Materials Today: Proceedings xxx (xxxx) xxx

Contents lists available at ScienceDirect

Materials Today: Proceedings

journal homepage: www.elsevier.com/locate/matpr

Copper nanoparticles green synthesis and characterization as anticancer

potential in breast cancer cells (MCF7) derived from Prunus nepalensis
phytochemicals
Samuel Shiferaw Biresaw ⇑, Pankaj Taneja
Sharda University, Biotechnology, plot No. 32-34, knowledge park III, Greater Noida, Uttar Pradesh 201310, India

a r t i c l e i n f o a b s t r a c t

Article history: The green synthesis of nanoparticles from bioactive compounds have attracted a wide range of applica-
Received 24 November 2020 tion, due to increased drug efficacy and less toxicity in the nanosized mediated drug delivery model. In
Received in revised form 14 June 2021 this study, we have fabricated copper nanoparticles (CuNPs) from the fruits of Prunus nepalensis (P.
Accepted 6 July 2021
nepalensis) extract. Therefore, the aim of present study was to investigate the anticancer ability of P.
Available online xxxx
nepalensis fruit phytochemical copper nanoaprticles (PNFPCuNP) on cancerous human breast cell line
(MCF-7) and healthy (MCFA10) cell lines. Crystalline CuNPs of P. nepalensis synthesis was confirmed
Keywords:
by different physicochemical analytical techniques such as UV–Visible Spectroscopy (UV–Vis); Fourier-
Copper nanoparticles
Phytochemicals
Transform Infrared Spectroscopy (FT-IR); Scanning Electron Microscopy (SEM); and Transmission
Gene expression Electron Microscopy (TEM). Nanoparticle Size was found to be ranging from 35 to 50 nm with the average
Characterization size of 42.5 nm. Further, after synthesized compounds were tested anticancer activity on human breast
Breast cancer cancer cell lines. Following 72 h treatment to PNFPCuNP, the expression of apoptotic marker genes
(P21, p53, P14/P19, Caspase-3) were studied in MCF-7 cells treated at 100 to 200 lg of PNFP-CuNP.
Our results showed that PNFP-CuNP increased the gene expression of apoptotic genes in a dose-
dependent manner. The real-time PCR data showed a significant upregulation in p53, Bax, caspase-3,
and caspase-9 and down regulation in the mRNA expression of Ras and Myc genes in MCF-7 cells exposed
to PNFP-CuNP. Collectively, the data from this study stated that P. nepalennsis fruit extract phytochem-
ical derived nanoparticles induced apoptosis via the up regulation of tumour suppressor genes and down
regulation of oncogenes in MCF-7 cells. Finally, our study confirmed the CuNPs synthesis from P. nepalen-
sis fruit phytochemical, which showed environmental friendly anticancer activity.
Ó 2021 Elsevier Ltd. All rights reserved.
Selection and peer-review under responsibility of the scientific committee of the National Conference on
Functional Materials: Emerging Technologies and Applications in Materials Science.

1. Introduction The leading cause of cancer death in women worldwide is breast

Phytochemicals from medicinal plant parts are believed much
safer and easier to metabolize than other synthetic medicinal com-
posites [1,2]. The bioactive compounds obtained from the plant
parts lead towards synthesis of drugs [3]. Developed countries
used almost quarter of the total medicinal bioactive compounds
from natural compounds [4–6].
As of WHO each year 1.3 million women developing breast can-
cer disease. And this cancer is a problem of global issue since its
incidence. But effective therapeutic options are quite limited [7].
⇑ Corresponding author.
E-mail address: tenbets@gmail.com (S.S. Biresaw).
cancer. Even if there is advancement in detection and chemother-
apy, still it is the main cause for dying of many women worldwide
especially in developed world [8].
Alkylating agents, antimetabolites and other different cancer
therapy methods have side effects without discriminating the
cancerous cells and normal cells [9]. Using of nanomaterials in
the cancer therapy has been found as an important means for dis-
covery of the modern cancer drugs [10,11]. Nanoparticles are
sometimes referred to as structured contemporary pharmaceuti-
cals that are particularly useful in the treatment of cancer due to
their nanoscale sized nature, which allows for improved medica-
tion efficacy and long-term drug release [12,13].

https://doi.org/10.1016/j.matpr.2021.07.149
2214-7853/Ó 2021 Elsevier Ltd. All rights reserved.
Selection and peer-review under responsibility of the scientific committee of the National Conference on Functional Materials: Emerging Technologies and Applications in
Materials Science.

