MOLECULAR IDENTIFICATION OF BACTERIA FROM UNKNOWN

DNA SEQUENCE
INTRODUCTION:

The Universal Method (UM) described here will allow the detection of any bacterial rDNA
leading to the identification of that bacterium. The method should allow prompt and accurate
identification of bacteria. The principle of the method is simple; when a pure PCR product of
the 16S gene is obtained, sequenced, and aligned against bacterial DNA data base, then the
bacterium can be identified.

Historically, identification and classification of eubacteria are based on phenotypic

characteristics . Early molecular techniques used in bacterial classification were based on GC
content , plasmid profiling, and compatibility to genetic transformation . Currently, two
Name: Ayesha khalid
fundamental molecular applications to:
Submitted are Dr.
beingSadia
extensively
ljaz utilized in bacterial detection and
Subject:
identification; these are Advance topics
based on hybridization in microbiology
and nucleotide sequencing.Molecular diagnosis is
playing an increasingly Practical
important work: Molecular
role in the rapid detectionldentification ofofBacteria
and identification pathogenicfrom
organisms in clinicalUnknown
samples. TheDNA geneticSequence
variation of (week
ribosomal10-11)
genes in bacteria offers an
alternative to culturingDate:
for the 12th January
detection 2021 of these organisms.
and identification

The use of 16S rRNA gene sequences to study bacterial phylogeny and taxonomy has been by
far the most common housekeeping genetic marker used for a number of reasons. These reasons
include (i) its presence in almost all bacteria, often existing as a multigene family, or operons;
(ii) the function of the 16S rRNA gene over time has not changed, suggesting that random
sequence changes are a more accurate measure of time (evolution); and (iii) the 16S rRNA gene
(1,500 bp) is large enough for informatics purposes.

Natrinema altunense strain, a halophilic archaeal strain, was isolated from a high-altitude (3884
m) salt lake in Xinjiang, China. This strain requires at least 1.7 M NaCl to grow and can grow
anaerobically in the presence of nitrate.
UNKNOWN SEQUENCE OF 16S rRNA

ATTCCGGTTGATCCTGCCGGAGGTCATTGCTATTGGAGTCCGATTTAGCCATGCTAGTTGCACGAGTTTA
GACTCGTAGCAGATAGCTCAGTAACACGTGGCCAAACTACCCTATGGATCCGAATAACCTCGGGAAACTG
AGGCTAATATGGAATAGCGTTCATCGCCTGGAGTGGCACGAACGCGAAACGTTACGGCGCCATAGGATGT
GGCTGCGGCCGATTAGGTAGACGGTGGGGTAACGGCCCACCGTGCCCATAATCGGTACGGGTTGTGAGAG
CAAGAGCCCGGAGACGGTATCTGAGACAAGATACCGGGCCCTACGGGGCGCAGCAGGCGCGAAACCTTTA
CACTGCACGCGAGTGCGATAAGGGGACTCCGAGTGCGAGGGCATATAGTCCTCGCTTTTCACGACCGTAA
GGTGGTCGTAGAATAAGTGCTGGGCAAGACCGGTGCCAGCCGCCGCGGTAATACCGGCAGCACGAGTGAT
GACCGCTATTATTGGGCCTAAAGCGTCCGTAGCTGGCCACGCAAGTCTATCGGGAAATCCGCGCGCTTAA
CGCGCGGGCGTCCGGTGGAAACTGCGTGGCTTGGGACCGGAAGACCAGAGGGGTACGTCCGGGGTAGGAG
TGAAATCCCGTAATCCTGGACGGACCACCGGTGGCGAAAGCGCCTCTGGAAGACGGATCCGACGGTGAGG
GACGAAAGCTCGGGTCACGAACCGGATTAGATACCCGGGTAGTCCGAGCTGTAAACGATGTCTGCTAGGT
GTGGCACAGGCTACGAGCCTGTGCTGTGCCGTAGGGAAGCCGTGAAGCAGACCGCCTGGGAAGTACGTCC
GCAAGGATGAAACTTAAAGGAATTGGCGGGGGAGCACTACAACCGGAGGAGCCTGCGGTTTAATTGGACT
CAACGCCGGACATCTCACCAGCATCGACAATGTGCAGTGAACGTCAGGTTGATGACCTTACTGGAGCCAT
TGAGAGGAGGTGCATGGCCGCCGTCAGCTCGTACCGTGAGGCGTCCTGTTAAGTCAGGCAACGAGCGAGA
CCCGCACTCCTAATTGCCAGCAACACCCTTGCGGTGGTTGGGTACATTAGGAGGACTGCCAGTGCCAAAC
TGGAGGAAGGAACGGGCAACGGTAGGTCAGTATGCCCCGAATGTGCTGGGCGACACGCGGGCTACAATGG
CCGAGACAGTGGGATGCAACCCCGAAAGGGGACGCTAATCTCCGAAACTCGGTCGTAGTTCGGATTGAGG
GCTGAAACTCGCCCTCATGAAGCTGGATTCGGTAGTAATCGCGCCTCAGAAGGGCGCGGTGAATACGTCC
CTGCTCCTTGCACACACCGCCCGTCAAAGCACCCGAGTGGGGTCCGGATGAGGCCGACGCAACGTCGGTC
GAATCTGGGCTCCGCAAGGGGGCTTAAGTCGTAACAAGGTAGCCGTAGGGGAATCTGCGGCTGGATCACC
TCCA

