ISSN 0042-9007 (Print) Volume 117 Number 3 March 2022

ISSN 1423-0410 (Online)

The International Journal of Transfusion Medicine

IN THIS ISSUE
An intervention study for the prevention of vasovagal reactions
and evaluating donors’ experience: Analysis of donors’ return
for subsequent donation
Challenging the 30-min rule for thawed plasma
Haemolytic disease of the newborn: Improved prediction
by novel integration of causative and protective factors
in newborn and mother
Prevalence of iron deficiency and red blood cell transfusions
in surgical patients
 Vox Sanguinis
Internaঞonal Journal of Blood Transfusion
Official Journal of the International Society of Blood Transfusion
Founded 1956 by J. J. van Loghem, L. P. Holländer, J. Dausset, A. Hässig and J. Julliard (formerly Bulleঞn of the Central Laboratory of the Blood Transfusion Service of the Dutch Red
Cross, founded 1951)

Editor-in-Chief
Miquel Lozano, Barcelona, Spain

Section Editors
Blood Component Collection and Production International Forum
Denese C. Marks, Sydney, Australia Nancy M. Dunbar, Lebanon, NH, USA
Cellular Therapy Patient Blood Management
Zbigniew ‘Ziggy’ M. Szczepiorkowski, Lebanon, NH, USA Nelson Tsuno, Tokyo, Japan
Donors and Donations Reviews
Katja van den Hurk, Amsterdam, the Netherlands Zbigniew ‘Ziggy’ M. Szczepiorkowski, Lebanon, NH, USA
Haemovigilance Leo van de Watering, Amsterdam, the Netherlands
Claudia Cohn, Minneapolis, MN, USA Transfusion Medicine and New Therapies
Immunohaematology and Immunogenetics Pierre Tiberghien, Paris, France
Jill R. Storry, Lund, Sweden Transfusion-transmitted Disease and its Prevention
Clive Seed, Perth, Australia

Editorial Board
Arwa Al-Riyami, Muscat, Oman Wolfgang R. Mayr, Vienna, Austria
Claire Armour Barrett, Bloemfontein, South Africa Pieter van der Meer, Amsterdam, the Netherlands
Thierry Burnouf, Taipei, Taiwan Celina Montemayor, Toronto, Canada
Andreas Buser, Basel, Switzerland Shirley Owusu-Ofori, Kumasi, Ghana
Marcela Contreras, London, UK Luca Pierelli, Rome, Italy
Dana Devine, Vancouver, Canada France Pirenne, Créteil, France
Hendrik Feys, Mechelen, Belgium Sandra Ramirez, Ottawa, Canada
Ruchika Goel, Springfield, IL, USA Veera Sekaran Nadarajan, Kuala Lumpur, Malaysia
Salwa Hindawi, Jeddah, Saudi Arabia Rattiram Sharma, Chandigarh, India
Yanli Ji, Guangzhou, China Eilat Shinar, Ramat Gan, Israel
Micky Koh, London, UK Claude Tayou Tagny, Yaounde, Cameroon
Linda Larsson, Stockholm, Sweden Vip Viprakasit, Bangkok, Thailand
Bridon M’Baya, Blantyre, Malawi Silvano Wendel, São Paulo, Brazil

Scientific/Medical Illustrator Editorial Office

Alison Schroeer, Thompson, CT, USA Maria Davie, Edinburgh, UK
Technical Editor Production Editor
Doug Huestis, Tucson, AZ, USA Shirley Villeza, Manila, the Philippines

ISBT Standing Committee on Vox Sanguinis Past Editors-in-Chief

Gwen Clarke, Chairperson, Edmonton, Canada J. J. van Loghem, 1956–1960
Lin Fung, Brisbane, Australia W. H. Crosby, 1960–1963 (N. and S. America)
Eric Jansen, Amsterdam, the Netherlands L. P. Holländer, 1960–1970 (Europe)
Diana Teo, Singapore F. H. Allen, 1963–1977 (N. and S. America)
Miquel Lozano, Editor-in-Chief, Barcelona, Spain M. G. Davey, 1970–1980 (Africa, Asia and Australia)
N. R. Rose, 1977–1980 (N. and S. America)
Observers
C. P. Engelfriet, 1977–1996
Erica Wood, ISBT President, Melbourne, Australia
M. Contreras, 1996–2003
Jenny White, ISBT Executive Director, Amsterdam,
W. R. Mayr, 2003–2011
the Netherlands
D. Devine, 2011–2020
Claire Dowbekin, Publishing Manager, Wiley, Oxford, UK
 Vox Sanguinis
Internaঞonal Journal of Blood Transfusion
Aims and Scope
Vox Sanguinis reports on all issues related to transfusion medicine, from donor vein to recipient vein, including cellular therapies. Comments, reviews, original articles,
short reports and international fora are published, grouped into 10 main sections:
1. Blood Component Collection and Production: Blood collection methods and devices (including apheresis); blood component preparation; inventory management;
collection and storage of tissues; quality management and good manufacturing practice; automation and information technology; plasma fractionation techniques
and plasma derivatives;
2. Cellular Therapy: Cell-based therapies; CAR T-cell therapies; genetically modified cell therapies; cellular therapy (sources; products; processing and storage); stem
cells; cell-based regenerative medicine; cellular immunotherapy; molecular therapy;
3. Donors and Donations: Donor recruitment and retention; donor selection; donor health
4. Haemovigliance: Adverse events in blood and blood component donors and transfusion recipients; corrective and preventive measures of complications; near-misses
and errors in the transfusion chain; evaluation and outcomes of adverse events
5. Immunohaematology and Immunogenetics: autoimmunity in haematology; alloimmunity of blood; pre-transfusion testing; complement in immunohaematology;
blood phenotyping and genotyping; genetic markers of blood cells and serum proteins: polymorphisms and function; parentage testing and forensic
immunohaematology;
6. International Forum: Section in which topics related to any aspects of the transfusion chain (from technical to scientific, including socioeconomic and ethical facets)
are discussed by invited participants and summarized by guest editors
7. Patient Blood Management: Bloodless surgery; preoperative anaemia; minimizing blood loss during surgery; alternatives to blood transfusion;
8. Review: Comprehensive reviews or short comments of any aspect related to transfusion medicine;
9. Transfusion Medicine: Transfusion indication, transfusion practice, thresholds and audits; transfusion efficacy assessment, clinical trials; therapeutic apheresis;
10. Transfusion-transmitted Disease and its Prevention: Identification and epidemiology of infectious pathogens transmissible by blood; donor testing for transfusion-
transmissible infectious pathogens; bacterial contamination of blood components; pathogen inactivation;
This comprehensive coverage has made the journal essential reading for a wide range of specialists interested in the present state of transfusion research and practice.
Journal Customer Services
For ordering information, claims and any enquiry concerning your journal subscription please go to https://hub.wiley.com/community/ support/onlinelibrary or contact
your nearest office. Americas: Email: cs-journals@wiley.com; Tel: +1 781 388 8598 or +1 800 835 6770 (toll free in the USA & Canada). Europe, Middle East and Africa:
Email: cs-journals@wiley.com; Tel: +44 (0) 1865 778315. Asia Pacific: Email: cs-journals@wiley.com; Tel: +65 6511 8000. Japan: For Japanese-speaking support, Email: cs-
japan@wiley.com. Visit our Online Customer Help at https://hub.wiley.com/community/support/ onlinelibrary.
Information for Subscribers: Vox Sanguinis is published in 12 issues per year. Institutional subscription prices for 2022 are: Print & Online: US$2196 (US), US$2560 (Rest
of World), €1533 (Europe), £1189 (UK). Prices are exclusive of tax. Asia-Pacific GST, Canadian GST/HST and European VAT will be applied at the appropriate rates. For more
information on current tax rates, please go to www. wileyonlinelibrary.com/ tax-vat. The price includes online access to the current and all online backfiles to 1 January 2018,
where available. For other pricing options, including access information and terms and conditions, please visit www.wileyonlinelibrary.com/access.
Delivery Terms and Legal Title: Where the subscription price includes print issues and delivery is to the recipient’s address, delivery terms are Delivered at Place (DAP);
the recipient is responsible for paying any import duty or taxes. Title to all issues transfers FOB our shipping point, freight prepaid. We will endeavour to fulfil claims
for missing or damaged copies within six months of publication, within our reasonable discretion and subject to availability.
Back Issues: Single issues from current and recent volumes are available at the current single issue price from cs-journals@wiley.com. Earlier issues may be obtained from
Periodicals Service Company, 351 Fairview Avenue – Ste 300, Hudson, NY 12534, USA. Tel: +1 518 822-9300, Fax: +1 518 822-9305, Email: psc@periodicals.com
Abstracting and Indexing Services: The Journal is indexed by Abstracts in Anthropology (Sage); Abstracts on Hygiene & Communicable Diseases (CABI); Academic Search
(EBSCO Publishing); Academic Search Alumni Edition (EBSCO Publishing); Academic Search Premier (EBSCO Publishing); AGRICOLA Database (National Agricultural
Library); BIOBASE: Current Awareness in Biological Sciences (Elsevier); Biological Abstracts (Clarivate Analytics); BIOSIS Previews (Clarivate Analytics); CAB Abstracts®
(CABI); CABDirect (CABI); CAS: Chemical Abstracts Service (ACS); CSA Biological Sciences Database (ProQuest); CSA Environmental Sciences & Pollution Management
Database (ProQuest); CSA Virology & AIDS Abstracts (ProQuest); Current Contents: Life Sciences (Clarivate Analytics); Embase (Elsevier); Global Health (CABI); HEED:
Health Economic Evaluations Database (Wiley-Blackwell); Index Veterinarius (CABI); Journal Citation Reports/Science Edition (Clarivate Analytics); MEDLINE/PubMed
(NLM); Nutrition Abstracts & Reviews Series A: Human & Experimental (CABI); Pig News & Information (CABI); ProQuest Central (ProQuest); ProQuest Health & Medical
Complete (ProQuest); ProQuest Research Library (ProQuest); Protozoological Abstracts (CABI); PubMed Dietary Supplement Subset (NLM); Review of Medical &
Veterinary Entomology (CABI); Review of Medical & Veterinary Mycology (CABI); Rural Development Abstracts (CABI); Science Citation Index (Clarivate Analytics);
Science Citation Index Expanded (Clarivate Analytics); Tropical Diseases Bulletin (CABI); Veterinary Bulletin (CABI).
Copyright and Copying (in any format): Copyright © 2022 International Society of Blood Transfusion. All rights reserved. No part of this publication may be reproduced,
stored or transmitted in any form or by any means without the prior permission in writing from the copyright holder. Authorization to copy items for internal and personal
use is granted by the copyright holder for libraries and other users registered with their local Reproduction Rights Organisation (RRO), e.g. Copyright Clearance Center
(CCC), 222 Rosewood Drive, Danvers, MA 01923, USA (www.copyright.com), provided the appropriate fee is paid directly to the RRO. This consent does not extend to other
kinds of copying such as copying for general distribution, for advertising or promotional purposes, for republication, for creating new collective works or for resale.
Permissions for such reuse can be obtained using the RightsLink “Request Permissions” link on Wiley Online Library. Special requests should be addressed to: permissions@
wiley.com
Open Access: Vox Sanguinis accepts articles for Open Access publication. Please visit https://onlinelibrary.wiley.com/page/journal/14230410/homepage/fundedaccess.
html for further information about Open Access.
Copyright Policy: Papers accepted must be licensed for publication in Vox Sanguinis and a completed Copyright Transfer Agreement Form must accompany
every accepted paper. Authors will be required to license copyright in their paper to John Wiley & Sons Ltd. Upon acceptance of an article, corresponding authors
must log into Author Services to complete the licence agreement of their paper.
Wiley’s Corporate Citizenship initiative seeks to address the environmental, social, economic, and ethical challenges faced in our business and which are important to our
diverse stakeholder groups. Since launching the initiative, we have focused on sharing our content with those in need, enhancing community philanthropy, reducing our
carbon impact, creating global guidelines and best practices for paper use, establishing a vendor code of ethics, and engaging our colleagues and other stakeholders in our
efforts. Follow our progress at www.wiley.com/go/citizenship. Wiley is a founding member of the UN-backed HINARI, AGORA, and OARE initiatives. They are now
collectively known as Research4Life, making online scientific content available free or at nominal cost to researchers in developing countries. Please visit Wiley’s Content
Access – Corporate Citizenship site: http://www.wiley.com/WileyCDA/Section/id-390082.html. The journal to which you are submitting your manuscript employs a
plagiarism detection system. By submitting your manuscript to this journal you accept that your manuscript may be screened for plagiarism against previously published
works.
Disclaimer: The Publisher, International Society of Blood Transfusion and Editors cannot be held responsible for errors or any consequences arising from the use of
information contained in this journal; the views and opinions expressed do not necessarily reflect those of the Publisher or the International Society of Blood Transfusion
and Editors, neither does the publication of advertisements constitute any endorsement by the Publisher or the International Society of Blood Transfusion and Editors of
the products advertised.
VOX SANGUINIS (Online ISSN: 1423-0410 Print ISSN: 0042-9007) is published monthly. US mailing agent: Mercury Media Processing, LLC, 1850 Elizabeth Avenue, Suite
#C, Rahway, NJ 07065 USA. Periodical postage paid at Rahway, NJ. Postmaster: Send all address changes to VOX SANGUINIS, John Wiley & Sons Inc., C/O The Sheridan
Press, PO Box 465, Hanover, PA 17331, USA. For submission instructions, subscription and all other information visit: www.wileyonlinelibrary.com/journal/vox. Printed
in Singapore by C.O.S. Printers Pte Ltd.

