journal of dentistry 41 (2013) 779–786

Available online at www.sciencedirect.com

journal homepage: www.intl.elsevierhealth.com/journals/jden

Antimicrobial resistance and virulence traits of

Enterococcus faecalis from primary endodontic
infections

Renata Ximenes Lins a,*, Aurimar de Oliveira Andrade a,

Raphael Hirata Junior b, Melanie J. Wilson c, Michael A.O. Lewis c,
David W. Williams c, Rivail Antonio Sergio Fidel a
a
School of Dentistry, Rio de Janeiro State University, Rio de Janeiro, Brazil
b
School of Medical Sciences, Rio de Janeiro State University, Rio de Janeiro, Brazil
c
School of Dentistry, College of Biomedical and Life Sciences, Cardiff University, Cardiff, Wales, United Kingdom

article info abstract

Article history: Objectives: To determine the phenotypic and molecular characteristics of Enterococcus fae-
Received 10 May 2013 calis recovered from primary endodontic infections in Brazilian patients.
Received in revised form Methods: Twenty isolates of E. faecalis recovered from 43 Brazilian patients with primary
21 June 2013 endodontic infections were identified by biochemical profiling (API20Strep) and 16S rDNA
Accepted 2 July 2013 sequencing. Antimicrobial susceptibility was ascertained by agar dilution, using the recom-
mended protocol of the Clinical and Laboratory Standards Institute (CLSI). PCR with
validated primers was used to detect genes associated with antibiotic resistance and specific
Keywords: virulence factors.
Enterococcus faecalis Results: All isolates were deemed susceptible to penicillin G, erythromycin and vancomycin.
Genotype However, nine isolates had a minimum inhibitory concentration of 4 mg/mL to vancomycin
Antimicrobial susceptibility (the resistance breakpoint). Fourteen isolates (70% of isolates) were also resistant to
Endodontic infection tetracycline with MICs of >64 mg/mL. PCR products for tetracycline resistance genes were
detected in test isolates, while erythromycin and vancomycin resistance genes were not
evident. Gelatinase, aggregation substance and enteroccocal surface protein genes were
detected in 20, 18 and 12 isolates, respectively.
Conclusions: Endodontic E. faecalis isolates exhibit high level of resistance to tetracycline, an
antibiotic that has use in local treatment of dental infections. This opens up a much-needed
debate on the role and efficacy of this antibiotic for oral infections. Furthermore, these
isolates were shown to possess genes that could contribute to pathogenicity in the pulp
cavity.
# 2013 Elsevier Ltd. All rights reserved.

aetiological agents remain unclear. Ozok et al.1 suggested that

1. Introduction endodontic infections were more complex than previously
reported with more than 600 bacterial taxa associated with
The microbiome of primary and post treatment endodontic infected root canals. Although a single aetiological agent is
infections has been extensively studied, although the main unlikely, there is evidence supporting the association of

