A Comprehensive Study of Polymorphic Sites along the

HLA-G Gene: Implication for Gene Regulation and Evolution

Erick C. Castelli,*,1 Celso T. Mendes-Junior,2 Luciana C. Veiga-Castelli,3 Michel Roger,4
Philippe Moreau,5 and Eduardo A. Donadi3
1
Laboratório de Genética Molecular e Citogenética, Departamento de Biologia Geral, Instituto de Ciências Biológicas, Universidade
Federal de Goiás, Goiânia, Brasil
2
Departamento de Quı́mica, Faculdade de Filosofia, Ciências e Letras de Ribeirão Preto, Universidade de São Paulo, Ribeirão Preto-
SP, Brasil
3
Divisão de Imunologia Clı́nica, Departamento de Clı́nica Médica, Faculdade de Medicina de Ribeirão Preto, Universidade de São
Paulo, Ribeirão Preto-SP, Brasil
4
Département de Microbiologie et Immunologie, Centre Hospitalier de L’Université de Montréal, Montréal, Québec, Canada
5
Commissariat à l’Energie Atomique et aux Energies Alternatives, Université Paris VII/DSV/I2BM/Service de Recherches en Hémato-

Research
Downloaded from https://academic.oup.com/mbe/article/28/11/3069/1045931
Immunologie, Institut Universitaire d’Hématologie, Hôpital Saint-Louis, Paris, France
*Corresponding author: E-mail: erick.castelli@gmail.com.
Associate editor: Yoko Satta

Abstract

article
HLA-G molecule plays an important role on immune response regulation and has been implicated on the inhibition of T
and natural killer cell cytolytic function and inhibition of allogeneic T-cell proliferation. Due to its immune-modulator
properties, the HLA-G gene expression has been associated with the outcome of allograft and of autoimmune, infectious,
and malignant disorders. Several lines of evidence indicate that HLA-G polymorphisms at the 5#-upstream regulatory
region (5# URR) and 3#-untranslated region (3# UTR) may influence the HLA-G expression levels. Because Brazilians
represent one of the most heterogeneous populations in the world with the widest HLA-G coding region variability already
detected among the studied populations, a high level of variability and haplotype diversity would be expected in Brazilians.
On this basis, the 5# URR, coding, and 3# UTR variability were evaluated in a Brazilian series consisting of 100 healthy bone
marrow donors, as well as the linkage disequilibrium pattern along the gene and the extended haplotypes encompassing
several gene segment variations. The HLA-G locus seems to present six different HLA-G lineages showing functional
variations mainly in nucleotides of the regulatory regions. Differences were observed at the 5# URR in positions that either
coincide with or are close to transcription factor–binding sites and at the 3# UTR mainly in positions that have already
been reported to influence HLA-G mRNA availability. We report several lines of evidence for balancing selection acting on
the regulatory regions, which may indicate that these HLA-G lineages may be related to the differential HLA-G expression
profiles.
Key words: HLA-G, 5# upstream regulatory region (5#URR), promoter, 3# untranslated region (3# UTR), polymorphism,
haplotypes, Brazilians.

by guest on 30 August 2022

Introduction
The HLA complex is a 3.6 Mb high-density gene region lo-
cated at the 6p21.3 chromosome region, encompassing
more than 200 genes (Klein and Sato 2000a, 2000b). The
HLA-G gene is a nonclassical class I HLA locus, which, like
its classical counterparts, is composed of eight exons and
seven introns. In contrast to classical class I loci, HLA-G has
a stop codon at exon 6, leading to a short cytoplasmic tail,
exhibits a 5# upstream regulatory (or promoter) region (5#
URR) extending at least 1.4 kb from the initial ATG (Solier
et al. 2001; Moreau et al. 2009) and presents an extended 3#
untranslated region (3# UTR).
HLA-G is predominantly expressed at the maternal–fetal
interface, particularly in the fetal extravillous cytotropho-
blast cells, placental macrophages, and mesenchymal
chronic villi (Berger et al. 2010) and has primarily been as-
sociated with maternal–fetal tolerance (Carosella, Moreau,
et al. 2008). HLA-G is believed to protect the fetus against
trophoblast damage caused by maternal natural killer (NK)
(Rouas-Freiss et al. 1997) and T-cytotoxic cells (CTLs) (Le
Gal et al. 1999) during pregnancy(Rouas-Freiss et al. 1997;
Berger et al. 2010), also preventing proliferation of CD4þ T
cells (LeMaoult et al. 2004) and tolerizing dendritic cells
(Ristich et al. 2005). Apart from pregnancy, HLA-G expres-
sion in nonpathological conditions is restricted, detected in
the thymus, cornea, proximal nail matrix, pancreas, and he-
matopoietic stem cells (Crisa et al. 1997; Mallet et al. 1999;
Le Discorde et al. 2003; Menier et al. 2004; Ito et al. 2005;
Cirulli et al. 2006). In pathological situations, HLA-G expres-
sion is observed in numerous tumors, viral infections, in-
flammatory and autoimmune diseases, and engrafted
tissues (Carosella, Moreau, et al. 2008; Donadi et al. 2011).
HLA-G molecules may protect cells from CD8 and NK
cell–mediated cytolysis through direct binding to the

© The Author 2011. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please
e-mail: journals.permissions@oup.com

