milleri, and
re
bacteria that were neither streptococci nor lactobacilli such as Actimomyces, Bifidobacteria,

Neisseria, and Veillonella [3].

lP

The role of specific bacteria in dental biofilms and understanding their relationship to health and

disease is essential in preventing and combating dental caries [5]. Therefore, identification of the
na

microorganisms responsible for dental caries has been a major focus of research for decades, and

with advances in oral microbiota identification and analysis techniques, the composition and
ur

characteristics of oral microbiota are continuously changing [6]. The development of new DNA

sequencing technologies has allowed for a more in-depth identification of hundreds of

Jo

uncultivable oral bacterial taxa [7,8]. Human oral microbe identification using next generation

sequencing (HOMINGS) technology, which is based on 16S rRNA gene sequence analysis, has

demonstrated the potential to more accurately reveal the composition of microbiota in dental

biofilms in health and disease [9-11]. Therefore, the objective of this study was to investigate the

4
community composition of dental plaque in the mixed dentition of caries-active and caries-free

Middle Eastern children. The null hypothesis was that there is no difference in the diversity or

most predominant genera and species of dental plaques between caries-free and caries-active

children.

of
ro
-p
re
lP
na
ur
Jo

5
MATERIALS AND METHODS

Study population: When conducting this study, the principles of the World Medical Association

Declaration of Helsinki were closely followed. The study protocol was approved by the Health

Science Centre Ethical Committee at XXXX University (VDR/EC/163- 18th March 2015). The

sample size calculation was based on an earlier study [12]. Expecting a mean difference in the

microbial diversity in the different bacterial categories from children in the caries-active and

of
caries-free groups of 8 and an SD = 15, with α = 0.05 and power 1‐ β = 0.8, it was estimated that

approximately 55 subjects in each group would be sufficient to avoid type I and type II errors.

ro
Assuming a dropout rate of 20% due to subject’s recruitment or sampling errors, 66 subjects per

group were needed. A random sample of 2173 girls and boys from the public and private schools

-p
of XXXX were invited to participate in the study. All subjects came from a similar
re
socioeconomic background and were under the care of the School Oral Health Program. Written

informed consent was obtained from the parents of 1550 children.

lP

The decayed, missing, and filled caries indices for primary and permanent teeth (dmft and

DMFT) were used. Dental caries detection was performed according to the criteria of the
na

International Caries Detection and Assessment System (ICDAS). Inclusion criteria included:

healthy 6–9-year-old children who were caries-free and without any history of dental caries
ur

(dmft and DMFT = 0) or caries-active (dt and DT ≥ 2, and DMFT and dmft ≥ 5). Exclusion

criteria included: 1) children with a systemic disease or any drug use that could affect the
Jo

microbiota of the oral cavity or salivary gland functions; 2) history of salivary gland disease; 3)

those who received antibiotic therapy during the last 3 months; and 4) children with severe

localised or generalised periodontitis. After applying the inclusion/exclusion criteria, 128

6
children were enrolled. The children were divided into two groups: a caries-active group

composed of 64 children and a caries-free group composed of 64 children.

Clinical examination and collection of samples: To prevent any bias in the processing or

analysis of the samples, the participants, microbiologists, laboratory assistants, and statistician

were all unaware of the identity of the two investigated groups throughout the study period. The

principal investigator collected the samples and number coded each participant’s sample tube.

of
Participating children were instructed not to brush their teeth for 24 hours and to refrain from

ro
eating breakfast before the examination and sample collection. On the morning of the

examination, all children were instructed to rinse with water. A trained paediatric dentist with

-p
previous clinical and research experience in the use of the ICDAS caries detection system then
re
examined the teeth of all children participating in this study. The examination was carried out in

the school’s dental clinic using a mouth mirror and probe (Hu-Friedy, Chicago, IL, USA) under
lP

dental chair lighting. For each child in both groups, a pooled sample of the supragingival plaque

was collected from the buccal/labial, lingual/palatal, and proximal surfaces of all present teeth.
na

The plaque was collected using a sterile curette (Gracey 1 & 2 Currette, Hu-Friedy, Chicago, IL,

USA into 1.5 mL tubes containing 1 mL sterile PBS. Immediately after collection, the tubes were
ur

kept on ice. Within 3 h, all vials were transported to the laboratory for processing in an ice

container and were centrifuged at 5000 g (relative centrifugal force) for 5 min. The supernatants
Jo

were discarded, and the pellets were stored at -80 °C.