117/3/2022
Contents
Review
299 Transfusion management of trauma from the
2019 El Paso mass shooting incident J. Qiao,
B. Ray, F. Wians & J. Abadie
Original Articles
Donors and Donations
313 An intervention study for the prevention of
vasovagal reactions and evaluating donors’
experience: Analysis of donors’ return for
subsequent donation J. Wiersum-Osselton,
F. Prinsze, E. van den Brekel, A. van Dongen,
F. Hermans, A. Bokhorst & T. Marijt-van der Kreek
321 The new donor vigilance system in Denmark reveals
regional differences in adverse reactions
supposedly caused by variation in the registration
C. Mikkelsen, H. M. Paarup, M. T. Bruun,
L. Ø. Pedersen, S. Hasslund, R. Larsen, B. Aagaard &
B. S. Sørensen
Blood Component Collection and Production
328 Challenging the 30-min rule for thawed plasma
S. Ramirez-Arcos, A. Howell, J. Bearne, V. Bhakta,
L. Bower, R. Cardigan, M. Girard, Y. Kou,
C. McDonald, M.-È. Nolin, D. Sawicka &
W. Sheffield
337 A pilot randomized clinical trial of cryopreserved
versus liquid-stored platelet transfusion for
bleeding in cardiac surgery: The cryopreserved
versus liquid platelet-New Zealand pilot trial
S. McGuinness, R. Charlewood, E. Gilder, R. Parke,
K. Hayes, S. Morley, A. Al-Ibousi, R. Deans, B. Howe,
L. Johnson, D. C. Marks & M. C. Reade Australian
and New Zealand College of Anaesthetists Clinical
Trials Network Australian and New Zealand
Intensive Care Society Clinical Trials Group
Transfusion-transmitted Disease and its Prevention
346 Evaluation of the Sysmex XN-31 automated
analyser for blood donor malaria screening at
Malawi Blood Transfusion Services B. M’baya,
T. Mfune, A. Samon, T. Hwandih & M. Münster
Transfusion Medicine and New Therapies
354 Time–temperature indicators versus temperature
indicators for transfusion practice: Application in
the real hospital setting M. Park, M. Hur, H. Kim,
K. Oh, D.-H. Ko & Y. Chung
This journal is available online at Wiley Online Library.
Visit wileyonlinelibrary.com to search the articles
and register for table of contents e-mail alerts.
Vox Sanguinis (2022) 117, 295–464
© 2022 International Society of Blood Transfusion
361 Plasma, platelet and red blood cell transfusion ratios
for life-threatening non-traumatic haemorrhage in
medical and post-surgical patients: An
observational study L. J. Matzek, E. B. Kurian,
R. D. Frank, T. J. Weister, O. Gajic, D. J. Kor &
M. A. Warner
371 Differential effects of speed and volume on
transfusion-associated circulatory overload:
A randomized study in rats R. B. Klanderman,
M. Wijnberge, J. J. Bosboom, J. J. T. H. Roelofs,
D. de Korte, R. van Bruggen, M. W. Hollmann,
M. B. Vroom, D. P. Veelo, N. P. Juffermans,
B. F. Geerts & A. P. J. Vlaar
379 Prevalence of iron deficiency and red blood cell
transfusions in surgical patients R. P. B. Tonino,
M. Wilson, J. J. Zwaginga & M. R. Schipperus
386 Psychological intervention in children with
transfusion-dependent β-thalassaemia M. Wang,
M. Huang & Y. Hong
393 Profile of the single-use, multiple-pass protein
A adsorber column in immunoadsorption
N. Schossee, G. Veit, J. Gittel, J. Viebahn,
M. Niklaus, P. Klingler, N. Üçeyler, E. Klinker,
A. Kobsar, M. Boeck & J. Koessler
Immunohaematology
399 Comparison between tube test and automated
column agglutination technology on VISION Max
for anti-A/B isoagglutinin titres: A multidimensional
analysis M. Nam, M. Hur, H. Lee, H. Kim, M. Park,
H.-W. Moon & Y.-M. Yun
408 Transfusion requirements and alloimmunization to
red blood cell antigens in orthotopic liver
transplantation A. Uzuni, J. El-Bashir, D. Galusca,
S. Yeddula, S. Nagai, A. Yoshida, M. S. Abouljoud &
Z. K. Otrock
415 ABO haemolytic disease of the newborn:
Improved prediction by novel integration of
causative and protective factors in newborn
and mother G. R. Krog, H. Lorenzen, F. B. Clausen,
A. T. Hansen, M. L. Donneborg &
M. H. Dziegiel
424 Molecular blood group screening in Omani
blood donors A. Z. Al-Riyami, D. Al Hinai,
M. Al-Rawahi, S. Al-Hosni, S. Al-Zadjali,
A. Al-Marhoobi, M. Al-Khabori, H. Al-Riyami &
G. A. Denomme
t
ea
n lin
a lo vo
x
ou
rn
n al/
i sj jo ur
th m/
w
co
Vie y.
r ar
lib
li ne
on
ley
wi
Contents
431 Human neutrophil antigen 2 sequence-based
typing: Joining the hunt for the CD177 answer
T. Browne, E. Wroe, L. Keen & A. Poles
Short Reports
438 Babesia microti in a Canadian blood donor and
lookback in a red blood cell recipient S. J. Drews,
P. Van Caeseele, J. Bullard, L. R. Lindsay, T. Gaziano,
M. P. Zeller, D. Lane, M. Ndao, V. G. Allen,
A. K. Boggild, S. F. O’Brien, D. Marko, C. Musuka,
M. Almiski & M. Bigham
442 Sequence variants in the proximal promoter and
+5.8-kb site of ABO in Koreans with weak
B phenotypes H. Yu, T. Y. Kim, S. J. Moon,
Y. N. Chung, H. J. Yoo, J. H. Kim & D. Cho
International Forum
447 International Forum on Gender Identification and
Blood Collection: Summary S. Pandey, J. B. Gorlin,
M. Townsend, N. Van Buren, J. N. S. Leung, C.-k. Lee,
K. van den Hurk, N. Casamitjana, R. Valles, E. Alonso,
Y. M. Miller, P. Richard, G. Woimant, P. Tiberghien,
E. Zhiburt, T. Butler-Foster, M. Goldman,
L. S. H. Nissen-Meyer, A. Espinosa, H. Kamel,
M. Bravo, L. A. Filho, M. Pecego, M. Germain,
I. Rabusseau, E. Shinar, H. Raz, N. Choudhury,
N. Bhatnagar, K. Hurt, M. Lopez, R. A. Reik, Y. Nie,
Y. Hung, L. Pheello & N. Dunbar
e21 International Forum on Gender Identification and
Blood Collection: Responses S. Pandey, J. B. Gorlin,
M. Townsend, N. Van Buren, J. N. S. Leung, C.-k. Lee,
K. van den Hurk, N. Casamitjana, R. Valles, E. Alonso,
Y. M. Miller, P. Richard, G. Woimant, P. Tiberghien,
E. Zhiburt, T. Butler-Foster, M. Goldman,
L. S. H. Nissen-Meyer, A. Espinosa, H. Kamel,
M. Bravo, L. A. Filho, M. Pecego, M. Germain,
I. Rabusseau, E. Shinar, H. Raz, N. Choudhury,
N. Bhatnagar, K. Hurt, M. Lopez, R. A. Reik, Y. Nie,
Y. Hung, L. Pheello & N. Dunbar
Letters to the Editor
457 ABO blood type analysis of the donors of
convalescent plasma after COVID-19 infection in
Chelyabinsk region, Russia A. A. Krokhin,
M. N. Rusakov, S. V. Belyaeva, A. Galkin &
T. A. Suslova
459 Appropriately specifying the quality of plasma for
fractionation A. Farrugia
460 Reply to Farrugia: Appropriately specifying the
quality of plasma for fractionation J. Siekmann,
A. Weber, C. Bauer & P. L. Turecek
462 Diary of Events
Received: 10 May 2021 Revised: 31 August 2021 Accepted: 6 September 2021

DOI: 10.1111/vox.13206

REVIEW ARTICLE

Transfusion management of trauma from the 2019

El Paso mass shooting incident

Jesse Qiao1 | Bradford Ray2 | Frank Wians1 | Jude Abadie1

1
Department of Pathology, Paul L. Foster
School of Medicine, Texas Tech University
Health Sciences Center, El Paso, TX, USA
2
Patient Blood Management and Research,
University Medical Center, El Paso, TX, USA
Correspondence
Jesse Qiao, Department of Pathology, Texas
Tech University Health Sciences Center,
El Paso, TX 79905, USA.
Email: jesse.qiao@ttuhsc.edu
Funding information
None.
Abstract
Background and Objectives: Mortality rates, transfusion ratios, trauma management
logistics, and assault characteristics from the El Paso mass shooting incident (MSI)
are evaluated in comparison to other MSIs. In 2019, El Paso, TX experienced the
eighth-deadliest MSIs in modern US history. In this 21st mass killing in the
United States of 2019, 19 people died immediately, and four of 27 injured, later died
from ballistic injuries.
Materials and Methods: We examined the victims’ injuries, pre-hospital treatments,
transfusions, rotational thromboelastometry (ROTEM) interpretation, tranexamic acid
(TXA) use, and compared El Paso’s outcomes with other MSIs.
Results: Fifteen casualties were treated for bullet injuries at University Medical
Center (UMC). Three were in critical condition; one died during surgery. Of the
remaining victims, two were guarded, and the remaining ten in stable condition. Anatomic
trauma locations included chest, abdomen, hip, breast, thigh and arm. Haemostatic agents
and TXA were administered to arriving patients. Seven casualties receiving blood products
were administered 95 units at UMC (45 red blood cells [RBC], 38 fresh frozen plasma
[FFP], 8 platelets and 4 cryoprecipitate). ROTEM guided mass transfusion decisions in
three patients. Out of seven MSIs reviewed, El Paso had the highest mortality rate (50.0%)
and lowest RBC:FFP:admission ratio (1.18 at UMC).
Conclusion: We report the greatest proportion of transfusions per admission for an
MSI and are first to discuss ROTEM roles to guide transfusion and manage
coagulopathy during an MSI. This case highlights the severity and impact of MSIs on
victims and requirements to follow established transfusion protocols with adjunct
use of ROTEM, TXA and haemostatic agents.