Mol. Biol. Evol. 28(11):3069–3086. 2011 doi:10.1093/molbev/msr138 Advance Access publication May 28, 2011 3069
Castelli et al. · doi:10.1093/molbev/msr138
ILT-2 (LILRB1 and CD85j), ILT-4 (LILRB2 and CD85d), and
KIR2DL4 (CD158d) leukocyte receptors (Colonna et al.
1997; Cosman et al. 1997; Colonna et al. 1998; Allan
et al. 1999; Ponte et al. 1999; Rajagopalan and Long
1999). Dendritic cell function is also inhibited by interaction
with ILT-2 and ILT-4 receptors (Carosella and Horuzsko
2007), which also interact with other class I HLA molecules,
but the highest affinity is for HLA-G (Brown et al. 2004;
Carosella, Favier et al. 2008; Donadi et al. 2011).
In contrast to the classical HLA class I loci, limited HLA-G
coding region variability has been observed in worldwide
populations (Castelli, Mendes-Junior et al. 2007). Based
on the gametic phase (haplotypes) of 73 single-nucleotide
polymorphisms (SNP) observed between exon 1 and intron
6, 46 HLA-G alleles have been currently recognized by the
International Immunogenetics Information System (IMGT,
database 3.1.0, July 2010). Most of these variation sites are
either intronic or synonymous substitutions, yielding only
15 different full-length proteins (two null alleles), of which
only 5 are frequently observed in worldwide populations
(Castelli, Mendes-Junior et al. 2007; Castelli et al. 2010).
A relatively higher degree of variation is observed in the 5#
URR (Tan et al. 2005) and 3# UTR (Castelli et al. 2010). To date,
29 SNPs have been identified in the HLA-G promoter region
(Hviid et al. 2004; Tan et al. 2005; Hviid et al. 2006; Berger et al.
2010), which may be implicated in the regulation of HLA-G
expression, considering that many of these polymorphisms
are within or close to known or putative regulatory elements.
In addition, polymorphic sites at the 5# URR may be in linkage
disequilibrium (LD) with the eight polymorphic sites identified
at the 3# UTR (Nicolae et al. 2005; Castelli et al. 2010), some of
them influencing alternative splicing (Auboeuf et al. 2002), and
mRNA stability (Rousseau et al. 2003). At least three polymor-
phic sites at the 3# UTR are associated with the regulation of
HLA-G expression levels: the 14-bp deletion/insertion polymor-
phism, which influences mRNA stability (Hiby et al. 1999;
O’Brien et al. 2001; Hviid et al. 2003; Rousseau et al. 2003),
the presence of guanine in the position þ3142, which increases
the affinity of specific microRNAs (miRNA) for HLA-G mRNA,
decreasing HLA-G expression (Tan et al. 2007; Veit and Chies
2009), and the presence of an adenine at position þ3187,
modifying an AU-rich motif in the HLA-G mRNA and decreas-
ing its stability (Yie et al. 2008).
In a previous study evaluating the 3# UTR polymorphic
sites associated with posttranscriptional HLA-G regulation
in the Brazilian population, we showed that their frequen-
cies were higher than 5% and were in LD, suggesting that
their influence on HLA-G expression is not independent
(Castelli et al. 2010). Although several studies have demon-
strated the importance of both the 5# URR and the 3# UTR
in the HLA-G expression profile, a complete LD and hap-
lotype evaluation along the entire HLA-G gene has not been
performed. In analogy to what has been observed for the 3#
UTR, a similar pattern of LD would be expected in the pro-
moter region or even in the entire gene. On this basis, we
analyzed the variability of the promoter, coding, and 3#
UTR of the HLA-G gene and its haplotype structure in a
series of Southeastern Brazilians.
3070
MBE
Materials and Methods
Subjects
The Local Research Ethics Committee approved the pro-
tocol of the study (Protocol HCRP #12398/2004), and all
participants gave written informed consent before blood
withdrawal. A total of 100 healthy unrelated bone marrow
donors from different regions of the State of São Paulo,
Southeastern Brazil, were randomly selected and their
DNA was obtained using a salting-out procedure (Miller
et al. 1988).
HLA-G Promoter Region Polymorphism Assignment
Downloaded from https://academic.oup.com/mbe/article/28/11/3069/1045931 by guest on 30 August 2022
For the evaluation of the HLA-G promoter region variation,
a polymerase chain reaction (PCR)-amplified fragment of
approximately 1752-bp encompassing the
1446 (5# URR)
and þ388 (exon 2) nucleotides was produced using the
GPROMO.S—ACATTCTAGAAGCTTCACAAGAATG (Ober
et al. 2003; Tan et al. 2005) and GPROMO.R—
GCCTTGGTGTTCCGTGTCT primers. Amplification was
performed in a final volume of 50 ll containing 1 PCR
buffer (70 mM Tris–HCl, pH 8.8, 20 mM (NH4)2SO4, 3
mM MgCl2, 1 mM dithiothreitol, 1% Triton X 100, 50 lg
bovine serum albumin), 0.2 mM of each dNTP, 12 pmol
of each primer, 1.5 units of platinum DNA polymerase (In-
vitrogen, Carlsbad, CA) and 200 ng of genomic DNA. The
initial denaturation cycle was carried out at 94 °C for 3
min, followed by 32 cycles at 94 °C for 30 s, 59 °C for 30
s, and 72 °C for 135 sec and by a final extension step at
72 °C for 5 min. The amplification product was evaluated
using 1% agarose gel.
PCR products were directly sequenced using the primers: G-
908R (5#-TTCACCTCACAGTTGTAAGTGTTC-3#), G-830F (5#-
CACACGGAAACTTAGGGCTACG-3#), GPR-247 (5#-CT
CAAGCGTGGCTCTCAGGGTC-3#), and G-304R (5#-GCC
AAGCGTTCTGTCTCAGTGT-3#) (Ober et al. 2003); HLA-G
AS-FW-G (5#-AACAGTGCTAGAGCCACAG-3#), HLA-GAS-
RE-G (5#-GAAGAGGGTTCGGGGC-3#), HLA-GAS-FW-A (5#-
AACAGTGCTAGAGCCACAA-3#), and HLA-GAS-RE-A (5#-
GAAGAGGGTTCGGGGT-3#) (Tan et al. 2005); HG01F (5#-
TAAAGTCCTCGCTCACCCAC-3#) (Castelli et al. 2010); and
also the same primers used for the promoter amplification,
which allowed the evaluation of two different segments of
the HLA-G promoter region: 1) the segment between
1400
and
1050 nucleotides and 2) the segment between
750
and þ 300 nucleotides. Altogether, approximately 1100 nucleo-
tides of the promoter region were evaluated, as well as 300 nu-
cleotides of the coding region (exon 1, intron 1, and part of exon
2), which are not considered to be a part of the HLA-G promoter
region. All the sequences obtained were aligned with each other
and each variation site detected was individually annotated us-
ing the SNPex software (http://www.fmrp.usp.br/immunogen/
snpex/), specifically designed to store and manage the variation
sites in the HLA-G locus. Although the promoter region be-
tween
1050 and
770 nucleotides presents variation as
described elsewhere (Tan et al. 2005), three of four variation sites
described in this region did not reach polymorphic frequencies
exceeding 1% [just one occurrence already detected among 268
HLA-G Variation in Regulatory Regions · doi:10.1093/molbev/msr138
sampled chromosomes (Tan et al. 2005)]; thus, these variation
sites were not included in our study.
HLA-G Coding and 3# UTR Characterization
For the HLA-G coding region polymorphism assignment, all
individuals had their HLA-G alleles defined by nucleotide se-
quence variations encompassing exons 1–4 (approximately
1975 bp), as described elsewhere (Castelli et al. 2010). The
complete sequence between the first base of exon 1 and
the last base of exon 2 (hence including intron 1) and the
complete sequence of exons 3 and 4 were evaluated, encom-
passing all the variation sites already described for these re-
gions (IMGT database version 3.1.0, July 2010). Additionally,
three variation sites at the beginning of intron 3 were also
evaluated. This procedure allowed the analysis of 43 previ-
ously described variation sites: 2 at exon 1 (positions 15
and 36), 5 at intron 1 (positions 99, 126, 130, 147, and
188), 13 at exon 2 (positions 234, 239, 280, 292, 293, 297,
306, 324, 361, 362, 366, 372, and 408), 12 at exon 3 (positions
706, 726, 727, 738, 741, 748, 755, 778, 814, 871, 902, and 934), 3
at intron 3 (positions 1016, 1019, and 1054), and 8 at exon 4
(positions 1590, 1659, 1681, 1682, 1734, 1799, 1800, and 1827).
The 3# UTR of the HLA-G locus (also designated as exon 8)
was evaluated by nucleotide sequence variations encompass-
ing þ2945 and þ3259 nucleotides (314 bp between the 3#
ends of the primers), by using a methodology described else-
where (Castelli et al. 2010). At least eight variation sites were
described in this region, including the 14-bp deletion/inser-
tion polymorphism and the þ3142 and þ3187 SNPs, known
to be relevant for HLA-G expression control (Castelli et al.
2010). For both coding and 3# UTR amplification, PCR prod-
ucts were directly sequenced using the primers proposed in
the original manuscript (Castelli et al. 2010).
The amplification for the coding and promoter regions
has an overlap of about 400 nucleotides, encompassing
a highly polymorphic region that includes exon 1, intron
1, and most of exon 2. This strategy increases the proba-
bility of identifying a potential preferential amplification
occurring in one of the two amplified regions.
It should be mentioned that part of the data concerning
the coding and the 3# UTR of the HLA-G locus presented in
this manuscript have been previously published (Castelli
et al. 2010) because the samples used in both studies over-
lap by about 70%.
Haplotyping Procedures
Currently, the sequencing of PCR products does not allow
the determination of the phase of any variation sites de-
tected or haplotypes, except in cases of homozygous sam-
ples or in cases in which all but one variation site is
homozygous. Thus, computational inferences using prob-
abilistic models are necessary to obtain haplotypes.
The presence of a significant association between all
HLA-G variation sites was evaluated by means of a likeli-
hood ratio test of LD (Excoffier and Slatkin 1998) using
the ARLEQUIN version 3.1 software (http://cmpg.unibe.
ch/software/arlequin3/) (Excoffier et al. 2005) and Hap-
loview 4.2 (http://www.broad.mit.edu/mpg/haploview/)
MBE
(Barrett et al. 2005). Given the positive association but un-
known gametic phase, the PHASE (http://stephenslab.
uchicago.edu/software.html) method (Stephens et al.
2001), implemented by the PHASE v2 package (Mac OS
version) (Stephens et al. 2001), was used to assign the most
probable haplotype constitution of each sample.
The database containing the variation sites was loaded in-
to the PHASE software and the analyses were performed to-
gether with the following parameters using six independent
runs with different seed values: 1) number of interactions:
1000, 2) thinning interval: 1, and 3) burn-in value: 100. Inde-
pendent runs yielded the same results for all samples, except
for four samples, in which a rare SNP allele with just one oc-
Downloaded from https://academic.oup.com/mbe/article/28/11/3069/1045931 by guest on 30 August 2022
currence was present, such as the one present in the G*01:09
allele. Such SNPs occur in the coding region and these alleles
were only represented once in the present sample, leading
the PHASE algorithm to produce haplotypes with very
low probability values (50%). To circumvent this problem,
we opted to include in the database two additional hetero-
zygous samples for these rare SNPs, informing the phase of
the haplotypes bearing these rare SNPs based on the IMGT
coding region official sequences. We performed six additional
independent runs with this new data set, specifying the
known phase for those two additional samples and using
the same parameters described above. Independent runs
yielded the same results for all samples, matching the results
with the previous six runs, but improving the inference qual-
ity for those four samples with rare alleles. Additionally, we
used polymorphic sites of each of the evaluated regions sep-
arately (promoter, coding, and 3# UTR) as well as a small sub-
set of polymorphic sites spread across these three regions, to
infer haplotypes by the same method described above. The
results obtained in these additional analyses were compatible
with the ones obtained using all polymorphic sites altogether.
To better evaluate the reliability of the PHASE method,
two other approaches were used. First, several HLA-G pro-
moter haplotypes were confirmed by directional sequenc-
ing of heterozygous samples by using the primers described
in the promoter assignment section HLA-GAS-FW-G and
HLA-GAS-FW-A, both specific for the variations found
in the
1305 position, and HLA-GAS-RE-G and HLA-
GAS-RE-A, both specific for the variations found in
the þ15 position. Second, samples carrying some common
haplotypes had their HLA-G gene amplified from the pro-
moter to the 3# UTR region in a single PCR reaction (by
using the primer GPROMO.S from the promoter and
HG08R from the 3# UTR) using a high-fidelity DNA poly-
merase (Platinum Taq DNA Polymerase High Fidelity; Invi-
trogen). The amplification product was cloned into an
appropriate vector (TOPO XL PCR Cloning Kit; Invitrogen)
and sequenced, in order to define the phase of all the var-
iation sites in the evaluated region. No discrepancies be-
tween the sequences obtained in the cloning procedures
and by the computational inference methods were found.
Statistical Analysis
Allelic frequencies and observed heterozygosity (hO) were
computed by the direct counting method. Adherences of
3071
Castelli et al. · doi:10.1093/molbev/msr138
genotypic proportions to expectations under Hardy–
Weinberg equilibrium were tested by the exact test of
Guo and Thompson (Guo and Thompson 1992) employing
the GENEPOP 3.4 software (http://genepop.curtin.edu.au/)
(Raymond and Rousset 1995). The expected heterozygosity
values (hSk) and haplotype diversity as well as their stan-
dard deviations were estimated by the ARLEQUIN 3.11 pro-
gram (Excoffier et al. 2005). Haplotype networks were
constructed by using the median joining algorithm imple-
mented in the Network 4.6.0.0 program (http://
www.fluxus-engineering.com/sharenet.htm) (Bandelt
et al. 1995). Tajima’s D and Fu and Li’s F neutrality tests
were performed using DNAsp 5.1 (http://www.ub.
edu/dnasp/) (Librado and Rozas 2009). The Ewens–Watterson
neutrality test was performed using the PyPop 0.7.0 software
(Lancaster et al. 2007).
Results
HLA-G Variation and LD Patterns
We evaluated the frequency of 76 previously reported vari-
ation sites along the HLA-G locus, including 25 SNPs at the
promoter region, 43 SNPs at the coding region, and 8 vari-
ation sites at the 3# UTR. Because 21 SNPs in the coding re-
gion were monomorphic, they were not considered for
further analyses, that is, SNPs at the 234, 239, 280, 293,
306, 324, 361, 362, 366, 408, 726, 727, 738, 741, 778, 934,
1659, 1681, 1682, 1734, and 1800 positions. Of the remaining
55 variation sites, 51 were polymorphic (frequencies higher
than 1%) and 4 were only represented once, achieving a fre-
quency of 0.5% (positions þ297 allele A, þ871 allele A, þ902
allele C, and þ1016 allele T). These SNPs are associated with
the HLA-G alleles known as G*01:04:05, G*01:01:09, G*01:09,
and G*01:01:02:02, respectively. With exception of the SNP at
the
369 position (P 5 0.0338) and the 14-bp polymorphism
at the 3# UTR (P 5 0.0127), the genotypes of the 53 remain-
ing polymorphic sites did fit Hardy–Weinberg expectations.
The nucleotide diversity at the HLA-G locus was 0.00643,
about eight times higher than the human genome average
(0.00075) (Sachidanandam et al. 2001; Tan et al. 2005).
The presence of a significant association between all
HLA-G variation sites was evaluated by means of a likeli-
hood ratio test of LD (Excoffier and Slatkin 1998) using
the ARLEQUIN version 3.1 program (Excoffier et al.
2005) and Haploview 4.2 (Barrett et al. 2005). Figure 1
illustrates the pattern of LD along the HLA-G locus. It
can be noticed that the majority of pairs of variation sites
did present LD. Figure 1A illustrates the LD pattern by using
polymorphisms with a minimum allele frequency (MAF) of
2%. Three haplotype blocks were defined using the confi-
dence interval method implemented by the Haploview
software. The first block is composed of the first four SNPs
of the promoter region (
1306,
1179,
1155, and

1140), the second block is composed of variation sites
of both promoter and coding regions (from
1138
to þ1590), and the last block is composed of variation sites
present in the 3# UTR (from 14 bp to þ 3196). In addition,
another LD plot was designed by using variation sites with
3072
MBE
MAF of 10% (fig. 1B). It can be noticed that, with the
exception of the SNP at the position þ3035 in the 3#
UTR region, most of the remaining variations sites (11 for
coding, 12 for promoter, and 7 for the 3# UTR region) did
present strong LD with each other. The lack of LD concerning
the þ3035 SNP could be due to the occurrence of two in-
dependent C . T mutations at such position in very different
HLA-G lineages (HG0103 and HG010103, at opposite sides of
fig. 2). Therefore, it can be observed that a strong LD is main-
tained throughout the whole gene. The promoter SNP at the

725 position (C/G/T) was removed from both plots be-
cause Haploview only accepts biallelic SNPs. Nevertheless,
the LD test performed by Arlequin did corroborate the Hap-
Downloaded from https://academic.oup.com/mbe/article/28/11/3069/1045931 by guest on 30 August 2022
loview findings, indicating with few exceptions a strong LD
between the
725 SNP and others (data not shown).
Given the positive association between pairs of SNPs
(fig. 1) but unknown gametic phase, the PHASE method
(Stephens et al. 2001) was used to determine the most
probable haplotype constitution of each sample, as de-
scribed earlier. All variation sites evaluated were included
in this approach, encompassing SNPs of the regulatory,
coding, and 3# UTR. Twenty-eight different HLA-G ex-
tended haplotypes were found, with frequencies ranging
from 0.5% to 21.0% and a haplotype diversity of 0.906.
To evaluate the similarity among these haplotypes and clus-
ter them into very similar haplotype groups, a haplotype net-
work was created by using these 28 haplotype sequences (fig.
2). It can be noticed that these haplotypes are arranged in six
haplotype lineages. Members of a same lineage share: 1) very
similar promoter haplotypes that only differ in a maximum
of two variation sites, 2) coding region variations that pro-
duce the same HLA-G protein or rare alleles that originated
from point mutation in an ancestral high-frequency allele,
and 3) a specific 3# UTR haplotype (table 2).
The first lineage (HG010101) is isolated from the others
in a single cluster. Inside this group, it can be noticed three
main subdivisions, in which the first sublineage
(HG010101a) is composed of three haplotypes presenting
the same coding and very similar 3# UTR and promoter
sequences (fig. 3); the second sublineage (HG010101b) is
represented by two haplotypes that present the same pro-
moter and 3# UTR sequences and very similar coding hap-
lotypes (fig. 3); the third sublineage (HG010101c) is
separated from the others in a single cluster and they all
present the same coding (the G*01:01:01:05 allele or alleles
originated from it by single mutations) and 3# UTR sequen-
ces as well as a very similar promoter haplotype. The sec-
ond lineage (HG0103) is isolated in a cluster and it presents
the coding sequence of the G*01:03 allele and the same 3#
UTR sequence as well as very similar promoter haplotypes.
The third lineage (HG0104) presents very similar promoter
and coding sequences (all related to the G*01:04 allele
group) and the same 3# UTR haplotype. The fourth lineage
(HG010102) is isolated from the others and it presents the
same promoter sequence and very similar coding and 3#
UTR sequences (usually alleles originated from G*01:01:02:01
by single mutations). The fifth lineage, HG010103, presents
the same promoter and 3# UTR sequences and coding
HLA-G Variation in Regulatory Regions · doi:10.1093/molbev/msr138 MBE

