Kidney International, Vol. 67 (2005), pp.
1126–1135
Angiotensin II induces fibronectin expression in human
peritoneal mesothelial cells via ERK1/2 and p38 MAPK
KEI KIRIBAYASHI, TAKAO MASAKI, TAKAYUKI NAITO, TAKAHIKO OGAWA, TAKAFUMI ITO, NORIAKI
YORIOKA, and NOBUOKI KOHNO
Department of Molecular and Internal Medicine, Graduate School of Biomedical Sciences, Hiroshima University, Hiroshima,
Japan; and Department of Radiobiology and Molecular Epidemiology, Radiation Effects Research Foundation, Hiroshima, Japan
Angiotensin II induces fibronectin expression in human peri-
toneal mesothelial cells via ERK1/2 and p38 MAPK.
Background. The renin-angiotensin system has been impli-
cated in the pathogenesis of fibrosis in various organs. However,
its involvement in peritoneal fibrosis, a crucial complication of
peritoneal dialysis, is unclear. Human peritoneal mesothelial
cells (HPMC) play a major role in peritoneal fibrosis by pro-
ducing extracellular matrix (ECM). However, there is scant data
regarding the effect of angiotensin II (Ang II) on ECM expres-
sion and signal transduction pathways in HPMC.
Methods. The concentration of Ang II in the peritoneal dial-
ysis effluent was measured by radioimmunoassay. We investi-
gated the expression of Ang II type 1 (AT1) and type 2 (AT2)
receptors by HPMC. We also examined the effect of Ang II
upon fibronectin production by HPMC, and dissected the re-
ceptor and intracellular signaling pathways involved.
Results. Ang II levels in the peritoneal dialysis effluent at the
onset of peritonitis were 30 times higher than baseline levels.
HPMC expression of AT1 and AT2 receptors was confirmed
at the mRNA and protein level by reverse transcriptase-
polymerase chain reaction (PCR), Western blotting, and im-
munocytochemistry. Quantitative reverse transcriptase-PCR
and Western blotting showed that 10 nmol/L Ang II in-
creased fibronectin mRNA expression followed by secretion
of fibronectin protein. This response was completely inhib-
ited by the AT1 receptor antagonist RNH6270, while the AT2
receptor antagonist PD123319 had no effect. Ang II-induced
fibronectin expression was mediated by the activation of extra-
cellular signal-regulated kinase 1/2 (ERK1/2) and p38 mitogen-
activated protein kinase (p38 MAPK), but not c-Jun N-terminal
kinase.
Conclusion. These results indicate the potential importance
of ERK1/2 and p38 MAPK signaling pathways in Ang II-
induced fibronectin expression in HPMC, and suggest the ther-
apeutic potential of AT1 receptor blockers in the prevention
or treatment of peritoneal fibrosis in patients on peritoneal
dialysis.
Key words: angiotensin II, human peritoneal mesothelial cells, fi-
bronectin, mitogen-activated protein kinase, peritoneal fibrosis.
Received for publication July 11, 2004
and in revised form September 6, 2004
Accepted for publication September 22, 2004


C 2005 by the International Society of Nephrology
1126
Continuous ambulatory peritoneal dialysis (CAPD)
has been used for more than two decades as a treatment
for end-stage kidney disease. However, peritoneal fibro-
sis is still one of the most important complications, and
eventually causes loss of ultrafiltration and encapsulating
peritoneal sclerosis [1, 2]. There is accumulating evidence
that continuous exposure to bioincompatible dialysis so-
lution components and refractory or repeated episodes
of infectious peritonitis play major roles in the develop-
ment of peritoneal fibrosis [2–4]. Histologically, excessive
deposition of extracellular matrix (ECM) in the subme-
sothelial zone precedes other morphologic changes [5].
Human peritoneal mesothelial cells (HPMC) are capable
of producing ECM, including various collagens (types I,
III, and IV), laminin, and fibronectin [6, 7], and are there-
fore thought to play a major role in the initiation and pro-
gression of peritoneal fibrosis. However, the underlying
biologic mechanisms of peritoneal fibrosis have not been
fully elucidated.
Angiotensin II (Ang II) is a well-recognized and potent
vasoactive peptide, but also exhibits regulatory roles in
inflammation, cell proliferation, apoptosis, and fibrosis
[8–11]. Recent studies indicate that the mitogen-activated
protein kinase (MAPK) cascades are involved in Ang
II-mediated regulation of ECM gene expression via two
distinct receptors, which are the Ang II type 1 (AT1) and
type 2 (AT2) receptors [12].
Ang II concentrations in the effluent of peritoneal
dialysis (PD) have not been reported previously. How-
ever, Delbaere et al [13] reported that the Ang II
concentration in female peritoneal fluid collected during
laparoscopy was higher than in plasma throughout the
menstrual cycle. This indicates the existence of a local
renin-angiotensin system in the peritoneal cavity.
In vivo, there are several studies indicating the re-
lationship between peritoneal fibrosis and the renin-
angiotensin system [14–16]. These studies demonstrate
the efficacy of angiotensin-converting enzyme inhibition
(ACEI) or Ang II receptor blockade (ARB) in pre-
venting the progression of peritoneal fibrosis in animal
 Kiribayashi et al: Angiotensin II induces fibronectin expression via ERK1/2 and p38 MAPK 1127

models. However, there is no published data regarding Table 1. Clinical characteristics of the study participants
the expression of Ang II receptors on HPMC, the effect Normal CAPD
of Ang II on ECM production by HPMC, or the intracel- CAPD patients with
patients peritonitis
lular signaling pathways involved in Ang II stimulation N=5 N=5 P valuea
of HPMC.
We hypothesized that Ang II induces ECM produc- Age years 51.9 ± 2.4 54.4 ± 7.7 NS
Gender (male/female) 3/2 3/2 NS
tion by HPMC via activation of MAPK. Therefore, in Primary disease CGN:4 CGN:3
the present study, we investigated the following issues: DN:1 DN:2 NS
(1) whether HPMC express AT1 and AT2 receptors; (2) Duration of CAPD years 5.9 ± 3.1 3.7 ± 0.8 NS
Ang II concentration pmol/L 11.1 ± 2.7 336.8 ± 81.7 <0.001
whether Ang II stimulates HPMC to produce fibronectin,
a key ECM component in fibrosis [17]; (3) whether Abbreviations are: CAPD, continuous ambulatory peritoneal dialysis; CGN,
chronic glomerulonephritis; Ang II, angiotensin II; DN, diabetic nephropathy;
AT1 and/or AT2 receptor antagonism suppresses Ang NS, not significant.
a
II-induced fibronectin expression by HPMC; (4) whether Mann-Whitney U test.

