1938 Letters
tifying the sex of Cannabis plants at the juvenile stage is needed. In
Genetic Identification of Female
Cannabis sativa Plants at Early
Developmental Stage
Natascha Techen 1, Suman Chandra 1, Hemant Lata 1,
Mahmoud A. ElSohly 1, 2, Ikhlas A. Khan 1, 3
1
National Center for Natural Products Research, Research Institute
of Pharmaceutical Sciences, School of Pharmacy, University of
Mississippi, University, MS, USA
2
Department of Pharmaceutics, School of Pharmacy, University
of Mississippi, University, MS, USA
3
Department of Pharmacognosy, School of Pharmacy, University
of Mississippi, University, MS, USA
Abstract
! the NaOH‑HCl method did not result in PCR products when used
Sequence-characterized amplified region (SCAR) markers were
used to identify female plants at an early developmental stage in
four different varieties of Cannabis sativa. Using the cetyl tri-
methylammonium bromide (CTAB) method, DNA was isolated
from two-week-old plants of three drug-type varieties (Terbag
W1, Terbag K2, and Terbag MX) and one fiber-type variety (Ter-
bag Fedora A7) of C. sativa grown under controlled environmen-
tal conditions through seeds. Attempts to use MADC2 (male-as-
sociated DNA from Cannabis sativa) primers as a marker to iden-
tify the sex of Cannabis sativa plants were successful. Amplifica-
tion of genomic DNA using MADC2-F and MADC2-R primers pro-
duced two distinct fragments, one with a size of approximately
450 bp for female plants and one for male plants with a size of
approximately 300 bp. After harvesting the tissues for DNA ex-
traction, plants were subjected to a flowering photoperiod (i.e.,
12-h light cycle), and the appearance of flowers was compared
with the DNA analysis. The results of the molecular analysis were
found to be concordant with the appearance of male or female
flowers. The results of this study represent a quick and reliable
technique for the identification of sex in Cannabis plants using
SCAR markers at a very early developmental stage.
Key words
Cannabis sativa L. · Cannabaceae · Cannabis sex · SCAR
Cannabis sativa L. (Cannabaceae) is one of the most ancient culti-
vated crops for drugs, fibers, and food [1]. It contains cannabi-
noids, a unique class of terpenophenolic compounds that accumu-
late mainly in the glandular trichomes of the plant [2]. Over 100
cannabinoids have been isolated from Cannabis sativa, the major
biologically active compound being Δ9-tetrahydrocannabinol,
commonly referred to as THC [3]. The pharmacologic and thera-
peutic potency of Δ9-THC and C. sativa preparations has been ex-
tensively reviewed [4–10]. C. sativa is one of the most valuable
agriculturally important crops that are dioecious in nature. Be-
cause female plants of this species contain higher levels of THC
than male plants, cultivation of the female plants is preferred.
However, as the sex of the plants is not revealed morphologically
before flowering, which may take a few weeks, male and female
plants cannot be distinguished at the seedling stage. To overcome
these problems in cultivation practice and to reduce the amount of
labor and field space required, a fast and reliable method for iden-
Techen N et al. Genetic Identification of … Planta Med 2010; 76: 1938–1939
the present study we report a simple and reliable technique for
identifying the sex of Cannabis plants at the early seedling stage.
Our aim was to find a way of extracting DNA that is quick and
simple, can be done in a microtiter (96 well) format, and results
in DNA good enough for PCR. Two different extraction methods,
NaOH‑HCl and CTAB, were tested and compared. Several studies,
using methods such as random amplified polymorphic DNA
(RAPD) and amplified fragment length polymorphisms (AFLPs),
have been published about the identification of male-associated
genetic markers [11–15]. A study by Mandolino et al. [16] identi-
fied a 391-bp male-specific RAPD band. This sex-specific RAPD
marker has been converted into a more reliable sequence-charac-
terized amplified region (SCAR) marker. Oligos specific for that
SCAR were used in the present study to distinguish between
male and female C. sativa plants at the juvenile stage.
The NaOH‑HCl and CTAB methods were used to extract DNA
from Cannabis samples. Some of the DNA samples extracted with
as a template. In contrast, the DNA extracted with the CTAB
Downloaded by: National University of Singapore. Copyrighted material.
method resulted in significantly better and reproducible PCR
products independent of the type of DNA solution (undiluted or
diluted) used. Therefore, the CTAB method was used for DNA ex-
traction in the present study. Twenty-eight samples collected
from the different varieties (Terbag W1, Terbag K2, and Terbag
MX1, eight samples from each variety; and Terbag Fedora A7,
four samples) of C. sativa were used for DNA extraction. Attempts
to use the MADC primers as a marker to identify sex in C. sativa
plants were successful. Amplification of genomic DNA using
MADC2-F and MADC2-R primers produced two distinct frag-
ments, one with a size of approximately 450 bp for female plants
and one for male plants with a size of approximately 300 bp
(l" Fig. 1). After harvesting tissues for the DNA extraction, plants
were subjected to a flowering photoperiod (i.e., 12-h light cycle),
and the appearance of flowers was compared with the DNA anal-
ysis. The results of the molecular analysis were found to be con-
cordant with the appearance of male or female flowers.