Please cite this article as: Samuel Shiferaw Biresaw and P. Taneja, Copper nanoparticles green synthesis and characterization as anticancer potential in
breast cancer cells (MCF7) derived from Prunus nepalensis phytochemicals, Materials Today: Proceedings, https://doi.org/10.1016/j.matpr.2021.07.149
Samuel Shiferaw Biresaw and P. Taneja
Green synthesis of nanoparticles (NPs) is one of the technology
branches that are rapidly developing in the field of bionanotech-
nology [14,15]. Particular emphasis has been placed on investigat-
ing different controlled shape, size, and dispersion degree of NPs
using bio-inspired methods [16].
Edible fruits have attracted the scientific community in recent
times because they contain many antioxidants and bioactive phy-
tochemicals that can serve as potential remedial agents. The plant
of interest in this study is P. nepalensis, which is commonly used to
make different juice drinks and other wines. Furthermore, P.
nepalensis fruits are used as an astringent. The leaves are also used
as a diuretic and to treat edema [17,18]. Moreover, also used as
antioxidant and scavenging agent [17]. Several bioactive com-
pounds like quinic acid, quercetin, rutin, scopoletin, palmitoleic
acid, and naringenin have been found in Prunus species [18,19].
However, there is no work has done that P. nepalensis fruit extract
can be used to make copper nanoparticles for the cancer cell treat-
ments. As a result, the current study was the first to use P. nepalen-
sis fruit extract to synthesise copper nanoparticles with anticancer
properties.
2. Material & method
2.1. material, collection of plant material
P. nepalensis fruits were purchased from market, India. This
fruits were washed clearly and cut into uniform pieces then sub-
jected to freeze drying. Those freeze dried sample was kept under
4 °C.
Then dried fruits made into powder. 10 g of dried fruit powder
was mixed with 1L of deionized water. Solution is heated in a
water bath to 80° for 1 h. then, the P. nepalensis fruit extract fil-
tered and made ready for subsequent experiments.
2.2. Reagents
Copper sulfate, starch, sodium hydroxide and CV dye used for
the nanoparticles synthesis were of analytical grades and they pur-
chased from Hi Media Laboratories Pvt. Ltd. Mumbai, India. MTT
test assay was obtained from Invitrogen, USA and acridine orange,
ethidium bromide and all other fine chemicals were obtained from
Sigma Aldrich, St. Louis, USA.
2.3. Nanoparticles synthesis
1 mM of aqueous copper sulphate solution incubated at room
temperature for overnight under dark condition mixing with water
in 1:9 ratio and then fruit extracts given synthesis of copper
nanoparticles (PNFECuNP). After incubation, the reaction mixture
color changed from light green to brown then to pink, indicating
the formation of nanoparticles. Subsequently, the nanoparticle
reaction mixture was removed and transferred into falcon tube,
centrifuged at 10,000 rpm for 10 min. After centrifugation, the
nanoparticle pellet washed with sterile distilled water for 3 times
to remove impurities. Then it dried and stored at
4°C for further
characterization and cancer therapy experimental study.
2.4. Characterizations of P. neplensis fruit extract CuNPs
The formation of Prunus nepalensis fruit extract mediated
CuNPs confirmed with processing by various analytical techniques
like UV–Visible Spectroscopy (Shimadzu UV-1800 PC, Japan)
between the wavelengths of 450–700 nm.
The Scherrer formula used to calculate the particle size determi-
nation using the formula, D = Kk/bCosh where D is the particle size,
2
Materials Today: Proceedings xxx (xxxx) xxx
k is the wavelength, K is a Scherrer constant having value of 0.94, b
is a half width maximum and h is the diffraction angle. FTIR tech-
nique used to identify functional groups present in the fruit extract
and synthesized CuNPs between the wave number of 450 cm
1 to
4000 cm
1. Scanning Electron Microscope (SEM) (LeoSupra55,
CarlZeiss, Germany) also used to determine the shape of synthe-
sized CuNPs. Moreover, TEM was used to confirm the size of
nanoparticles.
2.5. Cell culture
Human breast carcinoma cells (MCF7) and human normal cell
line MCF10A were obtained from Pune. MCF7 and MCF10A cells
were grown in DMEM, complemented with fetal bovine serum
(10%) in a CO2 incubator (5% CO2, 95% air) at 37 °C.
2.6. RNA extraction and CDNA synthesis
In accordance with the manufacturer instructions, Total RNA
was extracted from the cells through the use of RNXTM-Plus
Thermo scientific solution. Thermo Scientific NanoDropTM 1000
Spectrophotometer (Thermo Scientific, Germany) has determined
the purity and concentration of the extracted RNA and confirma-
tion of its integrity by gel electrophoresis. The DNaseI therapy fol-
lowed the RNA extraction step (EN0521, Fermentas, Germany).
Random hexamers were also used as primers and Prime
ScriptTM-RT kits for synthesis of CDNA, using 1 lg of RNA (TaKaRa,
Japan).
2.7. Quantitative RT-PCR
Both MCF7 and MCF10A cell lines were used to extract total
RNA by using the RNeasy mini test kit (Qiagen, Hilden, Germany)
according to the manufacturer’s instructions. Quantitative Real-
Time PCR used to measure the expression of mRNA of Ras, p21,
p53, Myc, P14/P19 and Caspas3 present in both MCF-10 and
MCF7 cells.
At 260 nm we measured optical density to analyse spectromat-
ically for purification and quantification of RNA.
DCt = Ct values of interest genes – Ct values of GAPDH gene
DDCt – DCt of control – DCt of sample
RQ = 2 – DDCt
Quantitative RT-PCR was performed using the manufacturer’s
instructions using specific primers (Table 1) and the SYBRÒPremix
Ex TaqTM II (TaKaRa, Japan). Initial activation at 95 °C for 5 min, 40
cycles of 95 °C for 15 s and 60 °C for 1 min. The thermal cycling
condition is as follows. Each run did not include template controls.
Standard curves were prepared using data from serial diluted sam-
ples to verify the reaction efficiencies for each primary set. For each
primary set, melting curve analyses were also done. PCR products
were electrophoresed to check their product size. GAPDH gene was
used as normalizer.
Relative expressions were calculated using 2
DDCt method
[20], the qPCR assays were performed in duplicate and the data
were presented as the mean ± standard error of the mean.
2.8. MTT assay
Cytotoxicity of copper nanoparticles determined using MTT
assay on cancerous MCF-7 cell lines, as described by Mosmann
[21]. The cells (5x105 cells per well) were plated for 24 h in
200 mL of DMEM supplemented with 10% FBS in 24-well plates.
To avoid nanoparticle agglomeration, different concentrations of
the samples (control, 100 g/ml, and 200 g/ml) in 0.1 percent DMSO
were sonicated for 15 min at room temperature using a sonicator
bath and incubated for 48 h at 37C° in an incubator under 5%
Samuel Shiferaw Biresaw and P. Taneja Materials Today: Proceedings xxx (xxxx) xxx

Table 1
Primers sequence of gene mRNA.

