Jyothish B. Pillai, Madhu Gupta, Senthilkumar B.

Rajamohan, Roberto Lang, Jai

Raman and Mahesh P. Gupta
Am J Physiol Heart Circ Physiol 291:1545-1553, 2006. First published Apr 21, 2006;
doi:10.1152/ajpheart.01124.2005

You might find this additional information useful...

This article cites 35 articles, 21 of which you can access free at:
http://ajpheart.physiology.org/cgi/content/full/291/4/H1545#BIBL

This article has been cited by 3 other HighWire hosted articles:

PARP-1 suppresses adiponectin expression through poly(ADP-ribosyl)ation of
PPAR{gamma} in cardiac fibroblasts
D. Huang, C. Yang, Y. Wang, Y. Liao and K. Huang
Cardiovasc Res, January 1, 2009; 81 (1): 98-107.
[Abstract] [Full Text] [PDF]

Metallothionein Suppresses Angiotensin II-Induced Nicotinamide Adenine Dinucleotide

Phosphate Oxidase Activation, Nitrosative Stress, Apoptosis, and Pathological Remodeling
in the Diabetic Heart
G. Zhou, X. Li, D. W. Hein, X. Xiang, J. P. Marshall, S. D. Prabhu and L. Cai

Downloaded from ajpheart.physiology.org on March 16, 2009

J. Am. Coll. Cardiol., August 19, 2008; 52 (8): 655-666.
[Abstract] [Full Text] [PDF]

Mice expressing ACE only in the heart show that increased cardiac angiotensin II is not
associated with cardiac hypertrophy
H. D. Xiao, S. Fuchs, E. A. Bernstein, P. Li, D. J. Campbell and K. E. Bernstein
Am J Physiol Heart Circ Physiol, February 1, 2008; 294 (2): H659-H667.
[Abstract] [Full Text] [PDF]

Updated information and services including high-resolution figures, can be found at:
http://ajpheart.physiology.org/cgi/content/full/291/4/H1545

Additional material and information about AJP - Heart and Circulatory Physiology can be found at:
http://www.the-aps.org/publications/ajpheart

This information is current as of March 16, 2009 .

AJP - Heart and Circulatory Physiology publishes original investigations on the physiology of the heart, blood vessels, and
lymphatics, including experimental and theoretical studies of cardiovascular function at all levels of organization ranging from the
intact animal to the cellular, subcellular, and molecular levels. It is published 12 times a year (monthly) by the American
Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright © 2005 by the American Physiological Society.
ISSN: 0363-6135, ESSN: 1522-1539. Visit our website at http://www.the-aps.org/.