KEYWORDS
mass trauma, patient blood management, shooting, transfusion challenges, viscoelastic testing

I N T R O D U CT I O N military-grade, semi-automatic rifle, initially within the parking lot of

On 3 August 2019, El Paso, TX, experienced the deadliest mass shoot-
ing in the United States of that year and tied the 6th deadliest ever,
which was documented in Killeen, TX in 1991 [1, 2]. Just before
10:40 AM on 3 August 2019, a lone gunman began discharging a
an El Paso Walmart and subsequently inside the store for 6 min. Firing
apparently indiscriminately, he killed 19 people immediately and
injured 27 others, three of whom died shortly after trauma centre
admission. The fourth person of the 27 injured died after a lengthy
hospitalisation. Figure 1 summarises the disposition of patients injured

Vox Sanguinis. 2022;117:299–312. wileyonlinelibrary.com/journal/vox © 2021 International Society of Blood Transfusion. 299
300
F I G U R E 1 Disposition of patients admitted following the mass shooting incident in El Paso. Patient-specific transfusion data from local Level
2 trauma centre are not available. F, female; GSWs, gunshot wounds; M, male
in the mass shooting incident (MSI) who were admitted to the El Paso
University Medical Center (UMC).
This incident meets the WHO definition of a mass casualty inci-
dent (MCI), described by events resulting in more patients at a given
time who can be reasonably managed with available local resources
and routine procedures [3]. MCIs are further defined as requiring
exceptional emergency logistical support, including notifying hospitals
of incoming MCIs in order to prepare for and anticipate use of trauma
packs in massive transfusion settings. While some institutions define
massive transfusion as 10 or more units of packed red blood cells
(pRBCs) administered during 24 h [4], another definition pertinent to
trauma and acute haemorrhage suggests using 10 or more units of
pRBCs administered from the emergency department to intensive
care unit (ICU) admission, including usage from immediate surgical
intervention [5]. Physician activation of massive transfusion protocols
(MTP) occurs when patients present with systolic blood pressures less
than or equal to 90 mmHg, heart rates greater than 120 beats per
minute, positive FAST sign, persistent haemodynamic instability and
active bleeding.
Civilian MSIs introduce battlefield theatre challenges to domestic
trauma care systems more consistent with what might be expected in
military combat operations. Furthermore, American surgeons serving
in battlefield locations during wartime have historically utilised their
experiences derived from military medicine and transferred those
experiences into the advancement of civilian care [4]. Fundamental
lessons learned by surgeons during wartime trauma management have
translated into favourable outcomes for patients injured in MSIs.
QIAO ET AL.
These outcomes continue to rely on critical response times and clini-
cal intervention protocols, including patient blood management.
In this case report, we describe demographics, injury mechanisms,
use of blood products, viscoelastic testing (VET), and outcomes for
the 15 patients admitted to the El Paso UMC Level 1 trauma centre
as a result of this MSI. Additionally, we compare transfusion statistics
of this MSI with that of six other large-scale civilian MSIs that
occurred during the last 20 years in three US locations. Further, these
comparisons are made with MSIs from post-industrial countries who
possess sophisticated healthcare systems.
M A T E R I A L S A N D M ET H O D S
This study was approved by the UMC El Paso Institutional Review
Board. For the 15 trauma patients admitted to UMC, the collected
data included patient demographics, injury characteristics, transport
mechanisms and trauma centre interventions. Additional outcome
data were obtained from the Trauma Registry, Blood Bank product
issue database, Vitalant records, as well as individual patient electronic
medical records. Injury severity scores (NISS), assigned upon arrival
and were obtained directly from the UMC Trauma Registry.
UMC is a College of American Pathologists and American College
of Surgeons accredited Level 1 trauma centre, operating with
354 licensed beds, 6 trauma bays in the emergency department, and
full blood bank support. The trauma centre is affiliated with Texas
Tech Health Sciences Center El Paso, with 100% of blood bank
MASS SHOOTING INCIDENT IN EL PASO TX
product inventory supplied by a national blood supplier (Vitalant).
Orders for additional blood products typically occur within 1 h of
request. UMC blood bank inventories are routinely managed within
the following parameters: RBCs (100 O-positive, 60 A-positive, 15
O-negative and 4 A-negative units); FFP (30 of each type [O, A, B and
AB]); platelets (PLT; 4 apheresis units); cryoprecipitate (CRYO; five
doses, each dose contains two of pooled CRYO units from five
individuals = total of 10 pooled units per dose). While UMC does not
currently have liquid plasma in the inventory, 5-day thawed plasma is
readily available for acute mass transfusions early in the course of
trauma resuscitation.
When notified of a Level 1 trauma, healthcare teams responding
at UMC include surgery, anaesthesia, blood bank, phlebotomy, radiol-
ogy and patient blood management consultation. Subsequently,
attending physicians in emergency medicine and surgery departments
activate MTP. As part of the routine inventory, UMC blood bank
continuously maintains a trauma box containing 4 units of group
O-positive pRBCs, 2 units of O-negative RBCs (reserved for patients
under 18 and childbearing-age females with unknown or negative Rh
type), and 4 units of thawed AB FFP. These products are administered
within minutes after patient arrival. Additional FFP are thawed imme-
diately upon activation of MTP (20 min in a 37 C water bath). Each
validated cooler is maintained at room temperature and contains
4 RBCs and 4 FFPs with 1 apheresis PLT dose (equivalent to pool of
six random donor PLT concentrates). CRYO (each dose contains two
of five pooled CRYO units for a total of 10 units per dose) is issued as
needed. The UMC’s mass transfusion policy is provided in Supplemen-
tal Document 1.
There is increasing support for the use of tranexamic acid (TXA) and
viscoelastic testing in managing trauma patients [6–11], including a system-
atic review of their use in paediatric trauma [12]. Thromboelastrography
(TEG) and thromboelastometry (TEM) are two distinct but frequently used
VET methods for ex vivo haemostatic analysis [13]. UMC integrated the
clinical use of rotational thromboelastometry (ROTEM: Instrumentation
Laboratories, ROTEM® delta) and TXA as part of the trauma management
at our institution, beginning in 2015. UMC policy states that anaesthesia
staff is responsible for administering the first dose of TXA, as required upon
trauma patient arrival. While ROTEM is not solely used to activate or dis-
continue MTPs (at the discretion of the attending physician), it is routinely
used for UMC Level 1 trauma patients to assess coagulation and guide
transfusion therapy [14]. While the blood bank is one floor directly below
trauma, the remainder of the UMC laboratory is approximately 3-min (walk)
from the main hospital. This presents a challenge when delivering routine
coagulation testing during an ongoing trauma. Two ROTEM instruments
are operated from the main laboratory, and initial results are usually avail-
able within 12–15 min (10 min run time with less than 5 min transport with
a dedicated specimen courier) for remote viewing by trauma surgeons.
UMC’s decision to incorporate thromboelastometry (ROTEM) is based on
its rapid result-time compared to traditional coagulation tests that can take
up to 60 min and more robust result reports compared to a single point-of-
care prothrombin time test (average of 25 min turnaround time) [15].
Furthermore, VET methodologies (i.e., TEG and TEM) can support
301
subsequent guidance of antifibrinolytic treatment by TXA and can detect
hyperfibrinolysis [13], which may not be rapidly identified using conven-
tional coagulation tests.
Variables for the El Paso MSI include: age and gender of victims,
pre-hospital haemostatic treatments, trauma level, injury severity
score at admission, use of TXA, number of surgical procedures, use of
ROTEM to guide transfusion strategy, activation of MTP, length
of stay (LOS-intensive care unit and total), days on ventilator, sites(s)
of injury, estimated blood loss 24 h post-arrival, blood components
transfused (RBCs, plasma, PLT and CRYO doses, uncrossmatched
RBCs, group O RBCs to non-group O patients), blood components
issued but not transfused, patients’ 24-h condition and discharge
disposition.
Peer-reviewed, scientific publications pertaining to MSIs were
identified by a literature search using key words and phrases such as
‘shooting’, ‘mass shooting casualty’, ‘blood component transfusion’,
and ‘severe trauma’. An in-depth review was conducted for a subset
of the identified publications (n = 24) deemed to be consistent with
an MSI, meeting WHO criteria. These publications spanned a 12-year
period and provided the most complete and applicable information to
the central, broad topic of MSIs with available transfusion statistics.
From these publications, demographic and transfusion variables on
MSIs were selected for comparison between casualties admitted dur-
ing previous MSIs worldwide. This study/analysis excluded MSI
reports with no transfusion data.
We evaluated publications summarising six (6) MSIs that contain
transfusion data (3 in the United States and 3 outside the
United States), between 1999 and 2019 (total no. of sites including
the El Paso MSI: 7). The variables compared included fatalities, inju-
ries, hospital admissions, fatality rate, type of weapon used by the
shooter, average number of wounds per deceased (if known), esti-
mated proximity of the shooter to the victims and blood component
transfusion statistics with ratios per admission. Transfusion ratios are
determined using a 6:6:1 ratio of transfused RBC to FFP to apheresis
PLT dose (in accordance with the 1:1:1 ratio as defined in the
PROPPR trial [16]). The El Paso MSI data include total transfusion and
admission statistics from UMC and the local Level 2 trauma centre.
RE SU LT S
UMC’s experience with trauma and transfusions
pertaining to the MSI
Table 1a,b presents patient demographic, pre-hospital admission
course and treatment, number of surgical procedures performed per
patient, and total hospital LOS for the 15 casualties treated at UMC
El Paso.
After being notified about the MSI from emergency personnel,
the UMC surgery department strategically placed haemostatic agents
in a centrally designated hallway location, allowing circulating nursing
staff easy access to supplies as needed. After being notified of the
TABLE 1 Demographic, injury and transfusion data of the victims of the El Paso, TX mass shooting incident
302

(a)

PHA PHA Arrival time to No. surgical

Pat. Age, Sex, TQ HA UMC/EPCH Min. To Trauma Admin procedures ROTEM-guided Tx MTP ICU VENT Total
No. years M/F used? used? (<18 years) arrival level TXA? performed strategy used? activation? LOS, d LOS, d LOS, d
1 24 F Yes 11:25 AM 40 L1 (Exp) 1 0
2 <1 M 11:22 AM 37 L2 0 <0.5
3 9 F 11:07 AM 22 L1 1 0.5
4 87 F 11:22 AM 37 L1 1 5 11
5 62 F 11:14 AM 29 L1 1 3 15
6 50 M Yes 11:28 AM 43 L2 1 3 12
7 33 M Yes Yes 11:23 AM 38 L1 Yes 2 Yes Yes 17 8 43
8 33 F Yes 11:29 AM 44 L1 Yes 2 Yes 18 10 20
9 48 M Yes 11:17 AM 32 L1 Yes 2 Yes Yes 11 8 63
10 50 F Yes 11:11 AM 26 L1 2 14
11 38 F 11:33 AM 48 L3 1 3
12 34 F 11:03 AM 18 L3 1 4
13 31 F 11:28 AM 43 L3 (Dchg) 1 0.5
14 34 F 11:35 AM 50 L3 (Dchg) 1 0.5
15 71 F Yes Next day transfer Next day L3 1 6

(b)

Patient’s Bld product(s) administered, units Patient’s

NISS at Est. blood Patient’s condition condition
Pat no. admission Location of injury loss, mla RBC FFP PLT CRYO at 24 h post-admission at dischargeb
c
1 27 Upper chest 3000 2 Critical Expired
2 3 Minor fractures 0 Stable Alive
3 3 Lt gluteal muscle 20 Stable Alive
4 10 Lt humerus fracture 20 2 Stable Alive
5 22 Chest, Lt side 920 4 5 1 Guarded Alive
6 17 Abdomen and Rt axilla 125 Critical Alive
7 38 Chest, abdomen, upper thigh 550 22 18 4 2 Guarded Alive
8 22 Rt hip and abdomen 800 4 4 1 Critical Alive
9 48 Chest and abdomen 1000 11 11 2 2 Stable Alive
10 2 Rt breast and thumb Minimal Stable Alive
11 2 Rt ankle 60 Stable Alive
(Continues)
QIAO ET AL.
 MASS SHOOTING INCIDENT IN EL PASO TX 303

incoming MSI, the UMC blood bank initiated plasma thaw procedures

to hospital arrival; MTP, massive transfusion protocol; NISS, new injury severity score; No., number; Pat., patient; PHA, pre-hospital admission; ROTEM, rotational thromboelastometry; Rt, right; TQ, tourniquet;
Torniquets); ICU, intensive care unit; L, (trauma) level (1, 2, or 3); LOS, length of stay; Lt, left; M, male; Med/Surg, medical-surgical hospital unit; Min. to arrival, time interval between the MSI event at 10:40 AM
at dischargeb

Abbreviations: admin, administered; Bld, blood; d, days; Dchg, discharged same day; EPCH, El Paso Children’s Hospital; Est., estimated; Exp, expired; F, female; HA, haemostatic agent (QuikClot, HemCon, CAT
and were in continuous communication with both trauma and the

condition
Patient’s

No severe, disabling complications such as limb loss or loss of physical functional status noted upon follow-up. No transfusion reactions or subsequent development of red blood cell alloantibodies noted.
local blood supplier (Vitalant). The patients ranged in age from <1 year

Alive
Alive
Alive
Alive
to 71 years old. Prior to hospital admission, a tourniquet was applied
to three patients. The strategically placed haemostatic agents (CAT
Tourniquets, QuikClot and HemCon), placed in one designated hall-
way, were administered to three patients upon hospital arrival; TXA
at 24 h post-admission

was administered to five patients immediately upon arrival to the hos-

Patient’s condition

pital. Blood products were not available on ambulances. Fourteen

(14) patients arrived to UMC between 11:07 AM and 11:35 AM. The
average time to arrival at UMC following the MSI was 37.5 min. One
Stable
Stable
Stable
Stable

trauma transfer occurred during the next day. Trauma surgery pro-
vided aggressive surgical intervention; 14 of 15 total patients under-
went 1–2 surgical procedures shortly after arrival.
Among the 15 patients transported to UMC El Paso for emer-
CRYO

gency treatment, the anatomic location of injuries ranged from ankle

to upper chest. Numerous organs and tissues were affected by
trauma. Reported blood loss among all patients was variable, as shown
in Table 1b. Patient 1 sustained major thoracic injury and died imme-
diately of exsanguination upon thoracotomy performed immediately
PLT
Bld product(s) administered, units

after arrival at 11:22 AM. A total of six patients were transfused with
RBC units (range: 2–22), five with plasma units (range: 4–18), four
with PLT doses (range: 1–4) and two with CRYO (2 doses per patient),
FFP

starting at 11:17 AM (30 min after the MSI event), with acute transfu-
sions ending at 5:11 PM. Given the severity of the injuries affecting
our 15 patients, uncrossmatched O neg or O pos RBC units (range: 2–6)
were administered to five patients, including the three patients dis-
RBC

cussed above; two of these three patients received massive transfu-

sions. Upon identifying their blood types, two patients were switched to
type-specific products with minimal wastage of unused blood products
Patient No.1 (immediate 3000 ml exsanguination) autopsy finding not yet publicly available.