activation of extracellular signal-regulated kinase (ERK)

1/2, p38 MAPK, and c-Jun N-terminal kinase (JNK) me-
diates Ang II-induced fibronectin expression.
Our findings demonstrate for the first time that AT1
and AT2 receptors are expressed by HPMC, and that
Ang II increases the mRNA expression and protein se-
cretion of fibronectin via the AT1 receptor. We also show
that Ang II-induced fibronectin expression is mediated
by ERK1/2 and p38 MAPK, but not JNK in HPMC.
METHODS
Reagents
Reagents for these studies were as follows: angiotensin
II, PD123319 (a selective AT2 receptor blocker),
and Protease Inhibitor Cocktail for mammalian tis-
sues (Sigma Chemical Co., St. Louis, MO, USA); fe-
tal calf serum (FCS) (Mitsubishi Kasei Co., Tokyo,
Japan); M199 medium, trypsin-0.01% (wt/vol) ethylene-
diaminetetraacetate solution, penicillin, streptomycin,
L-glutamine, and TRIzol Reagent (Life Technologies
Inc., Grand Island, NY, USA); phosphate-buffered
saline (PBS) (pH 7.2; Nissui Pharmaceutical Co., Tokyo,
Japan); ReverTra Ace (Toyobo, Osaka, Japan); RNase
inhibitor (Promega Co., Madison, WI, USA); Block
Ace (Dainippon Seiyaku Co., Ltd., Tokyo, Japan);
LightCycler Fast Start DNA Master SYBR Green I
(Roche Diagnostics Corp., Idaho Technology, Inc., Idaho
Falls, ID, USA); RNH6270 (a selective AT1 receptor
blocker) was kindly provided by Sankyo Pharmaceuti-
cal Co., Ltd. (Tokyo, Japan); PD98059 (MAPK/ERK ki-
nase 1 inhibitor) and SB203580 (p38 MAPK inhibitor)
(Calbiochem, San Diego, CA, USA); rabbit polyclonal
anti-AT1 receptor and goat polyclonal anti-AT2 recep-
tor (Santa Cruz Biotechnology, Inc., Santa Cruz, CA,
USA); mouse monoclonal antihuman fibronectin an-
tibody (BD Biosciences, Oxford, UK); antibodies to
phospho-ERK1/2 (Thr202/Tyr204), ERK1/2, phospho-
p38 MAPK (Thr180/Tyr182), p38 MAPK, phospho-JNK
(Thr183/Tyr185), and JNK (Cell Signaling Technology,
Beverly, MA, USA); horseradish peroxidase (HRP)-
conjugated rabbit antigoat IgG antibody and goat
antimouse IgG antibody (Dako Cytomation, Carpin-
teria, CA, USA); fluorescein isothiocyanate (FITC)-
conjugated goat antirabbit IgG antibody, rabbit antigoat
IgG antibody and 4,6-diamidino-2-phenylindole (DAPI)
(Molecular Probes, Leiden, The Netherlands); HRP-
conjugated donkey antirabbit IgG, PVDF membranes,
and the enhanced chemiluminescence (ECL) West-
ern blotting detection system (Amersham Pharmacia
Biotech, Buckinghamshire, UK); BCA protein assay
reagents (Pierce, Rockford, IL, USA).
Radioimmunoassay
To measure the Ang II concentration in the PD ef-
fluent, we enrolled 10 patients on CAPD at Hiroshima
University Hospital (Hiroshima, Japan). The PD effluent
following an overnight dwell was collected from five pa-
tients during normal uncomplicated dialysis and another
five patients at the onset of infectious peritonitis. The ef-
fluent was centrifuged at 1000g for 10 minutes at 4◦ C, and
supernatants aliquoted and stored at −80◦ C. The con-
centration of Ang II in the PD effluent was measured by
a radioimmunoassay kit (Mitsubishi Kagaku BCL, Inc.,
Tokyo, Japan) according to the manufacturer’s instruc-
tions. The clinical characteristics of the study participants
are shown in Table 1. All the patients participating in this
study gave full informed consent.
Cell cultures
HPMC were isolated from human omentum as de-
scribed previously [6]. Chemicals and tissue culture plas-
tics were as described in our earlier studies [18]. HPMC
were identified by their morphologic characteristics as
visualized by inverted phase-contrast microscopy and by
the presence of vimentin and cytokeratin, and by the ab-
sence of human factor VIII, by immunofluorescence mi-
croscopy. Harvesting of the omentum was permitted by
the Medical Ethics Committee of Hiroshima Graduate
School of Biomedical Sciences, and informed consent was
obtained from each patient. All data presented are from
1128 Kiribayashi et al: Angiotensin II induces fibronectin expression via ERK1/2 and p38 MAPK
experiments performed with confluent HPMC from the
second to third passage. All cells were washed and growth
arrested for 48 hours in control standard M199 medium
containing 0.1% FCS (vol/vol) prior to Ang II stimula-
tion. Human umbilical vein endothelial cells (HUVEC)
were obtained from the American Tissue Type Culture
Collection (Manassas, VA, USA).
Reverse transcriptase-PCR
HPMC were cultured in 60-mm dishes (both at 1 ×
106 cells/dish). Quiescent cells were washed twice with
PBS, and total RNA was extracted according to the
method of Chomczynski and Sacchi [19] with TRI-
zol reagent. Oligo dT-primed reverse transcription was
performed at 30◦ C for 10 minutes, and 42◦ C for 30 min-
utes after denaturation of the RNA at 95◦ C for 10 min-
utes with reverse transcriptase (ReverTra Ace; Toyobo)
and RNase inhibitor. The primer set used to detect the
AT1 and AT2 receptors were as follows: AT1 (388-bp);
sense 5 - CTGAATAACTCACTGATGCC-3 , antisense
5 - TAGGTAATTGCCAAAGGGCC -3 , AT2 (191-bp);
sense 5 -TTCCCTTCCATGTTCTGACC-3 , antisense
5 -AAACACACTGCGGAGCTTCT-3 . PCR for AT1
receptor was performed with denaturation for 1 minute
at 95◦ C, annealing for 1 minute at 52◦ C, and extension at
72◦ C for 2 minutes. After 40 cycles, the final product was
extended for 3 minutes at 72◦ C. PCR for AT2 receptor
was performed with denaturation for 1 minute at 95◦ C,
annealing for 1 minute at 59◦ C, and extension at 72◦ C for
2 minutes. After 32 cycles, the final product was extended
for 3 minutes at 72◦ C. A Program Temp Control System
PC-800 (Astec; Fukuoka, Japan) was used. PCR products
were separated by 1.5% agarose gel electrophoresis and
visualized by ethidium bromide staining. Non–reverse-
transcribed RNA was used as a template for the negative
control. HUVEC were used as a positive control [20].
Immunocytochemistry
Quiescent HPMC were cultured on 8-well chamber
slides (Nunc, Naperville, IL, USA) and fixed in 4%
paraformaldehyde for 20 minutes at room temperature.
After washing three times with PBS containing 0.1%
TritonX-100, (PBST) cells were blocked for one hour
in PBS containing 20% Block Ace, and then incubated
overnight at 4◦ C with the primary antibody. A rabbit poly-
clonal antihuman AT1 receptor antibody and a goat poly-
clonal antihuman AT2 antibody were used at dilutions
of 1:400 and 1:100 in PBS, respectively. After incubation
with the primary antibody, cells were washed five times
with PBST, and incubated with FITC-conjugated goat an-
tirabbit IgG (5 lg/mL) for one hour at room tempera-
ture. Nuclei were counterstained with 300 nmol/L DAPI
for three minutes, and stained specimens were examined
under a laser scanning microscope (AX-80, Olympus,
Tokyo, Japan).
Quantitative RT-PCR
HPMC (2 × 105 cells/well) were seeded on 6-well
plates, and grown until 80% confluent. Quiescent cells