Poly(ADP-ribose) polymerase-1-deficient mice are protected from angiotensin
II-induced cardiac hypertrophy
Jyothish B. Pillai,1 Madhu Gupta,4 Senthilkumar B. Rajamohan,1
Roberto Lang,2 Jai Raman,1 and Mahesh P. Gupta1,3
Departments of 1Surgery and 2Cardiology, and 3Committee on Molecular Medicine and Pathology, The University
of Chicago, Chicago, Illinois; and 4The Heart Institute of Children, Hope Children Hospital, Oak Lawn, Illinois
Submitted 24 October 2005; accepted in final form 12 April 2006
Pillai, Jyothish B., Madhu Gupta, Senthilkumar B. Rajamo-
han, Roberto Lang, Jai Raman, and Mahesh P. Gupta. Poly-
(ADP-ribose) polymerase-1-deficient mice are protected from an-
giotensin II-induced cardiac hypertrophy. Am J Physiol Heart Circ
Physiol 291: H1545–H1553, 2006. First published April 21, 2006;
doi:10.1152/ajpheart.01124.2005.—Poly(ADP-ribose) polymer-
ase-1 (PARP), a chromatin-bound enzyme, is activated by cell
oxidative stress. Because oxidative stress is also considered a main
component of angiotensin II-mediated cell signaling, it was pos-
tulated that PARP could be a downstream target of angiotensin
II-induced signaling leading to cardiac hypertrophy. To determine
a role of PARP in angiotensin II-induced hypertrophy, we infused
angiotensin II into wild-type (PARP⫹/⫹) and PARP-deficient mice.
Angiotensin II infusion significantly increased heart weight-to-
tibia length ratio, myocyte cross-sectional area, and interstitial
fibrosis in PARP⫹/⫹ but not in PARP⫺/⫺ mice. To confirm these
results, we analyzed the effect of angiotensin II in primary cultures
of cardiomyocytes. When compared with PARP⫺/⫺ cardiomyo-
cytes, angiotensin II (1 ␮M) treatment significantly increased
protein synthesis in PARP⫹/⫹ myocytes, as measured by 3H-
leucine incorporation into total cell protein. Angiotensin II-medi-
ated hypertrophy of myocytes was accompanied with increased
poly-ADP-ribosylation of nuclear proteins and depletion of cellu-
lar NAD content. When cells were treated with cell death-inducing
doses of angiotensin II (10 –20 ␮M), robust myocyte cell death was
observed in PARP⫹/⫹ but not in PARP⫺/⫺ myocytes. This type of
cell death was blocked by repletion of cellular NAD levels as well
as by activation of the longevity factor Sir2␣ deacetylase, indicat-
ing that PARP induction and subsequent depletion of NAD levels
are the sequence of events causing angiotensin II-mediated cardi-
omyocyte cell death. In conclusion, these results demonstrate that
PARP is a nuclear integrator of angiotensin II-mediated cell
signaling contributing to cardiac hypertrophy and suggest that this
could be a novel therapeutic target for the management of heart
failure.
heart failure; oxidative-stress signaling
IN SETTINGS OF sustained hemodynamic overload, myocardium
undergoes a growth response, termed as cardiac hypertrophy.
This process is characterized by an increase in myocyte cell
size and alterations in expression of contractile and Ca2⫹-
handling proteins. Cardiac hypertrophy initially develops as an
adaptive response; however, if remained unchecked, this even-
tually progresses to ventricular dilation and pump dysfunction
(12). At the biochemical level, many hypertrophy agonists
have been identified; among them, angiotensin II has been
Address for reprint requests and other correspondence: M. P. Gupta, Dept.
of Surgery, MC 5040, Univ. of Chicago, 5841 S. Maryland Ave., Chicago, IL
60637 (e-mail: mgupta@surgery.bsd.uchicago.edu).
http://www.ajpheart.org 0363-6135/06 $8.00 Copyright © 2006 the American Physiological Society
Am J Physiol Heart Circ Physiol 291: H1545–H1553, 2006.
First published April 21, 2006; doi:10.1152/ajpheart.01124.2005.
established as a most potent stimulator of cardiac hypertro-
phy. Multiple signaling pathways that regulate angiotensin
II-mediated cardiac hypertrophy response have been also
identified; these include activation of PKC, MAPKs, and the
production of reactive oxygen and nitrogen species (30).
However, the downstream targets and nuclear integrators of
angiotensin II-mediated cardiac growth response are not yet
Downloaded from ajpheart.physiology.org on March 16, 2009
understood.
Poly(ADP-ribose) polymerase-1 (PARP) is a (113 kDa)
multifunctional chromatin bound enzyme of the PARP family
of proteins. PARP catalyzes the transfer of multiple units of the
ADP-ribose moiety from NAD to the target proteins, a process
called poly-ADP-ribosylation (4, 18). PARP is activated by
DNA single-strand break as well as by production of oxygen
and nitrogen-derived free radicals and nuclear accumulation of
Ca2⫹ and Mg2⫹ ions (4, 17). In physiological conditions, mild
PARP activation regulates many cellular processes, including
DNA repair, gene transcription, cell-cycle progression, cy-
toskeleton organization, cell survival, and chromatin remodel-
ing (4, 18, 20). However, overactivation of PARP threatens cell
survival as it consumes cellular NAD content to add extended
chains of ADP-ribose moieties on the target proteins (4, 18).
Because NAD is essential for many crucial cell processes,
including energy metabolism, intracellular Ca2⫹ regulation,
and the activity of class-III histone deacetylases (also called
sirtuins or Sir2), depletion of NAD rapidly leads to functional
deficit and eventually to cell death (7a, 23). Overactivation of
PARP was implicated in various pathological conditions asso-
ciated with oxidative cell stress, including inflammation, dia-
betes mellitus, circulatory shock, stroke, and reperfusion injury
of many organs, including heart, brain, and kidney (reviewed
in Refs. 18 and 21). Data obtained from using PARP inhibitors
have also documented a role of PARP activation in the devel-
opment and progression of pressure-overload cardiac hypertro-
phy and heart failure (32).
Here we report that PARP is activated during angiotensin
II-induced cardiomyocyte hypertrophy, and mice deficient in
the PARP gene are protected from angiotensin II-mediated
hypertrophy. We also show that NAD depletion, which results
from PARP overactivation, contributes to angiotensin II-medi-
ated cardiac myocyte cell death. This type of cell death was
prevented by NAD repletion and activation of the longevity
factor Sir2␣ (3). These results demonstrate that PARP is a
downstream nuclear target of angiotensin II-induced signaling
pathway, contributing to cardiac hypertrophy and failure.
The costs of publication of this article were defrayed in part by the payment
of page charges. The article must therefore be hereby marked “advertisement”
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
H1545
H1546 HYPERTROPHY RESPONSE OF PARP⫺/⫺ MICE TO ANGIOTENSIN II
METHODS
Mice. PARP ⫺/⫺
mice (C57BL/6 ⫻ 129 background) were pur-
chased from Jackson Laboratories. Cardiac hypertrophy and failure
was induced in adult (8 wk old) wild-type (PARP⫹/⫹) and PARP⫺/⫺
mice of similar genetic background, by chronic infusion of angioten-
sin II (Sigma) at a subpressure dose of 0.3 mg 䡠 kg⫺1 䡠 day⫺1 for 14
days by using Alzet osmotic minipumps (Alzet model 1002). Pumps
were removed before echocardiographic measurements. All experi-
mental protocols were approved by the University of Chicago’s
Animal Care and Use Committee.
Assessment of cardiac hypertrophy. Mice were euthanized, and
body weight, heart weight, and tibia length were recorded. Some
hearts were fixed and cryosectioned (5 ␮m) for morphometric anal-
yses. To determine myofibrillar organization, sections were immuno-
stained with anti-␣-actinin primary antibody (A-7811) and anti-mouse
IgG FITC (F-2012) as secondary antibody (Sigma). For measurement
of interstitial fibrosis, sections were stained with Masson trichrome
stain. Collagen content was quantified by assessing the blue pixel
content in a computer-assisted image analysis program. Myocyte cell
size (⬎100 cells/section) was measured from transverse section
stained with wheat germ agglutinin (100 ␮g/ml) coupled to tetra-
methylrhodamine isothiocyanate (Sigma) by using a digital image
analyzer program.
Cell culture and transfection. Primary cultures of cardiac myocytes
were obtained from 1-day-old mouse neonatal pups according to the
procedure described previously (8). Briefly, hearts were quickly
excised, atria were removed, and the ventricles were collected in
ice-cold Ca2⫹ and Mg2⫹-free HBSS, pH 7.4. Ventricles were minced
and digested in trypsin solution that was made in HBSS (0.1%) at
37°C for 8 min. Trypsin was then inactivated with an equal volume of
FBS, and cells were collected by centrifugation. The first digested
cells were discarded. The remaining tissue was digested for four more
cycles, and the cells that were collected from each cycle were
suspended in MEM supplemented with 10% FBS and 5 mg/ml
penicillin-streptomycin (Invitrogen). Cell suspension was filtered and
centrifuged, and cell pellet was suspended in MEM. Fibroblasts were
removed by preplating twice for 45 min each, and myocytes were
further purified by Percoll density gradient. Finally, myocytes were
collected by centrifugation, counted, and plated in laminin-coated
culture dishes. Cells were grown in MEM (Invitrogen) for 48 h and
then treated and/or transfected by using TfX-TM-20 reagent (Pro-
mega). Typically, 1 ⫻ 105 cells were transfected with 1.0 ␮g of
plasmid expressing NAD-biosynthetic enzyme nicotinamide phospho-
ribosyl-transferase (NAMPT) or Sir2␣ deacetylase. Resveratrol and
NAD were purchased from Sigma; small interfering RNA (siRNA)-
mediated silencing of Sir2␣ was carried out by transient transfection
of pSUPER RNAi system (VEC-PBS-0003/0004) with the incorpo-
ration of 20 nucleotides of Sir2␣ (gaagttgacctcctcattgt).
Western and Northern blot analyses. Western blot analysis was
performed according to standard procedures using rabbit anti-Sir2␣
antibody (Upstate) and anti-polyADP-ribose antibody (Alexis Bio-
chemicals). For RNA analysis, total heart RNA was analyzed by
Northern blot analysis using gene-specific probes as described previ-
ously (24). For quantification purposes, autoradiograms were scanned
using Scion Image Windows analysis software based on NIH Image
for Macintosh by Wayne Rasband. Signal density was adjusted for
background density of the blot and calculated as percent change from
vehicle-treated controls.
Measurement of cell death. Myocytes were stained with two DNA
binding dyes (Molecular Probes): Hoechst 33342, which is permeable
to cell membrane and stains both live and dead cells blue, and
propidium iodide, which is impermeable to intact cell membrane and
stains dead cells red. For cell death measurements, adherent cells and
detached cells were processed separately. Briefly, myocytes were
trypsinized and collected by centrifugation. A single cell suspension
of myocytes was prepared in PBS and stained with both Hoechst
AJP-Heart Circ Physiol • VOL
33342 and propidium iodide dyes for 5 min. Cells that detached from
the plate were collected and included in the analysis. Cells were
washed twice and resuspended in PBS and analyzed by fluorescence-
activated cell sorting (FACS) analysis.
[3H]Leucine incorporation. Immediately after treatment of cardi-
omyocytes with angiotensin II, cells were incubated with [3H]leucine
(1.0 mCi/ml, 167 Ci/mmol Specific activity, Amersham Biosciences)
in leucine-free MEM medium (Invitrogen) for 72 h. To precipitate
proteins, cells were washed with PBS and then incubated in 10%
trichloroacetic acid. The resultant pellet was solublized in NaOH
(0.25 N), and the lysate was diluted with one-sixth volume of
scintillation fluid and counted in a scintillation counter. Values were
normalized with DNA content, which was measured by using
Quant-iT picogreen dsDNA assay kit (Invitrogen).
NAD estimation. The concentration of NAD was measured as
described previously (35) with slight modifications. The samples
(myocyte cultures or 50 g frozen crushed tissue) were resuspended in
200 ␮l of 0.5 M perchloric acid. Cell extracts were neutralized with
equal volume of 1 M KOH and 0.33 M KH2PO4/K2HPO4 (pH 7.5),
centrifuged to remove the KClO4 precipitate, and the supernatant was
collected. To 200 ␮l of NAD reaction mixture (600 mM ethanol, 0.5
Downloaded from ajpheart.physiology.org on March 16, 2009
mM 3-[4,5 dimethylthiazol-2-yl]-2,5 diphenyltetrazolium bromide, 2
mM phenazine ethosulfate, 5 mM EDTA, 1 mg/ml BSA, and 120 mM
bicine at pH 7.8), 50 ␮l of supernatant or NAD standard were added
and incubated for 5 min at 37°C. Twenty-five microliters of alcohol
dehydrogenase (0.5 mg/ml in 100 mM bicine at pH 7.8) were added
to the reaction mix and incubated for an additional 20 min at 37°C.
The reaction was stopped by adding 250 ␮l of 12 mM iodoacetate, and
the optical density was read at 570-nm wavelength. A standard curve
was generated from known concentrations of NAD and used to
calculate the concentration of NAD in each sample.
PARP assay. PARP activity of cardiac myocyte cultures treated
with different hypertrophy agaonists was measured using Universal
colorimetric PARP assay kit (4672– 096K, Trevigen), according to the
manufacturer’s protocol. Briefly, the PARP enzyme activity of each
sample (cell lysate) was estimated based on the incorporation of
biotinylated poly-ADP-ribose units onto histone proteins coated in a
96-well plate that was provided with the kit. The values were calcu-
lated from a standard curve generated by using known amounts of
PARP enzyme and normalized to the protein content.
RESULTS
PARP-deficient mice failed to produce angiotensin II-medi-
ated hypertrophy response. To determine the role of PARP in
angiotensin II-mediated cardiac hypertrophy, we chronically
infused angotensin II into control (PARP⫹/⫹) and PARP-
deficient (PARP⫺/⫺) mice (C57BL/6 ⫻ 129 background).
PARP knockout mice, in general, were smaller in size and had
slightly higher heart weight-to-tibia length ratio and a little
larger cross-sectional area of ventricular myocytes compared
with age-matched control mice (Fig. 1, A and E). Angiotensin
II infusion in control mice produced a marked increase in heart
size, heart weight-to-tibia length ratio, and left ventricular mass
and wall thickness (Table 1). The left ventricular end-diastolic
and end-systolic dimensions were also significantly increased
in control mice (Table 1), reflecting signs of ventricular dila-
tation. Angiotensin II-infused PARP⫺/⫺ mice did not produce
a significant amount of cardiac hypertrophy, and also no signs
of ventricular dilation were observed (Table 1). Consistent
with these observations, the cross-sectional area of ventricular
myocytes was significantly increased in control mice but not in
PARP-deficient mice, thus confirming impaired hypertrophy
response in PARP⫺/⫺ mice. Angiotensin II-mediated cardiac
hypertrophy is known to be associated with typical induction of
291 • OCTOBER 2006 • www.ajpheart.org
 HYPERTROPHY RESPONSE OF PARP⫺/⫺ MICE TO ANGIOTENSIN II H1547

