| |

Received: 9 August 2019    Revised: 26 September 2019    Accepted: 10 October 2019

DOI: 10.1002/syn.22139

RESEARCH ARTICLE

D2 autoreceptor switches CB2 receptor effects on

[3H]‐dopamine release in the striatum

Gabriel López‐Ramírez1 | Rodolfo Sánchez‐Zavaleta1 | Arturo Ávalos‐Fuentes1 |

Juan José Sierra1 | Francisco Paz‐Bermúdez1 | Gerardo Leyva‐Gómez2 |
José Segovia Vila1 | Hernán Cortés3 | Benjamín Florán1

1
Departamento de Fisiología, Biofísica y
Neurociencias, Centro de Investigación y de Abstract
Estudios Avanzados del Instituto Politécnico CB2 receptors (CB2R) are expressed in midbrain neurons. To evidence the control of
Nacional, Ciudad de México, Mexico
2 dopamine release in dorsal striatum by CB2R, we performed experiments of [3H]‐
Departamento de Farmacia, Facultad de
Química, Universidad Nacional Autónoma de dopamine release in dorsal striatal slices. We found a paradoxical increase in K+‐in‐
México, Ciudad de México, Mexico
duced [3H]‐dopamine release by CB2R activation with GW 833972A and JWH 133
3
Laboratorio de Medicina
Genómica, Departamento de
two selective agonist. To understand the mechanism involved, we tested for a role
Genética, Instituto Nacional de of the D2 autoreceptor in this effect; because in pallidal structures, the inhibitory ef‐
Rehabilitación Luis Guillermo Ibarra Ibarra,
Ciudad de México, Mexico
fect of CB1 receptors (CB1R) on GABA release is switched to a stimulatory effect by
D2 receptors (D2R). We found that the blockade of D2 autoreceptors with sulpiride
Correspondence
Benjamin Florán, Departamento de
prevented the stimulatory effect of CB2R activation; in fact, under this condition,
Fisiología, Biofísica y Neurociencias, Centro CB2R decreased dopamine release, indicating the role of the D2 autoreceptor in the
de Investigación y de Estudios Avanzados
del Instituto Politécnico Nacional, Apartado
paradoxical increase. We also found that the effect occurs in nigrostriatal terminals,
Postal 14‐740, Ciudad de México 07000, since lesions with 6‐OH dopamine in the middle forebrain bundle prevented CB2R
México D.F., Mexico.
Email: bfloran@fisio.cinvestav.mx
effects on release. In addition, D2–CB2R interaction promoted cAMP accumulation,
and the increase in [3H]‐dopamine release was prevented by PKA blockade. D2–CB2R
Funding information
Consejo Nacional de Ciencia y Tecnología
coprecipitation and proximity ligation assay studies indicated a close interaction of
receptors that could participate in the observed effects. Finally, intrastriatal injection
of CB2R agonist induced contralateral turning in amphetamine‐treated rats, which
was prevented by sulpiride, indicating the role of the interaction in motor behavior.
Thus, these data indicate that the D2 autoreceptor switches, from inhibitory to stimu‐
latory, the CB2R effects on dopamine release, involving the cAMP → PKA pathway
in nigrostriatal terminals.

KEYWORDS
CB2 receptors, D2–CB2, dopamine release, interaction substantia nigra pars compacta, motor
behavior

1 |  I NTRO D U C TI O N

Several reports have indicated the expression of CB2 receptors (CB2R) in neurons of the central nervous system by means of the presence
of mRNA, protein expression, and/or pharmacological studies (Jordan & Xi, 2019). In this regard, one of the sites with highest expression ap‐
pears to be the basal ganglia. CB2R have been reported in the following: striatal neurons of mouse and rat (Zhang et al., 2015); neurons of the

Synapse. 2019;00:e22139. wileyonlinelibrary.com/journal/syn © 2019 Wiley Periodicals, Inc  |  1 of 20

https://doi.org/10.1002/syn.22139
 |
2 of 20       LÓPEZ‐RAMÍREZ et al.

pallidal complex of the macaque (Lanciego et al., 2011; Sierra et al., 2015); dopaminergic neurons of the ventral tegmental area (VTA) of mouse
(Aracil‐Fernandez et al., 2012; Canseco‐Alba et al., 2019; Zhang et al., 2014, 2016); neurons of the rat subthalamus (Sanchez‐Zavaleta et al.,
2018); rat substantia pars reticulata neurons (SNr) (Brusco, Tagliaferro, Saez, & Onaivi, 2008; Gong et al., 2006); and dopaminergic neurons
of the substantia nigra pars compacta (SNc) of humans (Garcia, Cinquina, Palomo‐Garo, Rabano, & Fernandez‐Ruiz, 2015; Gomez‐Galvez,
Palomo‐Garo, Fernandez‐Ruiz, & Garcia, 2016).
To our knowledge, evidence of the presynaptic control of neurotransmitter release by CB2R in the projections areas for these nuclei was
shown for glutamate from subthalamic projections to SNr (Sanchez‐Zavaleta et al., 2018) and for dopamine from VTA projections to the nu‐
cleus accummbens (Xi et al., 2011). The study of the role of presynaptic CB2R in the control of neurotransmitter release is important to estab‐
lish their relevance in the neural function (Atwood & Mackie, 2010; Mechoulam & Parker, 2013) and, specifically, in basal ganglia circuitry for
their possible effect on motor control (Fernandez‐Ruiz & Gonzales, 2005). This is also important because CB2R and CB1 receptors (CB1R) can
co‐express with other G‐protein‐coupled receptors, interacting among them at the level of their signaling pathways or by means of dimeric
interactions (Balenga et al., 2014; Caballero‐Floran et al., 2016; Callen et al., 2012; Marcellino et al., 2008; Martinez‐Pinilla et al., 2014; Moreno
et al., 2018). Usually, these interactions modify cannabinoid receptor signaling, as ocurrs between CB1R and dopamine D2 receptors (D2R) in
the globus pallidus, and their effects in neurotransmitter release have a behavioral impact (Caballero‐Floran et al., 2016; Munoz‐Arenas et al.,
2015).
It is well established that CB2R in nucleus accumbens modify behavioral responses associated with dopaminergic transmission (Aracil‐
Fernandez et al., 2012; Canseco‐Alba et al., 2019; Liu et al., 2017; Xi et al., 2011; Zhang et al., 2014) by modulation of dopamine release (Xi et
al., 2011). Nevertheless, in dorsal striatum, the role of CB2R in dopamine release and their effects in motor behavior have not yet been deter‐
mined. With this in mind, we began to study the effect of CB2R on the control of dopamine release in dorsal striatum, first searching for the
presence of their mRNA and protein in SNc neurons of rat and then exploring their effect on the release of [3H]‐dopamine in striatum. During
the execution of experiments, a paradoxical increase in K+‐induced [3H]‐dopamine release was observed during CB2R activation. Since CB1R
and D2R interact in striatopallidal terminals, increasing GABA release, despite their individual coupling to Gi proteins and inhibition of release
when they were activated separately (Caballero‐Floran et al., 2016; Gonzalez et al., 2009), we studied the possibility of a similar interaction
between the CB2R and D2 autoreceptors (Ford, 2014) co‐expressed in the dopaminergic neurons. Here, we report the signaling mechanism of
this interaction, the probable protein–protein interaction, and their effect on motor behavior.

2 |  M ATE R I A L S A N D M E TH O DS

2.1 | Animals
Male Wistar rats (weighing 200–250 g each) housed together (five per cage) with water and food available ad libitum and kept under natural
light cycle were used throughout. All the procedures were carried out in accordance with the National Institute of Health Guide for Care
and Use of Laboratory Animals and were approved by the Institutional Animal Care Committee of CINVESTAV, México, making all efforts to
minimize suffering.

2.2 | 6‐OH dopamine lesions

Rats were anesthetized with ketamine/xylazine (112.5/22.5 mg/kg i.p.), placed on a David Kopf stereotaxic frame and injected unilaterally with
6‐hydroxydopamine (6‐OHDA; 16 µg/1 µl of saline containing 0.1% ascorbic acid) in the medial forebrain bundle (MFB) at coordinates (A −1.8, L
2.4, V −7 mm) according to the atlas of Paxinos and Watson. Lesion of the MBF produces an extensive lesion of midbrain dopaminergic neurons of
the substantia nigra pars compacta and in a lesser extent of the VTA (Yuan, Sarre, Ebinger, & Michotte, 2005), since dopaminergic innervation to
dorsal striatum comes mainly from SNc (Parent & Hazrati., 1995), our lesion method ensures the dopamine depletion in our study area. Rats were
pretreated with desipramine (10 mg/kg i.p. 40 min.) prior the surgery in order to prevent noradrenergic neurons damage. To ensure the degree of
lesion, animals were challenged with amphetamine (10 mg/kg i.p.) and tested for circling behavior 8 days after surgery. Only rats showing 10 or
more ipsilateral turns/minute at 30 min after injection were included in the study (Albarrán‐Bravo et al., 2019; Rangel‐Barajas et al., 2011).

2.3 | Preparation of the slices from the dorsal striatum

Animals were euthanized, the brains isolated and immersed in oxygenated ice‐cold Artificial CerebroSpinal Fluid (ACSF) solution (compo‐
sition in mM: NaCl 118.25, KCl 1.75, MgSO 4 1, KH2PO 4 1.25, NaHCO3 25, CaCl2 2, and D‐glucose 10 in mM, bubbled with O2/CO2 95:5
v/v, pH7.4). Coronal brain slices (300‐µm thick) containing the dorsal striatum were obtained with a vibroslicer (Campden Inc., Cambridge,
United Kingdom) and were transferred to ice‐cold slides. The striatum was identified according to the atlas of Paxinos and Watson (1997) and
dissected.
LÓPEZ‐RAMÍREZ et al. |
      3 of 20

2.4 | Primary culture of substantia nigra pars compacta neurons

Primary SNc neuronal cultures were obtained according to the protocol reported by Brewer and Torricelli (2007) with slight modifications
(Sanchez‐Zavaleta et al., 2018). In brief, 3–4 weeks old male Wistar rats were killed by decapitation, the brain was removed, and immersed in
ice‐cold 220 mM sucrose medium containing 25 mM NaHCO3, NaH2PO4 1.25 mM, MgSO4 2mM, CaCl2 2.5 mM, 10 mM D‐glucose, 2.5 mM
KCl, and 1.25 mM NaH2PO4 (pH 7.4). Coronal slices were obtained as described above and the SNc was dissected under a light microscope.
The slices were then incubated in 5 ml of a calcium‐free solution with the same composition of sucrose medium containing papain (20 U) for
30 min at 30°C, followed by two washes with Neurobasal A (NB) medium. Two milliliters of NB medium were added to the slices and then were
triturated with a siliconized Pasteur pipette 10 times during approximately 45 s. Tissue remained for 3 min in order to allow the tissue settle,
and then the supernatant was transferred to an empty 15‐mL tube (this step was done two more times). The total supernatant (approximately
6 ml of cells suspending) was carefully applied to the top of the Lymphoprep density gradient and centrifuged at 100 g for 15 min at 22°C.
Then, the neuronal fraction was collected and washed with 2 ml of NB medium and centrifuged for 2 min at 200 g (2 times). Finally, the pellet
was re‐suspended in 1 ml of NB/B27 with L‐GIutamine or/and gentamycin.
Cells were plated on glass coverslips previously coated with 50 mg/ml poly‐D‐lysine in water (135 kDa, Sigma). The poly‐D‐lysine was
applied overnight, aspirated, rinsed once with water, and allowed to dry about 1 hr. One hour after plating and incubation, the medium was
replaced in order to drain unattached cells and debris. Cells were maintained at 37°C in a humidified 5% CO2/95% air atmosphere for 48 hr
until the experiments were performed.

2.5 | Synaptosomes preparation
Synaptosomal fractions were isolated from dorsal striatum slices from eight rats. The slices were homogenized in buffer (sucrose, 0.32 M;
HEPES, 0.005 M, pH 7.4), and then homogenates were centrifuged at 800 g during 10 min. The resulting supernatant was further centrifuged
at 20,000 g during 20 min. From this second centrifugation the supernatant (S1) was discarded and the pellet (P1) was suspended and col‐
located on the sucrose 0.8 M; HEPES, 0.005 M, buffer (pH 7.4) and newly centrifuged at 20,000 g during 20 min. Finally, supernatant was
discarded and the new pellet (P2) containing synaptosomes was used.