(Table 2). A total of three FFP units were discarded (95 of 98 total blood
Tx, transfusion; TXA, tranexamic acid; UMC, University Medical Center; VENT, ventilator.
Est. blood
loss, mla

products transfused during the first 24 h, 97% transfusion rate);

50
25
200

100

the remaining blood products issued but not transfused were ret-
urned to inventory and subsequently used by other patients. The
14 total admitted UMC patients used a total of 45 RBCs, 38 FFPs,
8 PLT and 4 CRYO doses. The overall RBC:FFP:PLT transfusion
ratio across all transfusions within the first 24 h is 1.18:1:0.94.
From surgical procedures performed within 24 h post-arrival.

Table 3 includes transfusion and admission totals for both UMC

and the local level 2 trauma centre.
Location of injury
Thigh, bilaterally
Thigh, bilaterally

The UMC blood bank immediately contacted Vitalant when the

Gluteal cleft

MSI victims arrived. Vitalant fulfilled UMC’s blood component

Rt elbow

requests within 1 h of orders, with replacement products arriving con-

tinuously thereafter. This included a total of 89 O-positive RBCs,
15 O-negative RBCs, 20 AB FFP, 24 A FFP, 13 apheresis PLT and
2 CRYO doses.
Five surviving patients presented with major trauma (Patients
admission
Patient’s
(Continued)

NISS at

5 through 9 in Table 1b, all with an NISS greater than 15). They each
2
3
1
12

presented with abdominal gunshot wounds and 1–2 additional ballis-

tic wounds in other sites, including two with chest wounds. UMC’s
MTP was activated for two of these five patients and were carried
TABLE 1

through with ROTEM protocol guidance as described below. Three of

Pat no.

the five patients required a ventilator for 8–10 days, and their ICU
12
13
14
15
(b)

LOS and total hospital LOS (43–63 days) were the longest among all
b
a

c
304 QIAO ET AL.

TABLE 2 Additional blood utilisation data from the mass shooting incidenta

No. of un-crossmatched No. of group O RBC units

O pos or O neg units given to non-group No. of RBC No. of FFP
Pat no. Patient ABO type transfused O patients units discarded units discarded
1 Unknownb 2 N/Ab 0 0
4 A pos 3 3 0 0
5 AB pos 2 2 0 1c
7 A pos 6 6 0 2c
8 O pos 4 N/Ad 0 0
9 B pos 6 6 0 0

Abbreviations: FFP, fresh frozen plasma; neg, negative; No. number; Pat, patient; pos, positive; RBC, red blood cells.
a
Patients 2–3, 6, 10–15 did not receive blood products in the first 24 h upon admission.
b
Patient 1 died shortly after arrival; no ABO sample was collected.
c
Unused FFP was discarded from Patients 5 and 7 due to outside of laboratory/cooler for greater than 30 min, as the trauma teams were triaging and
treating additional incoming patients.
d
No group conversion for RBC necessary.

TABLE 3 Characteristics of the casualties and transfusion summaries of seven mass shooting incidents

Location of incident (year)

Littleton, Oslo, Paris Orlando, Las Vegas, Christchurch, El Paso,

Characteristic CO (1999) Norway (2011) France (2015) FL (2016) NV (2017) NZ (2019) TX (2019)
No. killed 15 77 129 49 58 51 23
No. injured 30 159 302 56 869 118 23
No. admitted 30 25 324 34 185 48 23
Total 45 236 431 102 927 169 46
a
Fatality rate, % 33.3 32.6 29.9 48.0 6.3 30.2 50.0
Type of weapon used SA handgun SA rifle and SR rifle SR rifle LR rifle LR and SR LR rifle
by shooter and DB pistol bombs and bombs rifles
shotgun
Avg. no. identified gunshot Not known Not known Not known 6.9 1.2 Not known Est. 1.7b
wounds per fatality
Est. proximity of shooter Closec Close Close Close Fard Close Close
to victim
Total transfused RBC 105 53 286 172 500 281 126 (45)e
components Plasma Not known 39 199 116 270 198 94 (38)
PLT Not known 14 25 25 87 23 21 (8)
CRYO Not known Not known Not known 18 45 12 14 (4)
Units/doses RBC 7.00 2.12 0.88 5.06 2.70 5.85 5.47 (3.21)
transfused per Plasma Not known 1.56 0.61 3.41 1.46 4.13 4.09 (2.7)
admission
PLT Not known 0.56 0.08 0.74 0.47 0.48 0.91 (0.57)
CRYO Not known Not known Not known 0.53 0.24 0.25 0.61 (0.29)
RBC:FFP overall ratio Not known 1.36 1.44 1.48 1.85 1.42 1.34 (1.18)

Abbreviations: Avg, average; CRYO, cryoprecipitate doses (each dose contains two 5 pooled individual cryoprecipitate units, for a total of 10 pooled
individual units per dose); DB, double-barrel; Est., estimated; LR, long-range; No. number; NZ, New Zealand; PLT, platelet single doses (each dose
equivalent to 6 pooled random donor platelet concentrates); RBC, packed red blood cells; SA, semi-automatic; SR, short-range.
a
Fatality rate (%) calculated as (no. killed/no. killed + no. injured) x 100.
b
Estimate based on 1.7 bullet wounds per survivor.
c
Close (proximity), less than 10 yds.
d
Far, greater than 10 yds.
e
Combined transfusions per total admission (UMC transfusions during the first 24 h after admission).
MASS SHOOTING INCIDENT IN EL PASO TX 305

F I G U R E 2 ROTEM data (including EXTEM, INTEM and FIBTEM parameters) performed at separate time intervals to guide transfusion
decisions and assess coagulopathy during the El Paso MSI. Patient numbers correspond to that of Tables 1a,b and 2 from the main manuscript.
(a) Patient 7, 3:33 PM; (b) Patient 7, 5:57 PM; (c) Patient 8, 12:48 PM; (d) Patient 8, 1:58 PM; (e) Patient 9, 12:56 PM; (f) Patient 9, 2:48 PM;
(g) Patient 9, 8:50 PM
306 QIAO ET AL.