Downloaded from ajpheart.physiology.org on March 16, 2009

Fig. 1. Cardiac hypertrophy response of poly(ADP-ribose) polymerase (PARP⫹/⫹) and PARP⫺/⫺ mice to ANG II infusion. A: quantification of heart
weight-to-tibia length ratio (HW/TL) in vehicle and ANG II-treated mice (n ⫽ 12/group; *P ⬍ 0.01). B: percent change in HW/TL (*P ⬍ 0.001). C:
quantification of cardiac hypertrophy marker mRNA transcripts in PARP⫹/⫹ and PARP⫺/⫺ mice (n ⫽ 3 for each gene; *P ⬍ 0.001). D: representative heart
sections (⫻200) stained with wheat germ agglutinin coupled with tetramethylrhodamine isothiocynate to demarcate cell boundaries. E: quantification of
cardiomyocyte size based on cross-sectional area in vehicle and ANG II-treated mice (n ⫽ 4 in each group, with 5 sections from each heart; *P ⬍ 0.05). NS,
not significant. Values are means ⫾ SE.

the fetal gene program. We therefore measured mRNA levels
of hypertrophy marker genes in PARP⫹/⫹ and PARP⫺/⫺ mice
after infusion of angiotensin II for 2 wk. As shown in Fig. 1C,
expression levels of atrial natriuretic factor and ␤-myosin
heavy chain (MHC) mRNA was increased, and ␣-MHC
mRNA was significantly reduced in control mice. The expres-
sion profile of these genes, however, was not significantly
altered in PARP-deficient mice, thus indicating a loss of the
typical angiotensin II-mediated hypertrophy response in
PARP⫺/⫺ mice.

Table 1. Echocardiographic parameters in PARP⫹/⫹ and PARP⫺/⫺ mice after ANG II infusion for 2 wk
PARP⫹/⫹ PARP⫺/⫺

Vehicle ANG II Vehicle ANG II

HR, beats/min 462⫾15.5 545⫾14.6 353⫾12.5 276⫾13.3

LVEDD, mm 4.1⫾0.11 4.46⫾0.12* 3.7⫾0.11† 3.45⫾0.12
LVESD, mm 2.7⫾0.09 3.6⫾0.07* 1.9⫾0.06† 1.55⫾0.07
LVPWD, mm 0.7⫾0.012 0.8⫾0.012* 0.7⫾0.008 0.69⫾0.014
ES, % 46.3⫾1.2 29.4⫾1.3* 48.9⫾1.8 55.2⫾2.5
PAV, cm/s 144⫾5.5 117⫾3.2* 103⫾4.4† 101⫾5.8
CO, ml/min 51.7⫾1.5 36.46⫾1.9* 40.3⫾2.2† 32.2⫾2.4
LVM, mg 105⫾2.9 135⫾2.5* 80⫾1.5† 87⫾2.0
BW, gm 30⫾2.6 32⫾1.2 24⫾1.4 27⫾1.6
LVM/BW, mg/g 3.5⫾0.15 4.2⫾0.12* 3.8⫾0.11 3.7⫾0.17
Values are means ⫾ SE; n ⫽ 7 mice/group. HR, heart rate; LVEDD, left ventricle end-diastolic diameter; LVESD, left ventricle end-systolic diameter;
LVPWD, left ventricle posterior wall thickness; FS, fractional shortening; PAV, peak aortic velocity; CO, cardiac output; LVM, left ventricular mass; BW, body
weight. *P ⬍ 0.01 ANG II-treated group compared with respective vehicle-treated animals. †P ⬍ 0.01 poly(ADP-ribose)polymerase (PARP⫺/⫺) mice compared
with vehicle-treated PARP⫹/⫹ animals.