Gene-mRNA/primers Primer Sequence F&R Temp Size of PCR product (in bp)
Ras TTGCCTTCTAGAACAGTAGACACG F 60 250
TGTCTTTGCTGAGGTCTCAATG R 61
Caspase 3 TAAGCCATGGTGATGAAGGG F 60 300
GGCAGTAGTCGCCTCTGAAG R 61
Myc CCTGACGACGAGACCTTCAT F 59 400
GCTTCTCCGAGACCAGCTT R 60
GADPH CAATGCCTCCTGCACCACCA F 60 250
TCCACCACTGACACGTTGGC R 60
P53 TGTGCACGTACTCTCCTCCC F 61 250
CTTCTGTACGGCGGTCTCTC R 60
P21 (CDKN2a) ACTGGAGGGTGACTTCGCCT F 60 250
TCCACCTGGGGACCCTTCAG R 60
P14/P19 GGGGTCGGGTAGAGGAGGTG F 60 250
CCACCAGCGTGTCCAGGAAG R 60

CO2. After treatment, the cells were incubated with MTT (100L) for
4 h at 37°Celsius, and the formazan crystals that formed were dis-
solved in 100 mL dimethylsulfoxide (DMSO).
Viability of the cells was determined by measuring the absor-
bance at 570 nm in a multiwell ELISA plate reader. The % cell via-
bility was evaluated using the following equation:
A570nm of exposed cells
Cell viability ¼  100
A570nm of control cells
The experiment was carried out in triplicate and the half max-
imal inhibitory concentration (IC50) for MCF-7 and CuNPs was cal-
culated from a dose response curve (log concentration versus
absorbance at 570 nm) using nonlinear regression with GraphPad
Prism 7.04 (GraphPad Inc.)
3. Results & discussion
3.1. Synthesis of copper nanoparticles
Using green route method, copper nanoparticles were made
from an aqueous extract of prunus nepalensis fruit. The colour
changes before and after incubation demonstrated the formation
of copper nanoparticles in the reaction medium.
Copper sulphate (CuSO4).H2O and extract from Prunus
nepalensis fruits used for synthesis of Cu-NPs. The change in colour
of the mixture from light pink to (Fig. 1f) to intense pink was
absorbed in the first 20 min, indicating the formation of NPs. Cu-
NPs exhibit characteristic surface plasmon resonance (SPR), which
results in this changing process. The pick absorptivity at 580 nm
observed in the UV–Vis spectroscopy record confirmed the
extract’s reduction (Fig. 2) [22].

4. Characterization of Cu nanoparticles from P. nepalensis fruit

2.9. Statistical analysis extract

‘‘Results expressed as mean standard deviation (SD) of three
replicates and were subjected to analysis of variance (ANOVA).
The data were analysed using GraphPad Prism version 7.04 on
the basis of one-way ANOVA after a Dunn post hoc analysis
(GraphPad Software, La Jolla, CA, USA). Mean results ± SE have been
expressed. Significant differences at P < 0.05 have been
considered.”
4.1. UV–Vis spectra analysis
The UV–Vis spectroscopy reading recorded from the Prunus
nepalensis fruit extract nanoparticle solution showed the charac-
teristic surface plasmon resonance (SPR) spectra with absorbance
at 450–700 nm and peak maximum at 580 nm (Fig. 2) which is
attributed to the formation of Cu nanoparticles. The formation of

Fig. 1. Graphical presentation of CuNP synthesis from P. nepalensis fruit extract; (a) P. nepalensis fruit, (b) fruit powder and (c) aqueous solution of synthesized fruit extract,
(d) Copper sulphate (e) aqueous solution of CuSO4H2O (f) synthesized CuNP.