2.6 | Real time‐Polymerase chain reaction (RT‐PCR)

Total RNA was extracted from rat spleen, substantia nigra compacta, and primary cultures using TRIzol Reagent, following the manufacturer's
instructions (Invitrogen Life Technologies). In brief, RNA was extracted with chloroform (Sigma) and then centrifuged at 12,000 g for 15 min at
4°C. The aqueous phase was precipitated with an equal volume of isopropanol and then centrifuged at 10,000 g for 10 min at 4°C. The pellet
was washed in 70% ethanol and suspended in diethyl pyrocarbonate‐treated water. The total RNA concentration was determined by spectro‐
metric analysis with a NanoDrop 2000 Spectrophotometer (Termo Scientific).
Single‐strand cDNA was synthesized from the extracted RNA (5 µg) with M‐MLV reverse transcriptase (Invitrogen) and oligo‐dT (50 pmol),
and then 3 µl of the resulting cDNA were used for PCR. The primer sequences for PCR amplification of Cnr2 (the gene for CB2R) were designed
using Snap Gen Viewer: GAGTTGGGAGGAGACTGCC (forward) and CCAGACGAATCAACTTCTTCCC (reverse). The predicted sizes of prod‐
ucts were 496 bp for transcript variant 1 (NM_001164143.3) and 2 (NM_001164142.3), and 353 bp for transcript variant 3 (NM_020543.4).
Reactions were performed as follows: an initial step at 94°C for 5 min was followed by 42 cycles (30 s at 94°C, 31 s at 57°C, and 30 s at 72°C),
and finally by a 5‐min extension step at 72°C. PCR products were visualized in 2% agarose gels with ethidium bromide staining and images
were recorded using a BioDoc‐It System (UVP).

2.7 | Immunofluorescence in slices and primary cultures

Rats were anesthetized with an overdose of pentobarbital (4 mg/kg i.p.), briefly perfused trans‐cardiac with saline Ringer solution followed by
4% paraformaldehyde (PFA) in 0.1 M phosphate buffer (PB), pH 7.4. Brains were dissected and postfixed with PFA 4% for 24 hr at 4°C. After,
tissue was dehydrated in 0.1 M PB with 30% sucrose and then embedded in OCT (Miles Inc., EIkhart, IN, USA) and cut into coronal 30‐µM
sections on a freezing microtome (Leica, Nussloch, Germany). For immunofluorescence procedures, free‐floating sections method was used;
slices were incubated with 2% donkey serum, 0.1% Triton X‐100, and 1% serum bovine albumin in PB 0.1 M for 2 hr at room temperature. After
complete blocking, sections were incubated with the primary antibodies. For CB2R, rabbit‐anti‐CB2 polyclonal antibody which recognizes an
epitope in the third intracellular loop (amino acids 228–242) was employed (dilution 1:100); while for dopaminergic cells, mouse‐anti‐tyros‐
ine hydroxylase monoclonal antibody which recognizes an epitope in the n‐terminal region (amino acids 9–16) was used (dilution 1:1,000).
Slices were incubated with the corresponding secondary antibodies: Alexa Fluor 488 anti‐rabbit and Alexa Fluor 594 anti‐mouse at room
 |
4 of 20       LÓPEZ‐RAMÍREZ et al.

temperature for 3 hr (1:100). Finally, after three washes, slices were mounted in coverslips, washed, and dried. Images were acquired with a
Leica TCS SP8 confocal microscope (Leica Microsystems, Wetzlar, Germany) using Leica LAS AF software and a 63X oil objective.
For immunostaining of cultured cells, coverslips were fixed with paraformaldehyde 2% for 10  min, washed 2 times with PBS 1%, and
permeabilized with 0.12% Triton X‐100 (Sigma) for 10 min. Coverslips were again washed with PBS 2 times. To reduce nonspecific binding of
the primary antibody, the cover slips were blocked 15 min with 10% normal horse serum (Sigma) in PBS and incubated in a mixture of primary
antibodies (1:200) diluted in 1% BSA overnight at 4°C. Coverslips were washed and incubated for 2 hr at room temperature in PBS containing
1% BSA, Alexa Fluor 488 (1:200), and Alexa Fluor 594 (1:200), finally the coverslips were washed and mounted.

2.8 | Proximity ligation assay assay

In order to identify protein–protein interactions between D2 and CB2R we performed the proximity ligation assay (PLA) method adapted from
Pacchiana et al. (Pacchiana, Abbate, Armato, Dal Pra, & Chiarini, 2014). First, we incubated dorsal striatum slices of the rat with the rabbit‐
anti‐CB2 polyclonal antibody (Alomone labs, 1:100) and mouse‐anti‐D2 polyclonal antibody (Santa Cruz Biotechnology, 1:100) similarly as for
immunofluorescence previously described, then we proceed to the incubation with the secondary antibody. We used secondary antibodies
provided in the Duolink II in situ red PLA detection kit mouse/rabbit (DUO92101, Sigma‐Olink Bioscience), these antibodies are attached to a
complementary DNA oligonucleotides strand (Sable et al., 2018). After incubation with primary antibodies, the slices were incubated for 2 hr
at 37°C under gentle agitation in Duolink antibody diluent that contains the secondary antibodies: Duolink II PLA anti‐rabbit PLUS (dilution 1:6)
and Duolink II PLA anti‐mouse MINUS (dilution 1:6), the primary antibodies act as binding sites for species‐specific secondary antibodies, then
the samples were rinsed in PBS‐T (10 mM sodium phosphate dibasic, 156 mM sodium chloride, 2 mM potassium phosphate monobasic, and
0.1% Tween‐20, pH 7.4) at room temperature (three changes in 5 min). Next, slices were incubated with Duolink ligation mix (dilution 1:5) for
1 hr at 37°C, when the PLA probes are in close proximity (<40 nm), the complementary DNA strands can interact and ligase contained in the
ligation mix, forms a closed‐circle DNA template, after that, the samples were rinsed with PBS‐T (two changes in 2 min). In the next step, the
samples were incubated with Duolink amplification mix (dilution 1:5) for 100 min at 37°C under gentle agitation, the closed‐circle DNA template
acts like a primer to performance the rolling‐circle amplification by the DNA polymerase contained in the mix (for details, see Söderberg et
al., 2008), then slices were rinsed again with PBS‐T (three changes in 5 min). Finally, the samples were mounted with Duolink mounting medium
and a coverslip was applied on top of the samples and were analyzed by fluorescence microcopy. The product of amplification can be seen as
discreet fluorescent spots in a confocal microscope using a filter set for Texas red fluorescence dye, spots indicate close proximity of receptor
proteins and high probability of physical interaction. All the dilution and incubation times were optimized for free‐floating sections.

2.9 | Laser confocal microscopy

Images were acquired with a Leica TCS SP8 confocal microscope (Leica Microsystems, Mannheim, Germany) equipped with an apochromatic
63X oil immersion objective (N.A. 1.4), with a 405 nm laser and a white laser that emits wavelength in the range of 470–670 nm. Sequential
scanning was used to prevent crosstalk between channels in samples with two or more fluorophores. All images were analyzed with Fiji pack‐
age (http://pacif​ic.mpi-cbg.de/) to calculate the density of nuclei and PLA spots according to the protocols established by Bonaventura et al.
(2014) and Rico et al. (2017).
For each field a stack of two channels (one per staining) and 12–15 Z stacks with a 1‐μm z‐interval were acquired. After getting the maximal
projections of each image stack, channels were processed individually. We quantified nuclei and red spots from 12 fields for each experimental
condition (three animals). The nuclei were segmented with a median filter, subtracting the background, applying a threshold to obtain the bi‐
nary image and finally the Nucleus Counter plug‐in was applied. Red spots images were also filtered and a threshold was selected manually to
discriminate from PLA spots from background fluorescence. Once selected this threshold, value was applied uniformly for all images. In order
to count and characterize all objects in the image thresholding, the built in macro “Analyze particles” was applied. Objects larger than 3 µm2
were rejected. An unpaired t test was used to compare PLA signal density between intact and injured sides.

2.10 | [3H]‐dopamine release
Experiments of [3H]‐dopamine release were done using a method adapted from Garcia, Floran, Arias‐Montano, Young, and Aceves (1997). In
each experiment, striatal slices from four rats were pooled in a single incubation assay tube and left equilibrating for 30 min in ACSF main‐
tained at 37°C and gassed with O2/CO2 (95:5 v/v); then these were incubated for 30 min in 2 ml of ACSF containing: 77 nM [3H]‐dopamine
(40 Ci/mmol), 10 µM pargiline (to inhibit dopamine metabolism), and 0.57 mM ascorbic acid and 0.03 nM EDTA present in the solution for the
rest of the experiment.
After removal from the radioactive solution, slices were transferred to the perfusion chambers and superfused at a rate of 0.5 ml/min.
The ACSF for superfusion was contained in reservoirs placed in a constant temperature bath maintained at 38°C. When the ACSF reached
LÓPEZ‐RAMÍREZ et al. |
      5 of 20

the chambers, its temperature was 36–37°C. Each chamber (80‐µL volume) contained 5–6 slices; 4–5 of the 20 chambers of the superfusion
apparatus shape an experimental group. Chambers were randomly assigned to one experimental group (i.e., the release of each chamber was
one replicate). Every experiment has 4–5 experimental groups as indicated in the graph or results. Experiments were reproduced from 3–5
times as indicated.
In order to wash out the [3H]‐dopamine trapped in the interstitial space, the slices were superfused with normal ACSF for 30 min before
collecting the fractions for counting radioactivity. Fractions of the superfusate were collected in a fraction collector every 4 min (each fraction
was 2 ml). Four fractions were first collected to determine the release under basal conditions, then [K+] in the ACSF was increased to 15 mM
(composition of this solution in mM was NaCl, 104.5; KCl, 13.75; MgSO4, 1; KH2PO4, 1.25; NaHCO3, 25; CaCl2, 2; and D‐glucose, 10). Six
more fractions were collected of the high [K+] medium. All drugs were added to the medium at fraction 3, before changing the superfusion to
the high [K+] medium, to explore the effects on the basal release. The radioactivity released into the superfusion medium in each fraction was
measured by liquid scintillation counting. To determine the total amount of tritium remaining in the tissue, the slices were collected, treated
with 1 ml of 1 M HCl and allowed to stand for 5 hr before adding the scintillator and counting the radioactivity in a scintillation counter. [3H]‐
dopamine release was expressed initially as a fraction of the total amount of tritium remaining in the tissue. The effect of drugs on the basal
release of [3H]‐dopamine was assessed by comparing the fractional release in fraction 2 (immediately before exposure of the tissue to drug)
and fraction 4 (immediately prior to exposure to 15 mM of K+). Changes in K+‐evoked [3H]‐dopamine release were assessed by comparing the
area under the appropriate release curves between the first and last fractions collected after the change to high K+. For each experimental
condition, relative areas were expressed as percent of control.

2.11 | Coprecipitation and western blotting

Striatal synaptosomes were resuspended in a buffer containing Tris‐HCl: 40 mM, pH 7.5; NaCl: 150 mM; EDTA 2 mM; glycerol 10%; Triton
X‐100; Na deoxycolate 5%; SDS 0.2% and protease inhibitors (Complete tablets, Roche), and phenylmethanesulfonyl fluoride 1 mM. Then,
the samples were sonicated and aliquots (2 µl) were used for protein determination with Bradford's method. For coprecipitation, a sample of
500 µg of protein was incubated with antibody to CB2R (1:250) from Alomone labs which binds to the third intracellular loop of rat CB2R or
antibody to D2R (1:250) from Millipore which bind to D2R at third intracellular loop, for 6 hr and then added to A/G‐agarose beads (Santa Cruz
Biotechnology, Inc.) for the next 12 hr. Then samples were rinsed by centrifugation three times at 10,000 rpm for 5 min and resuspended with
500 µl of RIPA buffer each time. The pellet of the third centrifugation was resuspended in sample buffer (Glycerol 50%, Tris‐HCl 125 mM, SDS
4% Bromophenol blue 0.08%, b‐mercaptoethanol 5%) and heated at 100°C for 10 min. To detect CB2R or D2R the coprecipitation samples
were resolved by SDS‐PAGE transferred onto PVDF membranes and immublotted for 2 hr at room temperature in Tris‐buffered saline contain‐
ing 0.1% Tween 20 and 5% nonfat powdered milk. Then, the membranes were incubated with primary antibodies for CB2R (1:1,000) or D2R
(1:1,000), 36 hr at 4°C. Detection of antibodies was performed by chemiluminescence (ECL‐Plus Amersham) with HRP‐conjugated secondary
antibodies (1:2,000 dilution).
For single western blotting, equal amounts of protein of lesioned and normal side (50 µg) for determinations of CB2R were used. The sam‐
ples were resolved by SDS‐PAGE, transferred onto PVDF membranes (PVDF, Amersham Pharmacia Biotech), and immublotted for 2 hr at room
temperature in Tris‐buffered saline containing 0.1% Tween 20 and 5% nonfat powdered milk. Membranes were incubated 36 hr at 4°C with
antibody to CB2R (1:1,000) obtained from Alomone labs. Detection of antibody was performed by chemiluminescence (ECL‐Plus Amersham)
with HRP‐conjugated secondary antibodies (1:2,000 dilution).