AJP-Heart Circ Physiol • VOL 291 • OCTOBER 2006 • www.ajpheart.org

H1548 HYPERTROPHY RESPONSE OF PARP⫺/⫺ MICE TO ANGIOTENSIN II
Angiotensin infusion produces markedly reduced fibrosis in
PARP⫺/⫺ mice. Impaired cardiac functions of a hypertrophied
heart and progression to cardiomyopathy are accompanied with
disorganization of myocytes and increased interstitial fibrosis.
We, therefore, performed histological analysis to examine
cardiac remodeling response. Heart sections of control and
PARP⫺/⫺ mice were stained with ␣-actinin antibody and
Masson trichrome dye to visualize the organization of myofi-
bers and collagen content, respectively. As shown in Fig. 2, A
and B, in control hearts (PARP⫹/⫹), angiotensin II infusion
resulted in a disorganization of myofibers and increased car-
diac fibrosis. Quantification of interstitial fibrosis showed a
marked increase in collagen deposition in hearts of angiotensin
II-infused PARP⫹/⫹ mice. Contrary to this, in PARP⫺/⫺ mice,
no significant change in cardiac fibrosis or alteration in myo-
fibers organization was observed. These data indicated that the
cardiac remodeling response of angiotensin II is, in part,
contributed to by the presence of the intact PARP gene.
Angiotensin II infusion depletes cardiac NAD content of
PARP⫹/⫹ but not PARP⫺/⫺ mice. To demonstrate whether
cardiac remodeling response of angiotensin II was indeed
contributed to by the activation of the PARP gene, we mea-
sured poly-ADP-ribosylation of nuclear proteins. Cardiac nu-
clear extract of angiotensin II-infused PARP⫹/⫹ and PARP⫺/⫺
mice was analyzed by Western blot analysis using anti-(ADP-
ribose) antibody. As shown in Fig. 3A, poly-ADP-ribosylation
of cardiac nuclear proteins was increased in angiotensin II-
infused PARP⫹/⫹ mice but not in PARP knockout mice,
compared with vehicle-treated controls, suggesting that PARP
is a target of angiotensin II-mediated signaling contributing to
cardiac hypertrophy and failure.
PARP activation induces poly-ADP-ribosylation of proteins
by transferring multiple ADP-ribose moieties from NAD to the
target protein. This process consumes cellular NAD levels.
Therefore, a substantial drop in cellular NAD content is also
taken as a sign of PARP activation (18). To determine whether
cellular NAD levels were altered after stimulation of hearts
with angiotensin II, we measured total heart NAD content. As
Fig. 2. Effect of ANG-II treatment on myo-
fibrillar organization and interstitial fibrosis
in PARP⫹/⫹ and PARP⫺/⫺ mice. A: repre-
sentative heart section (⫻200) immuno-
stained with ␣-actinin antibody and pro-
pidium iodide dye to visualize sarcomeres
and cell nuclei, respectively. B: interstitial
fibrosis was quantified from heart sections
(⫻100) stained with Masson’s trichrome
stain. Data presented as percent change of
collagen in ANG-II-treated wild-type
(PARP⫹/⫹) and PARP⫺/⫺ mice (n ⫽ 5, P ⬍
0.01).
AJP-Heart Circ Physiol • VOL
shown in Fig. 3B, cardiac NAD content reduced significantly
(30%) in angiotensin II-infused control (PARP⫹/⫹) mice but
not in mice lacking PARP gene. To further confirm these
results, we measured NAD content of primary cultures of
cardiac myocytes obtained from PARP⫹/⫹ and PARP⫺/⫺ mice.
Angiotensin II treatment significantly reduced the NAD con-
tent of PARP⫹/⫹ cardiomyocytes in a time-dependent manner.
Maximum decline of NAD content was observed at 48 h after
angiotensin II treatment, when nearly 40% of cellular NAD
content was lost. In contrast, in PARP⫺/⫺ cardiomyocytes, no
significant decrease of NAD content was observed due to
angiotensin II treatment (Fig. 3C). These results together dem-
onstrated that in control (wild-type) cells, angiotensin II treat-
ment activates PARP, which in turn decreases cellular NAD
levels.
Evolution and progression of cardiac hypertrophy are ac-
companied with increased protein synthesis and loss of myo-
cyte survivability. We therefore determined the effect of an-
Downloaded from ajpheart.physiology.org on March 16, 2009
giotensin II on protein synthesis by measuring incorporation of
[3H]leucine into total cell protein. PARP⫹/⫹ and PARP⫺/⫺
myocytes were treated with a hypertrophy dose of angiotensin
II (1 ␮M) and labeled with [3H]leucine for 72 h. Afterward,
cells were harvested, total cell protein was precipitated, and the
incorporation of [3H]leucine was measured. As shown in Fig.
4A, when compared with the vehicle-treated cells, [3H]leucine
incorporation was significantly higher in PARP⫹/⫹ myocytes
after angiotensin II treatment but not in cardiomyocytes defi-
cient of the PARP gene. We next measured the impact of
angiotensin II treatment on myocyte cell survivability by treat-
ing cells with higher doses of angiotensin II (10 and 20 ␮M).
After 48 h of treatment, cells were stained with Hoechst and
propidium iodide dyes, and cell death was determined by
FACS analysis. As shown in Fig. 4B, angiotensin II treatment
induced a significant amount (30%) of cell death of PARP⫹/⫹
myocytes, as expected. However, no significant cell death of
PARP⫺/⫺ myocytes was observed after angiotensin II treat-
ment. These results indicated that angiotensin II-mediated
291 • OCTOBER 2006 • www.ajpheart.org
 HYPERTROPHY RESPONSE OF PARP⫺/⫺ MICE TO ANGIOTENSIN II H1549