3
Samuel Shiferaw Biresaw and P. Taneja
the copper nanoparticle was considered successful by initial
change in colour. CuNPs exhibited pink colour in the solution
due to excitation of surface plasmon vibration in CuNPs. The exact
position of the SPR band may shift depending on the individual
particle properties including size, shape, and capping agents.
Fig. 2 shows the results.
4.2. Fourier Transform InfraRed (FT-IR) spectrum analysis
FT-IR used to investigate the interaction between copper salt
and phytochemicals of P. nepalensis. This method of characteriza-
tion is used to know the bioactive compounds which accounts for
the reduction, coating of and stabilization of the copper
nanoparticles.
Characterization of FT-IR is used to find the molecules and their
functional group present in the samples. FT-IR spectra of the P.
nepalensis fruit extract and nanoparticle prepared by drying
20 mL of P. nepalensis over water bath and the synthesized
nanoparticles was analysed.
Fig. 2. UV –Visible analysis of Prunus nepalensis fruit extract Copper nanoparticles.
Fig. 3. FT-IR Analysis; a) FT-IR of Prunus nepalensis fruit phytochemical extracts and b) FT-IR analysis of Prunus nepalensis fruit phytochemical extracts copper nanoaprticles.
4
Materials Today: Proceedings xxx (xxxx) xxx
The FTIR spectrum of P. nepalensis fruit extract showed the
bands at 3403.92, 1593.71, 1384.69, 1126.67 and 1046.56 cm
1
and synthesized nanoparticles at 3424.94, 2918.51, 2849.8,
1654.94, 1106.04 and 617.43 cm
1 (Fig. 3, a &b).
The FT-IR spectra showed the presence of different functional
groups like Alkane (CAH stretch, ACAH bending), alcohol (OH
stretch H-bonded, free), Alkene (@CH bending, C@C stretch) Amine
(CAN, stretch) Nitro-compounds (N-O stretch) Acid (OH, stretch)
and Ester (CO, stretch). These functional groups contribute for
the synthesis of copper nanoparticles formation.
Stretching another band at 1126 cm
1 was attributed to SO2
absorption of sulfones and 1046 cm
1 was assigned as absorption
peaks of ACAOACA or ACAOA. Band at 617 cm
1 for CAH bend
of alkynes, while band at 1106.04 cm
1, indicated the presence of
amine groups. 2850 cm
1 assigned to asymmetric stretching vibra-
tion of CAH bond. After synthesis of copper nanoparticles by
exposing the copper sulphate and P. nepalensis fruit extract there
was increase in the intensity at 3424 cm
1 which may be due to
binding of [Cu(SO4)2]+ to AOH groups (Fig. 3).
4.3. Scanning electron microscopy
The surface morphology of P. nepalensis fruit extract nanopar-
ticle is observed using SEM (LeoSupra55, CarlZeiss, Germany) and
transmission electron microscope (TEM) (JEOLJEM2010). TEM sam-
ples are prepared on the 400 mesh copper grid coated with carbon
and the shape was shown as face centred cubic (Fig. 4A). And Par-
ticle Size is ranging from 35 to 50 nm with the average size of
42.5 nm as shown in Fig. 4B.
5. Gene expression studies with quantitative reverse
transcriptase-PCR studies
5.1. P. nepalensis fruit phytochemicals copper nanoparticels
(PNFPCuNP) induced inhibition of Ras gene expression
Cancerous cell inhibition of PNFPCuNP was evaluated on two
breast cell lines of normal and tumor i.e. MCF10 and MCF7. Both
cell lines treated with three concentration of PNFPCuNP (controlled
100 mg/mL and 200 mg/mL). QRT-PCR was used to measure relative
Samuel Shiferaw Biresaw and P. Taneja
Fig. 4. Scanning Elecgtron Microscopy a) Prunus nepalensis fruit extract copper nanoparticle SEM/TEM analysis and b) Copper nanoparticles size of prunus nepalensis from
fruit extract.
gene expression of the Ras gene. As shown in Fig. 5a PNFPCuNP
down regulated the expression of ras gene of MCF-7 cell lines in
dose-dependent manner. PNFPCuNP significantly inhibited prolif-
eration of MCF-7 tumor cell line at concentrations (100 mg/mL
and 200 mg/mL) after 72 h (P < 0.05).
5.2. PNFPCuNP effect on Myc gene in MCF-7 breast cancer cells
Copper nanoparticles have shown inhibition on Myc gene in
cancerous cells (MCF-7) while the normal cells were not affected
significantly. Therefore Myc genes treated with this nanoparticle
down regulated in its expression when compared to untreated
group. PNFPCuNP showed down regulation of Myc gene expres-
sion in MCF-7 breast cancer cells at 100 mg/mL (P < 0.05) also sig-
nificantly inhibited at 200 mg/mL of PNFPCuNP at 72 h. As
indicated from Fig; 5b down regulation of Myc was not going as
per the dose – dependent manner. Actually At 200 mg/mL there
was a little increase of Myc gene expression.
C-Myc plays an important role in the progression of breast can-
cer. Our findings show that PNFPCuNP inhibited tumour growth in
MCF-7 cells by lowering the c-Myc protein level, implying that
PNFPCuNP has therapeutic potential in the treatment of breast
cancer.
5.3. PNFPCuNP effect on P14/P19 gene in MCF-7 breast cancer cells
P14/P19 gene was significantly increased in MCF7 breast cancer
cells at 100 ml and 200 mg of CuNP at 72 h (P < 0.05) with its expres-
sion as of untreated one was not changed. It is clearly that the
expression of P14/P19 gene significantly higher at 200 mg than at
100 ml (P < 0.01) CuNP in the dose dependent manner. Our results
revealed over expression of P14/P19 gene in treated groups com-
pared to normal cells treated with 100 ml and 200 mg at 72 h