DNA extraction: DNA was purified from the plaque samples using the DNeasy Blood & Tissue

Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Plaque samples

7
stored at -80 °C were brought to room temperature over 30 min, added to enzymatic lysis buffer,

and incubated at 37 °C for 30 min. Buffer AL (lysis buffer) and proteinase K were added, and the

mixture was incubated at 56 C for 1 h. The contents were transferred to spin columns and

centrifuged at 6000 g for 1 min. The DNA bound to the membranes in the spin columns was

sequentially washed using two wash buffers. The spin columns were placed on a sterile 1.5-mL

tube and the bound DNA was eluted with nuclease-free water (100 µL). Finally, the DNA

of
concentration in the samples was measured at A260 using a UV-Vis spectrophotometer (Nano

Drop, Thermo Scientific, Wilmington, DE, USA). Aliquots of purified DNA samples (containing

ro
at least 200 ng DNA) were stored and shipped freeze-dried under optimal conditions to the

Forsyth Institute for HOMINGS testing.

-p
re
HOMINGS 16S rRNA gene sequencing: The variable region V3-V4 of the 16S rRNA gene

was sequenced and analysed according to Gomes et al. [7]. Briefly, DNA purified from plaque
lP

samples was amplified using polymerase chain reaction (PCR) with 16S rRNA gene primers

targeting the V3-V4 region: 341F (forward primer)

na

AATGATACGGCGACCACCGAGATCTACACTATGGTAATTGTCCTACGGGAGGCAGC

AG and 806R (reverse primer)

ur

CAAGCAGAAGACGGCATACGAGATNNNNNNNNNNAGTCAGTCAGCCGGACTACHV

GGGTWTCTAAT.
Jo

After cleaning up the PCR amplicons using AMPure beads, 100 ng from each library was

pooled, run on an agarose gel, and gel purified. The DNA concentration of the gel-purified

amplicons was determined using a bioanalyzer followed by surrogate quantification using real-

time qPCR. Next, 12 pM of the library mixtures was spiked with 20% sequencing control (PhiX

8
Control, Illumina, San Diego, CA, USA) and run on a next generation sequencer (MiSeq,

Illumina, San Diego, CA, USA). Bad reads and chimeric sequences were removed from the

analyses. Each raw sequence read was searched for the presence of species level probe sequences

using 16S rRNA gene-based probes and ProbeSeq, a BLAST program.

Statistical and bioinformatics analysis:

of
Microbial community structure and composition analyses were performed by processing the

operational taxonomic units (OTUs) using a software package (Primer-7, Quest Research,

ro
Auckland, New Zealand). Bioinformatics analyses, such as analysis of similarity (ANOSIM),

alpha diversity, and beta diversity, were carried out on the OTU table. The ANOSIM test was

-p
used to compare microbial community composition within and between samples, where an R-
re
value near 1 indicates that the communities are different and an R-value close to 0 indicates

similar microbial communities. Alpha diversity measures included estimates of richness and
lP

evenness (Chao1 index and Shannon diversity index). The alpha diversity data were evaluated

using the non-parametric statistical Mann-Whitney U-test. For beta diversity, principal
na

coordinate analysis (PCoA) based on unweighted Euclidean distances was completed. The

differences in the relative abundances of taxa between the two study groups were evaluated using
ur

the Mann-Whitney U-test. In addition, multiple comparisons were controlled for using the false-

discovery rate [13]. An adjusted p value <0.05 was considered significant. Statistical analyses
Jo

were performed using a statistical software (SPSS V.20, IBM, Armonk, NY, USA).

9
RESULTS

The mean age of the children who participated in this study was 7.830.6 years. In the caries-

active group, 33 of the participants were female and 31 were male. In the caries-free group, 34 of

the participants were female and 30 were male. Table 1 demonstrates the demographics and

caries activity of the subjects in both groups. The mean DMFT/dmft score for the participants in

the caries-active group was 10.61±3.04 (range: 5–18) and the mean DT/dt score was 7.91 ± 2.85

of
(range: 2–17).

ro
Plaque microbiota of caries-free and caries-active subjects:

-p
On average, the number of sequences generated for each sample was 79,143 (range: 38,298–

147,401), of which 30.2% (range: 11.8–66.4%) and 48.7% (range: 26.8–72.4%) were identified
re
at the genus level and species levels, respectively. In addition, 21.1% (range: 6.8–34.6%) of the

generated sequences could not be matched to either a species-specific or genus-specific probe

lP

sequence based on BLAST against the ProbeSeq database. Of the total 738 probe sequences

present in the ProbeSeq database, 515 (70%) were positively identified. Of these, 82 were
na

identified at the bacterial genus level and 433 were identified at the species-level.