2.12 | Behavioral experiments
Male Wistar rats locally bred weighing 180–200 g were anesthetized with ketamine/xilasine (75/5 mg/kg i.p.) and placed on a David Kopf
stereotaxic frame. A guide cannula (22 gauge, 12 mm long) was placed in dorsal striatum of one side for microinjections. The coordinates
used were: 0.5 mm posterior and 3 mm lateral to bregma and −3 mm from dura. The cannula was secured in place with dental acrylic glued to
the cranium and small stainless steel screws; a wire stylet was inserted into the cannula to prevent clogging (Floran, Gonzalez, Floran, Erlij, &
Aceves, 2005).
For rotational behavior, rats were tested 3 days after surgery, the rat was gently restrained and the stylet was replaced by an injection can‐
nula (30 gauge, 13.5 mm long) connected to a 5‐µl Hamilton syringe. Animals were challenged with amphetamine 1 mg/kg i.p., then the animals
were placed to the observation chamber. Drugs or vehicle were applied in a final volume of 1 µl delivered during 1 min; the cannula remaining
in its place 4 additional min. In order to block receptors before administration of the agonist, antagonist was administered 2 min before. The
number of turns per minute was recorded every minute during 20 min. At the end of the experiment, the animals were killed by an overdose of
ketamine/xilasine, and the brains were removed and fixed in 4% of PFA for 24 hr. Brain sections (200 µm) were obtained with the vibroslicer.
Injection sites were assessed by the location of the cannula on digitized images of the brain slices. These images were superimposed onto
schemes of the brain (Paxinos & Watson, 1997). Experiments with cannula locations not corresponding to dorsal striatum were discarded.
 |
6 of 20       LÓPEZ‐RAMÍREZ et al.

2.13 | Statistical analysis
To test for statistical differences between treatments in release experiments, the area under the curve (AUC) in the presence of elevated K+
was calculated for each experimental group and expressed as percentage of control calculated in each experiment ([3H]‐dopamine release %
of control) and mean ± standard error graphed. Then, the data were analyzed by one‐way ANOVA followed by Dunett test for comparison
with control or Tukey–Kramer multiple comparison test for comparison between several experimental conditions. Comparison from two sin‐
gle groups of the same experimental condition of a different set of experiments was performed by t test. To obtain an unbiased estimate of
IC50 values, Imax and Hill‐slope, concentration–response data for inhibition of [3H]‐dopamine release were fitted by nonlinear regression to
a Hill equation (four parameters logistic equation). Densitometries of blots were analyzed using unpaired t test. Behavioral experiments were
analyzed by one‐way ANOVA following by Tukey´s test. All analyses were performed using GraphPad Prism ver. 7.03 software (GraphPad
Software, Inc.).

2.14 | Drugs
AM281: 1‐(2,4‐Dichlorophenyl)‐5‐(4‐iodophenyl)‐4‐methyl‐N‐4‐morpholinyl‐1H‐pyrazole‐3‐carboxamide, AM630: 6‐Iodo‐2‐methyl‐1‐
[2‐(4‐morpholinyl)ethyl]‐1H‐indol‐3‐yl](4‐methoxyphenyl)methanone, amphetamine: DL‐amphetamine hydrochloride; forskolin: 7β‐
Acetoxy‐8,13‐epoxy‐1α,6β,9α‐trihydroxylabd‐14‐en‐11‐one, GW833972A: 2‐[(3‐chlorophenyl)amino]‐N‐(4‐pyridinylmethyl)‐4‐(trifluorome‐
thyl)‐5‐Pyrimidinecarboxamide hydrochloride, H89: ‐[2‐(p‐Bromocinnamylamino)ethyl]‐5‐isoquinolinesulfonamide dihydrochloride, NEM:
N‐Ethylmaleimide, 6‐OH dopamine: 6‐hydroxydopamine, sulpiride: S)‐5‐Aminosulfonyl‐N‐[(1‐ethyl‐2‐pyrrolidinyl)methyl]‐2‐methoxybenza‐
mide, were obtained from Sigma Aldrich México. JWH 133: (6aR,10aR)‐3‐(1,1‐Dimethylbutyl)‐6a,7,10,10a‐tetrahydro‐6,6,9‐trimethyl‐6H‐
dibenzo[b,d]pyran, were obtained from Tocris.

3 |   R E S U LT S

3.1 | Expression of mRNA and protein for CB2R in SNc neurons

The presence of mRNA transcripts for CB2R in rat SNc was detected by RT‐PCR and a representative blot is presented in Figure 1. The primers
detected variants 1, 2, and 3 for CB2R (Sanchez‐Zavaleta et al., 2018), and a positive signal was observed in spleen as a positive control, while
in slices and primary cultures from SNc bands for variants 1 and/or 2 were found. No band for any variant was detected in the nontemplate
control.
Then, we examined the expression of the protein of CB2R in dopaminergic neurons by double immunohistochemistry with antibodies for
CB2R and tyrosine hydroxylase (TH). Positive staining for CB2R was observed in cellular elements in all of the substantia nigra and in a colo‐
calization with TH‐positive elements in the area corresponding to SNc (Figure 2A1–A4). Amplification of photomicrographs confirmed the

F I G U R E 1   Expression of mRNA for CB2R in substantia nigra pars compacta nucleus (SNc). Figure shows a representative agarose gel for
CB2R detection with designed primers (Sanchez‐Zavaleta et al., 2018) in spleen homogenates (positive control), SNc slices, primary neuronal
cultures, and the antisense riboprobe (as a negative control). Sequence of primers is indicated in Methods
LÓPEZ‐RAMÍREZ et al. |
      7 of 20

colocalization of markers (Figure 2B1–C4). Likewise, the colocalization of CB2R protein and TH‐positive staining was found in primary cultures
of dopaminergic neurons isolated from SNc from 3 to 4‐week‐old rats (Figure 2D1–D4).

3.2 | Presynaptic CB2R increase K+‐induced [3H]‐dopamine release in dorsal striatum of rat

In order to determine the effect of CB2R activation on dopamine release in the dorsal striatum, the projection area of SNc dopaminergic neu‐
rons, we carried out K+‐induced [3H]‐dopamine release experiments in slices from dorsal striatum with selective agonists GW833972A and
JWH 133 (Belvisi et al., 2008; Huffman et al., 1999; Sanchez‐Zavaleta et al., 2018). Results of a representative experiment with GW833972A
and a dose–response curve for both agonists are depicted in Figure 3a,b, respectively. The activation of CB2R with both agonists produced
an unexpected and dose‐dependent stimulation of K+‐induced [3H]‐dopamine release with similar potency but significantly different efficacy
(GW833972A IC50 = 47 nM, CI ranging from 26–85 nM, Emax 198% ranging from 182 to 214, JWH133 IC50 = 40 nM, and CI ranging from 23
to 69 nM, Emax 167% ranging from 157 to 176). The effect of GW833972A (100 nM) and JWH 133 (100 nM) was prevented by selective CB2R

F I G U R E 2   Immunohistochemical detection of CB2R in slices and cultures of rat substantia nigra pars compacta. In row A, a panoramic
view is presented of rat substantia nigra immunostained for nucleus with DAPI in 1, in 2 CB2R with a monoclonal antibody, tyrosine
hydroxylase in 3, and merging of the signal of the three stains is shown in 4. In rows B and C, magnifications are shown focusing on SNc with
the same stains. In row D, we can appreciate the stain of primary neuronal cultures
 |
8 of 20       LÓPEZ‐RAMÍREZ et al.

F I G U R E 3   Activation of CB2R increase dopamine release in dorsal striatum slices of rat. In (a) a typical release experiment of the
fractional release course of K+‐induced [3H]‐dopamine release in striatal slices is depicted. Different doses of selective agonist GW833972A
are plotted: vertical arrow indicates addition of drug and horizontal arrow indicates perfusion with the high K+ (15 mM) solution. In (b) dose–
response curve for selective CB2R agonists GW833972A and JWH 133 from data as in (a), but expressed as change in the relative AUC with
respect to the control. In (c) and (d), we note the antagonism of the effect of GW833972A (100 nM) and JWH 133 (100 nM) with selective
CB2R antagonist AM630 (100 nM), but not with CB1R antagonist AM281 (100 nM). Data are graphed as mean ± standard error of six
experiments with four replicates per experiment for (b), and three experiments and five replicates for experiment for (c) and (d). ***p < .001
with respect to control, ns = no significant differences among groups, One‐way ANOVA followed by Tukey's multiple comparison test

antagonist/inverse agonist AM630 (100 nM) (Ross et al., 1999), but not for CB1 antagonist AM281 (100 nM) (Lan et al., 1999), as observed in
Figure 3c,d, respectively ([3H]‐dopamine release with respect to the control: GW833972A 159 ± 5% vs. GW833972A + AM 630 111 ± 8%,
mean difference = 48, p < .001, F = 33.22, df = 5; vs. GW833972A + AM281, 164 ± 5%, mean difference = −6, ns, F = 33.22, df = 5. [3H]‐dopa‐
mine release with respect to the control: JWH 133 146 ± 3% vs. JWH 133 + AM 630, 103 ± 4%, mean difference = 42, p < .001, F = 60, df = 5;
vs. JWH133 + AM281, 154 ± 3%, mean difference = −8, ns, F = 33.22, and df = 5. ANOVA followed by Tukey, n = 6 experiments, five replicates
per experiment). On the other hand, the antagonists did not modify release by themselves.
To determine whether modification of dopamine release occurs in presynaptic dopaminergic terminals of dorsal striatum by CB2R, we first
studied the protein expression of CB2R by western blot in synaptosomes from the control side (nonlesioned side) and on the lesioned side of the
dorsal striatum from unilaterally 6‐OH dopamine‐lesioned rats (see methods). In Figure 4a, a representative blot is depicted; total brain homog‐
enates and HEK 293 cells were employed as positive and negative controls, respectively. It can be observed that, after a dopaminergic lesion, a
decrease of about 53% of CB2R protein was produced in synaptosomes from the lesioned side, as the densitometric analysis indicates (Figure 4b,
relative density of lesioned side compared with respect to control side (100%) = 47 ± 6%, t = 85, df = 2, p < .05, Student's t test). The effect of
GW833972A on the fractional course of K+‐induced [3H]‐dopamine release is illustrated in Figure 3c, comparing control versus lesioned sides
in slices from the striatum of 6‐OH dopamine‐lesioned rats. As can be observed in the control side (red circles), GW833972A increased release
compared to its respective control (black circles). On the other hand, in the denervated side, the amount of radioactive neurotransmitter is much
less (green circles), because denervation decreased the number of dopaminergic neurons and their projections; thus, under this condition, no ef‐
fect of the CB2R agonist was observed (blue circles), despite the remaining release. To better represent the effect of dopaminergic denervation on
[3H]‐dopamine release and the effect of GW833972A on the lesioned side, we graphed the percentage of change in the relative AUC with respect
LÓPEZ‐RAMÍREZ et al. |
      9 of 20

F I G U R E 4   Presynaptic striatal CB2R that modulate dopamine release originate in the substantia nigra pars compacta. In (a), is shown
a typical western blot for CB2R protein of whole brain homogenates (positive control), of HEK 293 cell cultures (negative control), and of
the synaptosomes from striatum of the control and lesioned side from 6‐OHDA‐lesioned rats. In (b), the densitometry analysis of blots
comparing the CB2R protein of striatal synaptosomes from the control and from the lesioned side of 6‐OHDA‐lesioned rats is depicted;
data are expressed as relative density with respect to actin, and then, with the denervated side expressed as the percentage of the control
side. In (c), a typical representative experiment is shown of the fractional release of [3H]‐dopamine and the effect of GW833972A (100 nM)
on it. Striatal slices were obtained from 6‐OHDA‐lesioned rats from the control (nonlesioned) and lesioned sides. In black circles is shown
the release of the control side, and in red circles, the effect of GW383972A (100 nM) on release. Green circles represent the control
condition of slices from the lesioned side, and blue circles, the effect of GW833972A on slices from the the lesioned side. In (d) is shown
the percentage of change in AUC with respect to the control condition of the control side of three experiments, as in (c). Data are expressed
as mean ± standard error of three experiments and five replicates per experiment. *p < .025 and ***p < .001, with respect to the control
condition, ns = no significant differences among groups, unpaired Student;s t test

to the release under the control condition of the control side for both the control and the denervated sides (Figure 4d). The decrease in CB2R ex‐
pression correlated with loss in the effect of GW833972A (100 nM) on the stimulation of K+‐induced [3H]‐dopamine release on the lesioned side,
as demonstrated in Figure 4d (on the lesioned side: [3H]‐dopamine release with respect to the control side: 26 ± 3% vs. GW833972A 25 ± 4%,
t = 0.06, df = 4, ns, not significant. On the control side: [3H]‐dopamine release with respect to the control: 100% vs. GW833972A 157 ± 7%,
p < .001, t = 10.95, df = 4, unpaired Student t test, n = three experiments, five replicates per experiment).

3.3 | D2R dependence of the stimulatory effect of CB2R on K+‐induced [3H]‐dopamine release

Due to that in studies of [3H]‐dopamine release evoked by depolarization, this is regulated by D2 autoreceptors activated by endogenous do‐
pamine released by that depolarization (Herdon & Nahorski, 1987; Iannazzo, Sathananthan, & Majewski, 1997), and that CB1R–D2R co‐activa‐
tion stimulates neurotransmitter release (Caballero‐Floran et al., 2016; Gonzalez et al., 2009; Munoz‐Arenas et al., 2015), we tested whether
the D2 autoreceptor participates in the stimulation of [3H]‐dopamine release elicited by CB2R activation (Figure 5a–c). The blockade of D2
autoreceptor with the D2‐like antagonist sulpiride (100 nM) (Vallone, Picetti, & Borrelli, 2000) increased [3H]‐dopamine release (Figure 5b)
([3H]‐dopamine release with respect to the control: 100% vs. 158 ± 5%, mean difference = 58, p < .001, F = 29.87, df = 3, ANOVA followed by
Tukey, n = three experiments, five replicates per experiment); indicating D2 autoreceptor activation by endogenous dopamine. Likewise, as we
 |
10 of 20       LÓPEZ‐RAMÍREZ et al.