(P < 0.01).Fig. 5c gives an overview of the PNFPCuNP effect on
P14/P19 gene regulation in MCF7 breast cancer cells.
5.4. PNFPCuNP effect on P53 gene
The tumor suppressor p53 works to incorporate several stress
signals into a number of anti-proliferative responses. One of the
most important functions of p53 is its ability to cause apoptosis,
5
Materials Today: Proceedings xxx (xxxx) xxx
and disruption of this mechanism may promote proliferation of
tumors and chemoresistance [23].
Gene expression profiling is a useful tool for figuring out how
cells respond to PNFPCuNP treatment. RNA sequencing was used
to examine the gene expression profiles of MCF-7 cells treated with
PNFPCuNP. When compared to the control, the PNFPCuNP showed
significantly higher activity in terms of gene regulation (Fig. 5).
PNFPCuNP has exhibited up-regulation of p53 apoptotic gene mar-
ker (Fig. 5d) [23].
P53 gene has shown higher expression in MCF-7 breast cancer
cells compared to controlled cells (P < 0.05). Expression of P53
gene significantly higher at 200 mg than at 100 ml (P < 0.01), this
result showed that CuNP has effect in the dose dependent manner.
Our results revealed that over expression of P53 gene in treated
groups compared to normal cells treated with 100 ml and 200 mg
at 72 h (P < 0.01). Fig. 5d gives an overview of the PNFPCuNP effect
on P53 gene expression in MCF7 breast cancer cells.
5.5. PNFPCuNP effect on P21 gene in MCF-7 cells
P21 gene was upregulated in treated MCF7 breast cancer cell
lines as compared to normal cells which were treated at 100 mg/
mL and 200 mg/mL PNFP-CuNP (P < 0.05) (Fig. 5e). On the other
hand, P21 was not shown any change on normal (MCF10A) human
mammary epithelial cell line treated cell groups compared to trea-
ted cancerous cell lines (MCF-7) (Fig. 5e).
P21gene expression showed overexpression in MCF-7 breast
cancer cells with 100 mg/mL PNFP-CuNP at 72 h (P < 0.05), also
shown upregulation at 200 mg/mL PNFP-CuNP at 72 h (P < 0.05).
P21 gene upregulation was seen in cancerous treated cells but
not in controlled cells. The result of PNFP-CuNP effect on P21 in
MCF7 breast cancer cells is shown in Fig. 5e.
5.6. PNFPCuNP effect on Caspase 3 gene in MCF-7 breast cancer cells
To test the expression of caspase 3 in MCF-7 cells, 100 lg/mL
and 200 lg/mL concentrations of the PNFP-CuNP after 72 h
involved. Both concentrations led to upregulation in the expression
of caspases 3 in MCF-7 breast cancer cell lines compared to the
control group and untreated group. The highest activation of mRNA
levels of the genes observed at the 200 mg/mL concentration of
Samuel Shiferaw Biresaw and P. Taneja
Fig. 5. Relative gene expression of a; Ras gene; Myc, p14/P19, P53, P21 and Caspase-3 treated with CuNP; Fold change effects of PNFPCuNP on both MCF-7 and MCF10A
analysed by QRT-PCR. The cells were exposed to different concentrations of CuNP for 72 h. Data are presented as the means ± SE of two different experiments. ⁄ p < 0.05,
⁄⁄p < 0.01, and ⁄⁄⁄p < 0.001 compared to control.
nanoparticles after 72 h (Fig. 5f). As we have seen from (Fig. 5f) the
fold change at 200 mg/mL increased significantly as compared to
the fold change at 100 mg/mL and untreated groups respectively
(P < 0.01; P < 0.001).
6. MTT assay
6.1. Cytotoxicity analysis
Cytotoxicity actions of the CuNPs were studied against the MCF-
7 (Fig. 6) through MTT assay. Cytotoxicity activity on tumor cells
studied with in two concentrations (control, 100 mg/mL and
200 lg/mL) and normal cells. IC50 of the phytoconstituted CuNPs
observed at concentration of 158.5 lg/mL against MCF-7 cell line.
This result shows that the minimum dose showed good cytotoxic
activity. The bar diagram of efficacy of biosynthesized copper
nanoparticles against MCF-7 (Fig. 7) cells at different
concentration.
7. Discussion
In this report, the characteristic peak of UV-spec absorption was
observed at 580 nm and could be the reason formation of non-
oxidized CuNPs by the surface plasmon band of Copper colloids.
The big size distribution of CuNPs might result in the diameter of
the absorption band. P. nepalensis fruit extract was combined with
Cu (SO4); the solution’s color gradually turned to dark pink, indi-
cating that CuNPs synthesized [22,24].
Because all protons present in the medium interfere with cop-
per electro-deposition at low pH ranges, the antioxidant nature
6
Materials Today: Proceedings xxx (xxxx) xxx
of P. nepalensis prevents oxidation of copper. P. nepalensis was
reported to have weak ascorbic acid since it possesses ascorbic
acid, saponins and flavonoids.
Because all protons present in the medium interfere with cop-
per electro-deposition at low pH ranges, P. nepalensis’ antioxidant
nature prevents copper oxidation. P. nepalensis (acts as a capping
agent) was found to contain weak acidic constituents such as
ascorbic acid, saponins, and flavonoids [18,25].
The fruit extract of P. nepanesis is rich in polyphenolic com-
pounds [17–19,26–28] has potential of antioxidant activity, so as
to determine the role in reducing and stabilizing copper nanopar-
ticles. Fig. 2 shows the UV–vis absorption spectrum of PNFP-
CuNPs, maximum absorbance was observed at 580 nm. SEM
images (Fig. 4A) represents cubic morphology of the particles with