* Corresponding author at: Av Afranio de Mello Franco, 141/207 Leblon, CEP 22430-060, Rio de Janeiro, RJ, Brazil. Tel.: +55 21 2294 8268.
E-mail addresses: ximenes@uerj.br, endodontia@renataximenes.com.br (R.X. Lins).
0300-5712/$ – see front matter # 2013 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.jdent.2013.07.004
780 journal of dentistry 41 (2013) 779–786
enterococci, particularly Enterococcus faecalis with both primary
and secondary endodontic infection.2–8
Enterococci are Gram-positive, coccus-shaped bacteria and
frequent colonisers of the human gastrointestinal and
genitourinary tracts. In the past, these bacteria were not
considered particularly virulent. However, recent years have
seen an increase in nosocomial infections caused by entero-
coccal species largely attributed to their antimicrobial resis-
tance profiles.9 Of the group, E. faecalis is considered the most
significant species, both in terms of frequency of isolation
from sites of infection and in the transfer of antibiotic
resistance.10
Enterococci are regarded as antibiotic-resistant, opportu-
nistic pathogens frequently recovered from patients who have
received multiple courses of antibiotics and who have been
hospitalized for prolonged periods. These bacteria exhibit
intrinsic resistance to several antibiotics, as well as an ability
to rapidly acquire antibiotic resistance. Enterococci are not
generally regarded as normal inhabitants of the oral cavity,
but may colonise transiently, particularly in debilitated
individuals.11 E. faecalis has, however, been isolated from a
range of oral conditions including carious lesions, chronic
periodontitis, and has been associated with persistent apical
periodontitis.12 E. faecalis has been detected primarily at sites
of persistent endodontic infections,9,13–15 and has also been
found in high numbers in some primary endodontic infec-
tions.7,8,16
Neither the source, nor the role of enterococci in the
pathogenesis of endodontic infections is understood.15,17 Oral
E. faecalis has been shown to possess a range of virulence
factors including gelatinase activity, expression of haemoly-
sin, response to pheromones, bacteriocin production, biofilm
development, expression of adherence factors, aggregation
substances and resistance to several antibiotics.12,18–21 Impor-
tantly, enterococci have been shown to transfer certain
virulence traits to related species in root canals ex vivo,
highlighting the need to more fully understand the role of
these pathogens in infection in general.22
Finally, it is not unrealistic to expect that enterococci
resistant to multiple antimicrobials may be able to colonise
the root canal environment. Although Vancomycin Resistant
Enterococci (VRE) have not been isolated in root canal
infections, Nandakumar et al.23 identified proteins from the
tet and van operons in all the patient cases where enterococci
were detected by genomic analysis of endodontic infections.
Additionally, in the patient sample from which the VanE
protein was identified, E. faecalis was highly prevalent. This is
important from a treatment perspective because antibiotics
are known not to be very effective in treating chronic or
localised acute endodontic infections or in preventing
recurrent episodes of infection. Besides, it is an alert to the
potential increase in antibiotic resistance amongst oral
isolates.
All this information justifies the isolation, identification
and characterisation of virulence factors and antimicrobials
resistant determinants of endodontic enterococci. Genetic
analysis can be used as an initial screening tool, and although
detection of the target gene itself does not necessarily mean
that the encoded protein will subsequently be expressed, it
does indicate the potential for expression.
The aims of this study were therefore to analyse isolates of
E. faecalis from patients with primary endodontic infections for
the presence of defined virulence genes and susceptibility to
antibiotics commonly used in dentistry and other areas of
clinical importance. Through enhanced awareness of the
characteristics of E. faecalis involved in endodontic infection,
we can identify optimal treatment strategies to improve
patients’ health and potentially limit dissemination of
antimicrobial resistance.
2. Materials and methods
2.1. Patient selection and sample collection
A total of 43 patients with primary endodontic infection were
recruited with informed consent for participation in this
study. Only necrotic pulps without oral exposition were
included. All patients were otherwise healthy and had not
been hospitalised or had received antibiotics for at least 6
months prior to the study. Pregnancy or active periodontal
disease were additional exclusion criteria. The research was
approved by the Research Ethics Committee of Rio de Janeiro
State University (COEP051/2009).
After plaque removal and rubber dam isolation, the tooth
and the operative field was cleansed with 3% (v/v) hydrogen
peroxide and then disinfected with 2.5% NaOCl solution.
Coronal access was made using sterile round burs without
water spray. Samples were collected from the root canal using
a #15 H-type file (Dentsply/Maillefer, Ballaigues, Switzerland)
and two sterile paper points, as previously described.24 Both
file and paper points were then transferred to tubes containing
Enterococcosel broth (Becton Dickinson Microbiology Sys-
tems, MD, USA) and incubated for 48 h at 37 8C to selectively
recover enterococci. Isolated colonies were then subcultured
on to blood agar plates (Becton Dickinson Microbiology
Systems) and pure colonies subjected to identification tests.
A sterile paper point without previous contact with the root
canal was included in all sampling procedures and served as a
negative control.
2.2. Culture and identification of E. faecalis
All isolates were presumptively identified as enterococci based
on growth in the presence of bile and azide, and esculin
hydrolysis. Additional tests to further characterise these
isolates included Gram-staining, catalase activity, motility
testing, pyruvate fermentation, and an ability to grow in Tryptic
Soy Agar (Merk Darmstadt, DE) supplemented with 6.5% NaCl at
42 8C. A commercial biochemical profiling test (API 20 Strep
identification kit; Analytical Profile Index; bioMérieux SA,
Marcy-Etoile, France) was also used, and E. faecalis ATCC
29212 served as a positive control. The prevalence of E. faecalis
was recorded as the percentage of cases examined.
2.3. Confirmation of E. faecalis identity by sequencing of
16S ribosomal DNA
Total DNA was extracted using the PureLinkTM Genomic DNA
Mini Kit (Invitrogen, Paisley, UK) and the manufacturer’s
 journal of dentistry 41 (2013) 779–786 781

recommended protocol. Extracted DNA served as template
for PCR using the universal bacterial 16S rRNA primer
pair of 27f and 1492r (Table 1). All PCRs were performed in a
50 mL final reaction volume containing 1 mM of each primer,
25 mL of PCR Master Mix (Promega, Madison, USA) and 2 mL
of total DNA template. Negative controls of sterile ultrapure
water in place of DNA template were included with each
PCR.
PCR was undertaken in a DNA thermocycler using an
initial denaturation step of 95 8C for 1 min, and then 26
thermal cycles of 94 8C for 45 s, 50 8C for 45 s and 72 8C for
1.5 min, followed by a final step of 72 8C for 15 min. Gel
electrophoresis of the amplicons was performed in a 1.0%
agarose gel at 60 V/cm2. PCR amplicons stained with safe
view dye (NBS Biologicals, Cambridgeshire, UK) were
subsequently detected by ultraviolet transillumination. A
100-bp DNA ladder (Promega) served as a molecular weight
standard.
Enterococcus species were then identified using Eurofins
MWG Operon’s sequencing service. Briefly, PCR products
were purified using the QIAquick PCR purification kit (Qiagen,
Hilden, Germany) and the DNA subjected to a sequencing PCR
reaction using the primer 357f (Table 1). The partial 16S rDNA
sequences obtained were then compared with those
sequences within the NCBI database using the Basic Local
Alignment Search Tool (BLAST). Sequences with 98–100%
identity to sequences deposited in the public domain
databases were considered to be positive identification of
taxa.
2.4. Antimicrobial susceptibility testing
The minimum inhibitory concentration (MIC) of E. faecalis
isolates against a range of antibiotics was determined by agar
dilution, using the recommendations of the Clinical and
Laboratory Standards Institute (CLSI). Briefly, Müeller-Hinton
Agar (Difco, USA) plates were prepared with penicillin,
erythromycin, tetracycline and vancomycin microdilutions
and inoculated with a bacterial suspension equivalent to 0.5
McFarland standard and incubated at 37 8C for 18 h. Isolates
were considered susceptible or resistant according to break-
point values recommended by the CLSI document M100-S21
(Wayne, PA, USA).
2.5. Detection of antimicrobial resistance and virulence
genes
The DNA of all isolates was analysed for the presence of
antibiotic resistance genes including those for erythromycin,
tetracycline and vancomycin, and also for the virulence
associated genes of gelatinase, surface protein, cytolysin
and aggregation substance (Table 1).