FIGURE 2 (Continued)
MASS SHOOTING INCIDENT IN EL PASO TX 307

FIGURE 2 (Continued)
308
FIGURE 2 (Continued)
15 patients triaged to UMC. At 24 h post-admission, 10/15 patients
were in stable condition, 2/15 were in guarded condition and 3/15
were in critical condition. At discharge, 14/15 patients were alive and
sufficiently stable.
For the three patients requiring a ventilator, ROTEM served to verify
and justify the need for MTP, as well as to assess whether coagulation
had been achieved (Figure 2a–g). MTP was activated on patient 7 (ISS of
38) due to severe intra-abdominal haemorrhage, persistent
haemodynamic instability and profound hypotension with tachycardia,
prior to arrival at the operating room. After initial aggressive resuscitation
efforts, the first ROTEM performed at 3:33 PM showed abnormalities in
the extrinsic-activated ROTEM test (EXTEM) and intrinsic-activated
ROTEM test (INTEM) parameters, including clot firmness at 10 min (A10)
and subsequent maximum clot firmness (MCF) after 30 min. This
supported a decision to continue balanced transfusions or plasma and
PLT transfusions. After MTP, Patient 7’s subsequent ROTEM at 5:57 PM
showed marked improvement of EXTEM and INTEM parameters, con-
firming haemostasis. ROTEM performed on Patient 8 (ISS of 19) at
12:48 PM revealed normal INTEM, EXTEM and fibrin-dependent
ROTEM test FIBTEM parameters. While Patient 8 received emergency
release blood from the trauma box, no MTP activation was required. A
follow-up ROTEM on Patient 8 at 1:58 PM was normal. Patient 9’s (ISS
of 32) ROTEM (performed immediately upon arrival at 12:56 PM) did
not demonstrate significant abnormalities; however, within the operating
room he experienced massive haemorrhage, sudden hypotension and
QIAO ET AL.
tachycardia and subsequent activation of MTP. A second ROTEM per-
formed at 2:48 PM on this patient showed marked abnormalities in
EXTEM, INTEM, FIBTEM A10 and MCF parameters. This supported a
decision to continue massive transfusion. This patient experienced fur-
ther post-op bleeding and was addressed for a second time in the oper-
ating room. A final ROTEM at 8:50 PM showed near-normalisation of all
parameters, indicating achievement of haemostasis.
Analysis of seven MSIs
The selected seven sites included in the retrospective evaluation were
located in: Littleton (Columbine High School), CO, Orlando, FL, Las
Vegas, NV, Oslo, Norway, Paris, France; and Christchurch,
New Zealand and El Paso, TX [17–24]. Fatalities were highest for the
MSI in Paris, France and lowest for Columbine, CO. The number
injured was highest for the MSI in Las Vegas, NV and lowest in El
Paso, TX, and the fatality rate ranged from 6% in Las Vegas to 50% in
El Paso. Shooters were within close proximity to victims in all MSIs
except Las Vegas. The type of weapon used by the shooter was most
often a rifle, either short- or long-range; however, a double-barrel
shotgun was included to the weapons used in one MSI (Columbine),
and bombs was used in two other MSIs (Oslo and Paris). Limited data
are available regarding number of wounds per deceased (Las Vegas:
1.2; Orlando: 6.9) (Table 3).
MASS SHOOTING INCIDENT IN EL PASO TX
F I G U R E 3 Blood product usage during seven mass shooting incidents between 1999 and 2019 (one cryoprecipitate dose is equivalent to
five pooled individual cryoprecipitate units, and each platelet unit is an apheresis unit that is equivalent to six random donor platelet
concentrates). CRYO, cryoprecipitate; MSI, mass shooting incident; NZ, New Zealand; PLT, platelets; RBC, red blood cell
Blood component usage between the seven MSIs (17) is com-
pared in Figure 3. There is consistent reporting of CRYO use in addi-
tion to RBCs, plasma and PLT transfusions beginning with the
Orlando MSI in 2016. Las Vegas had the most hospital admissions and
total number of reported total blood component usage (range: 105 to
902). Las Vegas had the highest RBC:FFP ratio per admission (1.85),
while El Paso had the lowest (1.18 at UMC, 1.34 combined UMC and
Level 2). Christchurch had the highest overall RBC and FFP transfu-
sions per admission (5.85 and 4.13, respectively), while Paris had the
lowest RBC and FFP transfusions per admission (0.88). El Paso had
the highest overall PLT transfusions per admission (0.91), while Paris
had the lowest PLT transfusions per admission (0.08). El Paso had the
highest overall CRYO transfusions per admission (0.61), while Las
Vegas had the lowest (0.24).
DISCUSSION
While an apparent increase in MCIs from the mid-1900s to present is
evident, it may be difficult to identify a definitive trend with respect
to fatalities. However, Figure 4 provides a visual appreciation for
fatalities and locations of MCIs in the United States during the past
70 years. Because MCIs are a part of the US history and may be a part
of the future, it is essential to remain cognizant that early and inten-
sive resuscitation efforts are associated with reduced mortality rates
during acute haemorrhagic trauma [25]. Favourable patient outcomes
of the El Paso MSI was dependent upon interdisciplinary cooperation
among the transfusion service, blood supplier (Vitalant), trauma team,
pre-established hospital policies, patient blood management program
and emergency response teams. Optimal patient blood management
logistics is essential to ensure not only inventory stewardship but also
appropriate use of resources. Furthermore, the time of acute transfu-
sion can influence survivability and can be closely linked with
haemorrhagic death.
Studies on battlefield use of haemostatic agents report successful
outcomes22-23. Although the context of MSI differs from typical
309
combat circumstances, result primarily from ballistics. We believe that
our patient blood management and damage control strategies [26],
that included use of haemostatic agents, tourniquets and the strategic
placement of in-hospital haemostatic agents for arriving patients,
directly resulted in reducing the overall need for blood products in the
El Paso MSI. One patient died in the operating room after thoracot-
omy with non-reparable aortic injuries and massive haemorrhage
(3000 ml loss). After retrospective evaluation of this patient’s condi-
tion, an alternate outcome was considered unlikely. While the injury
locations varied among the 14 remaining patients, those suffering
from thoraco-abdominal (rather to peripheral) injuries had higher
trauma level classifications upon arrival (Level 1 to 2), worse clinical
presentations at 24 h (critical to guarded condition), increased esti-
mated total blood loss, increased LOS (ICU and total admission) and
increased requirements for ventilator support.
There were no reported delays of delivering blood products to
the patients arriving at UMC, and no reported issues were noted with
receiving additional inventory from our sole blood supplier (Vitalant).
The UMC blood bank uses thawed plasma instead of liquid plasma.
Having readily available 5-day thawed AB plasma at UMC, specifically
designated for trauma use, eliminates delays incurred with initial
thawing of the first batch of FFP immediately at MTP activation. Most
thawed AB plasma at UMC is usually used for trauma within 1–2 days
after thaw; its coagulative ability is comparable with liquid type A
plasma (activity is similar for up to 7 days) [27]. The blood component
wastage incurred in the El Paso MSI (97% of issued products
transfused) is comparable to a study performed by Dunbar et al. on
wastage secondary to mass transfusions at regional trauma centres
(84%–95% of issued products transfused reported in the study) [28].
The use of thromboelastometry to guide transfusion and manage
coagulopathy has not been reported prior to this MSIs El Paso study.
During the past decade, use of thromboelastometry has been fre-
quently reported in diagnosing and treating acute coagulopathy during
traumatic haemorrhage [8]. While Noorman and Hess state that
thromboelastometry may have limited sensitivity [29] with no differ-
ence in clinical outcomes compared to conventional coagulation tests
310
MCI, year
F I G U R E 4 Mass casualty incidents (MCIs) in the United States (1949–2019), number killed and location of incident. The El Paso, TX MCI is
identified with larger font size and text box. Dashed line (- - - - -) indicates linear regression trend line
[30], Holcomb et al. have, on the contrary, suggested that in certain
scenarios it may eventually replace conventional coagulation tests in
emergency settings [10], with the ability to guide [31] and potentially
reduce transfusions. ROTEM parameters, EXTEM and FIBTEM A5
(clot amplitude after 5 min) have excellent correlation with A10 (clot
amplitude after 10 min) and MCF (maximal clot formation, after
30 min) [11]. A retrospective analysis by Kelly et al. showed strong
correlation between decreases in EXTEM A5, A10 and/or MCF with
mass transfusion requirements [9]. This study revealed that EXTEM
A5 may be more advantageous compared to EXTEM A10; however,
both are likely comparable/equivalent to the MCF. While the A5
parameter is now FDA-cleared, it was not yet widely adopted in the
United States at the time of the El Paso MSI. The use of the EXTEM
A10 parameter during the El Paso MSI was valuable in guiding mass
transfusion decisions within 10 min. This resulted in a 20–25 min
advantage over MCF, as well as a significant time advantage (60 min)
compared to routine coagulation tests.
Out of the seven MSIs in our retrospective study and literature
review, El Paso had the lowest transfused RBC to FFP to PLT ratio
(UMC with RBC:FFP:PLT ratio of 1.18:1:0.94 for the first 24 h). This
ratio was closest to the published 1:1:1 RBC:FFP:PLT ratio cited in
the PROPPR trial [32]. The use of blood components other than RBCs
were documented in more recent MSIs, including Las Vegas and
Christchurch, compared to earlier MSIs such as Columbine, where
only RBC use was documented. UMC’s close adherence to a 1:1:1
ratio for mass-transfused patients, comprehensive approach to MTP
and immediate use of TXA likely played a role leading to favourable
outcomes in the El Paso MSI. From a study based on 40,138
QIAO ET AL.
haemorrhaging patients, TXA was most effective when administered
immediately [6]. Every 15-min delay in administering TXA results in
increased bleeding and decreased survival by 10%, offering no benefit
if administered after 3 h post-haemorrhage. In addition to improved
trauma survival rates, the CRASH-2 trial suggested cost-effectiveness
of early TXA administration through earlier haemostasis of trauma
patients, by potentially decreasing components transfused [7].
Weapon type and proximity of the offender to victims may be
associated with the mortality and subsequent blood use. Proximity to
the victims from the seven analysed MSIs in our study, regardless of
weapon type, is associated with increased fatality rates (Table 3). Simi-
lar to penetrating injuries during war [33], military-grade weapons
with rifling cause the most damaging impact on human tissue and
necessitates urgent treatment with TXA and transfusions [33]. While
civilian mass casualty studies that correlate weapon type with transfu-
sion requirements have not yet been reported, based on our observa-
tion with the seven MSIs, we observe that long-range weapons used
against victims in close proximity are likely to result in increased trans-
fusion needs per patient. This is supported by the incident in both
Christchurch and El Paso. Additional data analysis may further support
this observation.
Limitations of this study are related to the MSI casualties treated
at two different facilities (UMC and a nearby Level 2 trauma centre).
Data from the El Paso County Medical Examiner’s Office are not pub-
licly available and not included in this report. Likewise, we were
unable to obtain access to all data from our associated Level 2 trauma
centre and is not included in this report. In-depth resuscitation timing,
injury severity, patient management specifics and hospital protocols
MASS SHOOTING INCIDENT IN EL PASO TX
were not obtainable for our review. As a result of this limitation, cal-
culation of combined transfusion statistics was performed per LOS,
not specific to the first 24 h. Injury patterns from the Medical Exam-
iner’s Office, including the autopsy findings on UMC patients who
died upon arrival to UMC with non-sustainable chest injuries, are not
available for review. However, similar to the Las Vegas MSI, where a
long-range assault weapon was used, we would expect the number of
wounds per fatality in the El Paso MSI to be close to 1.7, as deter-
mined with this group of UMC patients. Because data were obtained
from chart reviews, blood loss may be under-reported for the two
patients that required mass transfusions (loss of 550 and 1000 ml,
respectively). Our comparative analysis outcomes may be different if
full transfusion data were available for Columbine, Oslo and Paris.
Because various MSIs compared in this report may introduce different
weaponry (e.g., handguns, military-style rifles), differing MSI analysis
may present selection bias when compared to the El Paso MSI.
This case demonstrates traumatic impacts that mass shootings
can impart to MSI victims as well as highlights management impor-
tance of scarce resources diverted from routine patient care. Informa-
tion obtained from the UMC’s chief financial officer indicates that the
total cost incurred from the El Paso MSI at UMC was approximately
$800,000. During the last 20 years, civilian communities—schools,
workplaces, religious centres and public gatherings—have been more
frequent. The use of military-grade assault weapons has increased the
proportion of wounds likely to be associated with critical bleeding,
including critical time periods in which effective pre-hospital and
trauma resuscitation interventions must occur. Public safety, emer-
gency response and trauma care systems—including blood utilisation
and supply systems—must be prepared for these potential events.
Anticipation of transfusion requirements for MSIs, adherence to cur-
rent transfusion guidelines/haemorrhage protocols, judicious use of ancil-
lary testing and rapid interdisciplinary resuscitation responses are critical
to improving MSI survivor outcomes. Although there are many views
regarding the use of thromboelastometry or thromboelastography in
trauma, our experience with ROTEM enabled us to reduce overall trans-
fusions and develop a better perspective, appreciation and understanding
of acute resuscitation. After the El Paso MSI, UMC now obtains and is
increasing Whole Blood use for trauma, providing better transfusion
management and reduced utilisation.
ACKNOWLEDGEMEN TS
The authors acknowledge the following individuals for their help: Glenn
Ramsey, M.D., Professor, Department of Pathology, Northwestern
University, Chicago, IL; Jessica Hernando, sectional laboratory manager
of University Medical Center El Paso; Demi Veliz, supervisor of blood
bank and transfusion services at University Medical Center El Paso;
Susan McLean, M.D., M.P.H., FACS, Professor, Surgical Critical Care
Director, Department of General Surgery, Trauma/Surgery Critical Care,
Texas Tech University Health Sciences Center El Paso; Liz Rosenbaum,
M.D., Medical Director, Vitalant (formerly United Blood Services), Albu-
querque, NM. B.R. and F.W. obtained institutional review board approval
to obtain data. J.Q., B.R. and F.W. collected patient and transfusion data
related to the El Paso MSI. J.Q., B.R. and J.A. acquired data and analysed
311
other recent MSIs. J.Q., B.R. and F.W. wrote the first draft of the paper.
F.W., J.A., and J.Q. designed, edited and finalised all pertinent tables and
figures. J.A. reviewed re-wrote portions/added to and edited previous
drafts of the manuscript.
CONFLIC T OF INT ER E ST
The authors have no conflicts of interests to declare.
ORCID
Jesse Qiao https://orcid.org/0000-0002-8348-4893
Frank Wians https://orcid.org/0000-0002-1715-7886
RE FE RE NCE S
1. Mass Shootings in the US Fast Facts. CNN editorial research [updated
2020 May 3; cited 2020 June 6]. Available from: https://www.cnn.
com/2019/08/19/us/mass-shootings-fast-facts/index.html
2. Romero S, Fernandez M, Padilla M. Massacre at a crowded Walmart
in Texas leaves 2 dead. The New York Times, 3 Aug 2019 [cited
2020 June 5]. Available from: https://www.nytimes.com/2019/8/3/
us/el-paso-shooting.html.
3. World Health Organization. Mass casualty management systems:
strategies and guidelines for building health sector capacity [cited
2020 June 5]. Available from: https://www.who.int/hac/
techguidance/MCM_guidelines_inside_final.pdf.
4. Berwick D, Downey A, Cornett E. A national trauma care system:
integrating military and civilian trauma systems to achieve zero pre-
ventable deaths after injury. Washington, DC: National Academies
Press; 2016.
5. Nunez TC, Voskrensensky IV, Dossett LA, Shinnal R, Dutton WD,
Cotton BA. Early prediction of massive transfusion in trauma: simple
as ABC (assessment of blood consumption)? J Trauma. 2009;66:
346–52.
6. Gayet-Ageron A, Prieto-Merino D, Ker K, Haleema S, François-
Xavier A, Roberts I, et al. Effect of treatment delay on the effective-
ness and safety of antifibrinolytics in acute severe haemorrhage: a
meta-analysis of individual patient-level data from 40 138 bleeding
patients. Lancet. 2018;391:125–32.
7. Roberts I, Shakur H, Coats T, Hunt B, Balogun E, Barnetson L, et al.
The CRASH-2 trial: a randomized controlled trial and economic eval-
uation of the effects of tranexamic acid on death, vascular occlusive
events and transfusion requirement in bleeding trauma patients.
Health Technol Assess. 2013;17:1–79.
8. Brohi K, Singh J, Heron M, Coats T. Acute traumatic coagulopathy.
J Trauma. 2003;54:1127–30.
9. Kelly JM, Rizoli S, Veigas P, Hollands S, Min A. Using rotational
thromboelastometry clot firmness at 5 minutes (ROTEM® EXTEM
A5) to predict massive transfusion and in-hospital mortality in
trauma: a retrospective analysis of 1146 patients. Anaesthesia. 2018;
73:1103–9.
10. Holcomb JB, Minei KM, Scerbo ML, Radwan ZA, Wade CE, Kozar RA,
et al. Admission rapid thrombelastography can replace conventional
coagulation tests in the emergency department: experience with 1974
consecutive trauma patients. Ann Surg. 2012;256:476–86.
11. Olde-Engberink RH, Kuiper GJ, Wetzels RJ, Nelemans PJ,
Lance MD, Beckers EAM, et al. Rapid and correct prediction of
thrombocytopenia and hypofibrinogenemia with rotational
thromboelastometry in cardiac surgery. J Cardiothorac Vasc
Anesth. 2014;28:210–6.
12. Maw G, Furyk C. Pediatric massive transfusion: a systematic review.
Pediatr Emerg Care. 2018;34:594–8.
13. Carll T, Wool GD. Basic principles of viscoelastic testing. Transfusion.
2020;60:S1–9.
312
14. Veigas PV, Callum J, Rizoli S, Nascimento B, da Luz LT. A systematic
review on the rotational thrombelastometry (ROTEM®) values for
the diagnosis of coagulopathy, prediction and guidance of blood
transfusion and prediction of mortality in trauma patients. Scand J
Trauma Resusc Emerg Med. 2016;24:114.
15. Cotte J, D’Aanda E, Chauvin V, Kaiser E, Meaudre E. Point-of-care
coagulation testing for trauma patients in a military setting: a
prospective study. J Spec Oper Med. 2013;13:59–62.
16. Meyer DE, Cotton BA, Fox EE, Stein D, Holcomb JB, Cohen M, et al.
A comparison of resuscitation intensity and critical administration
threshold in predicting early mortality among bleeding patients: a
multicenter validation in 680 major transfusion patients. J Trauma
Acute Care Surg. 2018;85:691–6.
17. Ramsey G. Blood transfusions in mass casualty events: recent trends.
Vox Sang. 2020;115:358–66.
18. Gregory TM, Bihel T, Guigui P, Pierrart J, Bouyer B, Magrino B, et al.
Terrorist attacks in Paris: surgical trauma experience in a referral
center. Injury. 2016;47:2122–6.
19. Noël S, François A, Le Failler F, Charpentier F, Baudonnet T, Bierling P,
et al. Lessons learned from Paris and Nice. Vox Sang. 2018;13:35–46.
20. Badami KG, Mercer S, Chiu M, Yi M, Warrington S. Analysis of trans-
fusion therapy during the March 2019 mass shooting incident in
Christchurch, New Zealand. Vox Sang. 2020;115:424–32.
21. Heightman AJ. Lessons learned from EMS response to the Orlando
pulse nightclub shooting. J Emerg Med Serv [Internet]. 2017 [cited
2020 June 5]. Available from: https://www.jems.com/major-
incidents/mass-casualty-incidents/lessons-learned-from-ems-
response-to-the-orlando-pulse-nightclub-shooting/
22. Cheatham ML, Smith CP, Ibrahim JA, Havron WS, Lube MW,
Levy MS, et al. Orlando regional medical center responds to pulse
nightclub shooting. Bull Am Coll Surg. 2016;101:12–9.
23. Grady D. Orlando injuries were severe, but trauma care was nearby.
New York: The New York Times; 2016. p. A15 [cited 2020 June 6].
Available from: https://www.nytimes.com/2016/06/15/health/
orlando-shooting-medical-center.html
24. Gaarder C, Jorgensen J, Kolstadbraaten KM, Isaksen KS, Skattum J,
Rimstad R, et al. The twin terrorist attacks in Norway on July 22, 2011:
the trauma center response. J Trauma Acute Care Surg. 2012;73:269–75.
25. Malgras B, Prunet B, Lesaffre X, Boddaert G, Travers S, Cungi PJ,
et al. Damage control: concept and implementation. J Visc Surg.
2017;154(Suppl 1):S19–29.
QIAO ET AL.
26. Allison HA. Hemorrhage control: lessons learned from the battlefield
use of hemostatic agents that can be applied in a hospital setting.
Crit Care Nurs Q. 2019;42:165–72.
27. Gegel BT, Austin PN, Johnson AD. An evidence-based review of the
use of a combat gauze (QuikClot) for hemorrhage control. AANA J.
2013;81:453–8.
28. Dunbar NM, Olson NJ, Szczepiorkowski ZM, Martin ED,
Tysarcyk RM, Triulzi DJ, et al. Blood component transfusion and
wastage rates in the setting of massive transfusion in three regional
trauma centers. Transfusion. 2017;57:45–52.
29. Backholer L, Green L, Huish S, Platton S, Wiltshire M, Doughty H,
et al. A paired comparison of thawed and liquid plasma. Transfusion.
2017;57:881–9.
30. Noorman F, Hess JR. The contribution of the individual blood ele-
ments to the variability of thromboelastographic measures. Transfu-
sion. 2018;58:2430–6.
31. Baksaas-Aasen K, Gall LS, Stensballe J, Juffermans NP, Curry N,
Maegele M, et al. Viscoelastic haemostatic assay augmented proto-
cols for major trauma hemorrhage (ITACTIC): a randomized, con-
trolled trial. Intensive Care Med. 2021;47:49–59.
32. Deppe AC, Weber C, Zimmermann J, Kuhn EW, Slottosch I, Liakopoulos OJ,
et al. Point-of-care thromboelastography/thromboelastometry-based coagula-
tion management in cardiac surgery: a meta-analysis of 8332 patients. J Surg
Res. 2016;203:424–33.
33. Holcomb JB, Tilley BC, Baraniuk S, Fox EE, Wade CE,
Podbielski JM, et al. Transfusion of plasma, platelets, and red
blood cells in a 1:1:1 vs a 1:1:2 ratio and mortality in patients with
severe trauma: the PROPPR randomized clinical trial. JAMA. 2015;
313:471–82.
SUPPORTING INF ORMATION
Additional supporting information may be found in the online version
of the article at the publisher’s website.
How to cite this article: Qiao J, Ray B, Wians F, Abadie J.
Transfusion management of trauma from the 2019 El Paso
mass shooting incident. Vox Sang. 2022;117:299–312.
Received: 27 March 2021 Revised: 23 July 2021 Accepted: 3 August 2021