Downloaded from https://academic.oup.com/mbe/article/28/11/3069/1045931 by guest on 30 August 2022

FIG. 1. LD between pairs of SNPs at the HLA-G locus. The image was generated in the Haploview program using SNPs with frequency .2% (A)
and .10% (B). Areas in dark red indicate strong LD (LOD  2, D# 5 1), shades of pink indicate moderate LD (LOD  2, D# , 1), blue indicates
weak LD (LOD , 2, D# 5 1), and white indicates no LD (LOD , 2, D# , 1). The haplotype blocks were defined by the confidence intervals
method implemented by Haploview. D# values different from 1.00 are represented inside the squares as percentages. LOD, log of the odds; D#,
pairwise correlation between SNPs.

alleles that share the A/T mutation at the position þ748
at exon 3 (G*01:01:03:01, G*01:01:03:02, and G*01:01:05).
The last lineage, HG010108, was found in two individuals
and it presents the promoter of the HG010102 lineage, the
G*01:01:08 coding allele and the 3# UTR haplotype of the
HG0103 lineage. The sequence of each haplotype, the pro-
posed consensus sequence for each HLA-G main lineage
and its frequencies are illustrated in figure 3. One haplotype
found (H27) did not fit the pattern of haplotype clusters
observed in the network (fig. 2), and it was considered in

3073
Castelli et al. · doi:10.1093/molbev/msr138
FIG. 2. Haplotype network illustrating the similarity among the 28 HLA-G extended haplotypes (see fig. 3) found in the Brazilian population,
including SNPs at the regulatory 5# and 3# regions and coding region. Each lineage group is delimited by a rectangle. A haplotype network was
constructed using the median-joining algorithm of the Network 4.6.0.0 program. The number of mutational steps is represented in the small
black squares. When not indicated, only one mutational step is present.
figure 3 and table 1 as the results of possible crossing-over
events between haplotypes from different lineages. In ad-
dition, although haplotypes H07 and H09 were included in
the sublineages HG010101a and HG010101b, respectively,
they seem to be the results of crossing-over events between
haplotypes from different HG010101 sublineages.
In table 2, it is evident that 13 haplotypes were found just
once in the present series. However, some of these haplotypes
were confirmed by cloning (H07 and H18) or were present in
allele combinations that facilitate the phase inference, such as
H25, that was found in a sample with homozygosis in all the
variation sites except for the position
443. In addition, at
least five haplotypes were compatible with rare alleles that
were found in some populations and now in Brazil, such
as G*01:01:09 and G*01:04:05, all five with sequences that
are compatible with the ones described in IMGT. The remain-
ing five haplotypes that occurred just once were found in
samples carrying very common haplotypes such as H01
and H10, which facilitate the PHASE inference, which resulted
in probabilities ranging from 98.0% to 99.8%. Given these evi-
dences, we believe that these haplotype inferences are quite
robust, even for these 13 haplotypes that occurred just once.
HLA-G Promoter Sequence Variation and
Haplotype Structure
By taking together the known transcripts for the full-length
HLA-G protein available in the Ensembl Project database
3074
MBE
Downloaded from https://academic.oup.com/mbe/article/28/11/3069/1045931 by guest on 30 August 2022
(ENST00000360323, ENST00000428952, ENST0000437467,
ENST00000383621, and ENST00000411831), the HLA-G
5# UTR sequence (transcribed but not translated) vary be-
tween transcripts, most of them presenting a 5# UTR of 24
nucleotides before the ATG in exon 1 (positions
25 to
1).
Given that, all the variation sites evaluated in the present
manuscript in the promoter sequence must be considered
as variations of a 5# URR sequence (upstream regulatory, not
transcribed).
In order to understand the variability and the haplotype
structure of the 5# URR of the HLA-G locus, the haplotypes
of the promoter region were extracted from the 28 ex-
tended haplotypes illustrated in figure 3. Considering only
the promoter region, we identified 25 variation sites [23
SNPs and 2 insertion/deletion (indel)] in the present sam-
ple (table 1), encompassing the 1100 promoter nucleotides
evaluated as described above. All these 25 variation sites
have been already described in previous reports (Tan
et al. 2005; Rizzo et al. 2008; Berger et al. 2010). It is note-
worthy to mention that, exception made for the SNP at
the
443 position, all variation sites did present allele fre-
quencies higher than 2% in the present series. The two in-
dels consist of an insertion of an additional guanine in
a series of five between the
542 and
538 positions
and a deletion of an adenine in a series of eight adenines
between the
537 and
530 positions (Hviid et al. 2006;
Rizzo et al. 2008). To avoid conflict with previous data, we
HLA-G Variation in Regulatory Regions · doi:10.1093/molbev/msr138 MBE

Downloaded from https://academic.oup.com/mbe/article/28/11/3069/1045931 by guest on 30 August 2022

FIG. 3. Sequence variations of the 28 HLA-G extended haplotypes (H01–H28) observed in the Brazilian population, including SNPs at the
regulatory 5# and 3# regions and the coding region. The consensus sequence for each haplotype lineage and sublineage group are proposed
(gray lines). For these consensus sequences, variation sites in which the minor allele frequency is greater than 5% in the present lineage are
given as IUPAC codes; otherwise, the common allele is followed by a superscripted minor allele. Asterisk denotes a variation site, in which
a deletion or insertion is the minor allele and a nucleotide in the major allele, due to the absence of a proper IUPAC code. I indicates insertion
of the 14-bp fragment; - indicates deletion of a nucleotide. D: absence of the 14-bp fragment. IUPAC codes: Y: C or T, R: G or A, S: C or G, and K:
G or T.

used the nomenclature proposed by Rizzo and colleagues,
in which the guanine insertion was considered at the
540
position and the adenine deletion was considered at the

533 position. The nucleotide diversity of the promoter
region was 0.00692, almost the same as for the entire
HLA-G locus (0.00643).
The haplotyping analysis using the PHASE method re-
vealed the presence of 11 different HLA-G promoter hap-
lotypes (considering all the variation sites and the first SNP
of exon 1 at the þ15 position), with frequencies ranging
from 0.5% to 32.0% (table 1) and a haplotype diversity
of 0.816. Because these promoter haplotypes were similar
to those described by Tan et al. (2005), we used the same
nomenclature as proposed by these authors. As stated by
Tan and colleagues, the 12 haplotypes seem to be arranged
in four promoter lineages with very few variations inside
each group of lineages. It is interesting to note that two
major promoter lineages (PROMO-G010101 and PRO-
MO-G010102) account for 77.5% of the promoter haplo-
types, with a distribution of 32.0% for PROMO-G010102
and of 45.5% for PROMO-G010101. The haplotypes from
these two promoter lineages differ from each other in at
least 12 variation sites (table 1), most of them located near
to or within transcription factor–binding sites (Tan et al.
2005; Moreau et al. 2009).
Two novel HLA-G promoter haplotypes were found,
named PROMO-G010101f and PROMO-G0103e. PROMO-
G010101f presents an adenine deletion at the
533 position
and PROMO-G0103e presents a guanine insertion at the

540 position (table 1). Although we have not found known
haplotypes such as PROMO-G0103b and G0103c, it is pos-
sible that our new promoter haplotype PROMO-G0103e is

3075
 Castelli et al. · doi:10.1093/molbev/msr138 MBE

NOTE.—Four different lineages of haplotypes were found, grouped by their similarity. Differences among the haplotypes are given in shades of gray. ‘‘I’’ denotes an insertion of a guanine at position
540. ‘‘-’’ denotes a deletion of adenine at
21306 21179 21155 21140 21138 21121 2762 2725 2716 2689 2666 2646 2633 2540 2533 2509 2486 2483 2477 2443 2400 2391 2369 2201 256 15a (2n 5 200)
the same PROMO-G0103b haplotype as described by the
Frequency

0.135

0.225
0.070
0.045
0.045

0.020
0.040
0.025
0.005

0.320

0.070
Ober’s group (Tan et al. 2005) because it was described lack-

The variation at the position þ 15 is in the coding sequence in exon 1 and must not be considered as 5# URR. This SNP was used in this table to better characterize the haplotypes accordingly to Tan and Colleagues, 2005.
ing information about the guanine insertion at the
540
position. Despite this insertion, PROMO-G0103e is exactly

G
G
G
G
G

G
G
G
C A
C A

A
the same haplotype as PROMO-G0103b but with no gua-
nine insertion compared with the other members of the
C

C
C
C
C
C

T
T
T
G0103 promoter lineage.
G
G
G
G
G

G
G
G
A
A

HLA-G Coding Region Sequence Variation and

A
A

A
A
A
C
C
C
C
C
Haplotype Structure
G
G

G
G
G
G
G

A
A
A
Among the currently described 17 allele groups (15 encoding
different proteins and 2 null alleles), 6 were found in our study:
G
G

G
G
G
G
G

A
A
A
HLA-G*01:01 with eight alleles (G*01:01:01:01, G*01:01:01:04,

Downloaded from https://academic.oup.com/mbe/article/28/11/3069/1045931 by guest on 30 August 2022

G*01:01:01:05, G*01:01:02:01, G*01:01:02:02, G*01:01:03:01,
G

G
G
G
G
G

G
G
G
A

G*01:01:05, and G*01:01:09), HLA-G*0104 with three alleles

(G*01:04:01, G*01:04:04, and G*01:04:05), and the G*01:03,
G
G

G
G
G
C
C
C
C
C

G*01:05N, G*01:06, and G*01:09 allele groups. Interestingly,

some rare alleles such as G*01:01:09 and G*01:04:05, found
G
A
A

A
A
A

A
A
A

in African populations (Pyo et al. 2006; Lajoie et al. 2009),

A
A
A
A
A

A
A
A
C
C

G*01:01:02:02, found in Caucasian and African populations

(Pyo et al. 2006), and G*01:09, described for Koreans (Kang
G

G
C
C

C
C
C
C
C

et al. 2007) and Brazilians (Castelli, Mendes-Junior et al.

2007) were found in the present series, emphasizing the wide
A
A

A
A
A
A

A
A
A
HLA-G Promoter SNP Position

HLA-G variability in Brazilians (Castelli, Mendes-Junior et al.

2007; Castelli, Mendes-Junior, Wiezel, et al. 2007 Castelli
G
G

G
G
G
G
G

G
I
I

et al. 2008; Pirri et al. 2009).

In addition to these known HLA-G coding region variants,
G
G
G
G
G

G
G
G
A
A

some new HLA-G haplotypes were found and might repre-

sent new HLA-G alleles, including one occurrence of an allele
G
A
A

A
A
A
A
A

A
A

very similar to the known G*01:03 (named 01:03b) and

G
G
G
G
G

G
G
G
T
T

G*01:01:03:01 (named 01:01:03:01b) alleles. It should be em-

phasized that the G*01:01:03:01b allele sequence is not similar
Table 1. HLA-G Promoter Polymorphisms and Haplotypes in the Brazilian Population.

G
G

A
A
A
A
A

A
A
A

to the sequence of the recently described G*01:01:03:02 allele.

In addition, two copies of the G*01:01:08 allele were found
G
G

T
T
T
T
T

T
T
T

(table 2). The nucleotide diversity of the coding region

was lower than that obtained for the other regions
G
G
C
C

C
C

T
T
T

(0.00495), exhibiting a haplotype diversity of 0.869.