Fig. 3. ANG II treatment increases PARP

activity in wild-type mice hearts, as mea-
sured by protein poly-ADP-ribosylation and
depletion of cellular NAD content. A: car-
diac nuclear extract of PARP⫹/⫹ and
PARP⫺/⫺ mice treated with vehicle (V) or
ANG II was analyzed by Western blot anal-
ysis using anti-poly(ADP-ribose) antibody.
Blots shown are representative of 4 experi-
ments. B: NAD content of the whole heart
cell lysate prepared from vehicle and ANG
II-treated PARP⫹/⫹ and PARP⫺/⫺ mice
(n ⫽ 4, *P ⬍ 0.05). C: primary cultures of
cardiac myocytes obtained from PARP⫹/⫹
and PARP⫺/⫺ mice were treated with 1 ␮M
of ANG II. At different time points of treat-
ment, cells were harvested, and NAD con-

Downloaded from ajpheart.physiology.org on March 16, 2009

tent was measured and presented as percent
change from untreated control (n ⫽ 3 at each
time point; *P ⬍ 0.05).

cardiac hypertrophy response and cell death were, in part, this, we treated cardiac myocytes with a hypertrophy dose of
attributed to PARP activation. different agonists, viz. isoproterenol, phenylephrine, and an-
We next asked whether PARP activation is a common target giotensin II. Forty-eight hours after treatment, cultures in
of different agonists producing cardiac hypertrophy. To test which cell hypertrophy was apparent under the microscope

Fig. 4. PARP⫺/⫺ cardiac myocytes are protected from ANG II-mediated hypertrophy and cell death. A: cardiomyocytes cultures prepared from PARP⫹/⫹ and
PARP⫺/⫺ mice were treated with ANG II (1 ␮M) and labeled with [3H]leucine. Seventy-two hours after treatment, cells were harvested and [3H]leucine
incorporation into total cell protein measured (n ⫽ 4 plates in each group; *P ⬍ 0.05). B: cardiac myocytes were treated with 10 or 20 ␮M of ANG II. Forty-eight
hours after treatment, cell death was measured by fluorescence-activated cell sorting analysis (n ⫽ 10 plates for each group; *P ⬍ 0.001). C: PARP⫹/⫹ myocytes
were treated with different hypertrophy agonists: isoproterenol (Iso), phenylephrine (Phe), and ANG II. For a positive control of PARP activation, cells were
treated with a free-radical generating mixture of H2O2 plus FeSO4 (0.1 mM each). Forty-eight hours after treatment, cells were harvested, and PARP activation
was measured using a PARP assay kit (see METHODS). Values are means ⫾ SE of 4 to 6 experiments.

AJP-Heart Circ Physiol • VOL 291 • OCTOBER 2006 • www.ajpheart.org

H1550 HYPERTROPHY RESPONSE OF PARP⫺/⫺ MICE TO ANGIOTENSIN II

Fig. 5. NAD repletion and activation of Sir2␣ protect

PARP⫹/⫹ cardiomyocytes from ANG II-mediated cell
death. A: quantification of ANG II-mediated cell death
in different treatment groups, viz. cells overexpressing
NAD-biosynthetic enzyme nicotinamide phosphoribo-
syl-transferase (NAMPT), cells treated with 500 nM
resveratrol (Res), cells overexpressing Sir2␣, or res-
veratrol-treated (500 nM) cells in which Sir2␣ was
knocked out by small interfering RNA (siRNA). Open
bars, no ANG II treatment; gray bars, cells treated with
two different doses (10 and 20 ␮M) of ANG II for 48 h
(n ⫽ 5 experiments, *P ⬍ 0.05). Values are means ⫾

Downloaded from ajpheart.physiology.org on March 16, 2009

SE. B: NAD levels were determined in cells overex-
pressing NAMPT and/or treated with ANG II (20 ␮M).
Values are means ⫾ SE of 4 experiments. C: knock-
down of Sir2␣ expression by siRNA and overexpres-
sion by cell transfection was confirmed by Western blot
analysis using Sir2-specific antibody. Non-sp, nonspe-
cific reference band; Cont, control.