PROCEDURE

Following steps are used to find out bacteria by using unknown sequence:

UNROOTED PHYLOGENETIC TREE

1. BLAST: Basic Local Alignment Search Tool

A computer program that identifies homologous genes in different organisms (such as worms,
the fruit fly, mice, and humans). Homologous genes are genes in different species that share
similar structures and functions.
 First we go on google and open BLAST website. BLAST web has two types. Nucleotide
BLAST and protein BLAST , but we will go for nucleotide BLAST. Becuse we have
nucleotide sequence .

 We will copy our unknown sequence or query sequence and paste it in query box. Then
we will do some changes in parameters. As we know this is 16srRNA so,we will choose
rRNA database option. Furthermore we want to find exact match that is why we will
exclude model organisms and uncultured environmental samples. Then we will select
highly similar sequences(megablast).
 After setting this all we will BLAST the data.

 Then it will search in whole database that which organism is matched with this sequence
most close. After several times refreshing this will give you result. This shows that
 Ferrimonas marina strain A4D-4 16S ribosomal RNA, partial sequence is 100%
matched.
 E value tells how much this query coverage or result is significant . the more closer to 1
or 0 value the more significant the result is.

 It also gives graphical symmetry which tells us about query coverage of the organism.

 It also gives us alignments and taxonomy.

2. MEGASOFTWARE
 Download the most related 16srRNA sequences to make phylogenetic trees.
 We will open mega app,click on alignment > edit/build alignment > create new
alignment > DNA.

 Then we will get this box.

 We will add query sequence in the downloaded sequence fron NCBI site. Then copy the
all sequences and paste in the above box. We will get data unarranged.
 We will select all sequences > alignment > aligned by clustralW > Ok .
 First it will do pair alignment then multiple alignment and then give aligned sequence
data. As below.

 We will then save the data as such click on data > export alignment > mega format
> save > give title > no protein( because 16s does not code protein).
 We will go on main window and click on phylogeny . construct/test neighbor joining
tree and open your file.
 Change some parameters like in phylogeny test,select booststrap method this tells how
much significant your data is.
 Then in no of booststrap replications we will edit 1000 times,greater the no greater will
be significant data given.
 Remaing parameters will be same.
 Click ok.
 Tree will be formed.
 There is no common ancestor ,this is known as unrooted tree.
  Then I named my sequence as Natrinema altunensa strain A.
 This tree can give you information about percentage and also distance.
 Tree could be circular but here we will make traditional rectangular tree.
 Save file in any form and paste the tree in your document.

ROOTED PHYLOGENETIC TREE

 The tree in which we add an out group.
 We will open google and go on NCBI site NCBI site National Center for
Biotechnology Information.
 now we need to find out group bacteria for that we will search about Natrinema
altunensa which is most matched strain with our query sequence.

((Scientific classification

Domain: Archaea

Kingdom: Euryarchaeota

Phylum: Euryarchaeota

Class: Halobacteria

Order: Halobacteriales

Family: Halobacteriaceae

Genus: Natrinema

Species: Natrinema altunensa

 so it has Halobacteria class, now we can pick up any bacteria from this class because
they have same family. For this we will search out bacteria which came under this class.
 From this I selected Haloferax denitrificans. Then I go on NCBI site clicked on all
databases and selected nuclieotide option .Paste the beggiatoa 16s rRNA in search baar.
Then it will give you different strains,try to choose ATTC type strain which is best if
there is present.
 So I selected Haloferax denitrificans 16S ribosomal RNA (16S rRNA) gene, partial
sequence this strain. Open your selected stain there will be all of its information,we want
FASTA sequence so we will open it and copy that sequence and then paste it in your
previous file in we added query sequence.we add this outgroup sequence next to query
sequence.
 we will repeate the steps like copy all the sequences,paste them in MEGA ,align
them,export mega file,open phylogeny with neighbor option,open your fie with same
parameters which we have changed in unrooted tree.
 this gives you rooted tree with common ancestor ,from which your query sequence is so
far.this shows where will your query strain stand in evolutionary tree whether it is old or
new one.
  it will be new if it will away from common ancestor.