Table 1 – PCR details to detect antimicrobial resistance to erythromycin (erm(A) and erm(B)), tetracycline (tet(M) and tet(L)),
vancomycin (vanA, vanB, vanC1, vanC2/3) and virulence-associated genes gelatinase (gel(E)), enterococcal surface protein
(esp), cytolysin (cylB), and aggregation substance (agg, asa373).
Gene target(s) Primer Oligonucleotide sequence (50 –30 ) Product size (bp) Tm (8C) Reference
26,28
16S RNA 27f GTGCTGCAGAGAGTTTGATCCTGGCTCAG 1164 54
1492r CACGGATCCTACGGGTACCTTGTTACGACTT
357f CTCCTACGGGCGGCAGCAG
29
erm(A) ERMA1 TCTAAAAAGCATGTAAAAGAA 645 50
ERMA2 CTTCGATAGTTTATTAATATTAGT
29
erm(B) ERMB1 GAAAAGGTACTCAACCAAATA 639 52
ERMB2 AGTAACGGTACTTAAATTGTTTC
27
tet(M) TETM1 AGTTTTAGCTCATGTTGATG 1862 55
TETM2 TCCGACTATTTAGACGACGG
27
tet(L) TETL1 CCTGCGAGTACAAACTGG 1209 55
TETL2 TCAAGGTAACCAGCCAAC
25
vanA VANA1 GGGAAAACGACAATTGC 732 50
VANA2 GTACAATGCGGCCGTTA
25
vanB VANB ATGGGAAGCCGATAGTC 635 52
VANB2 GATTTGCTTCCTCGACC
25
vanC1 VANC1-1 GGTATCAAGGAAACCTC 822 50
VANC1-2 CTTCCGCCATCATAGCT
25
vanC2/3 VANC2/3-1 CTCCTACGATTCTCTTG 439 50
VANC2/3-2 CGAGCAAGACCTTTAAG
25
gelE GELE1 ACGCATTGCTTTTCCATC 419 51
GELE2 ACCCCGTATCATTGGTTT
25
esp ESP1 TTGCTAATGCTAGTCCACGACC 932 58
ESP2 GCGTCAACACTTGCATTGCCA
25
cylB CYLB1 ATTCCTACCTATGTTCTGTTA 843 50
CYLB2 AATAAACTCTTCTTTTCCAAC
25
agg AGG1 AAGAAAAAGAAGTAGACCAAC 1555 52
AGG2 AAACGGCAAGACAAGTAAATA
25
asa373 ASA373F GGACGCACGTACACAAAGCTACC 619 58
ASA373R TGGGTGTGATTCCGCTGTA
782 journal of dentistry 41 (2013) 779–786