FIGURE 5 Paradoxical increase of CB2R activation on dopamine release in rat striatal slices depends upon D2 autoreceptors. In (a), a typical
release experiment of the fractional release course of the K+‐induced [3H]‐dopamine release in striatal slices is depicted. The effect of separate
and concomitant activation of CB2R with selective agonist GW833972A (100 nM) and blockade of D2 autoreceptor with the D2‐like antagonist
sulpiride (100 nM) is shown, vertical arrow indicates the addition of the drug and horizontal arrow indicates perfusion with the high K+ (15 mM)
solution. In B, change is graphed as the relative AUC as a percentage of the control of similar experiments, as in (a). In (c) is shown the change
in the relative AUC as percentage of control in experiments in which D2 autoreceptors were blockaded with sulpiride. Under all conditions, the
effect of CB2R activation with GW833972A is prevented by selective CB2R antagonist AM630, but not by CB1R antagonist AM281. Data are
graphed as mean ± standard error of three experiments with five replicates for experiment in each graph. ***p < .001 with respect to control,
ns = no significant differences among groups, One‐way ANOVA followed by Tukey's multiple comparison test

observed previously (Figure 3), CB2R activation with GW833972A (100 nM) also stimulated [3H]‐dopamine release (Figure 5b) ([3H]‐dopamine
release with respect to control: 100% vs. 163 ± 5%, mean difference = −63, p < .001, F = 29.87, df = 3, ANOVA followed by Tukey, n = three
experiments, five replicates per experiment). However, concomitant activation of CB2R with blockade of the D2 autoreceptor prevented both
increments in [3H]‐dopamine release, which was not different from the control (Figure 5b) ([3H]‐dopamine release with respect to control:
100% vs. GW833972A + sulpiride, 115 ± 7%, mean difference = −15, ns not significant, F = 29.87, df = 3, ANOVA followed by Tukey, n = three
experiments, five replicates per experiment).
The previous blockade of D2 autoreceptor with sulpiride included in the control and all experimental groups unmasked the expected
inhibitory effect of CB2R activation (Figure 5c) ([3H]‐dopamine release with respect to control: 100% vs. GW833972A 67 ± 4%, mean differ‐
ence = 33, p < .001, F = 18.57, df = 5, ANOVA followed by Tukey, n = six experiments, five replicates per experiment). The effect was prevented
by selective antagonist AM 630 (100 nM) ([3H]‐dopamine release with respect to control: 100% vs. GW833972A + AM630 105 ± 4%, mean
difference = −5.33, ns not significant, F = 18.57, df = 5, ANOVA followed by Tukey, n = 6 experiments, five replicates per experiment). The
CB1R blockade with AM281 (100 nM), a selective antagonist (Lan et al., 1999), did not modify the inhibitory effect of GW833972A (Figure 5b)
([3H]‐dopamine release, GW833972A 67 ± 4% vs. GW833972A + AM281 64 ± 4%, mean difference 2.66, ns not significant, F = 18.57, df = 5,
ANOVA followed by Tukey, n = six experiments, five replicates per experiment). Finally, the antagonists themselves did not modify release.

3.4 | cAMP → PKA, mediates CB2R–D2R stimulation of [3H]‐dopamine release

CB1R–D2R co‐activation stimulates cAMP formation in striatum, globus pallidus, and heterologous systems (Caballero‐Floran et al., 2016;
Glass & Felder, 1997; Jarrahian, Watts, & Barker, 2004; Kearn, Blake‐Palmer, Daniel, Mackie, & Glass, 2005; Khan & Lee, 2014) thus, we
studied whether the same occurs with CB2R and D2R co‐activation. First, we tested the effect of CB2R activation on forskolin‐stimulated
accumulation of [3H]‐cAMP in synaptosomes from striatum. We found that CB2R activation with GW833972A (100 nM) decreased forsko‐
lin‐induced (10 µM) [3H]‐cAMP accumulation (Figure 6a) ([3H]‐cAMP accumulation forskolin 176 ± 6% vs. forskolin + GW833972A 150 ± 3%,
mean difference = 26, p < .001, F = 68.67, df = 4, ANOVA followed by Tukey, n = three experiments, five replicates per experiment). The ef‐
fect was completely prevented by selective antagonist AM630 ([3H]‐cAMP accumulation forskolin 176 ± 6% vs. forskolin + GW833972A +
AM630 171 ± 2%, mean difference = 5, ns = not significant, F = 68.67, df = 4, ANOVA followed by Tukey, n = three experiments, five replicates
per experiment). On the other hand, D2‐like receptor activation with quinpirole (1 µM) also decreased forskolin‐induced (10 µM) [3H]‐cAMP
accumulation, as can be observed in Figure 6b ([3H]‐cAMP accumulation forskolin 165 ± 3% vs. forskolin + quinpirole 119 ± 3%, mean differ‐
ence = 46, p < .001, F = 79.14, df = 4, ANOVA followed by Tukey, n = three experiments, four replicates per experiment). The effect was com‐
pletely prevented by selective antagonist sulpiride (100 nM) ([3H]‐cAMP accumulation forskolin 165 ± 3% vs. forskolin + quinpirole +sulpiride
167 ± 6%, mean difference = −2, ns = not significant, F = 68.67, df = 4, ANOVA followed by Tukey, n = three experiments, four replicates per
experiment). The antagonists did not modify [3H]‐cAMP accumulation by themselves.
LÓPEZ‐RAMÍREZ et al. |
      11 of 20

F I G U R E 6   CB2R and D2 autoreceptor activation stimulates cAMP accumulation and PKA activity. In (a), the effect of CB2R selective
agonist GW833972A (100 mM) on forskolin‐stimulated [3H]‐cAMP accumulation and its antagonist AM630 (100 mM) is depicted. In (b),
the effect of D2‐like selective agonist quinpirole (1 µM) on forskolin‐stimulated [3H]‐cAMP accumulation and its antagonist sulpiride
(100 mM) is shown. In (c), the effect of increasing doses of GW833972A on inhibition of quinpirole (1 µM) of forskolin‐stimulated [3H]‐cAMP
accumulation is depicted, the effect of GW833972A is graphed in log of concentration, and a fitted dose–response curve is shown. The
purple bar and the rose bar show the effect of CB2R antagonist AM630 (100 nM) and of CB1R antagonists AM281 (100 nM), respectively on
the effect of quinpirole (1 µM)+GW833972A (500 nM). In (d) is shown the effect of Gi signaling blockade with NEM (100 µM) on quinpirole,
and in (e), on GW833972A inhibition of forskolin‐stimulated cAMP accumulation, respectively. In (f) is shown the effect of blockade of
PKA with H89 (10 µM) on GW833972A (100 nM) stimulation of K+‐induced [3H]‐dopamine release in rat striatal slices. Data are graphed as
mean ± standard error of three experiments with five replicates per experiment in each graph. ***p < .001 with respect to control; #p < .05,
##p < .01, and ###p < .001 with respect to forskolin in (a), (b), (d), and (e), and, with respect to quinpirole in (c); &&& p < .001 with respect to
forskolin in (e), ns = no significant differences among groups, One‐way ANOVA followed by Tukey's multiple comparison test

The effect of co‐activation of CB2R and D2 autoreceptor on cAMP accumulation is shown in Figure 6c. In these experiments, increasing
doses of the CB2R agonist were employed in the inhibition of forskolin‐stimulated [3H]‐cAMP accumulation by D2R activation with quinpirole.
As can be observed, the inhibition of forskolin‐stimulated [3H]‐cAMP accumulation by quinpirole (1µM) is reverted dose dependently by CB2R
activation with GW833972A (ED50 = 19 nM, CI = 10–43 nM; Emax = 184% CI 173%–193%). In fact, the effect of GW833972A when co‐admin‐
istered with quinpirole became stimulatory at doses over 100 nM ([3H]‐cAMP accumulation forskolin 149 ± 5% versus forskolin + quinpirole
+ GW833972A (100 nM) 170 ± 5%, mean difference = −21, p < .05; and versus forskolin + quinpirole + GW833972A (500 nM) 184 ± 2, mean
difference −34, p < .01, F = 27.63, df = 7, ANOVA followed by Tukey, n = three experiments, five replicates per experiment). AM630 (100 nM),
but not AM281 (100 nM), prevented the effect of co‐activation of CB2R with GW833972A (500 nM) and D2R with quinpirole (1 µM), moving
accumulation of [3H]‐cAMP toward the effect of D2R activation alone ([3H]cAMP accumulation forskolin + quinpirole 119 ± 3% versus forsko‐
lin + quinpirole + GW833972A + AM630 (500 nM) 117 ± 10, mean difference = 2, ns = not significant, F = 51.38, df = 7, ANOVA followed by
Tukey, n = three experiments, five replicates per experiment).
Then, we tested the dependence of Gi protein of the effects of D2R and CB2R on cAMP accumulation. In Figure 6d, it can be observed
that quinpirole inhibition of forskolin‐induced [3H]‐cAMP accumulation is prevented by Gi protein blocker NEM (50  µM; (Gonzalez et al.,
2009) ([3H]cAMP accumulation forskolin 160 ± 8% versus forskolin + quinpirole + NEM 158 ± 5%, mean difference = 2, ns = not significant,
F = 43, df  =  4, ANOVA followed by Tukey, n = three experiments, five replicates per experiment). Interestingly, NEM not only prevented
GW833972A inhibition of forskolin‐induced [3H]‐cAMP accumulation, but also it increased [3H]‐cAMP on the forskolin effect (Figure 6e) ([3H]
 |
12 of 20       LÓPEZ‐RAMÍREZ et al.

cAMP accumulation forskolin 159 ± 2% versus forskolin + GW833972A + NEM 186 ± 2%, mean difference = −27.33, p < .01, F = 91, df = 4,
ANOVA followed by Tukey, n = three experiments, five replicates per experiment). NEM did not modify forskolin stimulation of [3H]‐cAMP.
Finally, since co‐activation of CB2R and D2R stimulated cAMP accumulation, we analyzed whether cAMP through PKA stimulates the
[3H]‐dopamine release induced by K+. In Figure 6f, it can be observed that the stimulatory effect of GW833972A (100 nM) was prevented
by PKA blockade with H89 (10  µM (Chijiwa et al., 1990) ([3H]‐dopamine release with respect to control: GW833972A 144  ±  8% versus
GW833972A + H89 98 ± 2%, mean difference = 46, p < .001, F = 31.97, df = 3, and ANOVA followed by Tukey, n = three experiments, five
replicates per experiment). H89 did not modify the release by itself.

3.5 | Protein–protein interaction of CB2R and D2 autoreceptor

Due to that, D2R and CB1R interaction requires proximity between receptors in order to be associated with heteromerization (Kearn et al.,
2005; Khan & Lee, 2014; Marcellino et al., 2008); we conducted coprecipitation and PLA assays to study this in D2R–CB2R interaction. First,
we effected coprecipitation in striatal synaptosomes obtained from the control and lesioned sides of 6‐OHDA unilaterally lesioned rats.
Illustrative positive western blots for the coprecipitation of CB2R revealed by D2R antibody and coprecipitation of D2R revealed by CB2R anti‐
body are depicted in Figure 7a,b, respectively. As can be observed, a decrease in precipitates occurs in the denervated side.
The consequence of denervation on D2R–CB2R interaction on cAMP was evaluated in the lesioned compared with the control side. As
can be observed in Figure 7c, as we previously found in the normal side, quinpirole (1  µM) decreased forskolin stimulation of [3H]‐cAMP