average estimated particle size of 42.5 nm. FTIR analysis of P.
nepalensis fruit extract showed the signals at 3403.92, 1593.71,
1384.69, 1126.67 and 1046.56 cm
1 while synthesized nanoparti-
cles (PNFP-CuNP) at 3424.94, 2918.51, 2849.8, 1654.94, 1106.04
and 617.43 cm
1 (Fig. 3 (A&B).
The anticancer effect of copper nanoparticles against MCF-7 cell
lines was performed. The results show the good cytotoxic activity
against the cancer cells (Fig. 7). The concentration of copper
nanoparticles plays an important role in the anticancer activity.
Copper nanoparticles exhibited better activity against MCF-7 in
that 200 mg/mL except at 100 mg/mL on Myc gene alone.
Similarly, the copper nanoparticles synthesized by broccoli had
shown good anticancer activity against prostate cancer cells [29],
copper nanoparticles synthesized from Quisqualis indica shown
promising inhibition on B16F10 melanoma cells [30]. Recently,
[1] synthesized the copper oxide nanoparticles and reported their
Samuel Shiferaw Biresaw and P. Taneja
Fig. 6. IC50 vale calculated from MCF-7 cell line treated with PNFE-CuNP of MTT Assay absorbance reading.
Fig. 7. Cell viability percentage of normal and tumor cell lines treated by PNFE-CuNP from MTT Assay Optical density reading.
great potential to inhibit the cell viability of human colon cancer
cell lines (HCT-116).
Copper nanoparticles’ cytotoxicity is caused by active physico-
chemical interactions of copper atoms with intracellular protein
functional groups, as well as nitrogen bases and phosphate groups
in DNA [31]. Nanoparticles with anticancer properties are known
for their potential ability to slow down the activities of abnormally
expressed signalling proteins, such as Akt and Ras, cytokine-based
therapies, DNA- or protein-based vaccines against specific tumour
markers, and tyrosine kinase inhibitors that have a consistent anti-
tumor effect [32], according to a previous study [33].
PNFP-CuNPs showed a clear cytotoxic effect on MCF-7 cells and
a clear concentration response relationship (Fig. 6). 100 mg/mL and
200 mg/mL of PNFP-CuNPs could inhibit the growth of MCF-7 cells.
And there were no side effect seen on mamary epitelial cells
(MCF10A). Due to this reason, 100 and 200 mg/mL of CuNPs was
used for further study.
In this study, anticancer activity was observed and the synthe-
sised copper nanoparticles inhibited breast cancer cells in a dose-
dependent manner. Side effects and a high cast were reported with
some of the approved chemotherapeutic agents. As a result, devel-
oping alternative medicines to combat this deadly disease is
7
Materials Today: Proceedings xxx (xxxx) xxx
critical. Copper nanoparticles were synthesised to meet the need
for a new therapeutic treatment.
Cancer is known throughout the world as one of the key causes
of death. Current drug-targeted therapy strategy has undeniably
improved the care of patients with cancer. Nevertheless, advanced
metastatic cancer remains untreatable. Therefore, safe and efficient
drugs for the creation of facilities and reducing costs in cancer
treatment must definitely be actively pursued. Cancer therapy
using natural bioactive compounds is a novel way to prevent and
treat cancer [34,35]. In our study P. nepalensis fruit extract copper
nanoparticles used to elucidate expression of breast cancer cells
through QRT-PCR analysis method of oncogenes (Ras, Myc genes)
and tumour suppressor genes (P14/P19, P53, P21 and Caspase 3)
expression in MCF7, human breast carcinoma cells and MCF10A
human mammary epithelial cell line.
Copper nanoparticles characterization was carried out through
UV–Vis spectroscopy. In our study, Copper nanoparticles formation
was confirmed at 580 nm absorption band same result has been
seen in this study [36] and this nanoparticles used in all
experiments.
FTIR revealed that there was no interaction between the chem-
icals used in the nanoparticle preparation and the extract. The
Samuel Shiferaw Biresaw and P. Taneja
functional groups present in the copper nanoparticles that were
incorporated on the p. nepalensis fruit were found to be responsi-
ble for stabilising the copper nanoparticles. The surfactants in the
solution were used to obtain the CuNPs as capping agent. The par-
ticle size would fall within the micron, without the presence of
capping agents, which may be due to the agglomeration or forma-
tion of copper nanoparticles aggregates [25].
Given the increasing importance of environmental protection in
recent years, the development of green nanoparticle synthesis
techniques is critical. For this purpose, bacteria, fungi, and plant
extracts were used to make nanoparticles [37].
A small change in the absorption frequencies of copper
nanoparticles spectra has indicated an association between copper
and alcoholic, carboxylic groups, so it can be inferred that phenolic,
aromatic, and acidic fruit extract is responsible for oxidising and
stabilising CuNPs. The mechanism of plant extract nanoparticles
(CuNPs) synthesis is still fully unknown. Phenolic compounds, gly-
cosides, flavonoids, amino acids, alkaloids, saccharides, and tannins
are likely to be involved in this process, which may reduce Cu
metal to CuNPs [38].
CuNPs stop cells from growing by interacting with membrane