and the possible high recovery based on use of an Enterococcus

3. Results selective isolation medium. The observed high prevalence,
does however, highlight the importance of continuous
3.1. E. faecalis isolates surveillance of E. faecalis at various sampling sites and the
impact of population demographics that could influence
A total of 20 E. faecalis isolates were recovered from the 43 microbial communities such as these.
patients studied following use of the selective medium for The origin and role of enterococci in the pathogenesis of
Enterococcus. endodontic infection is also unclear.7,12,17,34–36 Regarding the
role of enterococci in endodontic infection, we believe that
3.2. Antibiotic susceptibility knowledge of bacterial virulence factors involved in the
pathogenesis of apical periodontitis is fundamental to
All isolates were deemed susceptible to penicillin G and understanding the disease process and to assist in establish-
erythromycin, being inhibited by 2 and 0.25 mg/mL, respec- ing appropriate treatment, motivating us to characterise the
tively (Table 2).30 All isolates were susceptible to vancomycin, endodontic isolates both genotypically and phenotypically.
with MICs raging from 1 to 4 mg/mL. However, 9 of these In the present study, antimicrobial susceptibility was
‘susceptible’ isolates did exhibit MICs of 4 mg/mL to vancomy- determined for all endodontic isolates, and revealed a high
cin, and this is the resistance breakpoint concentration. An prevalence of tetracycline resistance (70%), exceeding
MIC above 4 mg/mL, i.e. between 8 mg/mL and 16 mg/mL would previously reported findings.2,18,37 The incidence does however,
result in isolates being classed as having ‘intermediate appear to be increasing, for example, between 2000 and 2010,
resistance’ to vancomycin. Fourteen strains (Table 2) were several studies have reported E. faecalis from endodontic
resistant to tetracycline, with MICs >64 mg/mL, representing infections to exhibit resistance to tetracycline at levels
70% of the isolates. increasing from 14.3%, 15.1%, 28.8% and 30% according to
Pinheiro et al.,38 Sedgley et al.,19 Reynaud af Geijersstam et al.,39
3.3. Detection of antimicrobial resistance and virulence and Skucaite et al.,40 respectively.
genes Kuch et al.41 analysed antimicrobial susceptibility of 386 E.
faecalis isolates from hospitals and communities of six
PCR products for tetracycline resistance were detected in European countries. The percentage of resistance to tetracy-
several test isolates and the relative prevalence of these genes cline was 77.9% for hospital isolates and 55.6% for community
are presented in Table 3.30 The tetM gene was detected in 12 isolates. In our study, we have therefore encountered a higher
isolates, whilst tetL was present in 4 isolates, representing 60% prevalence of tetracycline in endodontic isolates compared to
and 20% of the isolates, respectively. The ermA, ermB, vanA, those previously noted for community isolates.
vanB, vanC1 and vanC2/3 genes were not detected in any tested
isolates (Table 3).
PCR for specific virulence genes (Table 3) showed that all 20
isolates (100%) were positive for gelatinase (gelE), whilst Table 2 – Antibiotic susceptibility characteristics of E.
faecalis. Susceptibility (S) and resistance (R) MIC break-
enteroccocal surface protein (esp) gene was detected for 13
points (mg/mL) as recommended by CLSI (2011): penicillin
isolates (65%), and aggregation substance (agg) gene was found
(=8 S, I16 R); erythromycin (=0.5 S, I8 R); tetracycline
in 18 isolates (90%). All isolates were negative for the asa373 (=4 S, I16 R) and vancomycin (=4 S, I32 R).
(aggregation substance) gene and cytolysin (cylB) gene.
Isolate MIC (mg/mL)
Penicillin G Erythromycin Tetracycline Vancomycin
4. Discussion 1 2(S) 0.25(S) >64(R) 4(S)
2 2(S) 0.25(S) >64(R) 4(S)
3 2(S) 0.25(S) 1(S) 2(S)
Despite the microbiome of primary and post treatment
4 2(S) 0.25(S) 16(S) 2(S)
endodontic infections being extensively studied, the main 5 2(S) 0.25(S) 4(S) 2(S)
aetiological agents remain unclear. There is evidence support- 6 2(S) 0.25(S) 4(S) 2(S)
ing an association of enterococci, particularly E. faecalis with 7 2(S) 0.25(S) >64(R) 2(S)
both primary and secondary endodontic infection.2–8 Reports 8 2(S) 0.25(S) >64(R) 4(S)
on E. faecalis prevalence in root canals can vary considerably, 9 2(S) 0.25(S) >64(R) 4(S)
10 2(S) 0.25(S) >64(R) 4(S)
possibly due to differences in methods of clinical sampling
11 2(S) 0.25(S) >64(R) 2(S)
and analysis. In teeth exhibiting failed endodontic treatment,
12 2(S) 0.25(S) >64(R) 4(S)
previous studies report an E. faecalis prevalence of between 13 2(S) 0.25(S) 4(S) 2(S)
18.5–70% when culture is used, and 67–89.6% using PCR 14 2(S) 0.25(S) 4(S) 1(S)
detection.5,7,14,16,31–33 However, in cases of primary endodontic 15 2(S) 0.25(S) >64(R) 4(S)
infection, prevalence is lower, ranging between 4–12.5% with 16 2(S) 0.25(S) >64(R) 4(S)
culture and 33–89.3% using PCR.7,8,14,16 In this study, a high 17 2(S) 0.25(S) >64(R) 4(S)
18 2(S) 0.25(S) >64(R) 2(S)
prevalence of E. faecalis was noted (20/43 patients), and the
19 2(S) 0.25(S) >64(R) 2(S)
exact reasons for this remain unclear. There are several 20 2(S) 0.25(S) >64(R) 2(S)
factors that could have been responsible for this high recovery
Total (%) 0 0 75 0
which may relate to the demographics of the patients studied
 journal of dentistry 41 (2013) 779–786 783

Table 3 – Genetic profiles of E. faecalis from primary endodontic infection in Brazil.