were then incubated with various concentrations of Ang
II for the specified time. Total RNA was extracted
using the TRIzol reagent and equal amounts (2 lg)
of total RNA from each sample were converted to
cDNA by M-MLV reverse transcriptase RNaseH- with
oligo dT20 primer in a 20-lL reaction volume. We
performed real-time PCR using the LightCycler quick
system 350S (Roche Diagnostics, Tokyo, Japan). The
RT reaction was subjected to PCR amplification using
LightCycler Fast Start DNA Master SYBR Green I in a
20-lL reaction volume with 0.3 lmol/L of each primer
and 3 mmol/L MgCl 2 . b-actin was used as the inter-
nal control. The primer sequences were as follows: fi-
bronectin (421-bp), sense 5 -GCCTGGTACAGAATA
TGTAGTG-3 and antisense 5 -ATCCCAGCTGATC
AGTAGGCTGGTG-3 ; b-actin (260-bp), sense 5 -
GCAAAGACCTGTACGCCAAC-3 and antisense 5 -
CTAGAAGCATTTGCGGTGGA-3 . The amplification
program was 95◦ C for 10 minutes, and then 40 cycles con-
sisting of 95◦ C for 10 seconds, 62◦ C for 10 seconds, and
72◦ C for 10 seconds. Amplification products were ana-
lyzed by a melting curve, which confirmed the presence
of a single PCR product in all reactions apart from the
negative controls. Quantification of PCR products was
measured by a fit-point analysis, and melting curve anal-
ysis was performed in all measurements. The results of
fibronectin were normalized by b-actin.
Western blotting
HPMC and HUVEC were seeded into 75-cm2 tissue
culture flasks, and cultured until 80% confluent. Qui-
escent cells were washed twice with ice-cold PBS, and
then lysed in 500 lL of ice-cold lysis buffer (10 mmol/L
Tris-HCl pH 7.4, 100 mmol/L NaCl, 1 mmol/L EDTA,
1 mmol/L EGTA, 1 mmol/L NaF, 2 mmol/L Na 3 VO 4 ,
1% Triton X-100, 10% glycerol, 0.5% deoxycholate,
1 mmol/L PMSF, 10% Protease Inhibitor Cocktail for
mammalian tissues; Sigma). The lysates were put on ice
and vortexed every 2 minutes for 10 minutes. Lysates were
then centrifuged at 15,000g for 20 minutes at 4◦ C, and
supernatants aliquoted and stored at −80◦ C. The protein
content of cell lysates was determined by the BCA protein
assay. Lysates (15 lg of protein) were separated on 10%
polyacrylamide gels using SDS-PAGE, and transferred to
PVDF membranes. The blots were blocked overnight at
4◦ C with 20 mmol/L Tris-HCl pH 7.4, 140 mmol/L NaCl
with 0.05% Tween 20 (TBST buffer) containing 5% non-
fat dried milk, and then incubated for 2 hours at 4◦ C with
 Kiribayashi et al: Angiotensin II induces fibronectin expression via ERK1/2 and p38 MAPK
A AT 1 receptor mRNA AT 2 receptor mRNA
388 bp
Cell type HUVEC HPMC Cell type HUVEC HPMC
RT (+) (−) (+) (−) RT (+) (−) (+) (−)
B tect the presence of Ang II type 1 (B-I) and
AT 1 receptor protein AT 2 receptor protein
50 kD
Cell type HUVEC HPMC Cell type HUVEC HPMC
C tative of similar results obtained from 3 sep-
each primary antibody (1:200 dilution). After washing
three times in TBST buffer, blots were incubated with
secondary antibody (HRP-conjugated donkey antirabbit
IgG at a 1:5000 dilution) for two hours at room tempera-
ture, and the reaction products were detected by the ECL
Western blotting detection system. HUVEC were used as
a positive control [20].
For detection of phospho-ERK1/2 (Thr202/Tyr204),
ERK1/2, phospho-p38 MAPK (Thr180/Tyr182), p38
MAPK, phospho-JNK (Thr183/Tyr185), and JNK,
HPMC were seeded into 25-cm2 tissue culture flasks and
grown to 80% confluence. Quiescent cells were incubated
with Ang II for the specified time, and then lysed with
100 lL of ice-cold lysis buffer and stored as described
above. Lysates (20 lg of protein) were separated on 10%
polyacrylamide gels using SDS-PAGE, and transferred
to PVDF membranes.
For detection of supernatant fibronectin, HPMC were
seeded into 25-cm2 tissue culture flasks and grown to 80%
confluence. Quiescent cells were incubated with Ang II
for the specified time. The supernatants were then col-
lected and centrifuged at 1000g for 10 minutes at 4◦ C.
Supernatants (15 lg of protein, determined by the BCA
protein assay) were separated on 8% polyacrylamide gels
using SDS-PAGE, and transferred to PVDF membranes.
The blots were blocked for two hours at room temper-
ature with TBST containing 5% nonfat dried milk, and
then incubated overnight at 4◦ C with each primary anti-
body (1:1000 dilution for MAPK, 1:5000 dilution for fi-
bronectin). After washing three times in TBST buffer,
1129
Fig. 1. Human peritoneal mesothelial cells
(HPMC) express angiotensin II (Ang II) type
1 and 2 receptors. (A) RT-PCR was used to
detect mRNA for the Ang II type 1 (A-I) and
type 2 (A-II) receptors in quiescent HPMC.
The predicted length of each PCR product
191 bp (388-bp and 191-bp, respectively) is shown
by an arrow. The negative control was non–
reverse-transcribed RNA, while human um-
bilical vein endothelial cells (HUVEC) served
as positive control. (B) Western blotting of
quiescent HPMC or HUVEC was used to de-
type 2 (B-II) receptors. Data shown are rep-
resentative of similar results obtained from 3
50 kD separate experiments. (C) Immunocytochem-
istry was used to detect the Ang II type 1
(C-I) and type 2 (C-II) receptors in quies-
cent HPMC, with nuclei counterstained with
DAPI. These photomicrographs are represen-
arate experiments. Magnification ×400. For
negative control, 5% bovine serum albumin
was used instead of the primary antibody (C-
III). The specificity of the Western blotting
and immunocytochemistry results was con-
firmed by incubation of the primary antibod-
ies with their respective blocking peptides
(data not shown).
blots were incubated with HRP-conjugated secondary
antibody (1:5000 dilution) for one hour, and the reaction
products were detected by the ECL Western blotting de-
tection system using x-ray film. The intensity of each band
was determined using NIH image software (version 1.6).
Statistical analysis
Results are expressed as mean ± SEM of at least
three individual experiments. Statistical analysis was per-
formed with analysis of variance (ANOVA) followed by
Tukey’s post-hoc test unless otherwise stated. Differences
were deemed significant at P < 0.05.
RESULTS
Ang II concentrations are elevated in the effluent
of patients with infectious peritonitis
The Ang II concentration in the PD effluent was sig-
nificantly higher at the onset of infectious peritonitis
than during basal conditions (336.8 ± 81.7 vs. 11.1 ±
2.7 pmol/L, respectively) (Table 1).
Human peritoneal mesothelial cells express Ang II type
1 and 2 receptors
RT-PCR and Western blotting identified the presence
of both AT1 and AT2 receptors in quiescent HPMC
(Fig. 1A and B). As a positive control, HUVEC were
shown to express both AT1 and AT2 receptors. Immuno-
cytochemistry also demonstrated the expression of both
1130 Kiribayashi et al: Angiotensin II induces fibronectin expression via ERK1/2 and p38 MAPK