proteins and triggering signalling pathways. These nanoparticles
can also enter cells via diffusion or endocytosis, accumulating in
the mitochondria, where they cause mitochondrial dysfunction
and trigger apoptosis [39,40].
The in vitro cytotoxic activity against the MCF-7 cell line was
assessed at various concentrations and compared to the untreated
and normal cell lines (McF10A). Copper nanoparticles were tested
for anticancer activity at three different concentrations: control,
100 g, and 200 g. Copper nanoparticles’ anticancer activity against
MCF-7 increased as the concentration of copper nanoparticles
increased (Fig. 6). When compared to control and normal mam-
mary epithelial cells, copper nanoparticles show promising results.
Copper nanoparticles’ anticancer activity has previously been
investigated in prostate cancer cell line, human cervical carcinoma
cells, and B16F10 melanoma cells [1,29,30].
8. Conclusion
The importance of green synthesised CuNPs using phytochemi-
cals from P. nepalensis fruit extract was highlighted in this study.
The method could be considered as an environmentally friendly
and cost-effective approach because no reducing or capping agents
are required for the biosynthesis of nanoparticles. The speed of the
reaction process, low cost, and ease of access are all advantages of
this method. In other words, green synthesised CuNPs with an
average size of 42.5 nm have the ability to inhibit cell proliferation
and induce apoptosis in MCF-7 cancer cells while having no side
effects in the MCF10A human mammary epithelial cell line.
This is the first study to document these findings. As a result,
following confirmation by additional tests and in vivo studies,
the synthesised nanoparticles could be used as a potential cancer
treatment tool.
Declaration of Competing Interest
The authors declare that they have no known competing finan-
cial interests or personal relationships that could have appeared
to influence the work reported in this paper.
Acknowledgements
Pankaj Taneja would like to thank Sahrda University, India and
Samuel Shiferaw thanks both Sharda University and Wollo Univer-
8
Materials Today: Proceedings xxx (xxxx) xxx
sity, Ethiopia for offering scholar ship and making this research to
be happened.
References
[1] V. Gnanavel, V. Palanichamy, S.M. Roopan, Biosynthesis and characterization of
copper oxide nanoparticles and its anticancer activity on human colon cancer
cell lines (HCT-116), J. Photochem. Photobiol. B 171 (2017) 133–138.
[2] A. Altemimi, N. Lakhssassi, A. Baharlouei, D.G. Watson, D.A. Lightfoot,
Phytochemicals: Extraction, Isolation, and Identification of Bioactive
Compounds from Plant Extracts, Plants (Basel) 6(4) (2017).
[3] R.A. Hussein, A.A. El-Anssary, Plants Secondary Metabolites: The Key Drivers of
the Pharmacological Actions of Medicinal Plants, Herbal Medicine 2019.
[4] H. Yuan, Q. Ma, L.i. Ye, G. Piao, The traditional medicine and modern medicine
from natural products, Molecules 21 (5) (2016) 559, https://doi.org/
10.3390/molecules21050559.
[5] R.C.D.a.C.S.M. Akshada Amit Koparde, Natural Products in Drug Discovery,
2019.
[6] J.B. Calixto, The role of natural products in modern drug discovery, An. Acad.
Bras Cienc. 91 (Suppl 3) (2019) e20190105.
[7] R. Khateef, H. Khadri, A. Almatroudi, S.A. Alsuhaibani, S.A. Mobeen, R.A. Khan,
Potential in-vitro anti-breast cancer activity of green-synthesized silver
nanoparticles preparation against human MCF-7 cell-lines, Adv. Nat. Sci.:
Nanosci. Nanotechnol. 10 (4) (2019) 045012.
[8] Y.-H. Wang, S. Liu, G. Zhang, C.-Q. Zhou, H.-X. Zhu, X.-B. Zhou, L.-P. Quan, J.-F.
Bai, N.-Z. Xu, Knockdown of c-Myc expression by RNAi inhibits MCF-7 breast
tumor cells growth in vitro and in vivo, Breast Cancer Res. 7 (2) (2004) R220.
[9] C.-Y. Huang, D.-T. Ju, C.-F. Chang, P. Muralidhar Reddy, B.K. Velmurugan, A
review on the effects of current chemotherapy drugs and natural agents in
treating non-small cell lung cancer, Biomedicine (Taipei) 7 (4) (2017), 23 23.
[10] M. Arruebo, N. Vilaboa, B. Sáez-Gutierrez, J. Lambea, A. Tres, M. Valladares, A.
González-Fernández, Assessment of the evolution of cancer treatment
therapies, Cancers (Basel) 3 (3) (2011) 3279–3330.
[11] J.B. Vines, J.-H. Yoon, N.-E. Ryu, D.-J. Lim, H. Park, Gold nanoparticles for
photothermal cancer, Therapy 7 (2019) 167.
[12] J.K. Patra, G. Das, L.F. Fraceto, E.V.R. Campos, M.D.P. Rodriguez-Torres, L.S.
Acosta-Torres, L.A. Diaz-Torres, R. Grillo, M.K. Swamy, S. Sharma, S.
Habtemariam, H.-S. Shin, Nano based drug delivery systems: recent
developments and future prospects, J. Nanobiotechnol. 16 (1) (2018), 71 71.
[13] A.H. Azandaryani, S. Kashanian, T. Jamshidnejad-Tosaramandani, Recent
insights into effective nanomaterials and biomacromolecules conjugation in
advanced drug targeting, Curr. Pharm. Biotechnol. 20 (7) (2019) 526–541.
[14] S. Hashemi, Z. Asrar, S. Pourseyedi, N. Nadernejad, Green synthesis of ZnO
nanoparticles by Olive (Olea europaea), IET Nanobiotechnol. 10 (6) (2016)
400–404.
[15] M.H.S. Poor, M. Khatami, H. Azizi, Y. Abazari, Cytotoxic activity of
biosynthesized Ag nanoparticles by Plantago major towards a human breast
cancer cell line, Rendiconti Lincei 28 (4) (2017) 693–699.
[16] H. Shimoshige, Y. Nakajima, H. Kobayashi, K. Yanagisawa, Y. Nagaoka, S.