were harvested, and cell lysates were analyzed for the activity
of poly-ADP-ribosylated proteins. Cells treated with a free
radical-generating mixture of H2O2 and FeSO4 (0.1 mM each)
were used as positive control. As shown in Fig. 4C, all three
agonists stimulated PARP but with different degree of stimu-
lation. Highest PARP stimulation was observed with angioten-
sin II, followed by phenylephrine and then isoproterenol treat-
ment. Angiotensin II-mediated stimulation of PARP activity
was comparable with that achieved from cells treated with free
radical-generating mixture of H2O2 and FeSO4. These results
indicated that PARP activation could be a common down-
stream mechanism of different stimuli inducing hypertrophy,
and it plays a predominant role in angiotensin II-mediated
cardiac hypertrophy.
NAD repletion and Sir2␣ activation protects cardiac myo-
cytes from angiotensin II-mediated cell death. Having known
that angiotensin II-mediated hypertrophy and cell death are
associated with PARP activation and subsequent depletion of
cellular NAD content, we next asked whether repletion of
cellular NAD content could provide cell protection. To replen-
ish cellular NAD content, we transfected cells with a NAD
biosynthetic enzyme NAMPT. Overexpression of this enzyme
increases cellular NAD content (25). To examine the effect of
this enzyme, PARP⫹/⫹ myocytes were transfected with the
NAMPT-expressing plasmid, and on the next day after trans-
fection, cells were treated with angiotensin II (10 and 20 ␮M),
and cell death was determined 48 h later. As shown in Fig. 5,
AJP-Heart Circ Physiol • VOL
overexpression of NAD biosynthetic enzyme completely pro-
tected cells against angiotensin II-mediated cell death. In these
experiments, we also measured cellular NAD content, and the
results indicated that cellular NAD levels were in indeed
replenished by overexpression of the NAD biosynthetic en-
zyme NAMPT (Fig. 5B). These data strongly indicated that
some of the detrimental effects (if not all) of angiotensin II in
PARP⫹/⫹ myocytes were contributed by PARP activation and
NAD depletion.
Previous studies (3) have demonstrated that NAD is essen-
tial for the activity of the longevity factor Sir2␣ deacetylase.
We therefore reasoned whether NAD depletion might have
resulted in the reduced activity of Sir2␣, and that, in fact, leads
to cell death. To test this possibility, we treated PARP⫹/⫹
myocytes with a Sir2␣ activator resveratrol before the addition
of angiotensin II. As shown in Fig. 5, resveratrol pretreatment
markedly reduced angiotensin II-mediated cell death. Resvera-
trol has been shown to have both antioxidant and Sir2␣
deacetylase-inducing activities (19). To determine which ac-
tivity of resveratrol was effective in providing cell protection,
we examined the effect of resveratrol in cells where Sir2␣
levels were knocked down by siRNA. We found that reducing
the Sir2␣ levels eliminated the protective effect of resveratrol,
thus indicating that the beneficial effect of resveratrol was
indeed attributed to Sir2␣ activation. To further confirm these
results, we also examined the direct effect of Sir2␣ overex-
pression on survivability of PARP⫹/⫹ myocytes against angio-
291 • OCTOBER 2006 • www.ajpheart.org
 HYPERTROPHY RESPONSE OF PARP⫺/⫺ MICE TO ANGIOTENSIN II
tensin II-induced cell death. As shown in Fig. 5, angiotensin
II-mediated cell death was drastically reduced in cells overex-
pressing Sir2␣ deacetylase. These results, together, demon-
strated that PARP activation and subsequent depletion of NAD
and the change in activity of Sir2␣ are the sequence of events
contributing to the angiotensin II-mediated cardiac hypertro-
phy and cell death.
DISCUSSION
PARP is known to be activated by cell oxidative stress (18).
In this study we show that PARP is also involved in direct
cardiac hypertrophy response of angiotensin II. A marked
attenuation of angiotensin II-induced cardiac hypertrophy was
demonstrated in PARP knockout mice by measuring various
hypertrophy markers, including heart-to-tibia length ratio,
chamber dilation, myocyte cell size, interstitial fibrosis, and
expression of the fetal gene program. Results obtained from
cultures of cardiac myocytes demonstrated that PARP⫺/⫺
myocytes were protected from angiotensin II-dependent cell
death. We also document a downstream mechanism of PARP
activation contributing to myocyte cell death and show that this
type of cell death could be prevented by activation of the
longevity factor Sir2␣ deactylase. These data provide the first
in vivo evidence that PARP is a target of angiotensin II-
mediated cell signaling contributing to cardiac hypertrophy,
and the data support many previous reports where a beneficial
effect of PARP inhibitors was noticed in different experimental
models of heart failure (32).
Angiotensin II is an established neurohumoral factor that
induces cardiac hypertrophy. Multiple signal transduction
pathways have been demonstrated that converge the hypertro-
phy response of angiotensin II in cardiac myocytes. Recent
reports have indicated that increased oxidative/nitrosative
stress is the major component of angiotensin II-mediated cell
signaling contributing to hypertrophy of different cell types. In
vascular smooth muscle cells, endothelial cells as well as in
cardiac myocytes angiotensin II have been shown to activate
membrane-bound NADPH oxidases, leading to increased pro-
duction of reactive oxygen and nitrogen species (2, 29). The
downstream mechanism of angiotensin II-mediated reactive
oxygen/nitrogen species production in cardiac myocytes is,
however, not known (until this study). In the present study,
mice were infused with a subpressor dose of angiotensin II.
This dose of angiotensin II produced nearly 25% cardiac
hypertrophy, which is associated with increased poly-ADP-
ribosylation of proteins. Consistent with this finding, a recent
report (2) has indicated that the same dose of angiotensin II,
which is used here, activates myocardial NADPH oxidase
activity, and the knocking down of NADPH-oxidase activity
attenuates hypertrophy response of angiotensin II in mice, thus
implicating that the dose used in this study was sufficient to
induce production of reactive oxygen and nitrogen species. In
addition, there is evidence showing that angiotensin II stimu-
lation of cardiomyocytes causes DNA damage (14), which is
another profound stimulus of PARP activation. Our data pre-
sented here extend these previously reported intracellular cas-
cades of angiotensin II pathway and document that PARP is a
downstream nuclear target of angiotensin II-mediated signal-
ing, leading to myocardial hypertrophy. These results are in
agreement with a recent report (27) where angiotensin II
AJP-Heart Circ Physiol • VOL
H1551
stimulation was shown to trigger PARP activation in cultured
endothelial cells and chronic infusion of angiotensin in mice
induced endothelial dysfunction, which was associated with
free radical production.
One of the important features of cardiac hypertrophy and
remodeling is the accumulation of interstitial collagen. Previ-
ously, overexpression of angiotensin receptor 1 in mice has
been shown to cause a significant increase of collagen depo-
sition in the myocardium (22). Interestingly, the marked in-
crease in interstitial collagen content observed with angiotensin
II infusion in wild-type mice was completely eliminated in
PARP knockout mice, indicating that PARP activation might