* A
*
* Fibronectin
A NS
3.0
Fibronectin/β-actin ratio, fold

NS * * * *
* *

Fibronectin secretion,
NS NS

fold of 24h-control
2.0 *
2.0 Control
medium
Control
medium 1.0
1.0 Ang II
Ang II (10 nmol/L)
(10 nmol/L) 0
0 12 18 24 h
0 3 6 12 24 h *P < 0.05
*P < 0.05
B
*
* Fibronectin
B * *
*
Fibronectin/β-actin ratio, fold

2.0

Fibronectin/total protein,
* *
* *
2.0
fold
1.0 1.0

0 *P < 0.05
0 0.1 1 10
Ang II, nmol/L
Fig. 2. Angiotensin II (Ang II) induces fibronectin gene expression in
human peritoneal mesothelial cells (HPMC). (A) HPMC were incu-
bated in the absence or presence of 10 nmol/L Ang II for the indicated
times, and real time-RT-PCR was performed. Graph shows the relative
mRNA levels of fibronectin normalized to b-actin in the absence (open
bars) or presence (filled bars) of 10 nmol/L Ang II for the indicated
times relative to 0-hour control levels. (B) HPMC were incubated for
6 hours in the presence of various concentrations of Ang II, and real
time-RT-PCR was performed. Graph shows the relative mRNA levels
in various concentrations of Ang II normalized to b-actin relative to
control levels. Values are mean ± SEM of 9 individual experiments.
∗ P < 0.05.
0
0 0.1 1 10 100 1000
100 1000 Ang II, nmol/L
*P < 0.05
Fig. 3. Angiotensin II (Ang II) induces fibronectin protein expression
in human peritoneal mesothelial cells (HPMC). (A) HPMC were incu-
bated in the absence or presence of 10 nmol/L Ang II for the indicated
times, and Western blotting was performed. Graph shows the levels of
fibronectin protein in the culture supernatant (25 lL per lane) in the
absence (open bars) or presence (filled bars) of 10 nmol/L Ang II for
the indicated times relative to 24-hour control levels. (B) HPMC were
incubated for 24 hours in the presence of various concentrations of Ang
II, and Western blotting was performed. Graph shows the relative levels
of fibronectin protein in the culture supernatant (15 lg loaded per lane)
in various concentrations of Ang II relative to control levels. Values are
mean ± SEM of 3 individual experiments. ∗ P < 0.05 vs. control.

dent with 10 and 100 nmol/L Ang II (1.70- and 1.46-fold)

(Fig. 2B).
the AT1 and AT2 receptors (Fig. 1C). The specificity of
Stimulation of HPMC with 10 nmol/L Ang II also
the Western blotting and immunocytochemistry results
caused a significant time-dependent increase in the secre-
was confirmed by incubation of the primary antibodies
tion of fibronectin protein into the culture medium. This
with their respective blocking peptides (data not shown).
was evident following Ang II stimulation for 24 hours
(Fig. 3A).
Ang II induces fibronectin gene and protein expression The quantification of secreted fibronectin protein in-
in human peritoneal mesothelial cells duced by different concentrations of Ang II was per-
The addition of 10 nmol/L Ang II induced a signifi- formed by Western blotting at the 24-hour time point
cant increase in fibronectin mRNA expression (1.70-fold) (Fig. 3B). Incubation with 10 nmol/L Ang II signifi-
within six hours that was maintained for the 24-hour study cantly increased the secretion of fibronectin (1.83-fold).
period (Fig. 2A). The effect of different doses of Ang II on Fibronectin protein was undetectable in control media
fibronectin mRNA expression was investigated at the six- that had not been exposed to HPMC.
hour time point. Incubation with 1 nmol/L Ang II induced These results demonstrate that Ang II up-regulates
a significant increase (1.35-fold) in fibronectin mRNA fibronectin mRNA and protein expression in cultured
levels, with greater increases in fibronectin mRNA evi- HPMC.
 Kiribayashi et al: Angiotensin II induces fibronectin expression via ERK1/2 and p38 MAPK 1131