DOI: 10.1111/vox.13196

ORIGINAL ARTICLE

An intervention study for the prevention of vasovagal

reactions and evaluating donors’ experience: Analysis
of donors’ return for subsequent donation

Johanna Wiersum-Osselton1 | Femmeke Prinsze2 | Elise van den Brekel1 |

Anne van Dongen2 | Frank Hermans1 | Arlinke Bokhorst1 |
Tanneke Marijt-van der Kreek1

1
Sanquin, Unit Donor Affairs, Amsterdam,
The Netherlands Abstract
2
Sanquin, Donor Medicine Research, Background and Objectives: The EPISoDe (Experience Success in Donation) study
Amsterdam, The Netherlands
investigated the effect of interventions on self-reported vasovagal reactions (VVRs)
Correspondence in first-time and novice (second to fourth donation) whole blood donors aged
Johanna Wiersum-Osselton, Sanquin, Unit
≤30 years, demonstrating a 23% reduction of VVR from water drinking shortly before
Donor Affairs, Plesmanlaan 125, 1066CX
Amsterdam, The Netherlands. donation in the novice donors. Because donation experience and complications
Email: j.wiersum@sanquin.nl
affect donor retention, we analysed intervention group donors’ return for subse-
Funding information quent donation, a predefined secondary outcome.
None Materials and Methods: The interventions were as follows: 330 ml water, 500 ml
water, ball squeezing before phlebotomy (placebo) and a control group. All donors
received an online questionnaire about their experience within a week after dona-
tion. In the Netherlands, eligible donors are invited at least yearly depending on hos-
pitals’ needs. We analysed attendances within 421 days through return percentages
and binomial logistic regression.
Results: Of the 8300 EPISoDe participants, 6538 (78.8%) returned within 421 days.
Return did not differ between the two water groups, whereas odds for return were
significantly higher in both water and placebo intervention donors compared to the
control group (odds ratio [OR] 1.14, 95% confidence interval [CI] 1.00–1.29 and
1.22, 1.05–1.43, respectively) after adjustment for occurrence of VVR, unsuccessful
collection, gender and donation history. Staff-recorded or self-reported VVR at index
donation was associated with reduced odds for return (OR 0.47, 95% CI 0.37–0.60
and OR 0.53, 95% CI 0.46–0.61, respectively).
Conclusion: In this cohort of younger inexperienced blood donors, 78.8% returned
for subsequent donation. Donors who received an active study intervention, either
water or placebo, were more likely to return than control group donors.

KEYWORDS
blood collection, donors, donor motivation, donor return, vasovagal reaction