F I G U R E 7   D2 autoreceptor and CB2R coprecipitate in rat striatal synaptosomes. 6‐OHDA‐induced lesions decrease coprecipitation
and abolish functional response of the CB2/D2 co‐activation on cAMP accumulation. In (a) and (b) are shown a representative blot of three
coprecipitations of CB2 and D2R in striatal synaptosomes, in (a), coprecipitation using CB2R antibody and revealing with D2R antibody, and
in (b), the opposed using D2R antibody and revealing with CB2R antibody. In the first lane, the input, in the second, the coprecipitate from
the control side, the third from the lesioned side, and four, no IgG control. (c) and (d) show the effect of CB2R activation with GW383972A
(10 nM) on quinpirole (1 µM) inhibition of forskolin‐stimulated cAMP accumulation in synaptosomes obtained from the dorsal striatum
of the control (c) and lesioned (d) sides of 6‐OHDA‐lesioned rats. **p < .01; ***p < .001 with respect to control; #p < .05 with respect to
forskolin + quinpirole in (c), and with respect to forskolin in (d), ns = no significant differences among groups, one‐way ANOVA followed by
Tukey's multiple comparison test
LÓPEZ‐RAMÍREZ et al. |
      13 of 20

accumulation in striatal synaptosomes ([3H]‐cAMP accumulation forskolin 182 ± 6% vs. forskolin + quinpirole 125 ± 6, mean difference = 56,
p < .01, F  =  46.27, df  =  3, ANOVA followed by Tukey, n = three experiments, five replicates per experiment). Concomitant activation of
CB2R (GW833972A 10 nM) partially reverted the effect of quinpirole (Figure 6c) ([3H]‐cAMP accumulation forskolin + quinpirole 125 ± 6,
vs. forskolin + quinpirole + GW833972A 154 ± 6, mean difference = 28.67, p < .01, F = 46.27, df = 3, ANOVA followed by Tukey, n = three
experiments, five replicates per experiment). On the other hand, on the lesioned side, two phenomena were observed. First, the inhibitory
effect of quinpirole on forskolin‐stimulated [3H]‐cAMP accumulation was less compared with that on the control side (Figure 6d) ([3H]‐cAMP
accumulation control side forskolin 182 ± 6% vs. forskolin + quinpirole 125 ± 6 vs. [3H]‐cAMP accumulation lesioned side forskolin 175 ± 6%
vs. forskolin  +  quinpirole 143  ±  4, difference in percentage of decrease on the control side 57% vs. denervated side 32%). However the
decrement was still significant ([3H]cAMP accumulation forskolin 175 ± 6% vs. forskolin + quinpirole 143 ± 4, mean difference = 32, p < .01,
F = 68.39, df = 3, ANOVA followed by Tukey, n = three experiments, five replicates per experiment). Second, GW833972A did not modify the
quinpirole effect on forskolin‐induced [3H]‐cAMP accumulation ([3H]cAMP accumulation forskolin + quinpirole 143 ± 4% vs. forskolin + quin‐
pirole +GW833972A 147 ± 6, mean difference = −4, ns = not significant, F = 68.39, df = 3, ANOVA followed by Tukey, n = three experiments,
five replicates per experiment), indicating that interaction between CB2R and D2R was lost during denervation.
The PLA assay is a helpful technique to show proximity between receptors in native tissue, which may be taken as an indicative of het‐
eromerization (Gomes et al., 2016); here, we made PLA for D2 autoreceptors and CB2R. A PLA positive mark in a section of dorsal striatum
from the control side of a 6‐OHDA‐lesioned rat is shown in Figure 8A1. In Figure 8A2 is shown the PLA of the 6‐OHDA‐lesioned striatum,
and in 8A3, we may observe the lack of a mark in the negative control. Figure 8B1–B3 depict magnifications of the upper figures. The PLA
dot‐count analysis of 12 sections sampled fields deriving from three rats are depicted in Figure 8c. The data revealed an important decrease
in labeling on the denervated side with respect to the nonlesioned control (PLA dots per section, normal side 101 ± 8 vs. lesioned side 46 ± 4,
mean difference = 56, p < .001, t = 5.8, df = 24, Student's t test).

3.6 | Intrastriatal CB2R activation induced contralateral turning in amphetamine‐treated rats

To determine whether co‐activation of the D2 autoreceptor and CB2R could affect motor behavior, we studied the effect of an intranigral
injection of GW833972A (5 µg i.c.) in systemically administered amphetamine‐treated rats (1 mg/kg i.p.). GW833972A induced contralateral
turning in rats previously treated with systemic amphetamine 5 min prior to microinjection (Figure 9b). Turning increased gradually with a

F I G U R E 8   Close proximity between D2R and CB2R in striatum releveled by PLA assay. In A1 is shown a typical PLA image from dorsal
striatum on the control side of 6‐OHDA‐lesioned rat, on the lesioned side in A2, and the negative control in A3. An amplification is shown in
B1–B3. In the (b) bar graph, a count of PLA points is shown in 12 different fields of the dorsal striatum of three lesioned rats comparing the
normal and lesioned side. ***p < .001 with respect to the control, Student's t test
 |
14 of 20       LÓPEZ‐RAMÍREZ et al.

F I G U R E 9   CB2R activation in dorsal striatum induces contralateral turning in amphetamine‐treated rats. In (b) is shown the induction
of contralateral circling by a single intrastriatal microinjection of 4 µg of GW833972A in rats previously treated with 1 mg/kg i.p. of
amphetamine (5 min previously). In (c), the inverse manipulation is depicted. In (e), is shown a simultaneous microinjection of intrastriatal
50 µg of sulpiride with intraperitoneal amphetamine, 5 min prior to GW833972A intrastriatal microinjection. In (f), similar to that of (e), but
the first microinjection was of selective CB2R antagonist AM630 (2 µg). (a) and (d) show the location of pipette tips for the corresponding
graph color. *p < .05 and ***p < .001 with respect to Min 5. One‐way ANOVA followed by Tukey's multiple comparison test

maximum of nearly 5 turns/min at 10 min after GW8339372A injection, and then decreased to disappear at min 20 after injection. Inverse
manipulation is exhibited in Figure 9c, that is., the first injection of GW833972A and then amphetamine. As can be observed, intrastriatal
CB2R activation did not modify locomotor asymmetry until D2 autoreceptors were activated with amphetamine; then, contralateral turning
was elicited with a maximal effect of about 5 turns/min lasting 15 min after amphetamine administration. Finally, intrastriatal D2R and CB2R
blockades prevented the circling induced by GW833972A (Figure 9d,e).

4 |  D I S CU S S I O N

Our data indicate that CB2R activation at presynaptic dopaminergic terminals of the dorsal striatum inhibits dopamine release and decrease
forskolin‐stimulated cAMP accumulation; nevertheless, concomitant D2 autoreceptor activation by endogenous dopamine is capable of
switching this effect toward a stimulation of dopamine release through cAMP → PKA cascade activation. This interaction between the D2
autoreceptor and CB2R and its influence on motor behavior had not been previously described to our knowledge.

4.1 | CB2R expression in SNc neurons and their effects on dopamine release and cAMP accumulation
Our data suggested that SNc dopaminergic neurons possess CB2R, because the presence of mRNA (Figure 1) and protein in soma (Figure 2)
and in nigrostriatal terminals (Figure 4a,b) was found. Primers designed to detect variants 1, 2, and 3 for CB2R isoforms of the rat used previ‐
ously showed that transcript variants 1 and/or 2, but not 3, are present in subthalamic neurons (Sanchez‐Zavaleta et al., 2018). Here, we found
that the same variants are expressed in SNc, which are most probably located in their neurons, since enriched neuronal cultures exhibited the
same positive signal (Sanchez‐Zavaleta et al., 2018). Also this is consistent with the report of Zhang et al. (2016) in which by in situ hybridization
shown the co‐expression of mRNA for CB2R with mRNA of dopamine transporter (DAT) in midbrain dopaminergic neurons.
In addition, an immunohistochemically positive label for CB2 antibody in TH‐positive neurons revealed the translation of mRNA into pro‐
tein (Figure 2). The specificity of the monoclonal antibody provided by Alamone labs, used in this experiments has previously validated in the
knockout mouse (Zhang et al., 2014) and we perform two negative controls: one without primary antibody and other with the immunogenic
peptide provided by the manufacturer, also de same antibody used in western blot experiments of a previous paper of our group gave an
LÓPEZ‐RAMÍREZ et al. |
      15 of 20

expected positive signal in the spleen and negative in HEK293 cell line known that does not express CB2R (Sanchez‐Zavaleta et al., 2018).
Consistent with us the protein expression in SNc of rat could be observed in a previous report dedicated to VTA dopaminergic neurons (Zhang
et al., 2016; Figure 2); thus, the latter, with our report, constitute evidence of CB2R expression in SNc neurons of rat.
Interestingly, dopaminergic CB2‐positive neurons appear to be located in greater number on the border near SNr (Figure 2B4). In addition,
positive labeling in TH‐negative elements was found in SNc (Figure 2C4, arrowheads), as occurs in VTA (Zhang et al., 2016), and positive label‐
ing in SNr (Figure 2A4), which is consistent with previous reports (Brusco et al., 2008; Gong et al., 2006). However, the cell type of the nondo‐
paminergic CB2 positive elements in SNc remains to be elucidated. The presence of CB2R protein in synaptosomes of striatum that decreased
after dopaminergic denervation (Figure 4a,4), as well of the effects on dopamine release (Figures 3 and 5) strongly suggested the presynaptic
location of CB2R in nigrostriatal terminals. In addition, the lack of effect of CB2R activation on quinpirole inhibition of cAMP accumulation after
dopaminergic denervation (Figure 7c,d) reinforces this idea. Therefore, our data indicate that CB2R are expressed in nigrostriatal dopaminergic
neurons and their terminals.
The functional effects of these presynaptic CB2R are complex. Control of neurotransmitter release through presynaptic receptors has
been studied, employing radioactive‐labeled transmitters using electrical, chemical, or high K+‐induced release utilizing brain slices, as in this
study. In this regard, it has been shown that the [3H]‐neurotransmitter released follows the temporal course of the endogenous transmitter
and those manipulations that modify the release, affect both (Herdon & Nahorski, 1987).
High K+ depolarization stimulates release of endogenous GABA, glutamate, acetylcholine, and endogenous dopamine together with [3H]
dopamine. Thus, blockade of D2R with sulpiride can stimulate the release of transmitters that possess presynaptic D2R activated by endoge‐
nous dopamine during depolarization and indirectly these neurotransmitters could modify the release of dopamine and be responsible of the
increment of [3H]‐dopamine observed. Several related factors can participate in the effect of sulpiride, such as doses, magnitude of depolar‐
ization, sensitivity of the different receptors etc., so a possible indirect effect of sulpiride should be analyzed in the experimental context. In
striatum modulation of neurotransmitter release by D2R in similar experimental conditions (15 mM of K+) was observed only for acetylcholine
and for dopamine itself, since other neurotransmitter requires higher K+ depolarization to induce a measurable release and also despite of this,
no significant effect of several D2R agonist on release was observed (Stoof, De Boer, Sminia, & Mulder, 1982), either sulpiride in very similar
experimental condition (13.7 mM of K+) at doses higher than 2µM does not modify K+ induced [3H] acetylcholine release (Sabol et al., 1987),
suggesting that endogenous dopamine released is not enough to active enough presynaptic D2R that modulate acetyl‐choline release and/or
that this receptors have less sensitivity to dopamine. In fact, it has been considered that autorreceptors should have a high affinity for their
respective ligands to exert its function adequately (Beaulieu & Gainetdinov, 2011). Thus, in this experimental condition is highly feasible that
the effect of sulpiride observed here occurs at nigrostriatal terminals. Thus, dopamine itself will modulate their own release by D2 autorecep‐
tor activation (Herdon & Nahorski, 1987; Iannazzo et al., 1997) and, in consequence, the amount of [3H]‐dopamine increased by the blockade
of D2 autorreceptors by the antagonist sulpiride (Figure 5a,b; Herdon & Nahorski, 1987).
On the other hand, D2 autoreceptor function modified the effect of CB2R on dopamine release, in that they masked the effect of CB2R
activation on neurotransmitter release, namely inhibition of [3H]‐dopamine release (Figure 5c) and inhibition of [3H]‐cAMP accumulation
(Figure 6a,e). Contrariwise, stimulation was observed during the co‐activation of both receptors CB2R and D2 autoreceptors, either with
endogenous dopamine (Figure 5a,b) or with exogenous agonist (Figure 6c). Both effects of CB2R agonist on [3H]‐dopamine release and [3H]‐
cAMP were mediated by CB2R, since CB1 antagonist AM281 (Lan et al., 1999) did not modify the stimulatory or inhibitory effects (Figures 3c,d,
5c, and 6c), and their potency in the responses of the agonist used fell within the reported range (Sanchez‐Zavaleta et al., 2018).
The CB2R inhibitory effect on K+‐induced [3H]‐dopamine release could be observed after blockade of D2 autoreceptors with sulpiride
(Figure 5c) and on [3H]‐cAMP accumulation induced by forskolin in nondepolarized synaptosomes (Figure 6a,c). These data indicate that
presynaptic CB2R modulate dopamine release induced by depolarization and cAMP synthesis in dopaminergic terminals, which may be ex‐
plained by their typical Gi protein coupling (Pertwee et al., 2010); to our knowledge, these effects in dorsal striatum had not been previously
described. The signaling mechanism by which CB2R modulate release should be explored. Interestingly, tritiated and endogenous dopamine
release in synaptosomes and striatal slices are sensitive to cAMP and K+ channel blockers (Bowyer & Weiner, 1989; Martel, Leo, Fulton, Berard,
& Trudeau, 2011), and CB2R modulate the excitability of VTA dopaminergic neurons, reducing intracellular cAMP and enhancing K+ currents
(Ma et al., 2019). Thus, it is possible that the effects of CB2R in the terminals are related to these mechanisms found in soma. In addition, their
effects could extend to dopamine synthesis and the firing rate of compacta neurons, since both are cAMP dependent (Goldstein, Bronaugh,
Ebstein, & Roberge, 1976; Shi & Bunney, 1992); of course, this should be experimentally tested. In summary, nigrostriatal CB2R are functional
and decrease dopamine release and cAMP accumulation.