* A
A * 2.0 NS

Fibronectin/β-actin ratio, fold

2.0 *
Fibronectin/β-actin ratio, fold † * * * * * *
†
†
†

1.0
1.0

0
0
RNH6270 (µmol/L) 0 0 0.01 0.1 1 PD123319 (µmol/L) 0 0 0.1 1 10

Ang II (10 nmol/L) − + + + + Ang II (10 nmol/L) − + + + +

†P < 0.05 vs. control *P < 0.05 *P < 0.05 vs. control

B
B
Fibronectin
Fibronectin
*
* NS
2.0 * * 2.0

Fibronectin/total protein,
Fibronectin/total protein,

fold
fold

1.0 1.0

0 0
RNH6270 (1µmol/L) − + − + PD123319 (10 µmol/L) − + − +
Ang II (10 nmol/L) − − + + *P < 0.05 Ang II (10 nmol/L) − − + + *P < 0.05

Fig. 4. Angiotensin II (Ang II) induces fibronectin expression in hu-
man peritoneal mesothelial cells (HPMC) via the angiotensin II type 1
(AT1) receptor. Quiescent HPMC were incubated with various concen-
trations of RNH6270 (active form of olmesartan; selective AT1 recep-
tor blocker) or vehicle control for 30 minutes before stimulation with
10 nmol/L Ang II. (A) Real time-RT-PCR was performed to assess
the levels of fibronectin mRNA expression. Graph shows the relative
fibronectin mRNA levels normalized to b-actin relative to control. Val-
ues are mean ± SEM of 5 individual experiments. ∗ P < 0.05, †P < 0.05
vs. control. (B) Graph shows the levels of fibronectin protein in the
culture supernatant (15 lg loaded per lane) relative to control levels.
Values are mean ± SEM of 3 individual experiments. ∗ P < 0.05.
Fig. 5. Angiotensin II type 2 (AT2) receptor blocker does not af-
fect angiotensin II (Ang II)-induced fibronectin expression in human
peritoneal mesothelial cells (HPMC). Quiescent HPMC were incu-
bated with various concentrations of PD123319 (selective AT2 receptor
blocker) or vehicle control for 30 minutes before stimulation with 10
nmol/L Ang II. (A) Real time-RT-PCR was performed to assess the
levels of fibronectin mRNA expression. Graph shows the relative fi-
bronectin mRNA levels normalized to b-actin relative to control. Val-
ues are mean ± SEM of 5 individual experiments. ∗ P < 0.05 vs. control.
(B) Graph shows the levels of fibronectin protein in the culture su-
pernatant (15 lg of protein loaded per lane) relative to control levels.
Values are mean ± SEM of 3 individual experiments. ∗ P < 0.05.

Ang II induces fibronectin expression and fibronectin protein expression at 10 lmol/L (Fig. 5A
via the AT1 receptor and B). Both RNH6270 and PD123319 had no effect on
the expression of fibronectin in the absence of Ang II
Since HPMC express both the AT1 and AT2 recep- stimulation (data not shown). These results indicate that
tors, we examined which receptor was involved in Ang Ang II induces fibronectin expression via the AT1 recep-
II-induced fibronectin expression. Incubation of HPMC tor in HPMC.
with the AT1 receptor antagonist RNH6270 abolished the
up-regulation of fibronectin mRNA level by 10 nmol/L
Ang II in a dose-dependent manner (Fig. 4A). Accord- Ang II induces activation of ERK1/2 and p38 MAPK, but
ingly, up-regulation of fibronectin protein expression was not JNK in HPMC
completely inhibited by RNH6270 at 1 lmol/L (Fig. 4B). Having demonstrated that Ang II induces fibronectin
In contrast, the AT2 receptor antagonist PD123319 had expression via the AT1 receptor, we examined the intra-
no effect upon Ang II-induced fibronectin mRNA levels cellular signaling mechanisms in HPMC. Ang II is known
1132 Kiribayashi et al: Angiotensin II induces fibronectin expression via ERK1/2 and p38 MAPK

A to induce a number of cellular responses via ERK1/2, p38

MAPK, and JNK in various cell types [21–23]. There-
Phospho-ERK 1/2 fore, we examined whether Ang II treatment activates
Total ERK 1/2 these kinases in HPMC. As shown in Figure 6, stimu-
B lation of HPMC with 10 nmol/L Ang II induced a rapid
* activation (phosphorylation) of ERK1/2 and p38 MAPK,
Phospho/total ERK 1/2, fold

3.0
which peaked within several minutes and then gradually
decreased (2.7-fold at 5 minutes and 2.0-fold at 2 minutes
2.0 vs. control, respectively), whereas JNK was not activated.
Blots for total MAPKs remained constant throughout the
duration of the experiments.
1.0

Ang II induces fibronectin expression via ERK1/2 and

0 p38 MAPK
0 2 5 10 30 60 min
*P < 0.05 vs. time 0 Addition of 0.1 to 10 lmol/L PD98059, a specific
MAPK/ERK kinase 1 inhibitor, substantially inhibited
C ERK1/2 phosphorylation in Ang II-stimulated HPMC
Phospho-p38 MAPK (Fig. 7A and B). Accordingly, addition of 10 lmol/L
PD98059 completely inhibited fibronectin secretion into
Total p38 MAPK
the media (Fig. 7C and D).
D Addition of 0.2 to 20 lmol/L SB203580, a specific in-
Phospho/total p38 MAPK, fold

* hibitor of p38 MAPK, significantly reduced the phospho-

2.0 rylation of p38 MAPK (Fig. 8A and B). Western blotting
*
showed that 20 lmol/L SB203580 completely inhibited
Ang II-induced fibronectin secretion (Fig. 8C and D).
These data indicate that ERK1/2 and p38 MAPK play
1.0 a major role in Ang II-induced fibronectin expression,
whereas JNK is not involved.
*

0 DISCUSSION
0 2 5 10 30 60 min Peritoneal fibrosis is a crucial complication in CAPD
*P < 0.05 vs. time 0
patients, and is due to various factors, including the
E bioincompatibility of dialysate (high glucose content, low
Phospho-p54 JNK pH, hyperosmolality, lactate, glucose degradation prod-
Phospho-p46 JNK ucts, etc.) and severe or repeated episodes of infectious
Total p54 JNK peritonitis [2–4]. Recently, various improvements have
Total p46 JNK been made to the constituents of CAPD fluid (icodex-
F trin, neutralized pH, sodium bicarbonate, etc.), as well as
NS peritoneal dialysis devices (twin-bag system, connecting
Phospho/total JNK, fold

devices with ultraviolet light, etc.). These modifications

1.0
0 fibrosis affecting various organs, such as kidney [24] and
0 2
Fig. 6. Angiotensin II (Ang II) activates ERK1/2 and p38 MAPK, but
not JNK in human peritoneal mesothelial cells (HPMC). Quiescent
HPMC were stimulated with 10 nmol/L Ang II for the times indicated,
and then cells were lysed and analyzed by Western blotting for (A)
phosphorylated and total ERK1/2, (C) phosphorylated and total p38
MAPK, and (E) phosphorylated and total JNK. (B) Ratio of phospho-
ERK1/2 to total ERK1/2. (D) Ratio of phospho-p38 MAPK to total p38
have improved clinical outcome, but have not prevented
peritoneal fibrosis, thereby suggesting the existence of
unknown mechanisms involved in the initiation and pro-
gression of peritoneal fibrosis.
In vitro and in vivo studies have demonstrated that
the renin-angiotensin system plays an important role in
5 10 30 60 min heart [25]. However, in contrast with the well-recognized
MAPK. (F) Ratio of phospho-p46 and p54 JNK to total p46 and p54
JNK. Western blots shown are representative of similar results obtained
from 3 separate experiments. Values are mean ± SEM of 3 individual
experiments. ∗ P < 0.05 vs. time 0.
 Kiribayashi et al: Angiotensin II induces fibronectin expression via ERK1/2 and p38 MAPK 1133