Table 2 summarizes the alpha diversity index for all samples. Diversity index values from Chao1
ur

and Shannon analyses did not show differences between the caries-active and caries-free groups

(p > 0.05). ANOSIM analysis yielded an R-value of 0.004, suggesting that the microbiota
Jo

composition between the two groups did not differ (Figure 1). Further, the principal coordinate

analysis based on unweighted Euclidean distances of all species did not separate the two groups

(Figure 2). The first two principal coordinates explained 13.6% and 42.3% of the variation (p >

0.05).

10
HOMINGS microbial profile analysis:

Of the 25 most predominant bacterial genera found in both caries-active and caries-free groups,

Streptococcus, Neisseria, Leptotrichia, Veillonella, Aggregatibacter, and Actinomyces, showed

the highest abundance levels (Figure 3). However, most of these genera were not significantly

different between the two groups. Veillonella, Lactobacillus, and Lachnoanaerobaculum were

among those that were statistically significantly more common in the caries-active group and

Gemella, Tannerella, Haemophilus, and Catonella were significantly more common among the

of
caries-free group. Figure 4 demonstrates the 25 most predominant species in both groups. The

ro
most significantly predominant species in the caries-active group compared to those in the caries-

free group included Leptotrichia shahii (5.7% vs. 2.5%), Prevotella melaninogenica (2.8% vs.

-p
1.5%), Veillonella dispar (2.6% vs. 2.2%), Leptotrichia HOT 498 (2.5% vs. 1.5%), and
re
Streptococcus mutans (2.1% vs. 0.2%). On the other hand, the most significantly predominant

species identified in the caries-free group compared to those in the caries-active group were
lP

Corynebacterium matruchotii (5.8% vs. 3.6%), Lautropia mirabilis (1.1% vs. 0.7%), Neisseria

elongata (1.1% vs. 0.6%), and Corynebacterium durum (1.0% vs. 0.5%).
na
ur
Jo

11
DISCUSSION

Since the introduction of Miller’s (1890) acid decalcification theory, there has been continual

controversy regarding the role of bacteria in caries [2]. One of the issues of controversy is

whether a specific acid-producing bacterial species or a non-specific mixture of bacteria is the

agent responsible for dental caries. However, another theory later emerged suggesting that since

the bacteria that cause diseases in the mouth are normal oral commensals, such diseases can only

of
occur if there is a microbial, metabolic, and chemical imbalance in the dental film [2]. In the case

of dental caries, this would be an ecological change from one that favours neutral pH in the oral

ro
cavity to one that is acidogenic and therefore leads to caries formation. Specifically, many

studies have shown that both glycolysis (acid production) and ureolysis (alkali production) are

-p
major metabolic events in dental plaque with opposing effects on plaque pH homeostasis,
re
bacterial ecology, and oral disease [2,14]. It was then suggested that alkali generated from

salivary substrates, such as arginine and urea, could play an important role in plaque pH
lP

homeostasis, thus inhibiting caries [2,14]. This would occur through one or two mechanisms.

First, it increases the pH of the plaque, thus directing the balance in favour of remineralization
na

and away from demineralisation. Second, alkali production promotes the growth and persistence

of health-associated bacteria, while at the same time discouraging the growth of cariogenic
ur

bacteria that depend on low pH environments, for example, S. mutans [2,14]. Bacterial

identification, enumeration, and the precise role of certain species in health and disease has
Jo

received increased attention in recent years.

New developments in DNA-based identification technologies of oral bacterial communities have

demonstrated that the oral microbiota is complex and diverse [8]. One of the recently developed

technologies is HOMINGS. The use of this technology has allowed for more in-depth sequencing

and simultaneous species-level identification and analyses of hundreds of oral bacterial taxa [7].

12
To our knowledge, this study is the first to investigate the differences between oral microbial

profiles of caries-active and caries-free Middle Eastern children using HOMINGS analysis.

The determination of the diversity of dental caries microbial communities is usually based on the

species as the fundamental unit of analysis [12,15]. Alpha diversity is characterized by the total

number/richness of species within a given microbial community and the relative abundances and

evenness of the species. On the other hand, β diversity provides measurements for the number of

shared species between two or more communities [16]. In the current study, there were

of
comparable alpha and beta diversity indices in the supragingival plaque samples in both study

ro
groups. These findings are in agreement with earlier studies where investigators demonstrated

that the microbial diversity for groups of caries-active and caries-free infants and children were

-p
non-significant [17-19]. Other investigators have shown that caries-active individuals exhibit

greater diversity in the overall microbial population than caries-free individuals [10,12,20,21].
re
On the other hand, contrary to the above findings, researchers found a significantly greater
lP

diversity of oral microbes in caries-free individuals than in caries-active individuals [9,15,22].