Isolate Antimicrobial resistance genes Virulence genes
ermA ermB tet tet vanA vanB van van gelE esp agg asa cylB
M L C1 C2/3 373
1   +      + + +  
2         + + +  
3         + + +  
4         +  +  
5         +  +  
6         +  +  
7   + +     +  +  
8   +      + + +  
9   +      + + +  
10   +      + + +  
11         +  +  
12   +      + + +  
13         + +   
14         +    
15   +      + +   
16   +      + +   
17   +      + +   
18   + +     +  +  
19   + +     + + +  
20   + +     + + +  

Total (%) 0 0 60 20 0 0 0 0 100 65 90 0 0

This increased incidence of resistance to tetracycline for
endodontic isolates may be explained by selective pressure
due to previous use of tetracyclines in the practice of dentistry,
such as in the treatment of localised aggressive periodontitis
and as an intracanal medication. In a longitudinal study over
12 months, Rodrigues et al.42 observed the antibiotic resis-
tance profile of subgingival microbiota following systemic and
local administration of tetracycline as an adjunct to periodon-
tal therapy. In all cases where tetracycline was used, there was
an initial selection of drug-resistant microorganisms, and only
after months of continuous treatment, particularly topically
and at high concentrations was their prevalence reduced. This
fact demonstrates that short-term use of such intracanal
medication may promote prevalence of resistant strains at the
site of infection.
In endodontics, several studies have assessed the antimi-
crobial efficacy of antibiotic mixtures containing ciprofloxa-
cin, metronidazole, and minocycline against the pathogens
commonly found inside the root canal system including E.
faecalis. This triple antibiotic mixture is also promoted as an
intracanal medicament to disinfect the root canal system to
encourage revascularization of a tooth with a necrotic pulp.43
Antibiotics have been suggested as possible irrigants by
Torabinejad et al.44 and Giardino et al.45 with both of these
studies including tetracycline within their irrigant formula-
tions. Tetracycline is also present in Ledermix paste (Haupt
Pharma GmbH, Wolfratshausen, Germany), a combination of
the same tetracycline antibiotic, demeclocycline HCl (3.2%),
and a corticosteroid, triamcinolone acetonide (1%), in a
polyethylene glycol base, which is advocated as an intracanal
dressing in cases of pulp-less infected root canals, pulp
necrosis and infection with incomplete root formation
(apexification), perforations, inflammatory root resorption,
inflammatory periapical bone resorption, and for the treat-
ment of large periapical radiolucent lesions. Thus, the local
use of tetracycline in endodontic infection is still being utilised
in some cases, and may contribute to an increase in resistance
to this antibiotic by exposed isolates.
PCR products for tetracycline resistance genes were also
detected in our study, with the tetM gene being evident in 12
isolates and tetL in 4 isolates, representing 60% and 20% of the
samples. There was a direct correlation of 85% between the
presence of the tetM and antibiotic susceptibility test result (12
of 14 tetracycline resistant isolates were positive to tetM)
indicating that PCR analysis may be an important marker for
screening antibiotic resistance. Villedieu et al.46 also found a
high prevalence of 79% for the gene tetM in oral bacteria
isolated from dental plaque and saliva.
Tetracycline resistance in clinical isolates of enterococci is
frequently associated with plasmids and/or conjugative
transposons47 which can readily be transferred between
species.48
The conditions in root canals of low nutrient levels and the
presence of antimicrobials agents limit sensitive strains and
select for more resistant species such as E. faecalis. Multiple
antibiotic resistance in clinical isolates of E. faecalis from root
canal infections has been reported,19,38,39,49 as well as the
transfer of antibiotic resistance genes between these bacteria
and related species.22,50 Although our study did not find multi-
resistant isolates, or VRE, the possibility that these strains
could occur in root canals infections cannot be excluded. In
our study, 9 isolates (45%) had MICs of 4 mg/mL to vancomycin
which is at the resistance breakpoint for this agent. This result
motivated our investigation of the most common genes
related to resistance to vancomycin in enterococci, namely,
vanA, vanB, vanC1 and vanC2/3, which were not detected, thus
confirming the MIC results of the present study and those
previously reported.19,21,35,49 However, Nandakumar et al.23
found proteins from the tet and van operons to be predominant
in all patient cases where enterococci were detected by
784 journal of dentistry 41 (2013) 779–786
genomic analysis. ErmA and ermB genes were not detected in
our endodontic isolates, thus correlating with the phenotypic
results of susceptibility in the MIC test. These findings were
also in agreement with the work of Sedgley et al.19