A A
Phospho-ERK 1/2 Phospho-p38 MAPK
Total ERK 1/2 Total p38 MAPK

* B *
B * *
*

Phospho/total p38 MAPK,

3.0
Phospho/total ERK 1/2,

2.0

2.0
fold

fold
1.0
1.0

0
0
PD98059 (µmol/L) 0 0.1 1 10 0 0.1 1 10
SB203580 (µmol/L) 0 0.2 2 20 0 0.2 2 20
Ang II (10 nmol/L) − − − − + + + +
Ang II (10 nmol/L) − − − − + + + +
*P < 0.05
*P < 0.05
C
C
Fibronectin
Fibronectin
D
2.0 * D
Fibronectin/total protein,

* 2.0 *

Fibronectin/total protein,
*
fold

1.0 fold
1.0

0 0
PD98059 (10 µmol/L) − + − + SB203850 (20 µmol/L) − + − +
Ang II (10 nmol/L) − − + + *P < 0.05 Ang II (10 nmol/L) − − + + *P < 0.05
Fig. 7. Angiotensin II (Ang II)-induced fibronectin expression in
Fig. 8. Angiotensin II (Ang II)-induced fibronectin expression in hu-
human peritoneal mesothelial cells (HPMC) operates via ERK1/2.
man peritoneal mesothelial cells (HPMC) operates via p38 MAPK.
(A) Quiescent HPMC were incubated with various concentrations of
(A) Quiescent HPMC were incubated with various concentrations of
PD98059 or 0.02% DMSO vehicle control for 60 minutes before incu-
SB203580 or 0.02% DMSO vehicle control for 60 minutes before incu-
bation with 10 nmol/L Ang II or control media. HPMC were stimulated
bation with 10 nmol/L Ang II or control media. HPMC were stimulated
with 10 nmol/L Ang II for 5 minutes, and then cells were lysed and ex-
with 10 nmol/L Ang II for 2 minutes, and then cells were lysed and ex-
amined for phosphorylation of ERK1/2 by Western blotting. The blots
amined for phosphorylation of p38 MAPK by Western blotting. The
shown are representative of similar results obtained from 4 separate ex-
blots shown are representative of similar results obtained from 4 sepa-
periments. Preincubation with 10 lmol/L PD98059 substantially inhib-
rate experiments. Preincubation with 20 lmol/L SB203580 substantially
ited both basal and Ang II-induced ERK1/2 activation compared with
inhibited both basal and Ang II-induced p38 MAPK activation com-
0.02%DMSO vehicle control. (B) Graph shows the ratio of phospho- to
pared with 0.02% DMSO vehicle control. (B) Graph shows the ratio
total ERK1/2. Values are mean ± SEM of 3 individual experiments. ∗ P <
of phospho- to total p38 MAPK. Values are mean ± SEM of 4 individ-
0.05. (C) Quiescent HPMC were incubated with 10 lmol/L PD98059
ual experiments. ∗ P < 0.05. (C) Quiescent HPMC were incubated with
or 0.02% DMSO vehicle control for 60 minutes before incubation with
20 lmol/L SB203580 or 0.02% DMSO vehicle control for 60 minutes
10 nmol/L Ang II or control media. The representative blots show se-
before incubation with 10 nmol/L Ang II or control media. The repre-
creted fibronectin protein. (D) Graph shows the levels of fibronectin
sentative blots show secreted fibronectin protein. (D) Graph shows the
protein in the culture supernatant (15 lg of protein loaded per lane)
levels of fibronectin protein in the culture supernatant (15 lg of protein
relative to control levels. Values are mean ± SEM of 3 individual ex-
loaded per lane) relative to control levels. Values are mean ± SEM of
periments. ∗ P < 0.05.
3 individual experiments. ∗ P < 0.05.