The HLA-G*01:01:01:01 allele was the predominant allele
C
C
C
C
C

C
C
C
T
T

in our population with a frequency of 26%, followed by the

G*01:01:02:01 (15.5%) and G*01:01:01:05 (12.5%) alleles.
C
C

C
C

C
C

C
C
C
T

The frequency of the G*01:05N null allele was only 3.5%,

which is lower than that reported for other populations
G
G
G
A
A

A
A
A
A
A

(reviewed by (Castelli, Mendes-Junior et al. 2007). In addi-

tion, we observed two of the recently described HLA-G al-
A
A

A
A
A
A
A

A
A
A
T

leles, G*01:04:05 and G*01:09, as well as single copies of the

rare G*01:01:02:02 and G*01:01:09 alleles (table 2, fig. 3).
G

G
G
G
G
G

G
G
G
A
A

HLA-G 3# UTR Sequence Variation and Haplotype

G
G

G
G
G
A
A
A
A
A

Structure
As mentioned above, the 3# UTR haplotypes were named
G
G
G
G
G

G
G
G
A
A

according to a previous manuscript (Castelli et al. 2010). Like-

wise, only eight variation sites were detected in the 3# UTR,
PROMO-G010101d
PROMO-G010101b
PROMO-G010102a

PROMO-G010101a

PROMO-G010101c

PROMO-G010101f
PROMO-G0104b

PROMO-G0103d
PROMO-G0104a

PROMO-G0103a

PROMO-G0103e

including the 14-bp insertion/deletion polymorphism and

the þ3142 G/C and þ3187 A/G SNPs, known to be relevant
position
533.
Haplotype
Promoter

for the HLA-G expression control (Rousseau et al. 2003; Tan

et al. 2007; Yie et al. 2008; Castelli et al. 2010). Five other SNPs
were detected: þ3003T/C, þ3010C/G, þ3027 A/C, þ3035 C/
a

3076
HLA-G Variation in Regulatory Regions · doi:10.1093/molbev/msr138 MBE
Table 2. The 28 HLA-G Extended Haplotypes Separated into Promoter, 3#UTR and Coding Regions.
Extended Haplotype Frequency (2n 5 200) Promoter Haplotype Coding Haplotype 3# UTR Haplotype HLA-G Lineage
H01 0.210 PROMO-G010101a 01:01:01:01 UTR-1
H05 0.045 PROMO-G010101d 01:01:01:01 UTR-1 HG010101a

H03 0.065 PROMO-G010101f 01:01:01:04 UTR-6 HG010101b

H02 0.070 PROMO-G010101b 01:01:01:05 UTR-4

H04 0.045 PROMO-G010101c 01:01:01:05 UTR-4
H06 0.005 PROMO-G010101a 01:01:01:05 UTR-4
H08 0.005 PROMO-G010101a 01:01:09 UTR-4 HG010101c

H10 0.155 PROMO-G010102a 01:01:02:01 UTR-2

H11 0.060 PROMO-G010102a 01:06 UTR-2
H12 0.035 PROMO-G010102a 01:05N UTR-2
H13 0.005 PROMO-G010102a 01:01:02:02 UTR-2

Downloaded from https://academic.oup.com/mbe/article/28/11/3069/1045931 by guest on 30 August 2022

H14 0.005 PROMO-G010102a 01:09 UTR-2
H15 0.005 PROMO-G010102a 01:06 UTR-8 HG010102

H16 0.035 PROMO-G010102a 01:01:03:01 UTR-7

H17 0.005 PROMO-G010102a 01:01:05 UTR-7
H18 0.005 PROMO-G010102a 01:01:03:01b UTR-7 HG010103

H19 0.040 PROMO-G0103d 01:03 UTR-5

H20 0.020 PROMO-G0103a 01:03 UTR-5
H21 0.020 PROMO-G0103e 01:03 UTR-5
H22 0.005 PROMO-G0103e 01:03b UTR-5 HG0103

H23 0.085 PROMO-G0104a 01:04:01 UTR-3

H24 0.040 PROMO-G0104a 01:04:04 UTR-3
H25 0.005 PROMO-G0104b 01:04:01 UTR-3
H26 0.005 PROMO-G0104a 01:04:05 UTR-3 HG0104

H28 0.010 PROMO-G010102a 01:01:08 UTR-5 HG010108

H07 0.005 PROMO-G010101a 01:01:01:01 UTR-6 Possible crossing-over

H09 0.005 PROMO-G010101f 01:01:01:05 UTR-6 events between haplotypes
H27 0.005 PROMO-G0104a 01:04:01 UTR-2 from different lineages

T, and þ3196 C/G. All the variation sites did present allele
frequencies higher than 4.5%. The present haplotype analysis
revealed the same haplotypes as described in the previous
manuscript, named UTR-1 to UTR-8, with frequencies rang-
ing from 0.5% for UTR-8 to 25.5% for UTR-1 (table 2). It is
interesting to note that 52% of the 3# UTR haplotypes were
represented by UTR-1 and UTR-2, both with a frequency of
26.0%. Both haplotypes differ in five of eight variation sites
found at the 3# UTR, a scenario that is reminiscent to the
one observed for the promoter region. The nucleotide diver-
sity of the 3# UTR is the highest one among the HLA-G re-
gions evaluated (0.01073), about 14.2 times the diversity of
the entire human genome (Sachidanandam et al. 2001), with
a haplotype diversity of 0.818, higher than that observed for
the promoter region.
Relationship Between Promoter, Coding, and 3#
UTR Haplotypes
In order to investigate the relationship between the 5# URR,
coding, and 3# UTR haplotypes found in the present series,
the extended haplotypes described in figure 3 were stratified
into promoter, coding, and 3# UTR haplotypes. The pro-
moter haplotypes were named according to the data pro-
posed in table 1. The coding HLA-G haplotypes were
named according to the official HLA-G alleles described in
the IMGT database. The 3# UTR haplotypes were named ac-
cording to a previous manuscript evaluating this same region
(Castelli et al. 2010). It should be emphasized that the HLA-G
3# UTR and coding region sequence variation and haplotype
structure were thoroughly evaluated in previously published
manuscripts. Table 2 illustrates the relationship between the
promoter, coding, and 3# UTR haplotypes.
After the haplotypes from figure 3 were segmented, it could
be noticed that a very concise pattern of LD and haplotype as-
sociationwasobserved,witheachofthecodingregionhaplotype
being associated with a specific promoter haplotype or haplo-
types that did not differ in more than one position. The
HG010101a sublineage is an extended haplotype with only
two variation sites in the positions
483 and þ3187. This sub-
lineage is associated with a specific coding allele (G*01:01:01:01)
and a specific 3# UTR haplotype (UTR-1). UTR-1 is the only 3#
UTR haplotype carrying a guanine at the þ3187 position. Like-
wise,theHG010101bsublineageisassociated with aspecificpro-
moter and 3# UTR haplotype. The HG010101c sublineage
encompasses haplotypes associated with the same 3# UTR
(UTR-4), coding region (G*01:01:01:05 and G*01:01:09, which
is supposed to be derived from a G*01:01:01:05 allele), and pro-
moter haplotypes that only differ by single positions. The
HG010102 lineage is composed of haplotypes that present
the same promoter haplotype (except for one copy with a single
exchange), two very similar 3# UTR (mainly UTR-2 and secondly
UTR-8, which differs only in the þ3010 position), and a group of

3077
Castelli et al. · doi:10.1093/molbev/msr138 MBE

20.9559, P 5 0.1276
20.6521, P 5 0.2694
21.4216, P 5 0.0095
20.1934, P 5 0.5218
alleles mainly represented by G*01:01:02:01, the null G*01:05N,

Ewens-Watterson
G*01:06, and the rare G*01:09. G*01:09 is supposed to be orig-

Normalized F
inated by a single mutation in the G*0106 allele because both
shared a thymine at the þ1790 position and the G*01:05N and
G*01:06allelesaresupposedtobederivedfromG*01:01:02:01by
single mutations. The same pattern is observed for the other
HLA-G lineages, in which a very close promoter and coding hap-
lotypes are observed, usually coding alleles that produce the

1.44776, 0.1 > P > 0.05

same HLA-G protein (as in the HG0103 and HG0104 lineages)

20.11295, P > 0.10

and a specific 3# UTR haplotype.

1.20896, P > 0.10

1.11607, P > 0.10
Li’s D (p)
Fu and
Only 3 haplotypes of 28 did not fit this pattern (table 2;
figs. 2 and 3). One example is H27, in which the pattern of the
HG0104 lineage is observed for the promoter and coding hap-

Downloaded from https://academic.oup.com/mbe/article/28/11/3069/1045931 by guest on 30 August 2022

lotypes, but the pattern of the HG010102 lineage is observed
for the 3# UTR. These samples are probably cases of crossing-

In the software input files, all indels were converted into SNPs to prevent loss of data because DNAsp do not support indels to calculate Tajima’s D and Fu and Li’s D and F.
over among frequent HLA-G extended haplotypes (table 2).

2.12691, P < 0.02

0.52647, P > 0.10
1.92279, P < 0.05
1.87700, P < 0.05
Li’s F (p)
Fu and
Haplotyping Procedures
The present study used the PHASE method to infer
haplotypes (Stephens et al. 2001), evaluating more strin-
gent parameter values than those used by the method as
‘default’. We increased 10 times the interaction value and

2.23552, P < 0.05

1.26497, P > 0.10
2.34377, P < 0.05
2.12119, P < 0.05
we performed a total of 12 independent runs using differ-

Tajima’s
ent seed values, obtaining the same results for 96 samples

D (p)
in all runs, and at least 10 runs indicated the same
haplotype for the remaining four samples carrying rare al-
leles such as G*01:09. Directional sequencing analysis was
also employed to verify some of the haplotype inferences Haplotype
in heterozygous individuals, confirming the PROMO- Diversity
0.816
0.869
0.818
0.906
G010101f and PROMO-G0103a haplotypes. Moreover,
several haplotypes were found in homozygosis in some in-
dividuals, including the PROMO-G010101a, PROMO-
of Haplotypes (k)

G010102a, and PROMO-G0104a as well as their extended

haplotypes H01, H10, and H23 (table 2). The PROMO-
Number

8
11
18

28

G0104b haplotype was confirmed in a homozygous indi-

vidual for all the SNPs evaluated except the
443 position
(haplotypes H23 and H25, table 2). The PROMO-
G010101d haplotype was confirmed by its presence in
Diversity (p)

a homozygous individual for all the SNPs evaluated except

Nucleotide

0.00692
0.00495
0.01073
0.00643

the
483 position (H01 and H05 haplotypes, table 2).

Haplotypes were inferred obtaining inferences with a mean
Table 3. Neutrality Tests Performed on the HLA-G Locus.

probability of 0.9687 ± 0.1013 for the first six runs consid-

ering all samples (such average probability increases to
Segregating Sitesa

0.9858 ± 0.0494 if one does not consider the four samples

Number of

with rare HLA-G alleles). These six runs did not include
25
22
8
55

extra individuals with genotypes composed of the IMGT

sequence of rare alleles, as performed in the six remaining
runs. Additionally, the common extended haplotypes H01,
H02, H03, H10, H11, and H28 and one possible crossing-
Sequence

over event (H07) was confirmed by cloning and sequenc-

Length
1113
1109
262
2484

ing. On this basis, it is reasonable to propose that the hap-

lotype inference performed in the present study is quite
robust and reliable.
HLA-G promoter

HLA-G 3# UTR
HLA-G coding

Selection Acting on the HLA-G Locus

HLA-G gene

The Ewens–Watterson neutrality test was performed to in-

Region.