There is ongoing debate regarding the relative merits of
using local antibiotics to treat oral infections, particularly
given the inability of many antibiotics to penetrate bio-
films.51,52 New approaches have been proposed for biofilm
control by blocking adherence or co-aggregation mechanisms,
disruption of quorum-sensing mechanisms and probiotic
therapy.53 An understanding of the interactions between
the microorganisms and which are the virulence factors
involved, provides opportunities for novel ‘non-antibiotic’
methods of control. In this context, we also investigated a
number of virulence genes described in oral E. faecalis,
including cytolysin (cylB), enterococcal surface protein (esp),
gelatinase (gelE) and aggregation substances (agg and asa373).
Cytolysin is a haemolytic toxin that also has bacteriocin
activity54; ESP is a surface protein that enhances biofilm
formation by E. faecalis,55 and gelatinase is a metalloprotease
that cleaves several substrates including insoluble collagen
fragments, as well as the pheromone and inhibitor peptides
involved in conjugative plasmid transfer of E. faecalis. A role for
gelE in biofilm development has also been described.56
Aggregation substance is a pheromone-inducible surface
protein that promotes aggregation during bacterial conjuga-
tion. This virulence trait and others factors, including
cytolysin and ESP were found to be encoded on a large, 153-
kb pathogenicity island.57
In our study, the gelE was detected in all isolates, whilst esp
was detected in 13 isolates (65%), and agg was evident for 18
isolates (90%). As these virulence determinants have been
shown to influence biofilm formation58 they may play a role in
promoting the persistence of enterococci in the root canal
environment.
Wang et al.20 analysed the relationship of biofilm formation
and gelE gene expression in E. faecalis recovered from root
canals and found higher expression in cases of apical
radiolucency and in biofilm forming isolates. These authors
suggested that high expression of gelE may contribute to the
development of apical periodontitis. Although gelatinase
production in vitro was not examined in our study, other
studies have related expression to a determinant (ef1841/fsrC)
of a deletion sequence of the fsr gene cluster, the quorum
sensing system that regulate the expression of gelE gene.
Gelatinase-negative phenotype is related to the presence of
this determinant.25
5. Conclusion
In summary, this study demonstrated a high incidence of
tetracycline resistance (an antibiotic that is still used in local
treatment of oral infections) in E. faecalis isolates from primary
endodontic infections. This opens up a much needed debate
on the role and efficacy of this antibiotic for endodontic
infections. Furthermore, isolates were shown to possess genes
that could contribute to their pathogenicity in the pulp cavity,
and which can also be transferred in the microenvironment of
the root canal. Clearly, more research in this area is required
particularly in relation to the possession and expression of
virulence factors in the root canal environment, to better
inform our management strategies. Environmental pressure
in root canals may be responsible for the selection of more
resistant species and the possession of virulence determi-
nants. This knowledge is important in guiding procedures for
controlling the increasing problem of antibiotic resistance
amongst clinically relevant bacteria.
references
1. Ozok AR, Persoon IF, Huse SM, Keijser BJ, Wesselink PR,
Crielaard W, et al. Ecology of the microbiome of the infected
root canal system: a comparison between apical and coronal
root segments. International Endodontic Journal 2012;45:
530–41.
2. Heintz CE, Deblinger R, Oliet S. Antibiotic sensitivities of
enterococci isolated from treated root canals. Journal of
Endodontics 1975;1:373–6.
3. Möller AJ, Fabricius L, Dahlén G, Ohman AE, Heyden G.
Influence on periapical tissues of indigenous oral bacteria
and necrotic pulp tissue in monkeys. Scandinavian Journal of
Dental Research 1981;89:475–84.
4. Sundqvist G. Ecology of the root canal flora. Journal of
Endodontics 1992;18:427–30.
5. Peciuliene V, Balciuniene I, Eriksen HM, Haapasalo M.
Isolation of Enterococcus faecalis in previously root-filled
canals in a Lithuanian population. Journal of Endodontics
2000;26:593–5.
6. Gomes BPFA, Pinheiro ET, Gade-Neto CR. Microbiological
examination of infected dental root canals. Oral Microbiology
and Immunology 2004;19:71–6.
7. Sedgley C, Nagel A, Dahlén G, Reit C, Molander A. Real-time
quantitative polymerase chain reaction and culture
analyses of Enterococcus faecalis in root canals. Journal of
Endodontics 2006;32:173–7.
8. Sassone L, Fidel R, Figueiredo L, Fidel S, Faveri M, Feres M.
Evaluation of the microbiota of primary endodontic
infections using checkerboard DNA–DNA hybridization. Oral
Microbiology and Immunology 2007;22:390–7.
9. Bonten MJ, Willems R, Weinstein RA. Vancomycin-resistant
enterococci: why are they here, and where do they come