be the part of the process involved in the induction of collagen
synthesis. This is consistent with previous reports (24, 32)
where attenuation of interstitial fibrosis was observed in hearts
of aortic-banded mice treated with PARP inhibitors or where
banding was carried out in mice deficient in the PARP gene.
Our data obtained from cultured cardiac myocytes demon-
strated that a hypertrophy dose of angiotensin II that induced
Downloaded from ajpheart.physiology.org on March 16, 2009
protein synthesis in control myocytes failed to produce similar
changes in PARP⫺/⫺ myocytes. Although a direct role of
PARP in protein synthesis is not yet known, there is strong
evidence that PARP participates in regulation of general tran-
scription and cardiac-specific muscle gene expression, includ-
ing expression of those genes that are known to be activated
during hypertrophy (5, 28). Vyas et al. (28) have shown that
PARP participates in transcription activation of ␤-MHC gene,
a hallmark of the fetal gene program that is activated during
cardiac hypertrophy. Another important finding is that the dose
of angiotensin II, which induced a significant amount of cell
death of PARP⫹/⫹ myocytes, failed to do so in myocytes
devoid of the PARP gene, suggesting a role of PARP in
angiotensin II-mediated myocytes cell demise. These results
are consistent with previous reports (10, 18) where free radical-
mediated necrosis of many cell types, such as neurons, thymo-
cytes, and pancreatic ␤-cells, was shown to be prevented by
PARP inhibitors or PARP deficiency.
Fig. 6. Schematic model showing involvement of PARP in ANG II-mediated
cell death. Stimulation of cardiomyocytes with ANG II induces oxidative/
nitrosative stress. These signals activate PARP, leading to poly-ADP-ribosy-
lation of proteins at expense of cellular NAD content. Depletion of cellular
NAD levels eventually leads to cell death. Our data show that this cascade of
events can be blocked (arrows with circle head) by NAD repletion, Sir2␣
activation, as well as by treatment of cells with resveratrol, which could protect
cells by its antioxidative activity and/or by its ability to stimulate the activity
of Sir2␣ deacetylase.
291 • OCTOBER 2006 • www.ajpheart.org
H1552 HYPERTROPHY RESPONSE OF PARP⫺/⫺ MICE TO ANGIOTENSIN II
How does PARP activation induce hypertrophy and myocyte
cell-death? PARP regulates cellular functions by both its en-
zymatic activity to induce protein poly-ADP-ribosylation as
well as by its ability to bind to other proteins (4, 18, 20). Based
on previous reports, the pathological effects of PARP activa-
tion are contributed by three main mechanisms. First, PARP
activation catalyzes the transfer of multiple ADP-ribose moi-
eties from NAD to the target proteins, leading to depletion of
cellular NAD content. This process eventually impairs the
energy metabolism and culminates in an energy deficit, leading
to cell dysfunction and death (4, 18). There is also evidence
that PARP activation causes poly-ADP-ribosylation and inac-
tivation of the enzyme GAPDH, which could result in severe
consequences to cell energy metabolism (9). Second, PARP
regulates gene transcription by chromatin remodeling as well
as by its ability to bind directly to other transcription factors (4,
5, 18). A plethora of evidence has indicated that PARP inter-
acts with transcription factors, including YY-1, AP-2, AP-1,
OCT-1, NF-␬B, p53, and TEF-1 and regulates the expression
of several genes, including inducible nitric oxide synthase,
ICAM-1, and various cytokines and chemokines, and exerts a
profound inflammatory response (4, 18, 20). All these factors
have also been documented to participate in one or more steps
of the evolution and progression of cardiac hypertrophy. Third,
PARP activation induces translocation of apoptosis-inducing
factor (AIF) from mitochondria to nucleus, leading to chro-
matinolysis and cell death without activation of caspases (34).
Although each of these mechanisms is likely to contribute to
cardiac myocyte hypertrophy and cell death, depending on the
magnitude of PARP activation, our data presented here indi-
cate the presence of another new mechanism of PARP-medi-
ated cell death. We show that angiotensin II-mediated cell
death could be prevented by NAD repletion as well as by
treating cells with the Sir2␣ activator resveratrol. Knocking
down Sir2␣ levels by siRNA eliminated the protective effect of
resveratrol, thus indirectly indicating that PARP activation
threatens cell survival by reducing the activity of NAD-depen-
dent class-III histone deacetylases (sirtuins). These findings are
consistent with two earlier reports where a protective effect of
resveratrol treatment was observed against angiotensin II-
mediated hypertrophy of cardiac and smooth muscle cells (6,
15). Prevention of angiotensin II-mediated cell death by Sir2
overexpression indicates that in these cells sufficient levels of
cellular NAD must be available for the deacetylase reaction to
go on. Consistent with this finding, we have recently shown
that Sir2 overactivation prevents NAD loss, even in those cells
where PARP is ectopically overexpressed (23). Although the
precise mechanism of this effect is not known, one possible
explanation could be that the Sir2 overexpression blocks the
excessive enzymatic activity of PARP; as a result, NAD levels
are protected. Future studies are needed to figure out the
possible interplay between these two molecules. If this possi-
bility turns out to be true, it will disclose that these two
oxidative sensors reciprocally regulate the activity of each
other to control the cell fate. In this context, it is worth noting
that there are reports suggesting that PARP and Sir2␣ exert an
opposite effect on many apoptosis effectors, e.g., p53, Ku70,
and NF-␬B. Whereas PARP activation alone or in conjunction
with other factors enhances their proapoptotic activity, Sir2␣
activation via deacetylation of the factor attenuates their apop-
totic potential (7, 13, 16, 26, 31, 33).
AJP-Heart Circ Physiol • VOL
In conclusion, by using both in vitro and in vivo experi-
ments, we have demonstrated that PARP is a nuclear target of
angiotensin II-mediated cell signaling leading to cardiac hy-
pertrophy. A schematic model summarizing our results is given
in Fig. 6. Our data support many previous studies where cell
oxidative/nitrosative stress was shown to be involved in the
development of cardiac hypertrophy (reviewed in Ref. 21) and
in many other reports where failing hearts were found to be
associated with increased activity of the PARP enzyme (1, 24,
32). These results strengthen the notion that PARP inhibition
as monotherapy, or as a combination therapy that includes
activation of the Sir2␣, may represent a novel approach for the
management of heart failure.
ACKNOWLEDGMENTS
We thank Ayman Isbatan for technical assistance and the following inves-
tigators for their generous gift of different plasmids: Dr. V. Dawson (Depart-
ment of Neurology, Johns Hopkins University School of Medicine, Baltimore,
MD) for PARP plasmid, Dr. W. Gu (Department of Pathology, College of
Downloaded from ajpheart.physiology.org on March 16, 2009
Physician and Surgeons Columbia University, New York, NY) for Sir2
plasmids, and Dr. Shin-Ichiro Imai (Department of Molecular Biology and
Pharmacology, Washington University School of Medicine, St. Louis, MO) for
NAMPT plasmid.
GRANTS