These authors suggested that the reason for this could be that caries-free associated microbiota is
na

more diverse because certain groups of microbes dominate the plaque biofilm with caries

progression in the caries-active subjects [15]. The contradictions seen in the results of the

microbiome communities’ diversities between different studies may be explained by one or more
ur

of the following reasons. 1. The plaque sampling techniques and sites were different. Richards et
Jo

al. [20] demonstrated that microbial communities in samples taken from caries-free teeth

surfaces in caries-free children showed the greatest separation from dentin-caries in caries-active

children. 2. Some studies collected saliva samples from children. It is known that bacteria in the

saliva come from many intraoral sites including the buccal mucosa, tongue, and supragingival

plaque [12,23,24]. 3. Different investigators have employed different microbiological analysis

13
techniques. Using a cultivation-independent approach called denaturing gradient gel

electrophoresis, investigators were able to identify only 26 genera [21] compared to 82 identified

in our study using HOMINGS. 4. The definition of caries-active and caries-free subjects differed

between studies. For example, it has been shown that treatment of a carious lesion would cause a

decrease in the Streptococcus mutans count to the same level as that seen in caries-free children

[23]. Therefore, the use of decayed teeth (DT/dt) to identify caries-active subjects might be more

appropriate than using the DMFT/dmft index.

of
One of the main challenges facing oral health investigators is correlating specific microbial

ro
community compositions and metabolism with dental caries. However, accurately describing the

composition of the oral microbiome is the first logical step in identifying which of the potential

-p
microbial species is critical in dental health and disease [20]. In this study, the most predominant

species isolated from the caries-active group included L. shahii, P. melaninogenica, V. dispar,
re
Leptotrichia HOT 498, and S. mutans.
lP

L. shahii is a facultative gram-negative anaerobic bacterium found in the oral cavity [25]. It

ferments mono- and disaccharides to produce lactic acid [26]. L. shahii has been previously
na

recovered from the plaque of patients with active caries [6,9,20]. However, to our knowledge,

this is the first study to find L. shahii as the predominant species in caries-active children. Eribe

& Olsen [27] concluded that due to the insufficiency of biochemical databases, identification or
ur

classification of Leptotrichia spp. may be difficult. While most conventional databases contain
Jo

no more than two species of Leptotrichia [25], the use of HOMINGS in the current study allowed

for the identification of 17 known and novel Leptotrichia spp.

In agreement with previous reports, P. melaninogenica was more predominant in the caries-

active subjects [6,9,10]. While some investigators were able to isolate P. melaninogenica from

children with white-spot lesions and low levels of S. mutans [22], Kressirer et al. [21] were able

14
to detect it only in samples from dentin caries and not from caries-free or coronal-caries samples.

In the current study, some subjects in the caries-active group had white-spot lesions while others

had dentinal caries.

The contribution of Veillonella to the caries process is not well understood. While an earlier

report found no significant relationship between Veillonella spp. and caries status [28], other

investigators concluded that Veillonella increased significantly with caries progression

[9,10,19,20,22]. It has been postulated that the metabolic activities of V. dispar are stimulated by

of
low pH and the presence of lactic acid [29]. The removal of lactate from the environment and

ro
creating a higher pH microenvironment may facilitate the production of acid by other species

and/or the survival of acidogenic species intolerant to low pH conditions [22,28].

-p
Unlike most oral bacteria species, S. mutans thrives under low pH conditions, and it is under

these acidic conditions that demineralisation and cavitation of the teeth occur. Consistent with
re
the literature, this study showed that S. mutans is associated with dental caries [9,10,22,30-32].
lP

However, despite pooling the samples from all teeth surfaces in this study, S. mutans was not

identified in all subjects in the caries-active group. In addition, S. mutans was identified from the
na

supragingival plaque of children from the caries-free group. This is in agreement with the

observation where it was shown that S. mutans was not detected in all white spot or all types of

carious lesions, whether assayed using culture or molecular methods [33].

ur

Of the topmost abundant species cultivated in this study, Corynebacterium matruchotii, C.

Jo

durum, N. elongata, and L. mirabilis were significantly more abundant in caries-free children.