RESULT

Fi
g: Unrooted Phylogenetic tree

The evolutionary history was inferred using the Neighbor-Joining method [1]. The optimal tree is
shown. The percentage of replicate trees in which the associated taxa clustered together in the
bootstrap test (1000 replicates) are shown next to the branches [2]. The tree is drawn to scale,
with branch lengths in the same units as those of the evolutionary distances used to infer the
phylogenetic tree. The evolutionary distances were computed using the Maximum Composite
Likelihood method [3] and are in the units of the number of base substitutions per site. The
proportion of sites where at least 1 unambiguous base is present in at least 1 sequence for each
descendent clade is shown next to each internal node in the tree. This analysis involved 15
nucleotide sequences. All ambiguous positions were removed for each sequence pair (pairwise
deletion option). There were a total of 1475 positions in the final dataset. Evolutionary analyses
were conducted in MEGA X.
Fig: Rooted phylogenetic tree

The evolutionary history was inferred using the Neighbor-Joining method [1]. The optimal tree is
shown. The percentage of replicate trees in which the associated taxa clustered together in the
bootstrap test (1000 replicates) are shown next to the branches [2]. The tree is drawn to scale,
with branch lengths in the same units as those of the evolutionary distances used to infer the
phylogenetic tree. The evolutionary distances were computed using the Maximum Composite
Likelihood method [3] and are in the units of the number of base substitutions per site. The
proportion of sites where at least 1 unambiguous base is present in at least 1 sequence for each
descendent clade is shown next to each internal node in the tree. This analysis involved 16
nucleotide sequences. All ambiguous positions were removed for each sequence pair (pairwise
deletion option). There were a total of 1477 positions in the final dataset. Evolutionary analyses
were conducted in MEGA X.

DISCUSSION:

The most convenient way of presenting phylogenetic information is using a phylogenetic tree. In
a phylogenetic tree, every node represents a species. Nodes are labeled, either with species
names or the values (also referred to as states) of their characters, and the edges represent the
genetic connections. Phylogenetic trees take several forms: They can be rooted or unrooted,
binary or general, and may show, or not show, edge lengths. A rooted tree is a tree in which one
of the nodes is stipulated to be the root, and thus the direction of ancestral relationships is
determined. An unrooted tree, as could be imagined, has no pre-determined root and therefore
induces no hierarchy. Therefore, in this case, the distance between the nodes should be
symmetric (since the tree edges are not directed). Rooting an unrooted tree involves inserting a
new node, which will function as the root node. This can be done by introducing an outgroup, a
species that is definitely distant from all the species of interest. The proposed root will be the
direct predecessor of the outgroup.

Here we used two kinds of phylogenetic trees,on rooted which has common ancestor,this shows
the lager the distance between unknown and common ancestor the newer the bacteria is,it means
this evolves recently.second one is unrooted tree in which we do not use any outgroup that is
common ancestor,it just shows the distance among different bacteria but not with ancestral spp.

It is crucial in sequence comparisons to be able to properly align the two molecules in order to
identify regions of sequence homology and sequence and sequence heterogeneity. the sequence
of the molecule chosen should change at a rate commensurate with the evolutionary distance
measured. And in fact the broader the phylogenetic distance being measured the slower must be
the rate at which the sequence changes.

REFERENCES:

 HongCheng,Ying-YiHuo1,JingHu2,Xue-WeiXu1*andMinWu2* . High quality draft genome

sequence of an extremely halophilic archaeon Natrinema altunense strain AJ2T. (2017)12:25.
 https://jcm.asm.org/content/45/9/2761
 http://www.cs.tau.ac.il/~rshamir/algmb/00/scribe00/html/lec08/node3.html#:~:text=In%20a
%20phylogenetic%20tree%2C%20every%20node%20represents%20a%20species.&text=A
%20rooted%20tree%20is%20a,and%20therefore%20induces%20no%20hierarchy.