vestigate whether natural selection may exert significant pres-

sure on the allele and genotype frequencies in the 5# URR,
a

3078
HLA-G Variation in Regulatory Regions · doi:10.1093/molbev/msr138
coding region, and 3# UTR of the HLA-G locus (table 3). Only
the3#UTRpresentedastatisticallysignificant(P5 0.0095)neg-
ative normalized F value (observed homozygosity lower than
expected homozygosity); however, the 5# URR did present
a negative normalized F value, exhibiting a low P-value (P 5
0.1276). Considering the HLA-G extended haplotypes, which
encompasses the 5# URR, coding region, and 3# UTR, the
Ewens–Watterson neutrality test did reveal a nonsignificant
negative normalized F value higher than the values obtained
for each region separately (P 5 0.5218). The second neutrality
test employed, Tajima’s D test, which takes into account se-
quence diversity, resulted in the observation that all estimated
D values were positive, three of them reaching significance (ta-
ble 3). In fact, the 5# URR, 3# UTR, and the complete gene did
present statistically significant positive estimated D values (P ,
0.05, respectively). Taken together, the negative Ewens–Wat-
terson’s normalized F values and positive Tajima’s D values re-
flect an excess of heterozygosis that may be due to balancing
selection (Tan et al. 2005). The third and fourth neutrality tests
used (Fu and Li’s F and Fu and Li’s D) are based on the frequency
spectrum and positive values correspond to an excess of old
mutations, which is compatible with balancing selection
(Tan et al. 2005). In the present series, all the values for Fu
and Li’s F were positive with statistically significant P-values
forthe5#URR,3#UTRandforalltheregionsevaluatedtogether.
Discussion
In this study, we carried out an analysis of the genetic var-
iability of the 5# URR, coding, and 3# UTR of the HLA-G locus
in a randomly selected series of bone marrow donors from
southeastern Brazil. Although several reports have demon-
strated the importance of both 5# URR and 3# UTR for
the expression profile of the HLA-G locus, a complete LD
and haplotype evaluation among these 5# URR, coding,
and 3# UTR variation sites has not been simultaneously per-
formed, and the same pattern of variation observed in the 3#
UTR could be present in the promoter region or even in the
entire gene. Because Brazilians represent one of the most het-
erogeneous populations in the world (Parra et al. 2003) and
show the largest HLA-G variability already detected (Castelli,
Mendes-Junior et al. 2007; Castelli, Mendes-Junior, Wiezel,
et al. 2007; Castelli, Mendes-Junior, et al. 2008) among the
populations studied at a high resolution level, including
North India, Polish, German, and Chinese Han (Donadi
et al. 2011), a high level of variability and haplotype diversity
would be expected in a Brazilian sample.
The promoter haplotype frequency distribution in the
Brazilian population resembles those described for both Af-
rican American and European American populations (Tan
et al. 2005), which is compatible with the Brazilian ancestry
background (Parra et al. 2003). The association between
promoter haplotypes and HLA-G alleles presented by
Ober’s group was confirmed by the present data, exception
made for the association of the PROMO-G010102a haplo-
type and the G*01:01:08 allele.
Although almost all promoter haplotypes found in the pres-
ent study are shared by European Americans, African Amer-
MBE
icans, Chinese, Danes (Ober et al. 2003; Hviid et al. 2004; Tan
et al. 2005), and Brazilians, some inconsistencies regarding the
HLA-G promoter diversity and haplotypes were observed in
recent studies. Berger et al. have addressed the variability of
the HLA-G promoter region and compared the frequency
of all the variation sites and haplotypes detected in European
American (EA) women with recurrent spontaneous abortion
and healthy EA fertile women (Berger et al. 2010). Although
three of seven frequent promoter haplotypes found in Berger’s
study are shared by the Brazilian population, most of the hap-
lotypes with a frequency higher than 0.5% found in EA were
not detected among Brazilians. In Berger’s study, the haplo-
types were obtained using 12 variation sites and the three most
Downloaded from https://academic.oup.com/mbe/article/28/11/3069/1045931 by guest on 30 August 2022
frequent haplotypes found in EA were compatible with the
PROMO-G010101, PROMO-G010102, PROMO-G0103, and
PROMO-G0104 promoter lineages described here. Given
the background of the Brazilian population, the larger number
of haplotypes described by Berger et al. is quite unexpected
and may be explained by the different sample sizes in the
two studies and the large number of promoter region haplo-
types exhibiting very low frequencies.
Another study addressed the variability of the HLA-G pro-
moter region regarding its influence on the expression level of
soluble HLA-G (Hviid et al. 2006), evaluating the 5# URR be-
tween
762 and
400 nucleotides as well as the 14-bp poly-
morphism in 61 Caucasian healthy individuals, but only the
frequent haplotypes were shared between samples.
Recently, Rizzo et al. have addressed the variability of the
promoter and coding region in patients with systemic lupus
erythematosus and healthy controls. These authors also used
the PHASE method to infer promoter and coding haplotypes
in 14-bp insertion homozygous individuals. With the excep-
tion of a promoter haplotype that is compatible with both
PROMO-G0102 and PROMO-G0104 lineages, considering
only 13 promoter SNPs, none of the haplotypes found in this
particular Italian population is compatible with the ones ob-
served in the present series, including the haplotypes associ-
ated with the guanine insertion at
540 and the adenine
deletion at
533(Rizzo et al. 2008).
The discrepancies observed between the above men-
tioned studies may reflect the features and the size of
the populations used in each work [Hviid: 61 individuals
(Hviid et al. 2006) and Rizzo: 36 individuals (Rizzo et al.
2008)], which may directly influence haplotyping accuracy
(Bettencourt et al. 2008).
HLA-G Extended Haplotypes
The haplotype analysis using 55 segregating sites, 25 in the
promoter region, 22 in the coding region, and 8 in the 3#
UTR did reveal 28 different haplotypes. The pattern of the
haplotypes is quite concise, giving rise to six HLA-G haplotype
lineages, that is, HG010101, HG010102, HG010103, HG0103,
HG0104, and HG010108 (fig. 2). The most divergent of these
lineages was HG010101, which may be subdivided into three
sublineages, each associated with a specific 3# UTR haplo-
type. In addition, it should be noticed that all other 3#
UTR haplotypes only occur associated with a specific
3079
Castelli et al. · doi:10.1093/molbev/msr138
HLA-G lineage (table 2). The HG010108 lineage do not follow
the same pattern observed in the remaining lineages because
it has a promoter of the HG010102 or HG010103 lineage and
a 3# UTR of the HG0103 lineage, but a coding sequence that
apparently do not have an origin in the HG010102 or
HG010103 lineages. Curiously, the HG010102, HG010103,
and HG010108 promoter is the most compatible with pri-
mate sequences (Tan et al. 2005). Moreover, a small sample
of 3# UTR sequence data from nonhuman primates (Castro
et al. 2000) revealed that Old World Monkeys and Great Apes
present exclusively UTR-5 and UTR-3, respectively, which are
not so frequent in humans (Castelli et al. 2010). Given that
the promoter and the 3# UTR haplotypes of this HG010108
lineage are compatible with primates, it is possible that this
haplotype is in fact much older than the other ones, resem-
bling an ancestral haplotype that has been lost by genetic
drift or selection. In the present series, three chromosomes
could not be properly assigned to a specific lineage because
they probably resulted from crossing-over between frequent
haplotypes. One such example is represented by the H07 and
H27 haplotypes (fig. 3; table 2), which seem to be a product of
crossing-over between haplotypes from the HG010101a and
HG010101b lineages in the first case and from HG0104 and
HG010102 in the second case (table 2).
The six HLA-G haplotype lineages do present functional
variation mainly in their regulatory regions. Considering
the promoter region (5# URR), the minor allele frequency
in 24 of 25 variation sites is higher than 2%, with a nucleotide
diversity higher than the coding region (table 3) and an av-
erage of one variation site per 52 nucleotides. The 3# UTR
presents the minor allele frequency higher than 2% in all eight
variation sites, as well as the highest nucleotide diversity, with
an average of one variation site per 45 nucleotides. Although
the coding region presented the lowest nucleotide diversity,
with an average of one variation site per 62 nucleotides and
with only 18 of 22 variation sites presenting minor allele fre-
quencies higher than 2%, it did reveal the highest haplotype
diversity. However, it should be emphasized that most of the
polymorphic sites in the coding region are in fact synony-
mous substitutions. Therefore, it is plausible to propose that
the regulatory regions (5# URR and 3# UTR) are more func-
tionally variable than the coding region.
Genetic Diversity and Functional Aspects of HLA-G
Extended Haplotypes
The mRNA level of a particular gene is usually regulated by its
rate of synthesis, mainly driven by its 5# URR, transcription
factors that are produced and microenvironmental agents,
as well as by the rate of mRNA decay, specially driven by
the 3# UTR influencing mRNA stability and degradation
(Kuersten and Goodwin 2003). Although many factors may
affect transcriptional and post-transcriptional control of
HLA-G production (Moreau et al. 2009), the reasons for
HLA-G expression in some but not in other tissues have
not been fully elucidated. Several lines of evidence indicate
that numerous nucleotide variations at 5# URR and 3#
UTR of the HLA-G locus may influence HLA-G expression
and consequently tissue distribution in physiological and
3080
MBE
pathological conditions. In addition, variation sites observed
in introns may be involved in HLA-G regulation processes,
such as alternative splicing.
The HLA-G 5# URR is unique among the HLA genes
(Solier et al. 2001). Due to the presence of a modified
enhancer A (enhA) and a deleted interferon-stimulated
response element (ISRE), the proximal HLA-G promoter
is unresponsive to NF-jB (Gobin et al. 1998) and IFN-c
(Gobin et al. 1999). Among the regulatory elements known
to stimulate HLA-G, a 244-bp region located
1.2 kb from
exon 1 has been shown to be important for its spatiotem-
poral expression in transgenic mice and was proposed to
have a locus control region (LCR) function (Schmidt et al.
Downloaded from https://academic.oup.com/mbe/article/28/11/3069/1045931 by guest on 30 August 2022
1993; Yelavarthi et al. 1993). This LCR exhibits a binding site
for CREB1 factor
1380/
1370), which also binds to two
additional cAMP response elements at
934 and
770 po-
sitions from the ATG. CREB1 allows promoter transactiva-
tion with the coactivators CREB-binding protein (CBP)/
P300 (Gobin et al. 2002). In addition, a binding site (Inter-
feron Sequence Responsive Element/ISRE) for IFN response
factor-1 (IRF-1) is located at the
744 bp position (Lefebvre
et al. 2001), beside a nonfunctional GAS-like element
(
734) (Chu et al. 1999) and is involved in HLA-G trans-
activation following IFN-b treatment (Lefebvre et al. 2001).
The HLA-G promoter also contains a heat shock element at
the
459/
454 position that binds heat shock factor-1
(HSF-1) (Ibrahim et al. 2000) and a progesterone receptor
binding site at
37 bp from ATG (Yie et al. 2006). On the
other hand, the ras-responsive element binding 1 factor
(RREB-1) downregulates HLA-G promoter activity through
three ras response elements located at positions
1356,