This study was supported by National Heart, Lung, and Blood Institute
Grants RO1-HL-68083 and RO1-HL-77788, American Heart Association
Grant-in-aid N-150108, and the Department of Surgery research funds (to
M. P. Gupta).
REFERENCES
1. Bartunek J, Vanderheyden M, Knaapen MW, Tack W, Kockx MM,
and Goethals M. Deoxyribonucleic acid damage/repair proteins are
elevated in the failing human myocardium due to idiopathic dilated
cardiomyopathy. J Am Coll Cardiol 40: 1097–1103, 2002.
2. Bendall JK, Cave AC, Heymes C, Gall N, and Ahah AM. Pivotal role
of a gp91(phox)-containing NADPH oxidase in angiotensin II-induced
cardiac hypertrophy in mice. Circulation 105: 293–296, 2002.
3. Blander G and Guarente L. The Sir2 family of protein deacetylases.
Annu Rev Biochem 73: 417– 435, 2004.
4. Burkle A. Physiology and pathophysiology of poly(ADP-ribosyl)ation.
Bioassays 23: 795– 806, 2001.
5. Butler AJ and Ordahl CP. Poly(ADP-ribose) polymerase binds with
transcription enhancer factor 1 to MCAT1 elements to regulate muscle-
specific transcription. Mol Cell Biol 19: 296 –306, 1999.
6. Cheng TH, Liu JC, Lin H, Shih NL, Chen YL, Huang MT, Chan P,
Cheng CF, and Chen JJ. Inhibitory effect of resveratrol on angiotensin
II-induced cardiomyocyte hypertrophy. Naunyn Schmiedebergs Arch
Pharmacol 369: 239 –244, 2004.
7. Cohen HY, Miller C, Bitterman KJ, Wall NR, Hekking B, Kessler B,
Howitz KT, Gorospe M, Cabo Rde, and Sinclair DA. Calorie restriction
promotes mammalian cell survival by inducing the SIRT1 deacetylase.
Science 305: 390 –392, 2004.
7a.De Flora A, Zocchi E, Guida L, Franco L, and Bruzzone S. Autocrine
paracrine calcium signaling by the CD38/NAD⫹/cyclic ADP-ribose sys-
tem. Ann NY Acad Sci 1028: 176 –191, 2004.
8. Devic E, Xiang Y, Gould D, and Kobilka B. ␤-Adrenergic receptor
subtype-specific signaling in cardiac myocytes from ␤1 and ␤2 adreno-
ceptor knockout mice. Mol Pharmacol 60: 577–583, 2001.
9. Du X, Matsumura T, Edelstein D, Rossetti L, Zsengeller Z, Szabo C,
and Brownlee M. Inhibition of GAPDH activity by poly(ADP-ribose)
polymerase activates three major pathways of hyperglycemic damage in
endothelial cells. J Clin Invest 112: 1049 –1057, 2003.
10. Eliasson MJ, Sampei K, Mandir AS, Hurn PD, Traystman RJ, Bao J,
Pieper A, Wang ZQ, Dawson TM, Snyder SH, and Dawson VL.
Poly(ADP-ribose) polymerase gene disruption renders mice resistant to
cerebral ischemia. Nat Med 3: 1089 –1095, 1997.
12. Frey N, Katus HA, Olson EN, and Hill JA. Hypertrophy of the heart: a
new therapeutic target. Circulation 109: 1580 –1589, 2004.
291 • OCTOBER 2006 • www.ajpheart.org
 HYPERTROPHY RESPONSE OF PARP⫺/⫺ MICE TO ANGIOTENSIN II
13. Galande S and Kohwi-Shigematsu T. Poly(ADP-ribose) polymerase and
Ku autoantigen form a complex and synergistically bind to matrix attach-
ment sequences. J Biol Chem 274: 20521–20528, 1999.
14. Grishko V, Pastukh V, Solodushko V, Gillespie M, Azumo J, and
Shaffer S. Apoptotic cascade initiated by angiotensin II in neonatal
cardiomyocytes: role of DNA damage. Am J Physiol Heart Circ Physiol
285: H2364 –H2372, 2003.
15. Haider UG, Sorescu D, Griendling KK, Vollmar AM, and Dirsch VM.
Resveratrol suppresses angiotensin II-induced Akt/protein kinase B and
p70 S6 kinase phosphorylation and subsequent hypertrophy in rat aortic
smooth muscle cells. Mol Pharmacol 62: 772–777, 2002.
16. Hassa PO and Hottiger MO. The functional role of poly(ADP-ribose)
polymerase-1 as novel coactivator of NF-␬B in inflammatory disorders.
Cell Mol Life Sci 59: 1534 –1553, 2002.
17. Homburg S, Visochek L, Moran N, Dantzer F, Priel E, Asculai E,
Schwartz D, Rotter V, Dekel N, and Cohen-Armon M. A fast signal
induced activation of poly(ADP-ribose) polymerase: a novel down stream
target of phospholipase c. J Cell Biol 150: 293–307, 2000.
18. Jagtap P and Szabo C. Poly(ADP-ribose) polymerase and the therapeutic
effect of its inhibitors. Nat Rev Durg Discov 4: 421– 440, 2005.
19. Kaeberlein M, McDonagh T, Heltweg B, Hixon J, Westman EA,
Caldwell SD, Napper A, Curtis R, DiStefano PS, Fields S, Bedalov A,
and Kennedy BK. Substrate-specific activation of sirtuins by resveratrol.
J Biol Chem 280: 17038 –17045, 2005.
20. Kraus WL and Lis JT. PARP goes transcription. Cell 113: 677– 683,
2003.
21. Pacher P, Schulz R, Liaudet L, and Szabo C. Nitrosative stress and
pharmacological modulation of heart failure. Trends Pharmacol Sci 26:
302–310, 2005.
22. Paradis P, Dali-Youcef N, Paradis FW, Thibault G, and Nemer M.
Overexpression of angiotensin II type 1 receptor in cardiomyocytes
induces cardiac hypertrophy and remodeling. Proc Natl Acad Sci USA 97:
931–936, 2000.
23. Pillai JB, Isbatan A, Imai S, and Gupta MP. Poly(ADP-ribose) poly-
merase-1-dependent cardiac myocyte cell death during heart failure is
mediated by NAD⫹ depletion and reduced Sir2alpha deacetylase activity.
J Biol Chem 280: 43121– 43130, 2005.
24. Pillai JB, Russell HM, Raman J, Jeevanandam V, and Gupta MP.
Increased expression of poly(ADP-ribose) polymerase-1 contributes to
AJP-Heart Circ Physiol • VOL 291 • OCTOBER 2006 •
H1553
caspase-independent myocyte cell death during heart failure. Am J Physiol
Heart Circ Physiol 288: H486 –H496, 2005.
25. Revollo JR, Grimm AA, and Imai SI. The NAD biosynthetic pathway
mediated by nicotinamide phosphoribosyltransferase regulates Sir2 activ-
ity in mammalian cells. J Biol Chem 279: 50754 –50763, 2004.
26. Smith JS. Human Sir2 and the silencing of p53 activity. Trends Cell Biol
12: 404 – 406, 2002.
27. Szabo C, Pacher P, Zsengeller Z, Vaslin A, Komjati K, Benko R, Chen
M, Mabley JG, and Kollai M. Angiotensin II-mediated endothelial
dysfunction: role of poly(ADP-ribose) polymerase activation. Mol Med
10: 28 –35, 2004.
28. Vyas DR, McCarthy JJ, Tsika GL, and Tsika RW. Multiprotein
complex formation at the beta myosin heavy chain distal muscle CAT
element correlates with slow muscle expression but not mechanical over-
load responsiveness. J Biol Chem 276: 1173–1184, 2001.
29. Wang HD, Xu S, John DG, Du Y, Quinn MT, Cayatte AJ, and Cohen
RA. Role of NADPH oxidase in the vascular hypertrophy and oxidative
stress response to angiotensin II in mice. Circ Res 88: 947–953, 2001.
30. Wang Y. Signal transduction in cardiac hypertrophy dissecting compen-
satory versus pathological pathways utilizing a transgenic approach. Curr
Opin Pharmacol 1: 134 –140, 2001.
31. Wieler S, Gagne J, Vaziri H, Poirier GG, and Benchimol S. Poly(ADP)
ribose polymerase-1 is a positive regulator of the p53-mediated G1 arrest
Downloaded from ajpheart.physiology.org on March 16, 2009
response after ionizing radiation. J Biol Chem 278: 18914 –18921, 2003.
32. Xiao CY, Chen M, Zsengeller Z, Li H, Kiss L, Kollai M, and Szabo C.
Poly(ADP-ribose) polymerase promotes cardiac remodeling, contractile
failure, and translocation of apoptosis-inducing factor in a murine exper-
imental model of aortic banding and heart failure. J Pharmacol Exp Ther
312: 891– 898, 2005.
33. Yeung F, Hoberg JE, Ramsey CS, Keller MD, Jones DR, Frye RA,
and Mayo MW. Modulation of NF-␬B-dependent transcription and cell
survival by the SIRT1 deacetylase. EMBO J 23: 2369 –2380, 2004.
34. Yu SW, Wang H, Poitras MF, Coombs C, Bowers WJ, Federoff HJ,
Poirier GG, Dawson TM, and Dawson VL. Mediation of PARP-
dependent cell death by apoptosis-inducing factor. Science 297: 259 –263,
2002.
35. Zong WX, Ditsworth D, Bauer DE, Wang ZQ, and Thompson CB.
Alkylating DNA damage stimulates a regulated form of necrotic cell
death. Genes Dev 18: 1272–1282, 2004.
www.ajpheart.org