from. The Lancet Infectious Diseases 2001;1:314–25.
10. Fisher K, Phillips C. The ecology, epidemiology and
virulence of Enterococcus. Microbiology 2009;155:1749–57.
11. Murray BE. Vancomycin-resistant enterococcal infections.
The New England Journal of Medicine 2000;342:710–21.
12. Zhu X, Wang Q, Zhang C, Cheung GS, Shen Y. Prevalence,
phenotype, and genotype of Enterococcus faecalis isolated
from saliva and root canals in patients with persistent
apical periodontitis. Journal of Endodontics 2010;36:1950–5.
13. Pinheiro ET, Gomes BPFA, Ferraz CCR, Teixeira FB, Zaia AA,
Souza-Filho FJ. Evaluation of root canal microorganisms
isolated from teeth with endodontic failure and their
antimicrobial susceptibility. Oral Microbiology and
Immunology 2003;18:100–3.
14. Rôças IN, Siqueira Jr JF, Santos KRN. Association of
Enterococcus faecalis with different forms of periradicular
diseases. Journal of Endodontics 2004;30:315–20.
15. Kaufman B, Spangberg L, Barry J, Fouad AF. Enterococcus spp.
in endodontically treated teeth with and without
periradicular lesions. Journal of Endodontics 2005;31:851–6.
16. Gomes BP, Pinheiro ET, Sousa EL, Jacinto RC, Zaia AA, Ferraz
CC, et al. Enterococcus faecalis in dental root canals detected
by culture and by polymerase chain reaction analysis. Oral
 journal of dentistry 41 (2013) 779–786
Surgery Oral Medicine Oral Pathology Oral Radiology and
Endodontic 2006;102:247–53.
17. Zoletti GO, Pereira EM, Schuenck RP, Teixeira LM, Siqueira Jr
JF, dos Santos KR. Characterization of virulence factors and
clonal diversity of Enterococcus faecalis isolates from treated
dental root canals. Research in Microbiology 2011;162:151–8.
18. Dahlen G, Samuelsson W, Molander A. Identification and
antimicrobial susceptibility of enterococci isolated from
root canal. Oral Microbiology and Immunology 2000;15:309–12.
19. Sedgley CM, Molander A, Flannagan SE, Nagel AC, Appelbe
OK, Clewell DB, et al. Virulence, phenotype and genotype
characteristics of endodontic Enterococcus spp. Oral
Microbiology and Immunology 2005;20:10–9.
20. Wang L, Dong M, Zheng J, Song Q, Yin W, Li J, et al.
Relationship of biofilm formation and gelE gene expression
in Enterococcus faecalis recovered from root canals in patients
requiring endodontic retreatment. Journal of Endodontics
2011;37:631–6.
21. Sun J, Sundsfjord A, Song X. Enterococcus faecalis from
patients with chronic periodontitis: virulence and
antimicrobial resistance traits and determinants. European
Journal of Clinical Microbiology & Infectious Diseases
2012;31:267–72.
22. Sedgley CM, Lee EH, Martin MJ, Flannagan SE. Antibiotic
resistance gene transfer between Streptococcus gordonii and
Enterococcus faecalis in root canals of teeth ex vivo. Journal of
Endodontics 2008;34:570–4.
23. Nandakumar R, Madayiputhiya N, Fouad AF. Proteomic
analysis of endodontic infections by liquid
chromatography–tandem mass spectrometry. Oral
Microbiology and Immunology 2009;24:347–52.
24. Sassone LM, Fidel RA, Faveri M, Guerra R, Figueiredo L, Fidel
SR, et al. A microbiological profile of symptomatic teeth with
primary endodontic infections. Journal of Endodontics
2008;34:541–5.
25. Biavasco F, Foglia G, Paoletti C, Zandri G, Magi G,
Guaglianone E, et al. VanA-type enterococci from humans,
animals, and food: species distribution, population
structure, Tn1546 typing and location, and virulence
determinants. Applied and Environmental Microbiology
2007;73:3307–19.
26. Frank JA, Reich CI, Sharma S, Weisbaum JS, Wilson BA,
Olsen GJ. Critical evaluation of two primers commonly used
for amplification of bacterial 16S rRNA genes. Applied and
Environmental Microbiology 2008;74:2461–70.
27. Schwaiger K, Harms K, Hölzel C, Meyer K, Karl M, Bauer J.
Tetracycline in liquid manure selects for co-occurrence of
the resistance genes tet(M) and tet(L) in Enterococcus faecalis.
Veterinary Microbiology 2009;18:386–92.
28. Turner S, Pryer KM, Miao VPW, Palmer JD. Investigating
deep phylogenetic relationships among cyanobacteria and
plastids by small subunit rRNA sequence analysis. Journal of
Eukaryotic Microbiology 1999;46:327–38.
29. Zou LK, Wang HN, Zeng B, Li JN, Li XT, Zhang AY, et al.
Erythromycin resistance and virulence genes in Enterococcus
faecalis from swine in China. New Microbiologica 2011;34:
73–80.
30. Hanningan A, Lynch C. Statistical methodology in oral and
dental research: pitfalls and recommendations. Journal of
Dentistry 2013;41:385–92.
31. Möller AJ. Microbiological examination of root canals and
periapical tissues of human teeth. Methodological studies.
Odontologisk Tidskrift 1966;74:1–380.
32. Sundqvist G, Fidgor D, Sjogren U. Microbiology analysis of
teeth with endodontic treatment and the outcome of
conservative retreatment. Oral Surgery Oral Medicine Oral
Pathology 1998;85:86–93.
33. Zoletti GO, Siqueira Jr JF, Santos KRN. Identification of
Enterococcus faecalis in root-filled teeth with or without
785
periradicular lesions by culture dependent and independent