4.2 | Switching of the CB2R signal in D2–CB2R interaction

Co‐activation of CB2R and D2 autoreceptor stimulated [3H]‐cAMP accumulation (Figure 6c) and promoted [3H]‐dopamine release most prob‐
ably via PKA activity (Figures 3, 5, and 6c). This interaction is presynaptic, in that coprecipitation of the receptors decreased after dopaminer‐
gic denervation, indicating a diminution of interacting proteins (Figure 7a,b). Remarkably, the functional response of the co‐activation, which is
 |
16 of 20       LÓPEZ‐RAMÍREZ et al.

reverting the inhibition of quinpirole on forskolin‐stimulated [3H]‐cAMP accumulation by CB2R activation, also disappeared (Figure 7d, green
and blue bar, compared with their counterpart in Figure 7c of the nondenervated side), supporting this fact. The remaining effect of quinpirole
on [3H]‐cAMP accumulation after denervation could be explained in terms of other presynaptic D2 receptors on striatal aferences.
Due to that H89 can block other kinases (Lochner & Moolman, 2006) other signaling pathways could be responsible for the effect of
CB2–D2R co‐activation. Since dopamine release in the striatum is stimulated by NO–cGMP–PKG pathway (Lonart, Cassels, & Johnson, 1993;
Sandor, Brassai, Puskas, & Lendvai, 1995; Zhu & Luo, 1992) related with the activity of D2‐like receptors (Lee, Oh, Shim, & Choe, 2013) and
more specific with D3 autoreceptor (Lee, Oh, Yang, et al., 2013) and also CB2R in some conditions (Negrete, Hervera, Leanez, Martin‐Campos,
& Pol, 2011; Shmist et al., 2006) stimulate NO production it will be interesting to explore if co‐activation is related with this pathway, of course
it should be explored. Nevertheless, the fact that co‐activation increases cAMP production in terminals (Figure 6c) as CB1–D2R (Caballero‐
Floran et al., 2016) and usually cAMP production is related with PKA activation is highly probably that this is the signaling mechanism.
The effects of CB2R activation on the interaction depend on dopaminergic tone and the occupancy of D2 autoreceptors. In K+‐induced
3
[ H]‐dopamine release experiments, tritiated and endogenous dopamine are released in sufficient amounts to activate a high proportion
of D2 autoreceptors (Herdon & Nahorski, 1987); thus, the CB2R effect on release under this condition is stimulatory (Figures 3 and 5b).
Contrariwise, their blockade with sulpiride (that is less activation of D2 autoreceptors) allows for the CB2R signal, inhibiting neurotransmitter
release (Figure 5c). In line with this, in nondepolarized preparations, CB2R as well as D2 autoreceptors decreased forskolin‐stimulated [3H]‐
cAMP accumulation by themselves (Figure 6a,b,d,e). However, during a maximal activation of D2 autoreceptors with agonist quinpirole, the
inhibition of forskolin‐stimulated [3H]‐cAMP accumulation is switched to stimulation by CB2R activation (Figure 6c), as occurs in release exper‐
iments. This phenomenon closely resembles the D2R–CB1R interaction attributed to a CB1R change of linkage to the Gs proteins observed in
striatum (Glass & Felder, 1997), pallidal structures (Caballero‐Floran et al., 2016; Gonzalez et al., 2009; Munoz‐Arenas et al., 2015), and to the
heterologous system (Jarrahian et al., 2004), which is also attributed to a heterodimeric interaction (Kearn et al., 2005). Moreover, in this D2R–
CB2R interaction, judged by their pharmacological profile that is not prevented by CB1 receptor blockade (Figures 3c,d, and 6c) and their loss
after dopaminergic denervation (Figure 7c,d), we can say that this occurs at dopaminergic terminals and between CB2R and D2 autoreceptors.
This is in line with low or absent CB1R mRNA expression in pars compacta (Matsuda, Bonner, & Lolait, 1993; Howlett et al., 2002) and the lack
of modification of CB1R binding in striatum after dopaminergic denervation (Herkenham, Lynn, Costa, & Richfield, 1991).
In D2R–CB1R striatal and pallidal interaction, change in linkage is attributed to CB1R, in that PTX toxin treatment promotes the Gs switching
of CB1R, but not of D2R (Caballero‐Floran et al., 2016; Glass & Felder, 1997; Gonzalez et al., 2009; Kearn et al., 2005). This is reinforced by
reports showing the structural basis for this coupling (Abadji, Lucas‐Lenard, Chin, & Kendall, 1999; Chen et al., 2010). However, unlike CB1R,
the data suggested a low possibility of coupling of CB2R to Gs protein (Calandra et al., 1999). Notwithstanding this, some reports indicate
that CB2R modulates several effects that are mediated by cAMP or PKA, such as the contractile effects of atrial cells (Sterin‐Borda, Del Zar, &
Borda, 2005), increase in T‐cell receptor‐triggered signaling (Borner, Smida, Hollt, Schraven, & Kraus, 2009), the modulation of T‐type channels
in retinal ganglion cells (Qian et al., 2017), and the stimulation of interleukin secretion in leukocytes (Saroz, Kho, Glass, Graham, & Grimsey,
2019). In addition, in this D2R–CB2R interaction, the fact that Gi protein blockade with NEM also switched the CB2R response to stimulation
(Figure 6e) suggests that probable coupling to Gs proteins could not be discarded; of course, more research should be performed. Other fea‐
tures of the D2R–CB1R interaction related to CB1R coupling to Gs, in addition to the D2R‐induced switching and unmasking by Gi protein block‐
ade, should be evaluated for CB2R. Such features include agonist/antagonist class effects (Bagher, Laprairie, Kelly, & Denovan‐Wright, 2016;
Bonhaus, Chang, Kwan, & Martin, 1998; Przybyla & Watts, 2010), Gi protein availability (Jarrahian et al., 2004), oligomerization promoted by
the receptor (Kearn et al., 2005), CB1R number (Finlay et al., 2017), and reduced Gi/o function (Eldeeb, Leone‐Kabler, & Howlett, 2016).
Heteromerization is another possibility to explain D2R–CB1R interaction (Kearn et al., 2005) that could be applicable to D2R–CB2R inter‐
action. However, from a required experimental approach for an adequate proposal for D2R–CB2R heteromerization, we only have proximity
probes (PLA and coprecipitation) and more evidence is needed (Gomes et al., 2016). On the other hand, for CB2R, a few dimeric interactions
have been proposed (Balenga et al., 2014; Callen et al., 2012; Franco et al., 2019; Reyes‐Resina et al., 2018). These interactions reveal negative
crosstalk among the involved receptors as a fingerprint, which is not the case for a possible D2R–CB2R heterodimer, in which a change in the
signaling of the participating receptors could be the characteristic response. The most interesting finding here is the close similarity in the
response of D2R–CB1R and D2R–CB2R found with respect to cAMP and neurotransmitter release, indicating that whatever the interacting re‐
lationship, whether dimeric or not dimeric, a similar mechanism occurs between pairs of receptors. Evidently, much more research is necessary
to determine whether heteromerization takes place for these receptors, which is an exciting possibility.

4.3 | Behavioral effects and functional implications

As we pointed out previously, dopaminergic tone and D2 autoreceptor activation are the conditions necessary for switching CB2R response on
dopamine release. Therefore, in order to test an in vivo motor effect of D2R–CB2R interaction, we indirectly stimulated the D2 autoreceptor releas‐
ing endogenous dopamine with administration of systemic amphetamine. Although this drug promotes the blockade of DAT, dopamine released
also indirectly activates D2 autoreceptors (Schmitz, Lee, Schmauss, Gonon, & Sulzer, 2001), while stimulating motor behavior by the activation of
LÓPEZ‐RAMÍREZ et al. |
      17 of 20

dopamine receptors. The need for and enhancement of motor activity by amphetamine to observe behavioral effects of CB2R indicates that baseline
concentrations of dopamine are too low to activate a sufficient amount of D2 autoreceptors; thus, local application of CB2R agonist does not modify
motor behavior (Figure 9c). The need for the enhancement of dopaminergic activity has been observed also in the D2R–CB1R interaction (Caballero‐
Floran et al., 2016). The contralateral circling observed with CB2R activation by the unilateral microinjection in dorsal striatum of GW837972A in the
amphetamine‐treated rat is compatible with the increase in interstitial dopamine produced by the co‐activation of both receptors. Since co‐activa‐
tion increased more the release of dopamine, it produces an imbalance in the motor symmetry in favor of the manipulated side, that is, expressed as
contralateral circling. The role of D2R is supported by the prevention of circling produced by their blockade with sulpiride (Figure 9e).
It is now clear that CB2R expressed in VTA dopaminergic neurons modify some cocaine‐mediated motor behaviors, such as traveled
distance (Xi et al., 2011) and the sensitization of motor activity (Aracil‐Fernandez et al., 2012)) related with inhibitory effects on dopamine
release (Xi et al., 2011). Furthermore, selective knock‐out of CB2R in VTA neurons potentiates ambulatory distance, stereotypes, and rearing,
suggesting an inhibitory role on these spontaneous behaviors (Liu et al., 2017); thus, our data on the decrease of dopamine release in the dorsal
striatum by CB2R activation suggest that striatal CB2R could also participate in such motor effects. In this regard, behavioral effects, such as
stereotypes and rearing, were not evaluated in our experimental paradigm, since the amphetamine induces such effects at doses over 2 mg/kg
(Sharp, Zetterstrom, Ljungberg, & Ungerstedt, 1986), and during circling, they do not occur, or cannot be adequately evaluated. However, we
found that after amphetamine‐induced activation of D2 autoreceptor, CB2R activation increased motor displacement, which was evidenced by
locomotor asymmetry (Figure 9b,c) and was explained by the stimulation of dopamine release.
Other recent data indicate that amphetamine‐induced hyperactivity is increased by the absence of CB2R (Canseco‐Alba et al., 2019);
however, at low doses of amphetamine, similar to that used in this study, the absence of CB2R decreases the stimulatory effect of the am‐
phetamine on motor behavior (Canseco‐Alba et al., 2019). This effect could be explained by the lack of interaction of D2R–CB2R on knockout
mouse, assuming that, in the stimulatory effect of amphetamine on motor behavior at low doses of amphetamine, there is the participation of
D2 autoreceptors and CB2R. The mechanism by which CB2R could be active under this condition is unknown but, interestingly, D2R activation
with quinpirole injected into the striatum increases endocannabinoid synthesis and release (Giuffrida et al., 1999), particularly of anandamide,
suggesting a source of cannabinoids during D2R stimulation. On the other hand, at higher doses of amphetamine, intrastriatal CB2R activa‐
tion did not induce contralateral turning (data not shown). This finding can be explained because amphetamine also induced redistribution of
vesicular dopamine in the cytoplasmic compartment (Schmitz, Benoit‐Marand, Gonon, & Sulzer, 2003), which could diminish the expression
of autoreceptor activity. These possibilities suggested the conditions under which D2R–CB2R interaction could participate in motor control.

5 | CO N C LU S I O N

In summary, we present neurochemical and behavioral evidence for the presynaptic CB2R inhibitory control of dopamine release in dorsal
striatum and an interaction with D2 autoreceptors, in which receptor co‐activation stimulates dopamine release and promotes motor behavior.
This interaction closely resembles the D2R–CB1R interaction previously described. Several questions arise from the data, but the information
nonetheless provides a novel mechanism by which neural CB2R regulates neurotransmitter release.

AC K N OW L E D G M E N T S

Consejo Nacional de Ciencia y Tecnología (CONACYT).

C O N FL I C T O F I N T E R E S T

Co‐authors do not have a conflict of interest to declare.

ORCID

Benjamín Florán  https://orcid.org/0000-0002-3430-9335

REFERENCES

Abadji, V., Lucas‐Lenard, J. M., Chin, C., & Kendall, D. A. (1999). Involvement of the carboxyl terminus of the third intracellular loop of the cannabinoid
CB1 receptor in constitutive activation of Gs. Journal of Neurochemistry, 72(5), 2032–2038. https​://doi.org/10.1046/j.1471-4159.1999.07220​32.x
Albarrán‐Bravo, S., Avalos‐Fuentes, J. A., Cortes, H., Rodriguez‐Sanchez, M., Leyva‐Garcia, N., Rangel‐Barajas, C., … Floran, B. (2019). Severity of dys‐
kinesia and D3R signaling changes induced by L‐DOPA treatment of hemiparkinsonian rats are feautures inherent to treated subjets. Biomolecules,
9, 431. https​://doi.org/10.3390/biom9​090431
 |
18 of 20       LÓPEZ‐RAMÍREZ et al.