The expression of AT1 and AT2 receptors has been

efficacy of ACEI or ARB in the treatment of renal or
cardiovascular diseases [24], very limited information is
available regarding the relationship between the renin-
angiotensin system and the pathogenesis of peritoneal
fibrosis.
investigated in mesangial cells [23], macrophages [26],
HUVEC [20], but their presence on HPMC had not re-
ceived attention. The present study demonstrates for the
first time that HPMC express both AT1 and AT2 recep-
tors, and that Ang II increases the mRNA expression and
1134 Kiribayashi et al: Angiotensin II induces fibronectin expression via ERK1/2 and p38 MAPK
protein secretion of fibronectin via activation of ERK1/2
and p38 MAPK, but not JNK. In addition, we demon-
strate that these responses are specifically mediated by
the AT1 receptor because RNH6270, a specific inhibitor
of AT1 receptor, suppressed Ang II-induced expression
of fibronectin in HPMC, while the AT2 receptor blocker
PD123319 had no effect. These findings in HPMC are con-
sistent with a previous study in cultured mesangial cells
in which Ang II induced transcription and biosynthesis
of fibronectin via the AT1 receptor [27].
Ang II stimulation of quiescent HPMC resulted in in-
creased expression of fibronectin mRNA followed by in-
creased secretion of fibronectin protein into the culture
media. Although maximal induction of Ang II-induced
fibronectin secretion was seen with 10 nmol/L Ang II, an
increase in fibronectin mRNA was observed with Ang II
concentrations ranging between 1 to 100 nmol/L. These
levels are high compared with those found in plasma, but
local Ang II levels in the peritoneal cavity may be signifi-
cantly higher than those found in the circulation, as we de-
scribed above. The elevated levels of Ang II in the effluent
of infectious peritonitis might result from local induction
by activated neutrophils, which are capable of generating
Ang II with cathepsin G [28, 29]. Thus, considering di-
lution by dialysate, it is conceivable that concentrations
of Ang II including 1 to 100 nmol/L may be present lo-
cally in the peritoneal cavity and, therefore, have the po-
tential to influence the behavior of HPMC. This may be
one of the mechanisms whereby Ang II regulates tissue
repair and remodeling following peritoneal injury espe-
cially after infectious peritonitis. However, prolonged or
excessive activation of the renin-angiotensin system in
the peritoneal cavity during the pathophysiologic condi-
tions associated with CAPD may initiate or exacerbate
peritoneal fibrosis.
The ability of Ang II to up-regulate fibronectin ex-
pression by HPMC raised the question of the signaling
pathways involved. ERK1/2, p38 MAPK, and JNK are
cascades of serine/threonine kinases that transduce sig-
nals from the cell surface to the nucleus in response to
growth factors and cellular stress [30, 31]. These kinases
are reported to mediate various cell responses of HPMC.
For example, D-glucose-induced prostaglandin E 2 syn-
thesis is via activation of ERK1/2 [32], while fibronectin
mRNA expression is via p38 MAPK [33]. Furthermore,
both the ERK1/2 and p38 MAPK pathways are inde-
pendently required for TGF-b-induced up-regulation of
gene expression for plasminogen activator inhibitor type-
1 [34]. However, there have been no reports regarding the
role of MAPK signaling pathways activated by Ang II in
HPMC. The present study shows that Ang II-induced fi-
bronectin expression in HPMC was dependent on signal-
ing through ERK1/2 and p38 MAPK, but not JNK. This
finding is consistent with a similar study in renal intersti-
tial fibroblasts [35].
Many of the stimulants that activate the ERK1/2 path-
way also activate the p38 MAPK pathway without acti-
vating the JNK pathway [36–38]. Indeed, the ERK1/2
and p38 MAPK pathways share common elements in
both their upstream signaling cascades [38, 39] and down-
stream substrates [40, 41]. The requirement of ERK1/2
and p38 MAPK signaling for Ang II-induced fibronectin
expression in HPMC indicates, at least in part, that ac-
tivation of both kinases may play an important role
in accumulation of fibronectin in the peritoneum. Fur-
ther studies are required to clarify whether activation of
ERK1/2 and p38 MAPK contributes solely to transcrip-
tional regulation of the fibronectin gene, or if they have
an additional role in post-transcriptional events involved
in fibronectin expression.
CONCLUSION
This study demonstrates that Ang II stimulation of
HPMC increased mRNA expression and secretion of fi-
bronectin protein. Ang II-induced fibronectin expression
is via the AT1 receptor and signaling through the ERK1/2
and p38 MAPK pathways. These results suggest the po-
tential importance of these MAPK pathways in Ang II-
induced initiation and progression of peritoneal fibrosis
and the therapeutic potential of ARB in the prevention
or treatment of peritoneal fibrosis in patients receiving
CAPD.
ACKNOWLEDGMENTS
The authors wish to thank Professor Tetsuya Toge and Dr. Kazuhiro
Yoshida (Department of Surgical Oncology, Research Institute for Ra-
diation Biology and Medicine, Hiroshima University) for their cooper-
ation in collecting samples from abdominal operation patients. We also
thank Professor Masayuki Kambe and Ms. Fujiko Kohno (Department
of Clinical Laboratory Medicine, Division of Medical Intelligence and
Informatics, Programs for Applied Biomedicine, Hiroshima University
Graduate School of Biomedical Science) for technical assistance. This
work was supported by the Baxter PD Fund, and also by grants from
Japanese Association of Dialysis Physicians.
Reprint requests to Kei Kiribayashi, M.D., Department of Molecu-
lar and Internal Medicine, Graduate School of Biomedical Sciences,
Hiroshima University, Hiroshima, Japan, 1–2-3, Kasumi, Minami-ku,
Hiroshima 734–8551, Japan.
E-mail: kkiri@hiroshima-u.ac.jp
REFERENCES
1. DOBBIE JW: Morphology of the peritoneum in CAPD. Blood Purif
7:74–85, 1989
2. NAKAMOTO H, KAWAGUCHI Y, SUZUKI H: Encapsulating peritoneal
sclerosis in patients undergoing continuous ambulatory peritoneal
dialysis in Japan. Adv Perit Dial 18:119–123, 2002
3. MORTIER S, DE VRIESE AS, VAN DE VOORDE J, et al: Hemodynamic
effects of peritoneal dialysis solutions on the rat peritoneal mem-
brane: Role of acidity, buffer choice, glucose concentration, and
glucose degradation products. J Am Soc Nephrol 13:480–489, 2002
4. WONG TY, SZETO CC, LAI KB, et al: Longitudinal study of peritoneal
membrane function in continuous ambulatory peritoneal dialysis:
Relationship with peritonitis and fibrosing factors. Perit Dial Int
20:679–685, 2000
 Kiribayashi et al: Angiotensin II induces fibronectin expression via ERK1/2 and p38 MAPK