Vox Sanguinis. 2022;117:313–320. wileyonlinelibrary.com/journal/vox © 2021 International Society of Blood Transfusion. 313
314
I N T R O D U CT I O N
Retention of blood donors is important for blood supply and safety,
more so than recruitment of new blood donors. Studies show that the
risk of transfusion-transmitted viral infections is lower in repeat
donors than it is in new donors. For instance, Dodd et al. [1] report a
2.7-fold higher infection rate in first-time donors than in repeat
donors for human immunodeficiency virus, 13.6 for hepatitis B virus
and 25.5 for hepatitis C virus. Maintaining a good blood donor reten-
tion rate is therefore important for blood establishments.
Vasovagal reactions (VVRs) are known to reduce donors’ return
for future donation, especially in younger, new and novice donors
[2–4]. VVRs are the commonest adverse reaction to blood donation.
VVR symptoms, including typically dizziness, light-headedness, sweat-
ing or nausea and sometimes loss of consciousness (fainting), are
thought to be triggered by both physical (a drop in arterial blood pres-
sure) and psychological stimuli (e.g., pain, stress, fear). A promising
intervention to reduce VVRs is water loading within 30 min before
the donation as this is thought to mitigate the sudden drop in blood
pressure. In trials studying water loading as an intervention to prevent
self-reported VVRs, pre-donation water loading significantly reduced
the severity of self-reported vasovagal symptoms compared with the
self-reported symptoms of donors who had not drunk water [5, 6].
Morand et al. [7] found that consumption of water or an isotonic drink
was related to significantly lower odds of reporting an off-site
reaction within 48-h post donation than the ‘usual practice’ control
arm. Our recent large-scale placebo-controlled trial, the EPISoDe
(Experience Success in Donation) study, investigated the effect of
drinking water on the occurrence of VVRs in first-time and novice
(second to fourth donation) donors. The trial showed that drinking
either 330 or 500 ml water shortly before donation was associated
with a 23% reduction of self-reported VVR in younger novice whole
blood donors but not in first-time donors [8].
It is promising to see that these interventions decrease VVRs as
VVRs are unpleasant for donors. Ideally, we would like the reduction
in VVRs to translate into a higher retention rate, and for this reason,
donor return was a predefined secondary outcome of the EPISoDe
study. The literature has always implicitly assumed a mediation effect,
in the sense that water loading decreases incidence and severity of
VVR, which in turn increases retention. However, the direct effect
has, as far as we know, not been studied. Therefore, we do not know
if this is a pure mediation effect or if part of the effect is direct. If the
effect is direct, that is, if the intervention itself affects retention over
and above the mediation effect, this could have implications for donor
retention interventions. We studied this by setting up the EPISoDe
study as a placebo-controlled trial, where we also actively recruited a
group of donors to squeeze a ball prior to donation. All donors who
received an intervention, that is, the two water groups and the pla-
cebo (ball squeezing) group, were informed that the intervention could
improve their donation experience, without any specific mention of
VVR. A fourth (pure) control group did not receive any instructions in
relation to their donation but did receive a questionnaire about their
donation experience within a week following their donation.
WIERSUM-OSSELTON ET AL.
The aims of the present study were as follows: (1) to examine
whether, and if so how, the observed reduction in VVRs (both phle-
botomist and self-reported) in the EPISoDe study translated into
increased donor retention and (2) to investigate whether the placebo
intervention condition or the pure control condition in themselves
had any effect on donors’ return.
M A T E R I A L S A N D M ET H O D S
The EPISoDe study has been described elsewhere [8]. Briefly, young
(≤30 years) whole blood donors making their first, second, third or
fourth donation in collection centres in three quarters of the country
were invited to participate in the study from December 2014 to
September 2016. The study interventions were as follows: 330 ml
water drink, 500 ml water drink or squeezing a ball (placebo interven-
tion) before phlebotomy and a control group without intervention.
At phlebotomy, staff asked intervention donors whether they had
been able to drink all the water or perform the squeezing, but in other
respects, donor care was no different from non-participating donors.
Study donors (including the control group) were sent an online
questionnaire about their experience within a week following their
donation. The questionnaire consisted mainly of Likert-style questions
(scale of 5, from not at all to extreme) about different potential compli-
cations and was modelled on the Blood Donor Reactions Inventory [9].
A ‘self-reported VVR’ was defined as a binary variable based on a
survey response that the donor had fainted and/or experienced
moderate or worse dizziness or nausea. Donors consented to use of
their routinely recorded donation data in the study. This included
demographic data (age, gender and donation history) and donation
parameters such as donors’ estimated blood volume (EBV), pre-donation
haemoglobin and blood pressure as well as volume and duration of col-
lection and staff-recorded complication data. Standard blood collection
working procedures include the capture of a code, indicating either no
complication or occurrence of donation or procedural complication(s),
into the blood bank information system eProgesa (MAK Systems, Paris,
France). Each collection centre enrolled donors in one of the study
groups; a donor could participate only once per intervention and/or as
control according to the assignment of the centre where they attended.
All EPISoDe participants were included in the return analysis. In
the Netherlands, donors are usually invited for blood donation
in accordance with hospitals’ needs; the minimum interval between
whole blood donations is 8 weeks for men and 16 weeks for women.
The aim is to invite each eligible donor at least once a year. Allowing
for possible administrative delay, we postulated that eligible donors
should have received at least one invitation within 400 days after the
index donation. The invitation asks donors to attend in a 14-day
period, so we analysed their return for a donation attempt up to
421 days after the index donation. Data on donation invitations and
subsequent attendances to April 2018 were extracted from eProgesa
and the intervals calculated (in days). When the donor had not been
invited, we reviewed the donor record for recorded reasons of any
long-term medical or administrative non-availability.
INTERVENTIONS AND BLOOD DONORS’ RETURN
For verification of generalizability of findings, we constructed a
‘target group’ file using data extracted from eProgesa of all atten-
dances for a first, second, third or fourth whole blood donation by
donors aged up to 30 years during the study inclusion period, includ-
ing attendances at collection centres outside the participating geo-
graphic regions. The return percentage of all target group donors was
analysed with stratification for new (first-time) versus novice (second
to fourth donations) donor status, to explore whether control group
donors were more likely to return than target group donors who were
not approached for study participation.
Statistical analysis
Associations of donors’ return with the study interventions and
donors’ donation history, gender and age as well as successful versus
unsuccessful collection at their index donation and the occurrence of
VVR were analysed based on the return percentage and chi-square
statistic for 2  2 tables and by binomial logistic regression using
SPSS version 23 (IBM Corporation, Armonk, NY). Return percentages
of all EPISoDe participants who responded to the questionnaire were
examined in relation to the reported level of each symptom (univariate),
and binomial logistic regression was applied. For multivariable
regression analysis, the main analyses of differences between study
groups were performed with adjustment for gender, new versus novice
status, age, successful versus unsuccessful index donation and VVR
(staff-recorded VVR in total study group and self-reported VVR in
questionnaire responders, respectively). Additional analyses were
performed to explore the potential impact of haemoglobin and EBV,
variables known to have an association with the occurrence of VVR.
The lower return rate among female donors, for whom the standard
interval is longer, led us to additionally analyse the association between
donor return and the interval between index donation and the next
invitation to donate. Results with a p-value of <0.05 were considered
statistically significant.
RESULTS
Out of the 8300 EPISoDe participants, 6538 donors (78.8%) returned
within the study period (Figure 1). In all, 63.6% of returning donors
came before or in response to the first invitation (62.7% of female
donors and 65.3% of male donors). The median interval to return was
120 days after the index donation, namely, 130 for female donors and
77 for male donors.
Table 1 presents the demographics of the study groups and of
the target group donors who met the age and donation history criteria
but were not invited to participate. The study participants were
broadly comparable to those outside the study, though there
were slightly higher percentages of younger donors and female
donors in the study in comparison to the overall target group. Staff-
recorded VVR occurred in 4.1% in the total target group of donors
and in 3.5% of donors in the EPISoDe water groups (difference not
315
F I G U R E 1 Flowchart of donors’ return for subsequent donation
within 421 days of index donation
statistically significant, χ 2 = 1.506, d.f. = 1, p = 0.219). An unsuccess-
ful collection (less than 450 ml, the intended collection volume being
500 ml) was recorded as the outcome in 5.0% overall but in 4.1% of
study participants. The difference lay in the failed collections (less
than 100 ml) as opposed to incomplete collections (≥100 ml but
<450 ml) and can be explained by a tendency not to enrol this group
of donors as participants.
Table 2 shows percentages of donors who returned within
421 days for a subsequent donation, and Table 3 shows the results of
multivariable logistic regression analysis that were performed in the
EPISoDe groups. There was no statistical difference in donor
return between the 500 and 330 ml water interventions (χ 2 = 0.278,
d.f. = 1, p = 0.598), which were therefore combined for the remaining
return analyses. Overall, the odds for return were significantly higher
in both water and placebo intervention group donors compared to the
control (questionnaire only) group (odds ratio [OR] 1.14, 95% confi-
dence interval [CI] 1.00–1.29 and 1.22, 1.05–1.43, respectively, with
adjustment for gender, new versus novice, staff-recorded VVR
and unsuccessful donation). Return was slightly lower in women
(78.1% vs. 80.6%, adjusted OR 0.83, 95% CI 0.73–0.94) and lower in
first-time donors than after the second to fourth donation at 77.0%
versus 80.0%, OR 0.84, 95% CI 0.76–0.94 in the adjusted model.
Younger donors were more likely to return, and this effect was
independent of adjustment for new or novice donor status or intro-
duction of the donation number into the model. The interval to the
first invitation was significantly associated with donors’ return
(OR 0.995, 0.993–0.996 per extra day, N = 8148 donors, excluding
those who were not invited or who attended spontaneously before
being invited), and the effect of gender was no longer statistically
significant after this adjustment. Among the study group donors who
were invited but did not return in response to their first invitation
(n = 4039), 66.3% of female and 66.6% of male donors attended
within 421 days if they received (one or more) subsequent invitations.
In this subgroup, there was no effect of the study interventions.
A staff-recorded VVR at the index donation was associated with
reduced odds for return (Tables 2 and 3; adjusted OR 0.50, 95% CI
316 WIERSUM-OSSELTON ET AL.

TABLE 1 EPISoDe donor demographics

Donors in study (total N = 8300)

Placebo Control
Target group donors intervention (questionnaire
not in studya 500 ml 330 ml (ball squeezing) only)
Total 70,607 2006 2291 1838 2165
Female (N; % of total) 48,871 (69.2%) 1403 (69.9%) 1710 (74.6%) 1308 (71.2%) 1611 (74.4%)
First donation 18,501 (26.2%) 587 (29.3%) 775 (33.8%) 459 (25.0%) 688 (31.8%)
Second donation 13,087 (18.5%) 354 (17.6%) 442 (19.3%) 368 (20.0%) 456 (21.1%)
Third donation 9699 (13.7%) 250 (12.5%) 287 (12.5%) 263 (14.3%) 270 (12.5%)
Fourth donation 7584 (10.7%) 212 (10.6%) 206 (9.0%) 218 (11.9%) 197 (9.1%)
Male (N; % of total) 21,736 (30.8%) 603 (30.1%) 581 (25.4%) 530 (28.8%) 554 (25.6%)
First donation 7609 (10.8%) 256 (12.8%) 240 (10.5%) 175 (9.5%) 233 (10.8%)
Second donation 5734 (8.1%) 150 (7.5%) 170 (7.4%) 169 (9.2%) 143 (6.6%)
Third donation 4567 (6.5%) 111 (5.5%) 102 (4.5%) 112 (6.1%) 103 (4.8%)
Fourth donation 3826 (5.4%) 86 (4.3%) 69 (4.0%) 74 (4.0%) 75 (3.5%)
Donor age
Mean in years (SD); by age 22.8 (3.5) 22.1 (3.2) 22.1 (3.2) 22.1 (3.2) 22.4 (3.2)
groups (N; % of total)
18 years old 6725 (9.5%) 260 (13.0%) 275 (12.0%) 225 (12.2%) 216 (10.0%)
19–22 years old 30,068 (42.6%) 949 (47.3%) 1097 (47.9%) 894 (48.6%) 1011 (46.7%)
23–30 years old 33,814 (47.9%) 797 (39.7%) 919 (40.1%) 719 (39.1%) 938 (43.3%)
Hb mean (SD) mmol/L; 8.5 (0.5) 8.5 (0.5) 8.5 (0.5) 8.5 (0.5) 8.5 (0.5)
female
Hb mean (SD) mmol/L; male 9.5 (0.6) 9.5 (0.6) 9.5 (0.6) 9.5 (0.6) 9.5 (0.6)
EBV available (N; %) 70,515 (99.9%) 2004 (99.9%) 2288 (99.8%) 1838 (100%) 2163 (99.9%)
EBV mean (SD) in L; female 4.3 (0.5) 4.3 (0.5) 4.3 (0.5) 4.3 (0.5) 4.2 (0.5)
EBV mean (SD) in L; male 5.5 (0.6) 5.5 (0.6) 5.5 (0.6) 5.5 (0.5) 5.5 (0.6)
b
Staff-recorded VVR (N; %) 2917 (4.1%) 64 (3.3%) 88 (3.8%) 95 (5.2% 101 (4.7%
Unsuccessful collection 3503 (5.0%) 57 (2.8%) 88 (3.8%) 57 (3.1%) 141 (6.5%)
(n; %)
Respondersc (N; %) - 1726 (86.0%) 1981 (86.5%) 1510 (82.2%) 1704 (78.7%)
d
With staff-recorded VVR - 55 (3.2%) 70 (3.5%) 78 (5.2%) 78 (4.6%)
With self-reported VVRd - 296 (17.1%) 336 (17.0%) 319 (21.1%) 330 (19.4%)

Abbreviations: EBV, estimated blood volume; EPISoDe, experience success in donation; SD, standard deviation; VVR, vasovagal reaction.
a
The target group as constructed for the primary EPISoDe analyses did not adequately take account of previous failed donations (<100 ml), which
eProgesa does not include in the donation count as printed on the donor’s attendance form. This was corrected for the present study, yielding 1094 extra
target group attendances.
b
No statistical difference from rate in control group, p = 0.219.
c
Responders = donors who responded to the questionnaire.
d
N; % of responders.

0.40–0.64). The percentages of returning donors following VVR were
higher in the placebo group than in the water-drinking groups
(73.7% vs. 57.9%, χ 2 = 6.323, d.f. = 1, p = 0.012). Addition of the
pre-donation haemoglobin level and the EBV to the model showed
that both had an association with donors’ return (Hb OR 0.90, 95% CI
0.81–0.99 per mmol/L higher; EBV 1.22, 1.10–1.36 per litre increase)
and only minimally changed the associations with new versus novice
status, gender, staff-recorded VVR, unsuccessful collection and inter-
ventions (Supplementary Table S1). Removing the occurrence of a
staff-recorded VVR from the adjusted model or stratifying the model
for VVR left the odds for return in donors who had received the water
and placebo interventions unchanged, suggesting that the effect of
the interventions was not mediated by reduced VVR.
Among the 101 donors who did not return and had not been invited
for a subsequent donation within 400 days of the index donation
(84, 83% were women), 72 (61, 85% female) had been deregistered or
long-term deferred, and, in this group, there were 19 staff-recorded VVR
(26%). There were no statistical differences between the study groups.
Other recorded reasons included deferral for false-positive infectious dis-
ease markers (18) or unsuitable veins (11).
INTERVENTIONS AND BLOOD DONORS’ RETURN 317

TABLE 2 Percentage of donors returning within 421 days, per study group and among target group donors who were not study participants

Donors in study

Placebo Control
Target group intervention (questionnaire
% of returned donors not in study 500 ml 330 ml (ball squeezing; only,
donors per group (N = 70,607) (N = 2006) (N = 2291) N = 1838) N = 2165)
Total 76.4% 79.0%a 79.6%a 80.7%a 76.1%
Female 75.0% 78.2% 79.4% 79.4% 75.5%
New 72.7% 77.3% 78.5% 77.1% 74.9%
Novice 76.5% 78.8% 80.2% 80.6% 75.9%
Male 79.3% 80.8% 80.0% 84.2% 77.8%
New 74.7% 77.3% 79.2% 84.0% 70.0%
Novice 81.8% 83.3% 80.6% 84.2% 83.5%
Donor age
18 years old 83.9% 83.5% 85.5% 89.8% 83.3%
19–22 years old 78.7% 80.3% 80.6% 81.3% 77.6%
23–30 years old 72.8% 75.9% 76.6% 77.2% 72.7%
Staff-recorded VVR 55.2% 65.6% 52.3% 73.7% 55.4%
Unsuccessful collection 54.8% 59.6% 53.4% 73.7% 55.3%
Respondersb (all) - 79.8% 80.7% 81.9% 79.0%
With staff-recorded - 67.3% 55.7% 74.4% 57.7%
VVR
With self-reported VVR - 68.2% 70.2% 76.2% 67.6%

Abbreviation: VVR, vasovagal reaction.

a
Return percentage significantly higher than in control group, p-values are 0.026, 0.004 and 0.0004, respectively.
b
Responders = donors who responded to the questionnaire.