142, and
53 (Flajollet et al. 2009) and is likely to act
through C-terminal–binding protein (CtBP) implicated
in chromatin remodeling (Shi et al. 2003).
Many of the promoter region polymorphisms (table 1;
fig. 4) either coincide with or are close to known or putative
regulatory elements and thus may affect the binding of
HLA-G regulatory factors. For instance, this phenomenon
was demonstrated by Ober’s group regarding the
725
G/C/T SNP, a variation site that is very close to ISRE, in
which the
725G allele was associated with a significantly
higher expression level compared with the others (Ober
et al. 2006). In addition, besides the variation sites influenc-
ing the binding of transcription factors per se, the meth-
ylation status of the HLA-G gene promoter is crucial to the
transcriptional activity of the gene (Moreau et al. 2003;
Mouillot et al. 2005) and the promoter methylation status
may also be affected by polymorphisms located at CpG
sites (Ober et al. 2006).
The HLA-G 3# UTR contains several regulatory elements
(Kuersten and Goodwin 2003) including polyadenylation sig-
nals and AU-rich elements (Yie et al. 2008; Alvarez et al. 2009),
and polymorphic sites that may potentially influence HLA-G
transcription, translation, or both by several different mech-
anisms, particularly targets for microRNAs (miRNAs) (Castelli
et al. 2009). Among them, it is worth mentioning the 14-bp
polymorphism, which has been associated with the magni-
tude of HLA-G production (Rebmann et al. 2001), particularly
HLA-G Variation in Regulatory Regions · doi:10.1093/molbev/msr138
FIG. 4. Nucleotide differences between the two most frequent HLA-G lineages, G010101a and HG010102.
by modulating HLA-G mRNA stability (Hiby et al. 1999;
O’Brien et al. 2001; Hviid et al. 2003; Rousseau et al. 2003).
Although the mechanisms implicated have not been eluci-
dated, HLA-G alleles presenting the 14-bp (5#-ATTTGTT-
CATGCCT-3#) sequence (Harrison et al. 1993) have been
associated with lower mRNA production for most membrane
bound and soluble isoforms in trophoblast samples (Hviid
et al. 2003; Hviid 2006). On the other hand, a fraction of
HLA-G mRNA transcripts presenting the 14-base insertion
can be further processed (alternatively spliced) by the re-
moval of 92 bases from the mature HLA-G mRNA (Hiby
et al. 1999; Hviid et al. 2003), yielding smaller HLA-G tran-
scripts, reported to be more stable than the complete mRNA
forms (Rousseau et al. 2003). Besides the 14-bp polymor-
phism, two variation sites at the 3# UTR have been reported
to influence HLA-G expression. The presence of an adenine at
the þ3187 position, which is 4-bp upstream of an AU-rich
motif, mediates mRNA degradation, leading to a decreased
HLA-G expression (Yie et al. 2008). The presence of a guanine
at the þ3142 position may increase the affinity of the miR-
148a, miR-148b, and miR-152 microRNAs for the HLA-G
mRNA, therefore decreasing mRNA availability by mRNA
degradation and translation suppression (Tan et al. 2007).
In addition to the þ3142 SNP, a recent in silico analysis re-
vealed that several human miRNAs have the potential to bind
to the HLA-G mRNA 3# UTR and may influence HLA-G ex-
pression; however, the binding affinity might be influenced by
polymorphisms present in their target regions, emphasizing
the role of the 14-bp polymorphism and the þ3003, þ3010,
þ3027, and þ3035 SNPs (fig. 3), which encompass a region
of only 32 nucleotides (Castelli et al. 2009; Donadi et al. 2011).
Alleles from these three major 3# UTR polymorphic sites
associated with HLA-G production are in strong LD with
each other, illustrating a scenario in which their influence
may not be mutually exclusive (Castelli et al. 2010). It is
noteworthy that the 14-bp insertion is always accompanied
by the þ3142G and þ3187A alleles (fig. 3), both previously
associated with low mRNA availability, indicating that the
low mRNA production associated with the 14-bp insertion
(Hviid et al. 2003) may also be a consequence of the pres-
ence of these polymorphisms associated with the 14-bp
polymorphism (Castelli et al. 2010). Besides, these three
MBE
Downloaded from https://academic.oup.com/mbe/article/28/11/3069/1045931 by guest on 30 August 2022
polymorphisms present a high LD with promoter variation
sites (fig. 3 and table 2), which indicates that, in an in vivo
scenario, given a proper microenvironment stimulus for
HLA-G expression, the rate of transcription, and translation
may be influenced both by promoter and by 3# UTR poly-
morphisms, that is, each variation site exerts its influence in
a coordinated and dependent manner.
Genetic Diversity and Evolutionary Aspects of
HLA-G Extended Haplotypes
Given the immune tolerance property of HLA-G and its benign
or harmful presence depending on the situation, the expres-
sion of this gene must be under very tight control (Donadi
et al. 2011). It was previously shown that the pattern of var-
iation at the HLA-G promoter region is characterized by two
divergent lineages of promoter haplotypes that are maintained
by balancing selection in worldwide human populations. These
two divergent lineages may have different promoter activity
and might be involved in a fine balance between high-express-
ing and low-expressing HLA-G haplotypes (Tan et al. 2005).
Our data do corroborate the presence of these two main
HLA-G lineages, in which the extended HLA-G lineages
HG010102, HG010103, HG010108, and HG0104 (left part of
fig. 2) correspond to the first one of Ober’s lineage, whereas
extended lineages HG010101 and HG0103 correspond to the
second Ober’s lineage (table 1).
Regarding the HLA-G locus as a whole, the two most
frequent lineages, that is, sublineage HG010101a (H01
and H05) and lineage HG010102 (H10 to H15), which
are equally frequent (about 26%) and account for more
than 52% of the HLA-G haplotypes, are very different from
each other. In fact, they differ in more than 50% of the 55
segregating sites analyzed, especially in the 5# URR and 3#
UTR, with 11 and 4 fixed differences, respectively (fig. 4).
Most of these nucleotide differences coincide with or
are close to known or putative transcription factor–bind-
ing sites at the 5# URR or are even present at the 3# UTR
sites that have been reported to influence HLA-G mRNA
availability (14-bp polymorphism, þ3142 and þ3187
SNPS). Additionally, both lineages do present several differ-
ences in the coding region, but the same G*01:01 HLA-G
protein is encoded in approximately 79.8% of cases.
3081
Castelli et al. · doi:10.1093/molbev/msr138
The coding region suffers a strong selective pressure for
invariance (purifying selection), that is, preservation of nu-
cleotide and amino acid sequences, reduced variability, and
lower than expected nonsynonymous mutation rate
(Castro et al. 2000). In fact, strong evidence of purifying
selection at the coding region was disclosed by the perfor-
mance of a synonymous and nonsynonymous nucleotide
substitution test considering all HLA-G alleles available
at the IMGT database, which revealed an excess of synon-
ymous changes in all exons (1—5), which is consistent with
purifying selection (Mendes-Junior CT et al., unpublished
data). Because HLA-G presents several biological effects re-
lated to the control of immune response (Lee et al. 1995;
Diehl et al. 1996; Ishitani et al. 2003), one may expect that
an invariable mechanism of maternal tolerance should be
more effective, conferring a higher reproductive fitness. It is
possible that such purifying selection would result from
this tolerogenic feature of the HLA-G molecule. For exam-
ple, LILRB1 and LILRB2 are receptors expressed on the sur-
face of several leukocytes and they bind to the a3 domain
of the HLA-G molecule. Given that LILRBs are considered to
be the major HLA-G receptors, it is noteworthy that only
one worldwide HLA-G allele do present a nonsynonymous
polymorphic site at exon 4 (G*01:06), which codes the a3
domain of the molecule. One might expect that polymor-
phic residues observed in this domain may negatively in-
fluence LILRB interactions, modulating the inhibitory
intracellular signaling. It is interesting to observe that
the only frequent allele with a nonsynonymous mutation
at exon 4 (G*01:06) has been associated with preeclampsia
in several populations (Donadi et al. 2011).
In contrast to the coding region, the regulatory regions
(5# URR and 3# UTR) suffer selection toward heterozygosis
(balancing selection) (Aldrich et al. 2002; Tan et al. 2005;
Mendes-Junior et al. 2007; Castelli et al. 2010). It could
be possible that the balancing selection signature at the
3# UTR region results from a hitchhiking effect of balancing
selection at the 5# URR. However, this scenario is not
straightforward, given that an in silico study revealed that
most of the polymorphic sites of the 3# UTR region are
miRNA-binding sites and their alleles presumably affect
the miRNA-binding affinity (Castelli et al. 2009). These re-
sults suggest that these miRNAs might play a relevant role
on the HLA-G expression pattern and, hence, the 3# UTR
region would be a direct target for balancing selection.
The coexistence of different selective pressures over
a given gene would be favored by intragenic recombina-
tion. In fact, the existence of three recombining haplotypes
in the present sample support the existence of crossing-
over events throughout the HLA-G gene, particularly inside
the HLA-G coding-region. It should be emphasized that dif-
ferent patterns of natural selection shaping variability of
different parts of a same gene have been previously ob-
served. Various class I and II MHC genes have provided ev-
idence consistent with both balancing and purifying
selection in humans, mice, and elephants. Although HLA
class I antigen-binding sites are suffering overdominant se-
lection, coding regions that are not involved in antigen pre-
3082
MBE
sentation appear to have experienced purifying selection
(Hughes and Nei 1989; Archie et al. 2010). Outside the
MHC, there is strong evidence that balancing selection
has shaped the pattern of variation of the 5# URR region
of the CCR5 gene (Bamshad et al. 2002; Ramalho et al.
2010), whereas its coding region has been subject to pos-
itive selection or neutral evolution (Sabeti et al. 2005).
In order to better evaluate which polymorphic sites are in
fact driven by these balancing selection signatures, windows
of 150-bp in the promoter, coding, and 3# UTR regions were
established and the Tajima’s D were calculated in each one of
them. The promoter region did present three windows with
significantly positive Tajima’s D values: one window with the
Downloaded from https://academic.oup.com/mbe/article/28/11/3069/1045931 by guest on 30 August 2022
variation
1306, another window with variations
762,

725,
616,
689, and
666, and a third window with the
variation
201. The 3# UTR region did present significantly
positive Tajima’s D only in the window with the variations
þ3142, þ3187, and þ3196. The coding region presented
two windows with significantly positive Tajima’s D values,
one with the variations þ15 and þ36 at exon 1 and þ99,
þ126, þ130, and þ147 at intron 1, and the other with
the variation þ372. Interestingly, these windows are not ad-
jacent and may indicate polymorphisms with a greater func-
tional relevance. For example, the position
1306 is in the
LCR of the HLA-G gene and may influence the binding of
several transcriptional factors, including the RREB-1. The po-
sitions
762,
725, and
716 are close to the ISRE motif
present around position
744, a binding site for IRF-1.
The position
201 is in the nonfunctional enhancer A,
which may influence its functionality. In addition, positions