5. WILLIAMS JD, CRAIG KJ, TOPLEY N, et al: Morphologic changes in
the peritoneal membrane of patients with renal disease. J Am Soc
Nephrol 13:470–479, 2002
6. STYLIANOU E, JENNER LA, DAVIES M, et al: Isolation, culture and
characterization of human peritoneal mesothelial cells. Kidney Int
37:1563–1570, 1990
7. YUNG S, DAVIES M: Response of the human peritoneal mesothelial
cell to injury: An in vitro model of peritoneal wound healing. Kidney
Int 54:2160–2169, 1998
8. RUIZ-ORTEGA M, LORENZO O, SUZUKI Y, et al: Proinflammatory
actions of angiotensins. Curr Opin Nephrol Hypertens 10:321–329,
2001
9. WOLF G, NEILSON EG: Angiotensin II as a renal growth factor. J Am
Soc Nephrol 3:1531–1540, 1993
10. MEZZANO SA, RUIZ-ORTEGA M, EGIDO J: Angiotensin II and renal
fibrosis. Hypertension 38:635–658, 2001
11. BOUZEGRHANE F, THIBAULT G: Is angiotensin II a proliferative factor
of cardiac fibroblasts? Cardiovasc Res 53:304–312, 2002
12. BERRY C, TOUYZ R, DOMINICZAK AF, et al: Angiotensin recep-
tors: Signaling, vascular pathophysiology, and interactions with ce-
ramide. Am J Physiol Heart Circ Physiol 281:H2337–2365, 2001
13. DELBAERE A, BERGMANN PJ, GERVY-DECOSTER C, et al: Periovula-
tory elevation of angiotensin II in the peritoneal fluid during the
human menstrual cycle. J Clin Endocrinol Metab 81:2810–2815,
1996
14. DUMAN S, GUNAL AI, SEN S, et al: Does enalapril prevent peritoneal
fibrosis induced by hypertonic (3.86%) peritoneal dialysis solution?
Perit Dial Int 21:219–224, 2001
15. SAWADA T, ISHII Y, TOJIMBARA T, et al: The ace inhibitor, quinapril,
ameliorates peritoneal fibrosis in an encapsulating peritoneal scle-
rosis model in mice. Pharmacol Res 46:505–510, 2002
16. IMAI H, NAKAMOTO H, FUKUSHIMA R, et al: Role of adhesion
molecules in the progression of peritoneal sclerosis. Adv Perit Dial
19:180–185, 2003
17. HYNES R: Molecular biology of fibronectin. Annu Rev Cell Biol
1:67–90, 1985
18. OGATA S, YORIOKA N, KOHNO N: Glucose and prednisolone alter
basic fibroblast growth factor expression in peritoneal mesothelial
cells and fibroblasts. J Am Soc Nephrol 12:2787–2796, 2001
19. CHOMCZYNSKI P, SACCHI N: Single-step method of RNA isolation by
acid guanidinium thiocyanate-phenol-chloroform extraction. Anal
Biochem 162:156–159, 1987
20. SOHN HY, RAFF U, HOFFMANN A, et al: Differential role of an-
giotensin II receptor subtypes on endothelial superoxide formation.
Br J Pharmacol 131:667–672, 2000
21. UCHIYAMA-TANAKA Y, MATSUBARA H, NOZAWA Y, et al: An-
giotensin II signaling and HB-EGF shedding via metalloproteinase
in glomerular mesangial cells. Kidney Int 60:2153–2163, 2001
22. USHIO-FUKAI M, ALEXANDER RW, AKERS M, GRIENDLING KK: p38
mitogen-activated protein kinase is a critical component of the
redox-sensitive signaling pathways activated by angiotensin II. Role
in vascular smooth muscle cell hypertrophy. J Biol Chem 273:15022–
15029, 1998
23. NAITO T, MASAKI T, NIKOLIC-PATERSON DJ, et al: Angiotensin II
induces thrombospondin-1 production in human mesangial cells via
p38 MAPK and JNK: A mechanism for activation of latent TGF-
beta1. Am J Physiol Renal Physiol 286:F278–287, 2004
24. DEFERRARI G, RAVERA M, DEFERRARI L, et al: Renal and cardiovas-
cular protection in type 2 diabetes mellitus: Angiotensin II receptor
blockers. J Am Soc Nephrol 13(Suppl 3):S224–S229, 2002
1135
25. SCHIFFRIN EL: Vascular and cardiac benefits of angiotensin receptor
blockers. Am J Med 113:409–418, 2002
26. OKAMURA A, RAKUGI H, OHISHI M, et al: Upregulation of
renin-angiotensin system during differentiation of monocytes to
macrophages. J Hypertens 17:537–545, 1999
27. ARDAILLOU R, CHANSEL D, CHATZIANTONIOU C, DUSSAULE JC:
Mesangial AT1 receptors: Expression, signaling, and regulation. J
Am Soc Nephrol 10(Suppl 11):S40–S46, 1999
28. WINTROUB BU, KLICKSTEIN LB, WATT KW: A human neutrophil-
dependent pathway for generation of angiotensin II. Purification
of the product and identification as angiotensin II. J Clin Invest
68:484–490, 1981
29. OWEN CA, CAMPBELL EJ: Angiotensin II generation at the cell sur-
face of activated neutrophils: Novel cathepsin G-mediated catalytic
activity that is resistant to inhibition. J Immunol 160:1436–1443,
1998
30. COBB MH, GOLDSMITH EJ: How MAP kinases are regulated. J Biol
Chem 270:14843–14846, 1995
31. KYRIAKIS JM, AVRUCH J: Sounding the alarm: Protein kinase cas-
cades activated by stress and inflammation. J Biol Chem 271:24313–
24316, 1996
32. SITTER T, HASLINGER B, MANDL S, et al: High glucose increases
prostaglandin E 2 synthesis in human peritoneal mesothelial cells:
Role of hyperosmolarity. J Am Soc Nephrol 9:2005–2012, 1998
33. XU ZG, KIM KS, PARK HC, et al: High glucose activates the p38
MAPK pathway in cultured human peritoneal mesothelial cells.
Kidney Int 63:958–968, 2003
34. HIRASHIMA Y, KOBAYASHI H, SUZUKI M, et al: Transforming growth
factor-beta1 produced by ovarian cancer cell line HRA stimulates
attachment and invasion through an up-regulation of plasminogen
activator inhibitor type-1 in human peritoneal mesothelial cells. J
Biol Chem 278:26793–26802, 2003
35. SEKINE S, NITTA K, UCHIDA K, et al: Possible involvement of mitogen-
activated protein kinase in the angiotensin II-induced fibronectin
synthesis in renal interstitial fibroblasts. Arch Biochem Biophys
415:63–68, 2003
36. TOUYZ RM, HE G, EL MABROUK M, et al: Differential activation of
extracellular signal-regulated protein kinase 1/2 and p38 mitogen
activated-protein kinase by AT1 receptors in vascular smooth mus-
cle cells from Wistar-Kyoto rats and spontaneously hypertensive
rats. J Hypertens 19:553–559, 2001
37. WEI C, CARDARELLI MG, DOWNING SW, MCLAUGHLIN JS: The effect
of angiotensin II on mitogen-activated protein kinase in human car-
diomyocytes. J Renin Angiotensin Aldosterone Syst 1:379–384, 2000
38. WOO CH, KIM JH: Rac GTPase activity is essential for lipopolysac-
charide signaling to extracellular signal-regulated kinase and p38
MAP kinase activation in rat-2 fibroblasts. Mol Cells 13:470–475,
2002
39. EGUCHI S, DEMPSEY PJ, FRANK GD, et al: Activation of MAPKs
by angiotensin II in vascular smooth muscle cells. Metalloprotease-
dependent EGF receptor activation is required for activation of
ERK and p38 MAPK but not for JNK. J Biol Chem 276:7957–7962,
2001
40. TANOUE T, ADACHI M, MORIGUCHI T, NISHIDA E: A conserved dock-
ing motif in MAP kinases common to substrates, activators and
regulators. Nat Cell Biol 2:110–116, 2000
41. ROCIC P, JO H, LUCCHESI PA: A role for PYK2 in ANG II-dependent
regulation of the PHAS-1-eIF4E complex by multiple signaling
cascades in vascular smooth muscle. Am J Physiol Cell Physiol
285:C1437–1444, 2003