Corynebacterium spp. are gram‐ positive bacilli with long filaments and short, thick terminal

ends. Corynebacterium plays a key role in plaque formation. They provide a structural skeleton

for other bacteria to aggregate [11]. In addition, they raise the plaque biofilm pH by utilizing

organic acids, such as lactate and acetate, produced by other plaque microbes [11,28]. Similar to

15
this study, high levels of C. matruchotii were found to be a possible signature species for dental

health [9-11,22,28,33]. However, contrary to these findings, Peterson et al. [32] in a small

sample of eight children concluded that C. matruchotii was exclusively observed in the caries-

active group. They suggested that when the relative balance between sugar utilisation and

metabolism of organic acids tips toward the latter, this might lead to over-representation of this

species in the active state. However, this claim is yet to be validated.

Several studies have isolated species belonging to the genus Neisseiria from plaque and saliva

of
samples. The reported data are conflicting, with some studies associating this genus in general

ro
with the caries-active status of the subjects [9,17,19] and others found it to be more predominant

in caries-free subjects [8,20,22,32,33]. In the current study, N. elongata was more predominantly

-p
isolated from caries-free children. Gross et al. [28] concluded that individual species within the

Neisseria group are capable of metabolizing sugar to lactate, and other members of these genera
re
are also capable of metabolizing lactate to lower pKa acids and thus have a potentially more
lP

complex role in health and disease.

Lactobacillus spp. are anaerobes and highly acid tolerant, allowing them to survive the acidic
na

environment of active dentin carious lesions. Although in the current study, samples were not

taken directly from deep-dentin lesions, Lactobacillus spp. were significantly increased in the

caries-active group. Previously, it was reported that L. salivarius was almost exclusively found in
ur

dentin caries, suggesting that this species may be more important in the advanced stages of caries
Jo

[8,20,33,34]. Interestingly, in the present study, Lactobacillus spp. were found in subjects who

were caries-free. It is possible that because no intraoral radiographs were taken, some

interproximal cavities in caries-free children were missed.

While some of the strengths of this study are the large sample size of children included, and the

blinding of the operators throughout the study stages, this study is not without limitations. Many

16
studies correlating the diversity of oral cavity microbial communities with caries activity have

examined dental plaque samples pooled from multiple tooth surfaces [20]. Considering that

carious lesions occur at specific tooth sites, the clinical relevance of pooling the plaque sample

has been questioned [20]. In addition, no intraoral radiographs were taken in this study;

therefore, there is a possibility that some initial/advanced dental caries were not detected.

Another limitation of this study is that other aetiological factors associated with the initiation and

progression of dental caries, such as nutrition, sugar intake, oral hygiene practices, and exposure

of
to fluoride were not investigated. This study only investigated the differences in the microbial

ro
community diversity of dental plaque and the predominant bacteria between the two groups of

children matched for age and sex. In addition, although we utilized HOMINGS, which has fewer

-p
shortcomings than previous methods, false positive results cannot be eliminated [10].

Dental caries is a major oral health problem that has been shown to influence the quality of life
re
in activities such as eating, sleeping, talking, and smiling [35,36]. Nowadays, one of the major
lP

challenges facing dentists in preventing and controlling the progression of dental caries is the use

of biological or non-operative approaches [37]. Numerous investigations have established that

na

dental caries is a biofilm-dependent disease, and that caries will not form in the absence of a

dysbiotic plaque microbiota [2,8,10]. The incorporation of antimicrobial agents into dental
ur

products, such as toothpastes and mouth rinses, has been proposed as a potential prophylactic

method for controlling dental caries. However, the antibacterial effects of most of these agents
Jo

are still being tested on streptococci and Lactobacillus species as the key bacteria associated with

dental caries [36]. It is imperative to recognise that the first step in correctly identifying effective

antibacterial or antiplaque chemotherapeutic agents is the identification of the microorganisms

associated with the initiation and progression of dental caries using more recently developed

molecular microbiology methods.

17
CONCLUSIONS

Although the alpha and beta diversities did not differ between the caries-active and caries-free

groups, this study found that certain species belonging to the genera Leptotrichia, Prevotella, and

Veillonella were significantly predominant in the caries-active subjects. These findings

corroborate recent reports and, therefore, future studies aimed at elucidating pathogenic

of
mechanisms, particularly of Leptotrichia spp., are necessary for a greater understanding of their

role in caries development. On the other hand, in view of the lack of clear association of

ro
Corynebacterium spp. with caries vs. health in the literature, the predominance of this species in

-p
orally healthy Middle Eastern children warrants further research to understand their possible role

in a health-associated microbial community.

re
lP

Conflict of Interest

None
na

ACKNOWLEDGEMENTS
ur

This study was funded by Kuwait University Grant DD01/14. The Oral Microbiology Research
Jo

Laboratory at the Faculty of Dentistry is acknowledged for utilizing the equipment (SRUL

01/14).