In conclusion, the method described in this study represents a
quick molecular genetics procedure for the identification of fe-
male plants of Cannabis sativa at the juvenile stage. Because
DNA is already present at early developmental stages, DNA anal-
ysis can be performed as soon as enough tissue can be removed
from the seedling without causing lethal damage to it. This meth-
od is cost-effective, as it can reduce time, field space, and labor
costs and allows focusing on the desired plants only.
Fig. 1 PCR products derived from plant DNA were ~450 bp (female) or
~300 bp (male).

Materials and Methods
! !
Plants of three drug-type varieties (Terbag W1, Terbag K2, and
Terbag MX) and one fiber-type variety (Terbag Fedora A7) of Can-
nabis sativa were grown through seeds (imported from Terbag
GmbH) in 2-inch jiffy pots containing similar soil (coco natural
growth medium mixed with fertilome potting mix in a 1 : 1 ratio;
Canna Continental) and kept side-by-side under controlled envi-
ronmental conditions (vegetative light cycle, i.e., 18-h photoper-
iod, ~ 700 ± 24 µmol · m−2 · s−1 light at plant canopy level, 25 ± 3 °C,
and 55 ± 5% RH). Indoor light was provided by seven full-spec-
trum 1000-watt high-intensity discharge lamps in combination
with seven 1000-watt high-pressure sodium bulbs (Sun Sys-
tems), hung over the top of the plants and covering an area of
335 square feet. A hot-air suction fan was attached and a distance
of about 3 to 4 feet between the plants and the bulbs was main-
tained to avoid overheating. The plants were later transplanted to
4-inch and eventually to 12-inch pots after sufficient growth. The
vegetative tissue was harvested from two-week-old seedlings
and stored at − 80 °C until further use. The plants were then ex-
posed to a 12-h photoperiod for the induction of flowering to
score for the sex phenotype.
For DNA extraction, centrifugation was carried out at room tem-
perature with an IEC Centra CL3 centrifuge and a horizontal mi-
croplate rotor. A piece of fresh leaf, 3 × 3 mm2 in size, was col-
lected into 0.2-mL PCR tubes and stored at − 80 °C until further
use. For the NaOH‑HCl DNA extraction method, the tissue was
smashed in 100 µL 0.25 M NaOH and boiled for 5 min at 94 °C.
Then, 100 µL of 0.25 M HCL was added and the samples were
boiled for 5 min at 94 °C. The DNA solution was diluted 1 : 10 or
1 : 100 with 10 mM Tris-HCL, and 2 µL of the undiluted or diluted
DNA solution was used as a template in a PCR reaction. For the
CTAB DNA extraction method, the tissue was smashed for 1–2 s
without the addition of buffer. Then, 120 µL extraction buffer
(2% CTAB, 1.4 M NaCl, 20 mM EDTA pH 8.0, 0.2 % 2-mercaptoetha-
nol) and 120 µL chloroform-isoamyl alcohol (24 : 1) were added,
vortexed for 2 s, and incubated at 55 °C for 1 h. After centrifuga-
tion for 10 min at 4000 rpm (1800 × g), 80 µL of the solution was
transferred into a new 0.2-mL PCR tube containing 6.5 µL cold
7.5 M ammonium acetate and 47 µL isopropanol, vortexed for
2 s, and stored at − 20 °C for 15 min. After centrifugation for
10 min at 4000 rpm (1800 × g), the pellet was washed once with
70 % ethanol and once with 96% ethanol. The dry pellet was re-
suspended with 20 µL 10 mM Tris-HCl for 1 h at 55 °C. The DNA
solution was diluted 1 : 10 or 1 : 100, and 2 µL of the undiluted or
diluted DNA solution was used as a template in a PCR reaction.
PCR reactions were performed in 25-µL reactions with 0.2 mM of
each dNTP, 10 pmol of each primer, 1.5 mM MgCl2, and 1 unit
Platinum Taq DNA Polymerase (Invitrogen) in 1× PCR buffer. The
PCR program consisted of one initial denaturing step at 96 °C for
3 min followed by 45 cycles at 96 °C for 30 s, at 50 °C for 30 s, and
at 72 °C for 1 min with a final extension at 72 °C for 7 min. PCR
reaction mixtures were run in an MJ Research PTC-225 Gradient
Cycler. After amplification, each PCR reaction was analyzed by
electrophoresis on 1 % TAE agarose gel and visualized under UV
light. The sizes of the PCR products were compared with the mo-
lecular size standard 1 kb plus DNA ladder (Invitrogen). The
MADC2 marker was used to distinguish between male and fe-
male plants. The corresponding primers used for PCR amplifica-
tion were MADC2-F (GTGACGTAGGTAGAGTTGAA) and MADC2-R
(GTGACGTAGGCTATGAGAG) [16].