201, þ15, and þ36 are in complete LD with position

1306, which may also explain such high Tajima’s D value
by a hitchhiking effect. However, the window with the poly-
morphic sites in intron 1 (þ99 to þ147) was in fact intrigu-
ing. It is not possible to evaluate the impact of such
polymorphisms in the HLA-G function, unless they influ-
ence HLA-G splicing patterns, the mRNA secondary struc-
ture, or its stability. The polymorphic site þ372 may be not
relevant because it is a synonymous exchange, but it is in
elevated LD with all promoter variations discussed above.
The 3# UTR region presented balancing selection signature
only in the window with polymorphic sites that were eval-
uated regarding their functional relevance (þ3142 influ-
encing miRNA binding and þ3187 influencing mRNA
stability). Taking these evidences, we believe that indeed
balancing selection may act primarily in the regulatory re-
gions in the most functionally relevant polymorphic sites.
The HLA-G trend toward heterozygosity may assure
a fine balance between high-expressing and low-expressing
HLA-G haplotypes, that is, during pregnancy, high-express-
ing haplotypes would be favored in the absence of infec-
tion, whereas low-expressing haplotypes would be favored
in the presence of infection. Apparently, the presence of
both a high-expressing and a low-expressing haplotypes
in an individual may have been an advantage during evo-
lution, proning individuals to face situations when a high or
low HLA-G expression is profitable. This is strongly rein-
forced by all the neutrality tests performed (Ewens–
HLA-G Variation in Regulatory Regions · doi:10.1093/molbev/msr138
Watterson, Tajima’s D and Fu and Li’s F and D), which
revealed evidences of balancing selection acting only on
the regulatory regions (5# URR and 3# UTR) and on the
HLA-G locus as whole, probably by a hitchhiking effect
due to the regulatory regions surrounding the coding re-
gion. These results may be, however, obscured by the pop-
ulation history (admixture) that characterizes this Brazilian
urban population. Population stratification, for example,
may add to selection, overestimating the balancing selec-
tion signatures obtained here. However, these same eviden-
ces have been found in other populations, such as Han
Chinese, African American, and European American
(Tan et al. 2005). Nevertheless, analyses of other worldwide
autochthonous population samples should be carried out
to reinforce this hypothesis.
Due to the observation of very divergent HLA-G lineages,
as illustrated in figure 4, accounting for more than 52% of
the HLA-G haplotypes, one may argue that the six main
HLA-G lineages (HG010101 and their sublineages,
HG010102, HG010103, HG010108, HG0103, and HG0104)
as well as the very divergent HLA-G lineages (fig. 2, sides
A and B) are also suffering balancing selection toward het-
erozygosis and that these very divergent HLA-G lineages
might be associated with different HLA-G expression pro-
files. The Ewens–Watterson neutrality test was used to
evaluate this matter, and three additional tests were per-
formed considering 1) the main HLA-G lineages of each
sample, with all the HG010101 lineages stratified into their
sublineages and each crossing considered to involve differ-
ent haplotypes; 2) the main HLA-G lineages of each sample,
with all HG010101 lineages considered as a whole, the pos-
sible crossing-overs between sequences of the same lineage
considered as an allele of this lineage and the possible cross-
ing-overs between different lineages considered as different
haplotypes; and 3) the side (A or B) of figure 2 in which
each HLA-G haplotype of each sample was placed, in order
to evaluate the heterozygosis between very divergent HLA-
G lineages. All these tests revealed negative normalized F
values, but only the last test (divergent lineages) did reveal
a significant negative normalized F value (F 5
1.9637, P 5
0.0205). A closer evaluation of the HLA-G lineages from
sides A and B (fig. 2) reveals that each side is composed
exclusively by HLA-G haplotypes harboring one of the pro-
moter lineages proposed by Tan et al. (2005). Therefore,
although the inclusion of both the 3# UTR and the coding
regions enhance the resolution of the HLA-G network, the
present results corroborate previous findings (Tan et al.
2005), that is, the existence of two highly divergent lineages
of haplotypes(each one with sublineages) in diverse human
populations, which may have very different transcriptional
activity (determined by both the promoter and the 3# UTR
variability) and might result in precise and adequate
protein levels.
In conclusion, the HLA-G locus seems to present six dif-
ferent HLA-G lineages showing functional variations mainly
in nucleotides of the regulatory regions. These include dif-
ferences in the 5# URR at positions that either coincide
with or are close to known transcription factor–binding
MBE
sites and differences in the 3# UTR mainly at positions that
have already been reported to influence HLA-G mRNA sta-
bility and degradation rate. The evidence of balancing se-
lection acting on the regulatory regions indicates that these
HLA-G lineages are probably related to different expression
profiles, depending on microenvironmental factors and on
physiological or pathological conditions of the individual.
Acknowledgments
This study was supported by the Brazilian National Re-
search Council (CNPq/Brazil—Grants 475670/2007-8 and
558476/2008-0) and the binational collaborative research
program CAPES-COFECUB (project # 653/09). E.C.C was
Downloaded from https://academic.oup.com/mbe/article/28/11/3069/1045931 by guest on 30 August 2022
supported by a postdoctoral fellowship (07/58420-4) from
FAPESP/Brazil. L.C.V.C is supported by a postdoctoral fel-
lowship (150175/2009-4) from CNPq/Brazil. M.R. is recipi-
ent of Research Scholar Award from the Fonds de la
Recherche en Santé du Québec. We thank Marie-Claude
Faucher, Karine Beauchemin, Sandra Rodrigues, and Flavia
Tremeschin de Almeida for invaluable help. The authors
declare no competing financial interests.
References
Aldrich C, Wambebe C, Odama L, Di Rienzo A, Ober C. 2002.
Linkage disequilibrium and age estimates of a deletion poly-
morphism (1597DeltaC) in HLA-G suggest non-neutral evolu-
tion. Hum Immunol. 63:405–412.
Allan DS, Colonna M, Lanier LL, Churakova TD, Abrams JS, Ellis SA,
McMichael AJ, Braud VM. 1999. Tetrameric complexes of human
histocompatibility leukocyte antigen (HLA)-G bind to peripheral
blood myelomonocytic cells. J Exp Med. 189:1149–1156.
Alvarez M, Piedade J, Balseiro S, Ribas G, Regateiro F. 2009. HLA-G
3’-UTR SNP and 14-bp deletion polymorphisms in Portuguese
and Guinea-Bissau populations. Int J Immunogenet. 36:361–366.
Archie EA, Henry T, Maldonado JE, Moss CJ, Poole JH, Pearson VR,
Murray S, Alberts SC, Fleischer RC. 2010. Major histocompatibility
complex variation and evolution at a single, expressed DQA locus
in two genera of elephants. Immunogenetics 62:85–100.
Auboeuf D, Honig A, Berget SM, O’Malley BW. 2002. Coordinate
regulation of transcription and splicing by steroid receptor
coregulators. Science 298:416–419.
Bamshad MJ, Mummidi S, Gonzalez E, et al. (8 co-authors). 2002. A
strong signature of balancing selection in the 5’ cis-regulatory
region of CCR5. Proc Natl Acad Sci U S A. 99:10539–10544.
Bandelt HJ, Forster P, Sykes BC, Richards MB. 1995. Mitochondrial
portraits of human populations using median networks. Genetics
141:743–753.
Barrett JC, Fry B, Maller J, Daly MJ. 2005. Haploview: analysis and
visualization of LD and haplotype maps. Bioinformatics 21:263–265.
Berger DS, Hogge WA, Barmada MM, Ferrell RE. 2010. Comprehen-
sive analysis of HLA-G: implications for recurrent spontaneous
abortion. Reprod Sci. 17:331–338.
Bettencourt BF, Santos MR, Fialho RN, et al. (8 co-authors). 2008.
Evaluation of two methods for computational HLA haplotypes
inference using a real dataset. BMC Bioinformatics. 9:68.
Brown D, Trowsdale J, Allen R. 2004. The LILR family: modulators of
innate and adaptive immune pathways in health and disease.
Tissue Antigens. 64:215–225.
Carosella ED, Favier B, Rouas-Freiss N, Moreau P, Lemaoult J. 2008.
Beyond the increasing complexity of the immunomodulatory
HLA-G molecule. Blood 111:4862–4870.
3083
Castelli et al. · doi:10.1093/molbev/msr138
Carosella ED, Horuzsko A. 2007. HLA-G and cancer. Semin Cancer Biol.
17:411–412.
Carosella ED, Moreau P, Lemaoult J, Rouas-Freiss N. 2008. HLA-G:
from biology to clinical benefits. Trends Immunol. 29:125–132.
Castelli EC, Mendes-Junior CT, Deghaide NH, de Albuquerque RS,
Muniz YC, Simoes RT, Carosella ED, Moreau P, Donadi EA. 2010.
The genetic structure of 3’untranslated region of the HLA-G gene:
polymorphisms and haplotypes. Genes Immun. 11:134–141.
Castelli EC, Mendes-Junior CT, Donadi EA. 2007. HLA-G alleles and
HLA-G 14 bp polymorphisms in a Brazilian population. Tissue
Antigens. 70:62–68.
Castelli EC, Mendes-Junior CT, Viana de Camargo JL, Donadi EA. 2008.
HLA-G polymorphism and transitional cell carcinoma of the
bladder in a Brazilian population. Tissue Antigens. 72:149–157.
Castelli EC, Mendes-Junior CT, Wiezel CE, Peres NT, Simoes AL,
Rossi NM, Donadi EA. 2007. A novel HLA-G allele, HLA-G*010111,
in the Brazilian population. Tissue Antigens. 70:349–350.
Castelli EC, Moreau P, Oya e Chiromatzo A, Mendes-Junior CT, Veiga-
Castelli LC, Yaghi L, Giuliatti S, Carosella ED, Donadi EA. 2009. In
silico analysis of microRNAS targeting the HLA-G 3’ untranslated
region alleles and haplotypes. Hum Immunol. 70:1020–1025.
Castro MJ, Morales P, Martinez-Laso J, Allende L, Rojo-Amigo R,
Gonzalez-Hevilla M, Varela P, Moreno A, Garcia-Berciano M,
Arnaiz-Villena A. 2000. Evolution of MHC-G in humans and
primates based on three new 3’UT polymorphisms. Hum Immunol.
61:1157–1163.
Chu W, Gao J, Murphy WJ, Hunt JS. 1999. A candidate interferon-
gamma activated site (GAS element) in the HLA-G promoter
does not bind nuclear proteins. Hum Immunol. 60:1113–1118.
Cirulli V, Zalatan J, McMaster M, Prinsen R, Salomon DR, Ricordi C,
Torbett BE, Meda P, Crisa L. 2006. The class I HLA repertoire of
pancreatic islets comprises the nonclassical class Ib antigen HLA-G.
Diabetes 55:1214–1222.
Colonna M, Navarro F, Bellon T, Llano M, Garcia P, Samaridis J,
Angman L, Cella M, Lopez-Botet M. 1997. A common inhibitory
receptor for major histocompatibility complex class I molecules
on human lymphoid and myelomonocytic cells. J Exp Med.
186:1809–1818.
Colonna M, Samaridis J, Cella M, Angman L, Allen RL,
O’Callaghan CA, Dunbar R, Ogg GS, Cerundolo V, Rolink A.
1998. Human myelomonocytic cells express an inhibitory
receptor for classical and nonclassical MHC class I molecules. J
Immunol. 160:3096–3100.
Cosman D, Fanger N, Borges L, Kubin M, Chin W, Peterson L,
Hsu ML. 1997. A novel immunoglobulin superfamily receptor for
cellular and viral MHC class I molecules. Immunity 7:273–282.
Crisa L, McMaster MT, Ishii JK, Fisher SJ, Salomon DR. 1997.
Identification of a thymic epithelial cell subset sharing
expression of the class Ib HLA-G molecule with fetal
trophoblasts. J Exp Med. 186:289–298.
Diehl M, Munz C, Keilholz W, Stevanovic S, Holmes N, Loke YW,
Rammensee HG. 1996. Nonclassical HLA-G molecules are
classical peptide presenters. Curr Biol. 6:305–314.
Donadi EA, Castelli EC, Arnaiz-Villena A, Roger M, Rey D, Moreau P.
2011. Implications of the polymorphism of HLA-G on its
function, regulation, evolution and disease association. Cell Mol
Life Sci. 68:369–395.
Excoffier L, Laval G, Schneider S. 2005. Arlequin ver. 3.0: an
integrated software package for population genetics data
analysis. Evol Bioinform Online. 1:47–50.
Excoffier L, Slatkin M. 1998. Incorporating genotypes of relatives into
a test of linkage disequilibrium. Am J Hum Genet. 62:171–180.
Flajollet S, Poras I, Carosella ED, Moreau P. 2009. RREB-1 is