18
CRediT authorship contribution statementQudeimat MA:
Conceptualization, Methodology, Validation, Formal analysis, Data Curation, Writing - Original

Draft, Visualization, Project administration, Funding acquisition

Alyahya A: Formal analysis, Data Curation, Writing - Review & Editing

Karched M: Conceptualization, Methodology, Validation, Formal analysis, Data Curation,

Writing - Original Draft, Visualization, Funding acquisition

of
Behbehani JM: Data Curation, Writing - Original Draft

ro
Salako NO: Conceptualization, Methodology, Writing - Review & Editing, Funding acquisition

-p
re
lP
na
ur
Jo

19
References

[1] E.S. Davenport, Caries in the preschool child: aetiology, J. Dent. 18 (6) (1990) 300–303.

[2] I. Kleinberg, A mixed-bacteria ecological approach to understanding the role of the oral

bacteria in dental caries causation: an alternative to Streptococcus mutans and the specific-plaque

hypothesis, Crit. Rev. Oral Biol. Med. 13 (2) (2002) 108–125.

of
[3] F.O. Van Ruyven, P. Lingström, J. Van Houte, R. Kent, Relationship among mutans

streptococci, “low-ph” bacteria, and lodophilic polysaccharide-producing bacteria in dental

ro
plaque and early enamel caries in humans, J. Dent. Res. 79 (2) (2000) 778–784.

-p
[4] J.R. Radford, H.M. Ballantyne, Z. Nugent, D. Beighton, M. Robertson, C. Longbottom, N.B.

Pitts, Caries-associated micro-organisms in infants from different socio-economic backgrounds

re
in Scotland, J. Dent. 28 (5) (2000) 307–312.

[5] B.J. Keijser, E. Zaura, S.M. Huse, J.M.B.M. van der Vossen, F.H.J. Schuren, R.C. Montijn,
lP

J.M. ten Cate, W. Crielaard, Pyrosequencing analysis of the oral microflora of healthy adults, J.

Dent. Res. 87 (11) (2008) 1016–1020.

na

[6] M.K. Keller, C.A. Kressirer, D. Belstrøm, S. Twetman, A.C.R. Tanner, Oral microbial

profiles of individuals with different levels of sugar intake, J. Oral Microbiol. 9 (1) (2017)
ur

1355207.
Jo

[7] B.P. Gomes, V.B. Berber, A.S. Kokaras, T. Chen, B.J. Paster, Microbiomes of endodontic-

periodontal lesions before and after chemomechanical preparation, J. Endod. 41 (12) (2015)

1975–1984.

20
[8] D. Belstrøm, B.J. Paster, N.E. Fiehn, A. Bardow, P. Holmstrup, Salivary bacterial

fingerprints of established oral disease revealed by the Human Oral Microbe Identification using

Next Generation Sequencing (HOMINGS) technique, J. Oral Microbiol. 8 (1) (2016) 30170.

[9] M. Agnello, J. Marques, L. Cen, B. Mittermuller, A. Huang, N. Chaichanasakul Tran, W.

Shi, X. He, R.J.J. Schroth, Microbiome associated with severe caries in Canadian first nations

children, J. Dent. Res. 96 (12) (2017) 1378–1385.

[10] N.N. Al-Hebshi, D. Baraniya, T. Chen, J. Hill, S. Puri, M. Tellez, N.A. Hasan, R.R.

of
Colwell, A. Ismail, Metagenome sequencing-based strain-level and functional characterization of

ro
supragingival microbiome associated with dental caries in children, J. Oral Microbiol. 11 (1)

(2019) 1557986.

-p
[11] K.S. Fakhruddin, H.C. Ngo, L.P. Samaranayake, Cariogenic microbiome and microbiota of
re
the early primary dentition: a contemporary overview, Oral Dis. 25 (4) (2019) 982–995.

[12] A.H. Luo, D.Q. Yang, B.C. Xin, B.J. Paster, J. Qin, Microbial profiles in saliva from
lP

children with and without caries in mixed dentition, Oral Dis. 18 (6) (2012) 595–601.

[13] Y. Benjamini, Y. Hochberg, Controlling the false discovery rate: a practical and powerful
na

approach to multiple testing, J. R. Stat. Soc. Ser. B. 57 (1) (1995) 289–300.

[14] R.A. Burne, R.E. Marquis, Alkali production by oral bacteria and protection against dental
ur

caries, FEMS Microbiol. Lett. 193 (1) (2000) 1–6.

[15] Y. Li, Y. Ge, D. Saxena, P.W. Caufield, Genetic profiling of the oral microbiota associated
Jo

with severe early-childhood caries, J. Clin. Microbiol. 45 (1) (2007) 81–87.