Aracil‐Fernandez, A., Trigo, J. M., Garcia‐Gutierrez, M. S., Ortega‐Alvaro, A., Ternianov, A., Navarro, D., … Manzanares, J. (2012). Decreased cocaine
motor sensitization and self‐administration in mice overexpressing cannabinoid CB(2) receptors. Neuropsychopharmacology, 37(7), 1749–1763.
https​://doi.org/10.1038/npp.2012.22
Atwood, B. K., & Mackie, K. (2010). CB2: A cannabinoid receptor with an identity crisis. British Journal of Pharmacology, 160(3), 467–479. https​://doi.
org/10.1111/j.1476-5381.2010.00729.x
Bagher, A. M., Laprairie, R. B., Kelly, M. E., & Denovan‐Wright, E. M. (2016). Antagonism of dopamine receptor 2 long affects cannabinoid receptor
1 signaling in a cell culture model of striatal medium spiny projection neurons. Molecular Pharmacology, 89(6), 652–666. https​://doi.org/10.1124/
mol.116.103465
Balenga, N. A., Martinez‐Pinilla, E., Kargl, J., Schroder, R., Peinhaupt, M., Platzer, W., … Franco, R. (2014). Heteromerization of GPR55 and cannabinoid
CB2 receptors modulates signalling. British Journal of Pharmacology, 171(23), 5387–5406.
Beaulieu, J., & Gainetdinov, R. R. (2011). The physiology, signaling, and pharmacology of dopamine receptors. Pharmacological Reviews, 63, 182–217.
https​://doi.org/10.1124/pr.110.002642
Belvisi, M. G., Patel, H. J., Freund‐Michel, V., Hele, D. J., Crispino, N., & Birrell, M. A. (2008). Inhibitory activity of the novel CB2 receptor ago‐
nist, GW833972A, on guinea‐pig and human sensory nerve function in the airways. British Journal of Pharmacology, 155(4), 547–557. https​://doi.
org/10.1038/bjp.2008.298
Bonaventura, J., Rico, A. J., Moreno, E., Sierra, S., Sanchez, M., Luquin, N., … Franco, R. (2014). L‐DOPA‐treatment in primates disrupts the expression
of A(2A) adenosine‐CB(1) cannabinoid‐D(2) dopamine receptor heteromers in the caudate nucleus. Neuropharmacology, 79, 90–100. https​://doi.
org/10.1016/j.neuro​pharm.2013.10.036
Bonhaus, D. W., Chang, L. K., Kwan, J., & Martin, G. R. (1998). Dual activation and inhibition of adenylyl cyclase by cannabinoid receptor agonists:
Evidence for agonist‐specific trafficking of intracellular responses. Journal of Pharmacology and Experimental Therapeutics, 287(3), 884–888.
Borner, C., Smida, M., Hollt, V., Schraven, B., & Kraus, J. (2009). Cannabinoid receptor type 1‐ and 2‐mediated increase in cyclic AMP inhibits T cell
receptor‐triggered signaling. Journal of Biological Chemistry, 284(51), 35450–35460.
Bowyer, J. F., & Weiner, N. (1989). K+ channel and adenylate cyclase involvement in regulation of Ca2+‐evoked release of [3H]dopamine from synapto‐
somes. Journal of Pharmacology and Experimental Therapeutics, 248(2), 514–520.
Brewer, G. J., & Torricelli, J. R. (2007). Isolation and culture of adult neurons and neurospheres. Nature Protocols, 2(6), 1490–1498.
Brusco, A., Tagliaferro, P. A., Saez, T., & Onaivi, E. S. (2008). Ultrastructural localization of neuronal brain CB2 cannabinoid receptors. Annals of the New
York Academy of Sciences, 1139, 450–457.
Caballero‐Floran, R. N., Conde‐Rojas, I., Oviedo Chavez, A., Cortes‐Calleja, H., Lopez‐Santiago, L. F., Isom, L. L., … Floran, B. (2016). Cannabinoid‐in‐
duced depression of synaptic transmission is switched to stimulation when dopaminergic tone is increased in the globus pallidus of the rodent.
Neuropharmacology, 110(Pt A), 407–418.
Calandra, B., Portier, M., Kerneis, A., Delpech, M., Carillon, C., Le Fur, G., … Shire, D. (1999). Dual intracellular signaling pathways mediated by the human
cannabinoid CB1 receptor. European Journal of Pharmacology, 374(3), 445–455.
Callen, L., Moreno, E., Barroso‐Chinea, P., Moreno‐Delgado, D., Cortes, A., Mallol, J., … McCormick, P. J. (2012). Cannabinoid receptors CB1 and CB2
form functional heteromers in brain. Journal of Biological Chemistry, 287(25), 20851–20865.
Canseco‐Alba, A., Schanz, N., Sanabria, B., Zhao, J., Lin, Z., Liu, Q. R., & Onaivi, E. S. (2019). Behavioral effects of psychostimulants in mutant mice with
cell‐type specific deletion of CB2 cannabinoid receptors in dopamine neurons. Behavioural Brain Research, 360, 286–297.
Chen, X. P., Yang, W., Fan, Y., Luo, J. S., Hong, K., Wang, Z., … Zhou, N. M. (2010). Structural determinants in the second intracellular loop of the human
cannabinoid CB1 receptor mediate selective coupling to G(s) and G(i). British Journal of Pharmacology, 161(8), 1817–1834.
Chijiwa, T., Mishima, A., Hagiwara, M., Sano, M., Hayashi, K., Inoue, T., … Hidaka, H. (1990). Inhibition of forskolin‐induced neurite outgrowth and pro‐
tein phosphorylation by a newly synthesized selective inhibitor of cyclic AMP‐dependent protein kinase, N‐[2‐(p‐bromocinnamylamino)ethyl]‐5‐
isoquinolinesulfonamide (H‐89), of PC12D pheochromocytoma cells. Journal of Biological Chemistry, 265(9), 5267–5272.
Eldeeb, K., Leone‐Kabler, S., & Howlett, A. C. (2016). CB1 cannabinoid receptor‐mediated increases in cyclic AMP accumulation are correlated with
reduced Gi/o function. Journal of Basic and Clinical Physiology and Pharmacology, 27(3), 311–322.
Fernandez‐Ruiz, J., & Gonzales, S. (2005). Cannabinoid control of motor function at the basal ganglia. Handbook of Experimental Pharmacology, 168,
479–507.
Finlay, D. B., Cawston, E. E., Grimsey, N. L., Hunter, M. R., Korde, A., Vemuri, V. K., … Glass, M. (2017). Galphas signalling of the CB1 receptor and the
influence of receptor number. British Journal of Pharmacology, 174(15), 2545–2562.
Floran, B., Gonzalez, B., Floran, L., Erlij, D., & Aceves, J. (2005). Interactions between adenosine A(2a) and dopamine D2 receptors in the control of [(3)
H]GABA release in the globus pallidus of the rat. European Journal of Pharmacology, 520(1–3), 43–50.
Ford, C. P. (2014). The role of D2‐autoreceptors in regulating dopamine neuron activity and transmission. Neuroscience, 282, 13–22.
Franco, R., Villa, M., Morales, P., Reyes‐Resina, I., Gutierrez‐Rodriguez, A., Jimenez, J., … Navarro, G. (2019). Increased expression of cannabinoid CB2
and serotonin 5‐HT1A heteroreceptor complexes in a model of newborn hypoxic‐ischemic brain damage. Neuropharmacology, 152, 58–66.
Garcia, M. C., Cinquina, V., Palomo‐Garo, C., Rabano, A., & Fernandez‐Ruiz, J. (2015). Identification of CB(2) receptors in human nigral neurons that
degenerate in Parkinson's disease. Neuroscience Letters, 587, 1–4.
Garcia, M., Floran, B., Arias‐Montano, J. A., Young, J. M., & Aceves, J. (1997). Histamine H3 receptor activation selectively inhibits dopamine D1 recep‐
tor‐dependent [3H]GABA release from depolarization‐stimulated slices of rat substantia nigra pars reticulata. Neuroscience, 80(1), 241–249.
Giuffrida, A., Parsons, L. H., Kerr, T. M., Rodriguez de Fonseca, F., Navarro, M., & Piomelli, D. (1999). Dopamine activation of endogenous cannabinoid
signaling in dorsal striatum. Nature Neuroscience, 2(4), 358–363.
Glass, M., & Felder, C. C. (1997). Concurrent stimulation of cannabinoid CB1 and dopamine D2 receptors augments cAMP accumulation in striatal
neurons: Evidence for a Gs linkage to the CB1 receptor. Journal of Neuroscience, 17(14), 5327–5333.
Goldstein, M., Bronaugh, R. L., Ebstein, B., & Roberge, C. (1976). Stimulation of tyrosine hydroxylase activity by cyclic AMP in synaptosomes and in
soluble striatal enzyme preparations. Brain Research, 109(3), 563–574. https​://doi.org/10.1016/0006-8993(76)90035-4
Gomes, I., Ayoub, M. A., Fujita, W., Jaeger, W. C., Pfleger, K. D., & Devi, L. A. (2016). G protein‐coupled receptor heteromers. Annual Review of
Pharmacology and Toxicology, 56, 403–425. https​://doi.org/10.1146/annur​ev-pharm​tox-011613-135952
LÓPEZ‐RAMÍREZ et al. |
      19 of 20

Gomez‐Galvez, Y., Palomo‐Garo, C., Fernandez‐Ruiz, J., & Garcia, C. (2016). Potential of the cannabinoid CB(2) receptor as a pharmacological target
against inflammation in Parkinson's disease. Progress in Neuro‐Psychopharmacology and Biological Psychiatry, 64, 200–208. https​://doi.org/10.1016/j.
pnpbp.2015.03.017
Gong, J. P., Onaivi, E. S., Ishiguro, H., Liu, Q. R., Tagliaferro, P. A., Brusco, A., & Uhl, G. R. (2006). Cannabinoid CB2 receptors: Immunohistochemical
localization in rat brain. Brain Research, 1071(1), 10–23. https​://doi.org/10.1016/j.brain​res.2005.11.035
Gonzalez, B., Paz, F., Floran, L., Aceves, J., Erlij, D., & Floran, B. (2009). Cannabinoid agonists stimulate [3H]GABA release in the globus pallidus of the
rat when G(i) protein‐receptor coupling is restricted: Role of dopamine D2 receptors. Journal of Pharmacology and Experimental Therapeutics, 328(3),
822–828.
Herdon, H., & Nahorski, S. R. (1987). Comparison between radiolabelled and endogenous dopamine release from rat striatal slices: Effects of electrical
field stimulation and regulation by D2‐autoreceptors. Naunyn Schmiedebergs Archives of Pharmacology, 335(3), 238–242. https​://doi.org/10.1007/
BF001​72790​
Herkenham, M., Lynn, A. B., de Costa, B. R., & Richfield, E. K. (1991). Neuronal localization of cannabinoid receptors in the basal ganglia of the rat. Brain
Research, 547(2), 267–274. https​://doi.org/10.1016/0006-8993(91)90970-7
Howlett, A. C., Barth, F., Bonner, T. I., Cabral, G., Casellas, P., Devane, W. A., … Pertwee, R. G. (2002). International union of pharmacology. XXVII.
Classification of cannabinoid receptors. Pharmacological Reviews, 54(2), 161–202. https​://doi.org/10.1124/pr.54.2.161
Huffman, J. W., Liddle, J., Yu, S., Aung, M. M., Abood, M. E., Wiley, J. L., & Martin, B. R. (1999). 3‐(1',1'‐Dimethylbutyl)‐1‐deoxy‐delta8‐THC and related
compounds: Synthesis of selective ligands for the CB2 receptor. Bioorganic & Medicinal Chemistry, 7(12), 2905–2914.
Iannazzo, L., Sathananthan, S., & Majewski, H. (1997). Modulation of dopamine release from rat striatum by protein kinase C: Interaction with presyn‐
aptic D2‐dopamine‐autoreceptors. British Journal of Pharmacology, 122(8), 1561–1566.
Jarrahian, A., Watts, V. J., & Barker, E. L. (2004). D2 dopamine receptors modulate Galpha‐subunit coupling of the CB1 cannabinoid receptor. Journal of
Pharmacology and Experimental Therapeutics, 308(3), 880–886.
Jordan, C. J., & Xi, Z. X. (2019). Progress in brain cannabinoid CB2 receptor research: From genes to behavior. Neuroscience & Biobehavioral Reviews, 98,
208–220.
Kearn, C. S., Blake‐Palmer, K., Daniel, E., Mackie, K., & Glass, M. (2005). Concurrent stimulation of cannabinoid CB1 and dopamine D2 receptors en‐
hances heterodimer formation: A mechanism for receptor cross‐talk? Molecular Pharmacology, 67(5), 1697–1704.
Khan, S. S., & Lee, F. J. (2014). Delineation of domains within the cannabinoid CB1 and dopamine D2 receptors that mediate the formation of the het‐
erodimer complex. Journal of Molecular Neuroscience, 53(1), 10–21.
Lan, R., Gatley, J., Lu, Q., Fan, P., Fernando, S. R., Volkow, N. D., … Makriyannis, A. (1999). Design and synthesis of the CB1 selective cannabinoid antag‐
onist AM281: A potential human SPECT ligand. AAPS PharmSci, 1(2), E4.
Lanciego, J. L., Barroso‐Chinea, P., Rico, A. J., Conte‐Perales, L., Callen, L., Roda, E., … Franco, R. (2011). Expression of the mRNA coding the cannabinoid
receptor 2 in the pallidal complex of Macaca fascicularis. Journal of Psychopharmacology, 25(1), 97–104.
Lee, D. K., Oh, J. H., Shim, Y., & Choe, E. U. (2013). Protein kinase G regulates dopamine release, ΔFos B expression, and locomotor activity after re‐
peated cocaine administration: Involment of dopamine D2 receptors. Neurochemical Research, 38, 1424–1433.
Lee, D. K., Oh, J. H., Yang, J. H., Youn, B., Shim, Y., Shim, I., … Choe, E. U. (2013). Protein kinase G linked to dopamine D3 receptors in the dorsal striatum
controls dopamine release, ΔFos B expression, and locomotor activity after repeated cocaine administration. Neuroscience Letters, 541, 120–125.
Liu, Q. R., Canseco‐Alba, A., Zhang, H. Y., Tagliaferro, P., Chung, M., Dennis, E., … Onaivi, E. S. (2017). Cannabinoid type 2 receptors in dopamine neurons
inhibits psychomotor behaviors, alters anxiety, depression and alcohol preference. Scientific Reports, 7(1), 17410.
Lochner, A., & Moolman, J. A. (2006). The many faces of H89: A review. Cardiovascular Drug Reviews, 24(3–4), 261–274.
Lonart, G., Cassels, K. L., & Johnson, K. M. (1993). Nitric oxide induces calcium dependent [3H]dopamine release from striatal slices. Journal of
Neuroscience Research, 35, 192–198.
Ma, Z., Gao, F., Larsen, B., Gao, M., Luo, Z., Chen, D., … Wu, J. (2019). Mechanisms of cannabinoid CB2 receptor‐mediated reduction of dopamine neu‐
ronal excitability in mouse ventral tegmental area. EBioMedicine, 42, 225–237.
Marcellino, D., Carriba, P., Filip, M., Borgkvist, A., Frankowska, M., Bellido, I., … Fuxe, K. (2008). Antagonistic cannabinoid CB1/dopamine D2 receptor
interactions in striatal CB1/D2 heteromers. A combined neurochemical and behavioral analysis. Neuropharmacology, 54(5), 815–823.
Martel, P., Leo, D., Fulton, S., Berard, M., & Trudeau, L. E. (2011). Role of Kv1 potassium channels in regulating dopamine release and presynaptic D2
receptor function. PLoS ONE, 6(5), e20402.
Martinez‐Pinilla, E., Reyes‐Resina, I., Onatibia‐Astibia, A., Zamarbide, M., Ricobaraza, A., Navarro, G., … Franco, R. (2014). CB1 and GPR55 receptors are
co‐expressed and form heteromers in rat and monkey striatum. Experimental Neurology, 261, 44–52.
Matsuda, L. A., Bonner, T. I., & Lolait, S. J. (1993). Localization of cannabinoid receptor mRNA in rat brain. Journal of Comparative Neurology, 327(4),
535–550.
Mechoulam, R., & Parker, L. A. (2013). The endocannabinoid system and the brain. Annual Review of Psychology, 64, 21–47.
Moreno, E., Chiarlone, A., Medrano, M., Puigdellivol, M., Bibic, L., Howell, L. A., … Guzman, M. (2018). Singular location and signaling profile of adenos‐
ine A2A‐cannabinoid CB1 receptor heteromers in the dorsal striatum. Neuropsychopharmacology, 43(5), 964–977.
Munoz‐Arenas, G., Paz‐Bermudez, F., Baez‐Cordero, A., Caballero‐Floran, R., Gonzalez‐Hernandez, B., Floran, B., & Limon, I. D. (2015). Cannabinoid
CB1 receptors activation and coactivation with D2 receptors modulate GABAergic neurotransmission in the globus pallidus and increase motor
asymmetry. Synapse (New York, N. Y.), 69(3), 103–114.
Negrete, R., Hervera, A., Leanez, S., Martin‐Campos, J., & Pol, O. (2011). The antinociceptive effects of JWH‐015 in chronic inflammatory pain are
produced by nitric oxide‐cGMPPKG‐KATP pathway activation mediated by opioids. PLoS ONE, 6(10), e26688.
Pacchiana, R., Abbate, M., Armato, U., Dal Pra, I., & Chiarini, A. (2014). Combining immunofluorescence with in situ proximity ligation assay: A novel
imaging approach to monitor protein‐protein interactions in relation to subcellular localization. Histochemistry and Cell Biology, 142(5), 593–600.
Parent, A., & Hazrati, L. (1995). Functional anatomy of the basal ganglia. I. The cortico basal‐ganglia‐thalamo‐cortical loop. Brain Research Reviews, 20,
91–127.
Paxinos, G., & Watson, C. (1997). The rat brain in stereotaxic coordinates. San Diego, CA: Academic Press.
Pertwee, R. G., Howlett, A. C., Abood, M. E., Alexander, S. P., Di Marzo, V., Elphick, M. R., … Ross, R. A. (2010). International union of basic and clinical
pharmacology. LXXIX. Cannabinoid receptors and their ligands: Beyond CB(1) and CB(2). Pharmacological Reviews, 62(4), 588–631.
 |
20 of 20       LÓPEZ‐RAMÍREZ et al.