a transcriptional repressor of HLA-G. J Immunol. 183:6948–6959.
Gobin SJ, Biesta P, de Steenwinkel JE, Datema G, van den Elsen PJ.
2002. HLA-G transactivation by cAMP-response element-
3084
MBE
binding protein (CREB). An alternative transactivation pathway
to the conserved major histocompatibility complex (MHC) class
I regulatory routes. J Biol Chem. 277:39525–39531.
Gobin SJ, Keijsers V, van Zutphen M, van den Elsen PJ. 1998. The
role of enhancer A in the locus-specific transactivation of
classical and nonclassical HLA class I genes by nuclear factor
kappa B. J Immunol. 161:2276–2283.
Gobin SJ, van Zutphen M, Woltman AM, van den Elsen PJ. 1999.
Transactivation of classical and nonclassical HLA class I genes
through the IFN-stimulated response element. J Immunol.
163:1428–1434.
Guo SW, Thompson EA. 1992. Performing the exact test of Hardy-
Weinberg proportion for multiple alleles. Biometrics 48:361–372.
Harrison GA, Humphrey KE, Jakobsen IB, Cooper DW. 1993. A 14 bp
deletion polymorphism in the HLA-G gene. Hum Mol Genet.
Downloaded from https://academic.oup.com/mbe/article/28/11/3069/1045931 by guest on 30 August 2022
2:2200.
Hiby SE, King A, Sharkey A, Loke YW. 1999. Molecular studies of
trophoblast HLA-G: polymorphism, isoforms, imprinting and
expression in preimplantation embryo. Tissue Antigens. 53:1–13.
Hughes AL, Nei M. 1989. Nucleotide substitution at major
histocompatibility complex class II loci: evidence for over-
dominant selection. Proc Natl Acad Sci U S A. 86:958–962.
Hviid TV. 2006. HLA-G in human reproduction: aspects of genetics,
function and pregnancy complications. Hum Reprod Update.
12:209–232.
Hviid TV, Hylenius S, Rorbye C, Nielsen LG. 2003. HLA-G allelic
variants are associated with differences in the HLA-G mRNA
isoform profile and HLA-G mRNA levels. Immunogenetics
55:63–79.
Hviid TV, Rizzo R, Christiansen OB, Melchiorri L, Lindhard A,
Baricordi OR. 2004. HLA-G and IL-10 in serum in relation to
HLA-G genotype and polymorphisms. Immunogenetics
56:135–141.
Hviid TV, Rizzo R, Melchiorri L, Stignani M, Baricordi OR. 2006.
Polymorphism in the 5’ upstream regulatory and 3’ untranslated
regions of the HLA-G gene in relation to soluble HLA-G and IL-
10 expression. Hum Immunol. 67:53–62.
Ibrahim EC, Morange M, Dausset J, Carosella ED, Paul P. 2000. Heat
shock and arsenite induce expression of the nonclassical class I
histocompatibility HLA-G gene in tumor cell lines. Cell Stress
Chaperones. 5:207–218.
Ishitani A, Sageshima N, Lee N, Dorofeeva N, Hatake K,
Marquardt H, Geraghty DE. 2003. Protein expression and
peptide binding suggest unique and interacting functional roles
for HLA-E, F, and G in maternal-placental immune recognition. J
Immunol. 171:1376–1384.
Ito T, Ito N, Saathoff M, Stampachiacchiere B, Bettermann A,
Bulfone-Paus S, Takigawa M, Nickoloff BJ, Paus R. 2005.
Immunology of the human nail apparatus: the nail matrix is
a site of relative immune privilege. J Invest Dermatol.
125:1139–1148.
Kang H, Yun HS, Song MY, Lee JK, Kwack K. 2007. Identification of
novel HLA-G subtype, HLA-G*0109, by sequencing in the Korean
population. Tissue Antigens. 70:529–530.
Klein J, Sato A. 2000a. The HLA system. First of two parts. N Engl J
Med. 343:702–709.
Klein J, Sato A. 2000b. The HLA system. Second of two parts. N Engl J
Med. 343:782–786.
Kuersten S, Goodwin EB. 2003. The power of the 3’ UTR:
translational control and development. Nat Rev Genet.
4:626–637.
Lajoie J, Boivin AA, Jeanneau A, Faucher MC, Roger M. 2009.
Identification of six new HLA-G alleles with non-coding DNA
base changes. Tissue Antigens. 73:379–380.
HLA-G Variation in Regulatory Regions · doi:10.1093/molbev/msr138
Lancaster AK, Single RM, Solberg OD, Nelson MP, Thomson G. 2007.
PyPop update-a software pipeline for large-scale multilocus
population genomics. Tissue Antigens: 69(Suppl 1): 192–197.
Le Discorde M, Moreau P, Sabatier P, Legeais JM, Carosella ED. 2003.
Expression of HLA-G in human cornea, an immune-privileged
tissue. Hum Immunol. 64:1039–1044.
Le Gal FA, Riteau B, Sedlik C, Khalil-Daher I, Menier C, Dausset J,
Guillet JG, Carosella ED, Rouas-Freiss N. 1999. HLA-G-mediated
inhibition of antigen-specific cytotoxic T lymphocytes. Int
Immunol. 11:1351–1356.
Lee N, Malacko AR, Ishitani A, Chen MC, Bajorath J, Marquardt H,
Geraghty DE. 1995. The membrane-bound and soluble forms of
HLA-G bind identical sets of endogenous peptides but differ
with respect to TAP association. Immunity. 3:591–600.
Lefebvre S, Berrih-Aknin S, Adrian F, Moreau P, Poea S, Gourand L,
Dausset J, Carosella ED, Paul P. 2001. A specific interferon (IFN)-
stimulated response element of the distal HLA-G promoter
binds IFN-regulatory factor 1 and mediates enhancement of this
nonclassical class I gene by IFN-beta. J Biol Chem. 276:6133–6139.
LeMaoult J, Krawice-Radanne I, Dausset J, Carosella ED. 2004. HLA-
G1-expressing antigen-presenting cells induce immunosuppres-
sive CD4þ T cells. Proc Natl Acad Sci U S A. 101:7064–7069.
Librado P, Rozas J. 2009. DnaSP v5: a software for comprehensive
analysis of DNA polymorphism data. Bioinformatics 25:1451–1452.
Mallet V, Blaschitz A, Crisa L, Schmitt C, Fournel S, King A, Loke YW,
Dohr G, Le Bouteiller P. 1999. HLA-G in the human thymus:
a subpopulation of medullary epithelial but not CD83(þ)
dendritic cells expresses HLA-G as a membrane-bound and
soluble protein. Int Immunol. 11:889–898.
Mendes-Junior CT, Castelli EC, Simoes RT, Simoes AL, Donadi EA. 2007.
HLA-G 14-bp polymorphism at exon 8 in Amerindian populations
from the Brazilian Amazon. Tissue Antigens. 69:255–260.
Menier C, Rabreau M, Challier JC, Le Discorde M, Carosella ED,
Rouas-Freiss N. 2004. Erythroblasts secrete the nonclassical HLA-
G molecule from primitive to definitive hematopoiesis. Blood
104:3153–3160.
Miller SA, Dykes DD, Polesky HF. 1988. A simple salting out
procedure for extracting DNA from human nucleated cells.
Nucleic Acids Res. 16:1215.
Moreau P, Flajollet S, Carosella ED. 2009. Nonclassical transcriptional
regulation of HLA-G: an update. J Cell Mol Med. 13(9B):2973–2989.
Moreau P, Mouillot G, Rousseau P, Marcou J, Dausset C,
Carosella ED. 2003. HLA-G gene repression is reversed by
demethylation. Proc Natl Acad Sci U S A. 100:1191–1196.
Mouillot G, Marcou C, Rousseau P, Rouas-Freiss N, Carosella ED,
Moreau P. 2005. HLA-G gene activation in tumor cells involves
cis-acting epigenetic changes. Int J Cancer. 113:928–936.
Nicolae D, Cox NJ, Lester LA, et al. (19 co-authors). 2005. Fine mapping
and positional candidate studies identify HLA-G as an asthma
susceptibility gene on chromosome 6p21. Am J Hum Genet.
76:349–357.
O’Brien M, McCarthy T, Jenkins D, Paul P, Dausset J, Carosella ED,
Moreau P. 2001. Altered HLA-G transcription in pre-eclampsia is
associated with allele specific inheritance: possible role of the HLA-G
gene in susceptibility to the disease. Cell Mol Life Sci. 58:1943–1949.
Ober C, Aldrich CL, Chervoneva I, Billstrand C, Rahimov F, Gray HL,
Hyslop T. 2003. Variation in the HLA-G promoter region
influences miscarriage rates. Am J Hum Genet. 72:1425–1435.
Ober C, Billstrand C, Kuldanek S, Tan Z. 2006. The miscarriage-
associated HLA-G -725G allele influences transcription rates in
JEG-3 cells. Hum Reprod. 21:1743–1748.
Parra FC, Amado RC, Lambertucci JR, Rocha J, Antunes CM,
Pena SD. 2003. Color and genomic ancestry in Brazilians. Proc
Natl Acad Sci U S A. 100:177–182.
MBE
Pirri A, Contieri FC, Benvenutti R, Bicalho Mda G. 2009. A study of
HLA-G polymorphism and linkage disequilibrium in renal trans-
plant patients and their donors. Transpl Immunol. 20:143–149.
Ponte M, Cantoni C, Biassoni R, Tradori-Cappai A, Bentivoglio G, Vitale C,
Bertone S, Moretta A, Moretta L, Mingari MC. 1999. Inhibitory
receptors sensing HLA-G1 molecules in pregnancy: decidua-associated
natural killer cells express LIR-1 and CD94/NKG2A and acquire p49,
an HLA-G1-specific receptor. Proc Natl Acad Sci U S A. 96:5674–5679.
Pyo CW, Williams LM, Moore Y, Hyodo H, Li SS, Zhao LP,
Sageshima N, Ishitani A, Geraghty DE. 2006. HLA-E, HLA-F, and
HLA-G polymorphism: genomic sequence defines haplotype
structure and variation spanning the nonclassical class I genes.
Immunogenetics 58:241–251.
Rajagopalan S, Long EO. 1999. A human histocompatibility
leukocyte antigen (HLA)-G-specific receptor expressed on all
Downloaded from https://academic.oup.com/mbe/article/28/11/3069/1045931 by guest on 30 August 2022
natural killer cells. J Exp Med. 189:1093–1100.
Ramalho RF, Santos EJ, Guerreiro JF, Meyer D. 2010. Balanced
polymorphism in bottlenecked populations: the case of the
CCR5 5’ cis-regulatory region in Amazonian Amerindians. Hum
Immunol. 71:922–928.
Raymond M, Rousset F. 1995. GENEPOP (version 1.2): population
genetics software for exact tests and ecumenicism. J Hered.
86:248–249.
Rebmann V, van der Ven K, Passler M, Pfeiffer K, Krebs D, Grosse-
Wilde H. 2001. Association of soluble HLA-G plasma levels with
HLA-G alleles. Tissue Antigens. 57:15–21.
Ristich V, Liang S, Zhang W, Wu J, Horuzsko A. 2005. Tolerization of
dendritic cells by HLA-G. Eur J Immunol. 35:1133–1142.
Rizzo R, Hviid TV, Govoni M, et al. (13 co-authors). 2008. HLA-G
genotype and HLA-G expression in systemic lupus erythemato-
sus: HLA-G as a putative susceptibility gene in systemic lupus
erythematosus. Tissue Antigens. 71:520–529.
Rouas-Freiss N, Goncalves RM, Menier C, Dausset J, Carosella ED.
1997. Direct evidence to support the role of HLA-G in
protecting the fetus from maternal uterine natural killer
cytolysis. Proc Natl Acad Sci U S A. 94:11520–11525.
Rousseau P, Le Discorde M, Mouillot G, Marcou C, Carosella ED,
Moreau P. 2003. The 14 bp deletion-insertion polymorphism in
the 3’ UT region of the HLA-G gene influences HLA-G mRNA
stability. Hum Immunol. 64:1005–1010.
Sabeti PC, Walsh E, Schaffner SF, et al. (12 co-authors). 2005. The
case for selection at CCR5-Delta32. PLoS Biol. 3:e378.
Sachidanandam R, Weissman D, Schmidt SC, et al. (38 co-authors).
2001. A map of human genome sequence variation containing
1.42 million single nucleotide polymorphisms. Nature
409:928–933.
Schmidt CM, Ehlenfeldt RG, Athanasiou MC, Duvick LA,
Heinrichs H, David CS, Orr HT. 1993. Extraembryonic expression
of the human MHC class I gene HLA-G in transgenic mice.
Evidence for a positive regulatory region located 1 kilobase 5’ to
the start site of transcription. J Immunol. 151:2633–2645.
Shi Y, Sawada J, Sui G, Affar el B, Whetstine JR, Lan F, Ogawa H,
Luke MP, Nakatani Y. 2003. Coordinated histone modifications
mediated by a CtBP co-repressor complex. Nature 422:735–738.
Solier C, Mallet V, Lenfant F, Bertrand A, Huchenq A, Le Bouteiller P.
2001. HLA-G unique promoter region: functional implications.
Immunogenetics 53:617–625.
Stephens M, Smith NJ, Donnelly P. 2001. A new statistical method
for haplotype reconstruction from population data. Am J Hum
Genet. 68:978–989.
Tan Z, Randall G, Fan J, et al. (9 co-authors). 2007. Allele-specific
targeting of microRNAs to HLA-G and risk of asthma. Am J Hum
Genet. 81:829–834.
Tan Z, Shon AM, Ober C. 2005. Evidence of balancing selection at
the HLA-G promoter region. Hum Mol Genet. 14:3619–3628.
3085
Castelli et al. · doi:10.1093/molbev/msr138
Veit TD, Chies JA. 2009. Tolerance versus immune
response—microRNAs as important elements in the regulation
of the HLA-G gene expression. Transpl Immunol. 20:229–231.
Yelavarthi KK, Schmidt CM, Ehlenfeldt RG, Orr HT, Hunt JS. 1993.
Cellular distribution of HLA-G mRNA in transgenic mouse
placentas. J Immunol. 151:3638–3645.
3086
MBE
Yie SM, Li LH, Xiao R, Librach CL. 2008. A single base-pair mutation
in the 3’-untranslated region of HLA-G mRNA is associated with
pre-eclampsia. Mol Hum Reprod. 14:649–653.
Yie SM, Xiao R, Librach CL. 2006. Progesterone regulates HLA-G
gene expression through a novel progesterone response
element. Hum Reprod. 21:2538–2544.
Downloaded from https://academic.oup.com/mbe/article/28/11/3069/1045931 by guest on 30 August 2022