approaches. Journal of Endodontics 2006;32:722–6.
34. Vidana R, Sullivan A, Billström H, Ahlquist M, Lund B.
Enterococcus faecalis infection in root canals – host-derived or
exogenous source? Letters in Applied Microbiology
2011;52:109–15.
35. Dahlén G, Blomqvist S, Almståhl A, Carlén A. Virulence
factors and antibiotic susceptibility in enterococci isolated
from oral mucosal and deep infections. Journal of Oral
Microbiology 2012;4:10855.
36. Souto R, Colombo AP. Prevalence of Enterococcus faecalis in
subgingival biofilm and saliva of subjects with chronic
periodontal infection. Archives of Oral Biology 2008;53:
155–60.
37. Noda M, Komatsu H, Inoue S, Sano H. Antibiotic
susceptibility of bacteria detected from the root canal
exudate of persistent apical periodontitis. Journal of
Endodontics 2000;26:221–4.
38. Pinheiro ET, Gomes BP, Drucker DB, Zaia AA, Ferraz CC,
Souza-Filho FJ. Antimicrobial susceptibility of Enterococcus
faecalis isolated from canals of root filled teeth with
periapical lesions. International Endodontic Journal
2004;37:756–63.
39. Reynaud af Geijersstam AH, Ellington MJ, Warner M,
Woodford N, Haapasalo M. Antimicrobial susceptibility and
molecular analysis of Enterococcus faecalis originating from
endodontic infections in Finland and Lithuania. Oral
Microbiology and Immunology 2006;21:164–8.
40. Skucaite N, Peciuliene V, Vitkauskiene A, Machiulskiene V.
Susceptibility of endodontic pathogens to antibiotics in
patients with symptomatic apical periodontitis. Journal of
Endodontics 2010;36:611–6.
41. Kuch A, Willems RJ, Werner G, Coque TM, Hammerum AM,
Sundsfjord A, et al. Insight into antimicrobial susceptibility
and population structure of contemporary human
Enterococcus faecalis isolates from Europe. Journal of
Antimicrobial Chemotherapy 2012;67:551–8.
42. Rodrigues RM, Gonçalves C, Souto R, Feres-Filho EJ, Uzeda
M, Colombo AP. Antibiotic resistance profile of the
subgingival microbiota following systemic or local
tetracycline therapy. Journal of Clinical Periodontology
2004;31:420–7.
43. Banchs F, Trope M. Revascularization of immature
permanent teeth with apical periodontitis: new treatment
protocol. Journal of Endodontics 2004;30:196–200.
44. Torabinejad M, Khademi AA, Babagoli J, Cho Y, Johnson WB,
Bozhilov K, et al. A new solution for the removal of the
smear layer. Journal of Endodontics 2003;29:170–5.
45. Giardino L, Ambu E, Becce C, Rimondini L, Morra M. Surface
tension comparison of four common root canal irrigants
and two new irrigants containing antibiotic. Journal of
Endodontics 2006;32:1091–3.
46. Villedieu A, Diaz-Torres ML, Hunt N, McNab R, Spratt DA,
Wilson M, et al. Prevalence of tetracycline resistance genes
in oral bacteria. Antimicrobial Agents and Chemotherapy
2003;47:878–82.
47. Clewell DB. Movable genetic elements and antibiotic
resistance in enterococci. European Journal of Clinical
Microbiology and Infectious Diseases 1990;9:90–102.
48. Flannagan SE, Clewell DB, Sedgley CM. A retrocidal plasmid
in Enterococcus faecalis: passage and protection. Plasmid
2008;59:217–30.
49. Jungermann GB, Burns K, Nandakumar R, Tolba M, Venezia
RA, Fouad AF. Antibiotic resistance in primary and
persistent endodontic infections. Journal of Endodontics
2011;37:1337–44.
50. Palmer KL, Kos VN, Gilmore MS. Horizontal gene transfer
and the genomics of enterococcal antibiotic resistance.
Current Opinion in Microbiology 2010;13:632–9.
786 journal of dentistry 41 (2013) 779–786
51. Dunavant TR, Regan JD, Glickman GN, Solomon ES,
Honeyman AL. Comparative evaluation of endodontic
irrigants against Enterococcus faecalis biofilms. Journal of
Endodontics 2006;32:527–31.
52. Norrington DW, Ruby J, Beck P, Eleazer PD. Observations of
biofilm growth on human dentin and potential destruction
after exposure to antibiotics. Oral Surgery Oral Medicine Oral
Pathology Oral Radiology and Endodontics 2008;105:526–9.
53. Wade WG. New aspects and new concepts of maintaining
microbiological health. Journal of Dentistry 2010;38:21–5.
54. Coburn PS, Gilmore MS. The Enterococcus faecalis cytolysin: a
novel toxin active against eukaryotic and prokaryotic cells.
Cellular Microbiology 2003;5:661–9.
55. Tendolkar PM, Baghdayan AS, Gilmore MS, Shankar N.
Enterococcal surface protein, Esp, enhances biofilm
formation by Enterococcus faecalis. Infection and Immunity
2004;72:6032–9.
56. Hancock LE, Perego M. The Enterococcus faecalis fsr two-
component system controls biofilm development through
production of gelatinase. Journal of Bacteriology
2004;186:5629–39.
57. Shankar N, Baghdayan AS, Gilmore MS. Modulation of
virulence within a pathogenicity island in vancomycin-
resistant Enterococcus faecalis. Nature 2002;417:746–50.
58. Di Rosa R, Creti R, Venditti M, D’Amelio R, Arciola CR,
Montanaro L, et al. Relationship between biofilm
formation, the enterococcal surface protein (Esp) and
gelatinase in clinical isolates of Enterococcus faecalis and
Enterococcus faecium. FEMS Microbiology Letters
2006;256:145–50.