Shimamura, T. Mizuki, A. Inoue, T. Maekawa, B. Xu, Formation of core-shell
nanoparticles composed of magnetite and samarium oxide in
Magnetospirillum magneticum strain RSS-1, PLoS ONE 12 (1) (2017)
e0170932.
[17] D. Chaudhuri, N.B. Ghate, S. Panja, A. Das, N. Mandal, J. Kim, Wild edible fruit of
Prunus nepalensis Ser. (Steud), a potential source of antioxidants, ameliorates
iron overload-induced hepatotoxicity and liver fibrosis in mice, PLoS ONE 10
(12) (2015) e0144280.
[18] T.L. Swer, K. Chauhan, Stability studies of enzyme aided anthocyanin extracts
from Prunus nepalensis L, LWT 102 (2019) 181–189.
[19] K. Vivek, S. Mishra, R.C.J.J.o.F.M. Pradhan, Characterization, Physicochemical
characterization and mass modelling of Sohiong (Prunus nepalensis L.) fruit,
12(2) (2018) 923–936.
[20] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-
time quantitative PCR and the 2(-Delta Delta C(T)) method, Methods 25 (4)
(2001) 402–408.
[21] T. Mosmann, Rapid colorimetric assay for cellular growth and survival:
application to proliferation and cytotoxicity assays, J. Immunol. Methods 65
(1) (1983) 55–63.
[22] M. Thiruvengadam, I.-M. Chung, T. Gomathi, M.A. Ansari, V. Gopiesh Khanna,
V. Babu, G. Rajakumar, Synthesis, characterization and pharmacological
potential of green synthesized copper nanoparticles, Bioprocess. Biosyst.
Eng. 42 (11) (2019) 1769–1777.
[23] J.S. Fridman, S.W. Lowe, Control of apoptosis by p53, Oncogene 22 (56) (2003)
9030–9040.
[24] S. Yallappa, J. Manjanna, M.A. Sindhe, N.D. Satyanarayan, S.N. Pramod, K.
Nagaraja, Microwave assisted rapid synthesis and biological evaluation of
stable copper nanoparticles using T. arjuna bark extract, Spectrochim. Acta A
Mol. Biomol. Spectrosc. 110 (2013) 108–115.
[25] S. Shende, A.P. Ingle, A. Gade, M. Rai, Green synthesis of copper nanoparticles
by Citrus medica Linn. (Idilimbu) juice and its antimicrobial activity, World J.
Microbiol. Biotechnol. 31 (6) (2015) 865–873.
[26] K. Vivek, S. Mishra, R.C. Pradhan, R. Jayabalan, Effect of probiotification with
Lactobacillus plantarum MCC 2974 on quality of Sohiong juice, LWT 108
(2019) 55–60.
Samuel Shiferaw Biresaw and P. Taneja
[27] T.L. Swer, K. Chauhan, C. Mukhim, K. Bashir, A. Kumar, Application of
anthocyanins extracted from Sohiong (Prunus nepalensis L.) in food
processing, Lwt 114 (2019) 108360, https://doi.org/10.1016/j.
lwt.2019.108360.
[28] D. Agrahar-Murugkar, G. Subbulakshmi, Nutritive values of wild edible fruits,
berries, nuts, roots and spices consumed by the Khasi tribes of India, Ecol. Food
Nutrit. 44 (3) (2005) 207–223.
[29] P.R. Prasad, S. Kanchi, E.B. Naidoo, In-vitro evaluation of copper nanoparticles
cytotoxicity on prostate cancer cell lines and their antioxidant, sensing and
catalytic activity: one-pot green approach, J. Photochem. Photobiol. B 161
(2016) 375–382.
[30] R. Mukhopadhyay, J. Kazi, M.C. Debnath, Synthesis and characterization of
copper nanoparticles stabilized with Quisqualis indica extract: Evaluation of
its cytotoxicity and apoptosis in B16F10 melanoma cells, Biomed.
Pharmacother. 97 (2018) 1373–1385.
[31] E.V. Hackl, V.L. Galkin, Y.P. Blagoi, DNA interaction with biologically active
divalent metal ions: binding constants calculation, Int. J. Biol. Macromol. 34 (5)
(2004) 303–308.
[32] D. Martins, L. Frungillo, M.C. Anazzetti, P.S. Melo, N. Durán, Antitumoral
activity of L-ascorbic acid-poly- D, L-(lactide-co-glycolide) nanoparticles
containing violacein, Int. J. Nanomedicine 5 (2010) 77–85.
[33] J.L. Bos, ras oncogenes in human cancer: a review, Cancer Res. 49 (1989) 4682–
4689.
[34] T.O.K. Hu Wanga, Limin Shub, Zhengyuen Sub, Francisco Fuentesb, Jong-Hun
Leeb, and Ah-Ng Tony Kong,a,b, Plants against cancer: a review on natural
Materials Today: Proceedings xxx (xxxx) xxx
phytochemicals in preventing and treating cancers and their druggability,
(2012).
[35] H. Zubair, S. Azim, A. Ahmad, M.A. Khan, G.K. Patel, S. Singh, A.P. Singh, Cancer
chemoprevention by phytochemicals: nature’s healing touch, Molecules (Basel
Switzerland) 22 (3) (2017) 395.
[36] A. Amorim, A.C. Mafud, S. Nogueira, J.R. Jesus, A.R.d. Araújo, A. Plácido, M. Brito
Neta, M.M.M. Alves, F.A.A. Carvalho, D.D. Rufino Arcanjo, S. Braun, M.S.-P.
López, B. López-Ruiz, C. Delerue-Matos, Y. Mascarenhas, D. Silva, P. Eaton, J.R.S.
Almeida Leite, Copper nanoparticles stabilized with cashew gum:
Antimicrobial activity and cytotoxicity against 4T1 mouse mammary tumor
cell line, J. Biomater. Appl. 34 (2) (2019) 188–197.
[37] S. Ahmad, S. Munir, N. Zeb, A. Ullah, B. Khan, J. Ali, M. Bilal, M. Omer, M.
Alamzeb, S.M. Salman, S. Ali, Green nanotechnology: a review on green
synthesis of silver nanoparticles - an ecofriendly approach, Int. J. Nanomed. 14
(2019) 5087–5107.
[38] G. Marslin, K. Siram, Q. Maqbool, R. Selvakesavan, D. Kruszka, P. Kachlicki, G.
Franklin, Secondary metabolites in the green synthesis of metallic
nanoparticles, Materials (Basel) 11 (6) (2018) 940, https://doi.org/
10.3390/ma11060940.
[39] D.-D. Ma, W.-X. Yang, Engineered nanoparticles induce cell apoptosis:
potential for cancer therapy, Oncotarget 7 (26) (2016) 40882–40903.
[40] R. Chakraborty, T. Basu, Metallic copper nanoparticles induce apoptosis in a
human skin melanoma A-375 cell line, Nanotechnology 28 (10) (2017)
105101.