Przybyla, J. A., & Watts, V. J. (2010). Ligand‐induced regulation and localization of cannabinoid CB1 and dopamine D2L receptor heterodimers. Journal
of Pharmacology and Experimental Therapeutics, 332(3), 710–719.
Qian, W. J., Yin, N., Gao, F., Miao, Y., Li, Q., Li, F., … Wang, Z. (2017). Cannabinoid CB1 and CB2 receptors differentially modulate L‐ and T‐type Ca(2+)
channels in rat retinal ganglion cells. Neuropharmacology, 124, 143–156.
Rangel‐Barajas, C., Silva, I., Lopez‐Santiago, L. M., Aceves, J., Erlij, D., & Floran, B. (2011). L‐DOPA‐induced dyskinesia in hemiparkinsonian rats is as‐
sociated with up‐regulation of adenylyl cyclase type V/VI and increased GABA release in the substantia nigra reticulata. Neurobiology of Disease,
41(1), 51–61.
Reyes‐Resina, I., Navarro, G., Aguinaga, D., Canela, E. I., Schoeder, C. T., Zaluski, M., … Franco, R. (2018). Molecular and functional interaction between
GPR18 and cannabinoid CB2 G‐protein‐coupled receptors. Relevance in neurodegenerative diseases. Biochemical Pharmacology, 157, 169–179.
Rico, A. J., Dopeso‐Reyes, I. G., Martinez‐Pinilla, E., Sucunza, D., Pignataro, D., Roda, E., … Lanciego, J. L. (2017). Neurochemical evidence supporting
dopamine D1–D2 receptor heteromers in the striatum of the long‐tailed macaque: Changes following dopaminergic manipulation. Brain Structure
and Function, 222(4), 1767–1784.
Ross, R. A., Brockie, H. C., Stevenson, L. A., Murphy, V. L., Templeton, F., Makriyannis, A., & Pertwee, R. G. (1999). Agonist‐inverse agonist characteriza‐
tion at CB1 and CB2 cannabinoid receptors of L759633, L759656, and AM630. British Journal of Pharmacology, 126(3), 665–672.
Sable, R., Jambunathan, N., Singh, S., Pallerla, S., Kousoulas, K. G., & Jois, S. (2018). Proximity ligation assay to study protein-protein interactions of
proteins on two different cells. Biotechniques, 65(3), 149–157.
Sabol, B., Boldry, R., Farooqui, T., Chang, Y. A., Miller, D., & Uretsky, N. (1987). Effect of permanently charged and uncharged dopaminergic agonists on
the potassium-induced release of [3H]acetylcholine from striatal slices. Biochemical Pharmacology, 36(10), 1679–1685.
Sanchez‐Zavaleta, R., Cortes, H., Avalos‐Fuentes, J. A., Garcia, U., Segovia Vila, J., Erlij, D., & Floran, B. (2018). Presynaptic cannabinoid CB2 receptors
modulate [(3) H]‐Glutamate release at subthalamo‐nigral terminals of the rat. Synapse (New York, N. Y.), 72(11), e22061.
Sandor, N., Brassai, A., Puskas, A., & Lendvai, B. (1995). Role of nitric oxide in modulating neurotrasmitter release from rat striatum. Brain Research
Bulletin, 35(5), 483–486.
Saroz, Y., Kho, D. T., Glass, M., Graham, E. S., & Grimsey, N. L. (2019). Cannabinoid receptor 2 (CB2) signals via G‐alpha‐s and Induces IL‐6 and IL‐10
cytokine secretion in primary human leukocytes. ACS Pharmacology and Translational Science. https​://doi.org/10.1021/acspt​sci.9b00049
Schmitz, Y., Benoit‐Marand, M., Gonon, F., & Sulzer, D. (2003). Presynaptic regulation of dopaminergic neurotransmission. Journal of Neurochemistry,
87(2), 273–289.
Schmitz, Y., Lee, C. J., Schmauss, C., Gonon, F., & Sulzer, D. (2001). Amphetamine distorts stimulation‐dependent dopamine overflow: Effects on D2
autoreceptors, transporters, and synaptic vesicle stores. Journal of Neuroscience, 21(16), 5916–5924.
Sharp, T., Zetterstrom, T., Ljungberg, T., & Ungerstedt, U. (1986). Effect of sulpiride on amphetamine‐induced behaviour in relation to changes in striatal
dopamine release in vivo. European Journal of Pharmacology, 129(3), 411–415.
Shi, W. X., & Bunney, B. S. (1992). Roles of intracellular cAMP and protein kinase A in the actions of dopamine and neurotensin on midbrain dopamine
neurons. Journal of Neuroscience, 12(6), 2433–2438.
Shmist, Y. A., Goncharov, I., Eichler, M., Shneyvays, V., Isaac, A., Vogel, Z., & Shainberg, A. (2006). Delta‐9‐tetrahydrocannabinol protects cardiac cells
from hypoxia via CB2 receptor activation and nitric oxide production. Molecular and Cellular Biochemistry, 283, 75–83.
Sierra, S., Luquin, N., Rico, A. J., Gomez‐Bautista, V., Roda, E., Dopeso‐Reyes, I. G., … Lanciego, J. L. (2015). Detection of cannabinoid receptors CB1
and CB2 within basal ganglia output neurons in macaques: Changes following experimental parkinsonism. Brain Structure and Function, 220(5),
2721–2738.
Söderberg, O., Leuchowius, K. J., Gullberg, M., Jarvius, M., Weibrecht, I., Larsson, L. G., & Landegren, U. (2008). Characterizing proteins and their inter‐
actions in cells and tissues using the in situ proximity ligation assay. Methods, 45(3), 227–232.
Sterin‐Borda, L., Del Zar, C. F., & Borda, E. (2005). Differential CB1 and CB2 cannabinoid receptor‐inotropic response of rat isolated atria: Endogenous
signal transduction pathways. Biochemical Pharmacology, 69(12), 1705–1713.
Stoof, J. C., De Boer, T., Sminia, P., & Mulder, A. H. (1982). Stimulation of D2-dopamine receptors in rat neostriatum inhibits the release of acetylcholine
and dopamine but does not affect the release of gammaaminobutyric acid, glutamate or serotonin. European Journal of Pharmacology, 84(3–4),
211–214.
Vallone, D., Picetti, R., & Borrelli, E. (2000). Structure and function of dopamine receptors. Neuroscience & Biobehavioral Reviews, 24(1), 125–132. https​://
doi.org/10.1016/S0149-7634(99)00063-9
Xi, Z. X., Peng, X. Q., Li, X., Song, R., Zhang, H. Y., Liu, Q. R., … Gardner, E. L. (2011). Brain cannabinoid CB(2) receptors modulate cocaine's actions in
mice. Nature Neuroscience, 14(9), 1160–1166. https​://doi.org/10.1038/nn.2874
Yuan, H., Sarre, S., Ebinger, G., & Michotte, Y. (2005). Histological, bejavioral and neurochemical evaluation of medial forebrain bundle and striatal
6‐OHDA lesions as rat models of Parkinson's disease. Journal of Neuroscience Methods, 144, 35–45.
Zhang, H. Y., Bi, G. H., Li, X., Li, J., Qu, H., Zhang, S. J., … Liu, Q. R. (2015). Species differences in cannabinoid receptor 2 and receptor responses to
cocaine self‐administration in mice and rats. Neuropsychopharmacology, 40(4), 1037–1051. https​://doi.org/10.1038/npp.2014.297
Zhang, H. Y., Gao, M., Liu, Q. R., Bi, G. H., Li, X., Yang, H. J., … Xi, Z. X. (2014). Cannabinoid CB2 receptors modulate midbrain dopamine neuronal activ‐
ity and dopamine‐related behavior in mice. Proceedings of the National Academy of Sciences of the United States of America, 111(46), E5007–E5015.
Zhang, H. Y., Gao, M., Shen, H., Bi, G. H., Yang, H. J., Liu, Q. R., … Xi, Z. X. (2016). Expression of functional cannabinoid CB2 receptor in VTA dopamine
neurons in rats. Addiction Biology, 22(3), 752–765.
Zhu, X., & Luo, L. (1992). Effect of nitroprusside (nitric oxide) on endogenous dopamine release from rat striatal slices. Journal of Neurochemistry, 59(3),
932–935. https​://doi.org/10.1111/j.1471-4159.1992.tb083​32.x

How to cite this article: López‐Ramírez G, Sánchez‐Zavaleta R, Ávalos‐Fuentes A, et al. D2 autoreceptor switches CB2 receptor effects
on [3H]‐dopamine release in the striatum. Synapse. 2019;00:e22139. https​://doi.org/10.1002/syn.22139​