[16] C.A. Lozupone, R. Knight, Species divergence and the measurement of microbial diversity,

FEMS Microbiol. Rev. 32 (4) (2008) 557–578.

21
[17] H. Xu, W. Hao, Q. Zhou, W. Wang, Z. Xia, C. Liu, X. Chen, M. Qin, F. Chen, Plaque

bacterial microbiome diversity in children younger than 30 months with or without caries prior to

eruption of second primary molars, PLoS One. 9 (2) (2014) e89269.

[18] S. Jiang, X. Gao, L. Jin, E. Lo, Salivary microbiome diversity in caries-free and caries-

affected children, Int. J. Mol. Sci. 17 (12) (2016) 1978.

[19] Y. Zheng, M. Zhang, J. Li, Y. Li, F. Teng, H. Jiang, M. Du, Comparative analysis of the

microbial profiles in supragingival plaque samples obtained from twins with discordant caries

of
phenotypes and their mothers, Front. Cell. Infect. Microbiol. 8 (2018) 361.

ro
[20] V.P. Richards, A.J. Alvarez, A.R. Luce, M. Bedenbaugh, M.L. Mitchell, R.A. Burne, M.M.

Nascimento, Microbiomes of site-specific dental plaques from children with different caries

status, Infect. Immun. 85 (8) (2017) e00106- e00117.

-p
re
[21] C.A. Kressirer, T. Chen, K. Lake Harriman, J. Frias-Lopez, F.E. Dewhirst, M.A. Tavares,

A.C. Tanner, Functional profiles of coronal and dentin caries in children, J. Oral Microbiol. 10
lP

(1) (2018) 1495976.

[22] E.L. Gross, C.J. Beall, S.R. Kutsch, N.D. Firestone, E.J. Leys, A.L. Griffen, Beyond
na

streptococcus mutans: dental caries onset linked to multiple species by 16S rRNA community

analysis, PLoS One. 7 (10) (2012) e47722.

ur

[23] S. Petti, R. Pezzi, M.S. Cattaruzza, J.F. Osborn, A.S. D’Arca, Restoration-related salivary

streptococcus mutans level: a dental caries risk factor?, J. Dent. 25 (3-4) (1997) 257–262.
Jo

[24] Q. Zhang, Z. Bian, M. Fan, W.H. van Palenstein Helderman, Salivary mutans streptococci

counts as indicators in caries risk assessment in 6-7-year-old Chinese children., J. Dent. 35 (2)

(2007) 177–180.

22
[25] Y.K. Lim, O.J. Kweon, H.R. Kim, M.K. Lee, Leptotrichia goodfellowii Infection: case

report and literature review, Ann. Clin. Lab. Sci. 46 (1) (2016) 83–86.

[26] E.R.K. Eribe, Genetic diversity of leptotrichia and description of leptotrichia goodfellowii

sp. nov., leptotrichia hofstadii sp. nov., leptotrichia shahii sp. nov. and leptotrichia wadei sp.

nov., Int. J. Syst. Evol. Microbiol. 54 (2) (2004) 583–592.

[27] E.R.K. Eribe, I. Olsen, Leptotrichia species in human infections II, J. Oral Microbiol. 9 (1)

(2017) 1368848.

of
[28] E.L. Gross, E.J. Leys, S.R. Gasparovich, N.D. Firestone, J.A. Schwartzbaum, D.A. Janies,

ro
K. Asnani, A.L. Griffen, Bacterial 16S sequence analysis of severe caries in young permanent

teeth, J. Clin. Microbiol. 48 (11) (2010) 4121–4128.

-p
[29] A. Edlund, Y. Yang, S. Yooseph, A.P. Hall, D.D. Nguyen, P.C. Dorrestein, K.E. Nelson, X.
re
He, R. Lux, W. Shi, J.S. McLean, Meta-omics uncover temporal regulation of pathways across

oral microbiome genera during in vitro sugar metabolism, ISME J. 9 (2) (2015) 2605–2619.
lP

[30] R. Joharji, J. Adenubi, Prevention of pit and fissure caries using an antimicrobial varnish: 9

month clinical evaluation, J. Dent. 29 (4) (2001) 247–254.

na

[31] M. Seki, F. Karakama, T. Terajima, Y. Ichikawa, T. Ozaki, S. Yoshida, Y. Yamashita,

Evaluation of mutans streptococci in plaque and saliva: correlation with caries development in
ur

preschool children, J. Dent. 31 (4) (2003) 283–290.