Letters 1939
Acknowledgements
This work was supported in part by federal funds from the Na-
tional Institute on Drug Abuse (NIDA), National Institutes of
Health (NIH), Department of Health and Human Services, USA,
under contract No. N01DA-5-7746 and by the United States De-
partment of Agriculture (Agricultural Research Service Specific
Cooperative Agreement No. 58-6408-6-067).
References
1 Abel E. Marihuana: the first 2000 years. New York: Plenum Press; 1990
2 Hammond CT, Mahlberg PG. Morphogenesis of capitate glandular hairs
of Cannabis sativa (Cannabaceae). Am J Bot 1977; 64: 1023–1031
3 Mechoulam R, Ben-Shabat A. From gan-zi-gun-nu to anandamide and
2-arachidonoylglycerol: the ongoing story of Cannabis. Nat Prod Rep
1999; 16: 131–143
4 Mechoulam R. Cannabinoids as therapeutic agents. In: Mechoulam R,
editor. Cannabinoids as therapeutic agents. Boca Raton: CRC Press;
1986: 1
5 Formukong EA, Evans AT, Evans F. The medicinal uses of Cannabis and
its constitutents. J Phytother Res 1989; 3: 219–231
6 Grinspoon L, Bakalar JB. Marihuana, the forbidden medicine. New Ha-
Downloaded by: National University of Singapore. Copyrighted material.
ven: Yale University Press; 1993
7 Mattes RD, Shaw LM, Eding-Owens J, Egelman K, ElSohly MA. Bypassing
the first pass effect for therapeutic use of cannabinoids. Pharmacol Bio-
chem Behav 1993; 44: 745–747
8 Mattes RD, Egelman K, Shaw LM, ElSohly MA. Cannabinoids appetite
stimulation. Pharmacol Biochem Behav 1994; 49: 187
9 Brenneisen R, Egli A, ElSohly MA, Henn V, Spiess Y. The effect of orally and
rectally administered Δ9-tetrahydrocannabinol on spasticity. A pilot
study with two patients. Int J Clin Pharmacol Therap 1996; 34: 446
10 Sirikantaramas S, Taura F, Tanaka Y, Ishikawa Y, Morimoto S, Shoyama
Y. Tetrahydrocannabinolic acid synthase, the enzyme controlling mar-
ijuana psychoactivity is secreted into the storage cavity of the glandu-
lar trichomes. Plant Cell Physiol 2005; 46: 1578–1582
11 Sakamoto K, Shimomura K, Komeda Y, Kamada H, Satoh S. A male-asso-
ciated DNA sequence in a dioecious plant, Cannabis sativa L. Plant Cell
Physiol 1995; 36: 1549–1554
12 Sakamoto K, Abe T, Matsuyama T, Yoshida S, Ohmido N, Fukui K, Satoh S.
RAPD markers encoding retrotransposable elements are linked to the
male sex in Cannabis sativa L. Genome 2005; 48: 931–936
13 Flachowsky H, Schuhmann E, Weber WE, Peil A. Application of AFLP for
the detection of sex-specific markers in hemp. Plant Breed 2001; 120:
305–309
14 Törjék O, Bucherna N, Kiss E, Homoki H, Finta-Korpelová Z, Bócsa I, Nagy
I, Heszky LE. Novel male-specific molecular markers (MADC5, MADC6)
in hemp. Euphytica 2002; 127: 209–218
15 Li M, Yang H, Li F, Yang F, Yin G, Gan S. A male specific SCAR marker in
Calamus simplicifolius, a dioecious rattan species endemic to China.
Mol Breed advance online publication 2009; DOI: 10.1007/s11032-
009-9349-9
16 Mandolino G, Carboni A, Forapani S, Faeti V, Ranalli P. Identification of
DNA markers linked to the male sex in dioecious hemp (Cannabis sa-
tiva L.). Theor Appl Genet 1999; 98: 86–92
received February 25, 2010 revised – accepted April 23, 2010
Bibliography
DOI http://dx.doi.org/10.1055/s-0030-1249978
Published online June 8, 2010
Planta Med 2010; 76: 1938–1939
© Georg Thieme Verlag KG Stuttgart · New York ·
ISSN 0032‑0943
Correspondence
Dr. Natascha Techen, Ph.D
School of Pharmacy
National Center for Natural Products Research
University of Mississippi
University Ave, P. O. Box 8048
University, MS 38677
United States
Phone: + 1 66 29 15 10 10
Fax: + 1 66 29 15 70 62
ntechen@olemiss.edu
Techen N et al. Genetic Identification of … Planta Med 2010; 76: 1938–1939