[32] S.N. Peterson, E. Snesrud, J. Liu, A.C. Ong, M. Kilian, N.J. Schork, W. Bretz, The dental
Jo

plaque microbiome in health and disease, PLoS One. 8 (3) (2013) e58487.

[33] A.C. Tanner, C.A. Kressirer, L.L. Faller, Understanding caries from the oral microbiome

perspective, J. Calif. Dent. Assoc. 44 (7) (2016) 437–446.

23
[34] M. Bönecker, C. Toi, P. Cleaton-Jones, Mutans streptococci and lactobacilli in carious

dentine before and after atraumatic restorative treatment, J. Dent. 31 (6) (2003) 423–428.

[35] J. Montero, E. Rosel, R. Barrios, A. López-Valverde, A. Albaladejo, M. Bravo, Oral health-

related quality of life in 6- to 12-year-old schoolchildren in Spain, Int. J. Paediatr. Dent. 26 (3)

(2016) 220-230.

[36] A.S. Braga, L.L.M Simas, J.G. Pires, B.M. Souza, F.P.S.R. de Melo, L.L. Saldanha, A.L.

Dokkedal, A.C. Magalhães, Antibiofilm and anti-caries effects of an experimental mouth rinse

of
containing Matricaria chamomilla L. extract under microcosm biofilm on enamel, J. Dent. (2020)

ro
doi: https://doi.org/10.1016/j.jdent.2020.103415.

[37] J.C. Carvalho, I. Dige, V. Machiulskiene, V. Qvist, A. Bakhshandeh, C. Fatturi-Parolo, M.

-p
Maltz, Occlusal Caries: Biological Approach for Its Diagnosis and Management, Caries. Res. 50
re
(6) (2016) 527-542.
lP
na
ur
Jo

24
Figure 1

of
ro
-p
re
Fig. 1. Microbial community composition was compared using Analysis of Similarity
lP

(ANOSIM). An R-score of 0.004 indicated no difference in microbial communities’ composition

between the caries-free and caries-active groups
na
ur
Jo

25
Figure 2

of
ro
-p
re
lP

Fig. 2. Principal Coordinates analysis of unweighted Euclidean distances between the samples
considering OTU relative abundances. Two-dimensionally visualized axes are expressed as the
na

two foremost inertia values tallying for a cumulative inertia of 55.9%. Samples from caries-free
(CF) group are shown in blue while those in caries-active (CA) group are in red
ur
Jo

26
Figure 3

of
ro
-p
re
lP
na
ur
Jo

Fig. 3. Relative abundance levels of the top 25 most predominant genera

* significantly more predominant in the caries-active group

** significantly more predominant in caries-free children

27
Figure 4

of
ro
-p
re
lP
na
ur

Fig. 4. Relative abundance levels of the top 25 most predominant species

Jo

* significantly more predominant in the caries-active group

** significantly more predominant in caries-free children

28
 TABLES

Table 1 Demographic and clinical information of study subjects

Caries-active Caries-free
Females Males Mean (SDa) Females Males Mean (SD)
Sample Size 33 31 __ 34 30 __

Age (SD) years 7.80 (0.60) 7.86 (0.66) 7.83 (0.57) 7.83 (0.60) 7.83 (0.56) 7.83 (0.57)

of
Mean DMFTb/dmftc (SD) 10.27 (3.07) 10.97 (3.02) 10.61 (3.04) 0 0 0

Mean DMFSd/dmfse (SD) 26.36 (13.99) 30.03 (14.82) 28.14 (14.40) 0 0 0

ro
Mean DT and dt (SD) 7.03 (2.24) 8.84 (3.16) 7.91 (2.85) 0 0 0

Mean DS and ds (SD) 12.49 (7.98) 20.03 (13.18) 16.14 (11.38) 0 0 0

Mean DFT and dft (SD) 8.55 (2.17) 9.81 (2.93)

-p
9.16 (2.62) 0 0 0
re
Mean DFS/dfs (SD) 17.12 (8.19) 22.42 (13.21) 19.69 (11.15) 0 0 0

a
SD standard deviation.
b
DMFT (D: decayed, M: missing, or F: filled T: permanent teeth).
lP

c
dmft (d: decayed, m: missing, or f: filled t: deciduous teeth).
d
DMFS (D: decayed, M: missing, or F: filled S: permanent teeth surfaces).
e
dmfs (d: decayed, m: missing, or f: filled s: deciduous teeth surfaces).
na
ur

Table 2 Summary of alpha diversity indices

Jo

Diversity method Caries-free Caries-active p-value

Chao1 474 (263-593) 467 (271-601) >0.05

Shannon 4.11 (2.8-4.46) 4.05 (4.35-4.49) >0.05

29