TABLE 3 Results of binomial logistic regression for donor return within 421 days (N = 8300 donors)

95% Confidence interval

Odds ratio Lower Upper

a
Gender (female vs. male) 0.83 0.73 0.94
Donation history (new vs. novice) 0.84a 0.76 0.94
b a
Water intervention 1.14 1.00 1.29
Placebo interventionc 1.22a 1.05 1.43
a
VVR (staff recorded) 0.50 0.40 0.64
Unsuccessful collection 0.45a 0.35 0.57
a
Age (per year older) 0.93 0.92 0.95

Abbreviation: VVR, vasovagal reaction.

a
Statistically significant, p < 0.05.
b
330 and 500 ml combined, in comparison to control.
c
In comparison to control group.

Donors who responded to the questionnaire (6921) were slightly
more likely to return in all study groups (Table 2). In the adjusted multi-
variable regression analysis, there was no significant effect of the study
interventions (Supplementary Table S2). Donors with a self-reported
VVR showed an increased return in the placebo intervention group
(OR 1.47, 95% CI 1.03–2.08) but not in the water intervention groups.
Among donors who responded to the questionnaire, other reported
symptoms following donation were associated with a lower return
percentage among responding donors, and the reduced return was
broadly correlated with the severity of symptoms. Figure 2 shows that
the generalized symptoms such as dizziness tended to have a greater
impact than venipuncture-related complications. This corresponded to
significantly reduced odds for return with dizziness and fatigue
(Supplementary Table S3). In regression analysis, no effect of the study
interventions was seen irrespective of whether all the self-reported symp-
toms were included in the model or only those with significant ORs.
318
FIGURE 2 Donors’ return for subsequent donation, depending on reported symptoms at their index donation (total N = 8300 donors)
DISCUSSION
The analysis of donors’ return for a subsequent donation attempt
shows that donors who had received a study intervention, whether
water-drinking or the placebo intervention of ball squeezing, were
15%–20% more likely to return for a subsequent donation attempt
than control group donors. This was chiefly apparent in donors who
had not experienced a VVR. Donors in the water intervention groups
who experienced a VVR did not show a significantly (or relevantly)
improved return in comparison to control group donors with VVR.
Donors with VVR in the placebo intervention group did, however,
show improved return compared to the control group, suggesting that
the enhancement was at least in part from psychological mechanisms.
Across all study groups, as anticipated, donors’ return was
inversely correlated with the degree of symptoms from their index
donation. Vasovagal symptoms and fatigue had a greater negative
impact than venipuncture-related symptoms. This would be in line
with an explanation of donors’ return based on the often used theory
of planned behaviour [10], with donors’ self-efficacy (‘I am confident
that I will be able to donate blood again’) being more negatively
affected by generalized reactions (‘I reacted badly to the donation’)
than from venipuncture problems (‘The nurse could not find my vein’).
The latter might be experienced as more extraneous and one-off. It is
also possible that local symptoms had a weaker impact on donors’
return because they were less troublesome to donors in the days fol-
lowing donation or more quickly forgotten.
Our study employed an online questionnaire to elicit donors’
symptoms, and this showed that as reported before, mild symptoms,
not noticed or reported by blood bank staff, can have a significant
effect on donors’ return [3, 11, 12].
Other groups have reported on donor return following interven-
tions to improve donation experience and donor return, particularly in
first-time donors. In the review by Bagot et al. [13–16] of work
WIERSUM-OSSELTON ET AL.
published up to July 2014, the greatest effect on both avoidance of
VVR and return was seen in studies of social support at the first dona-
tion. In our collection centres, extra support and information are given
to all donors giving their first donation, but there was no instruction
to pay more attention to study donors, other than to record their
compliance with the intervention (if there had been one). The active
(email) enquiry after their experience might have had an equivalent
effect to extra support, but return of the control group who only
received the questionnaire was no different from the target group of
donors who did not participate in the study, suggesting that this was
not the case. Masser et al. [17] found that donors’ intention to return
for future donations was reduced following a complication of whole
blood donation or a deferral, but this reduction was avoided if a donor
who had suffered a VVR was offered an alternative such as converting
to plasmapheresis. In our study, the donors in the water groups had
already drunk extra, so the customary advice to take plenty of fluids
for their next attempt would not be an alternative strategy, making
their poorer return understandable.
The EPISoDe study was a pragmatic cluster-assigned intervention
study and not a randomized study, and this constitutes a limitation. As
reported in the primary publication, we stratified by geographic region
and presence/absence of a large city factors when assigning clusters [8].
Nevertheless, unmeasured cluster-specific factors might play a role in
donor return, and this bias cannot be excluded. Another limitation was
the incomplete inclusion of eligible donors in participating centres.
Nevertheless, the demographics of the study groups confirmed
within-study comparability, and the ability to stratify by age and
donation history allows comparison to similar donors outside the
study. Also, there was no difference in return rate between the target
group not included in the study and the EPISoDe (questionnaire only)
control group. The study demonstrated only a small effect of the
interventions on the return rate after index donation. However,
the study interventions were not primarily designed to improve
INTERVENTIONS AND BLOOD DONORS’ RETURN
return. The importance of paying attention to donors, giving them
information and providing social distraction for improving return of
inexperienced donors was mentioned above. The effect on donors’
return in the EPISoDe intervention groups appears not to have been
mediated by physiological effects and may be partly due to extra staff
attention or psychological effects from receiving an intervention. This
might mean that the improvement in return associated with the water
intervention will be less when it is implemented in routine donor care.
Our analysis of donor return as a binary variable (return within
421 days) led to the finding that female donors were slightly less likely
(OR 0.86, 95% CI 0.76–0.97) to come back than male donors after
adjustment for age, study group, occurrence of self-reported VVR and
donation history. However, there was no longer a poorer return in
female donors after adjustment for the interval until the first invita-
tion or among male and female donors who did not attend in response
to their first invitation but received a subsequent invitation. Thus, we
conclude that poorer return compliance in female donors was an arte-
fact of the defined variable and unimportant. The slightly improved
return associated with the interventions is as welcome in female as in
male donors.
The interventions in this study had a positive effect of 15%–20%
improved donor return for subsequent donations. The objective of
the study was primarily to reduce VVR, and we are currently rolling
out the active recommendation of water drinking in younger, inexperi-
enced whole blood donors. The effect of the water intervention on
donor return was not better than the placebo intervention, thus the
impact on return is not likely to be the result of reduced adverse
effects. The potential for improved return of donors receiving an
intervention to improve their donation experience should be maxi-
mized by actively promoting the drinking of water by younger, inexpe-
rienced donors and by phlebotomy staff verifying whether donors
took the advice to drink extra water.
Another learning point is the non-negligible contribution of other
adverse donation experiences to reducing donor return. Whereas col-
lection failure or adverse venipuncture effects at the first donation
may simply reflect the fact that the donor’s veins are not ‘good
enough’ for blood donation, such effects after a successful first
attempt should—with optimal staff training and care—be kept to a
minimum.
The improved return by donors who received a study inter-
vention appears to result from psychological mechanisms. Further
study is needed to elucidate the possible mechanisms, for exam-
ple, extra staff attention or a sense of reassurance or satisfaction
from contributing to the study. Whatever the mechanisms, it is
essential to adopt and regularly reinforce practices to optimize
donor care and support, improve donors’ experience and maximize
retention.
In conclusion, in this cohort of new and novice blood donors
aged up to 30 years, 78.8% returned for a subsequent donation.
Donors who received a pre-donation intervention, either a water
drink or placebo, were more likely to return. A VVR (either staff-
recorded or self-reported) reduced donor return. Blood establish-
ments should have strategies in place to minimize complications and
319
improve donors’ experience, and this will contribute to improving
donor retention.
AC KNOW LEDG EME NT S
We thank Bert Mesman and Herman Geerligs for data exports and
Sandra van Nieuwmegen for administrative support.
We also acknowledge Benny Markovitch and Joep Rutgers, Medi-
cal Statistics students at Leiden University, whose parallel analyses
prompted us to examine the impact of time to receipt of invitation
more closely.
J.C.W.-O., T.M.-vdK., A.G.B., A.vD., E.vdB. and F.H. designed and
supervised the study; F.P. constructed target group, donor invitation
and donor return tables; J.C.W.-O. and F.P. performed statistical ana-
lyses; J.C.W.-O. drafted the manuscript. All authors critically reviewed
and commented on the manuscript and agreed to its submission to
Vox Sanguinis.
CONFLIC T OF INT ER E ST
The authors declare that they have no conflicts of interest relevant to
this manuscript submitted to Vox Sanguinis.
ORCID
Johanna Wiersum-Osselton https://orcid.org/0000-0003-3451-
9911
RE FE RE NCE S
1. Dodd RY, Crowder LA, Haynes JM, Notari EP, Stramer SL,
Steele WR. Screening blood donors for HIV, HCV, and HBV at
the American Red Cross: 10-year trends in prevalence, incidence,
and residual risk, 2007 to 2016. Transfus Med Rev. 2020;34:
81–93.
2. Veldhuizen I, Atsma F, van Dongen A, de Kort W. Adverse reactions,
psychological factors, and their effect on donor retention in men and
women. Transfusion. 2012;52:1871–9.
3. van Dongen A, Abraham C, Ruiter RA, Veldhuizen IJ. The influence
of adverse reactions, subjective distress, and anxiety on retention of
first-time blood donors. Transfusion. 2013;53:337–43.
4. Thijsen A, Masser B, Gemelli CN, Davison TE. Trends in return
behaviour after an adverse event in Australian whole blood and
plasma donors. Transfusion. 2019;59:3157–63.
5. Hanson SA, France CR. Predonation water ingestion attenuates neg-
ative reactions to blood donation. Transfusion. 2004;44:924–8.
6. France JL, France JL, Wissel ME, Ditto B, Dickert T, Himawan LK.
Donor anxiety, needle pain, and syncopal reactions combine to
determine retention: a path analysis of two-year donor return data.
Transfusion. 2013;53:1992–2000.
7. Morand C, Coudurier N, Rolland C, Thoret S, Legrand D, Tiberghien P,
et al. Prevention of syncopal-type reactions after whole blood donation:
a cluster-randomized trial assessing hydration and muscle tension exer-
cise. Transfusion. 2016;56:2412–21.
8. Wiersum-Osselton JC, Romeijn B, van den Brekel E, van Dongen A,
Hermans F, Bokhorst A, et al. Can we prevent vasovagal reactions in
young inexperienced whole blood donors? A placebo controlled
study comparing effects of a 330 vs 500 mL. Transfusion. 2019;
59:555–65.
9. Meade MA, France CR, Peterson LM. Predicting vasovagal reactions
in volunteer blood donors. J Psychosom Res. 1996;40:495–501.
10. Ajzen I. The theory of planned behavior. Organ Behav Hum Decis
Process. 1991;50:179–21.
320 WIERSUM-OSSELTON ET AL.

11. France CR, France JL, Roussos M, Ditto B. Mild reactions to blood 17. Masser BM, Bove LL, White KM, Bagot KL. Negative experiences
donation predict a decreased likelihood of donor return. Transfus and donor return: an examination of the role of asking for something
Apher Sci. 2004;30:17–22. different. Transfusion. 2016;56:605–13.
12. Sweegers MG, Twisk JWR, Quee FA, Ferguson E, van den Hurk K.
Whole blood donors’ post-donation symptoms diminish quickly but
are discouraging: results from 6-day symptom diaries. Transfusion. SUPPORTING INF ORMATION
2021;61:811–21. Additional supporting information may be found online in the
13. Bagot KL, Murray AL, Masser BM. How can we improve retention of
Supporting Information section at the end of this article.
the first-time donor? A systematic review of the current evidence.
Transfus Med Rev. 2016;30:81–91.
14. Pagliariccio A, Marinozzi M. Increasing regular donors through a psy-
chological approach which reduces the onset of vasovagal reactions. How to cite this article: Wiersum-Osselton J, Prinsze F, van
Transfus Apher Sci. 2012;47:301–4. den Brekel E, van Dongen A, Hermans F, Bokhorst A, et al. An
15. Hanson SA, France CR. Social support attenuates presyncopal reac- intervention study for the prevention of vasovagal reactions
tions to blood donation. Transfusion. 2009;49:843–50.
and evaluating donors’ experience: Analysis of donors’ return
16. Gillet P, Rapaille A, Benoît A, Ceinos M, Bertrand O, de Bouyalsky I, et al.
First-time whole blood donation: a critical step for donor safety and
for subsequent donation. Vox Sang. 2022;117:313–20.
retention on first three donations. Transfus Clin Biol. 2015;22:312–7.
Received: 11 May 2021 Revised: 24 August 2021 Accepted: 24 August 2021

DOI: 10.1111/vox.13202

ORIGINAL ARTICLE

The new donor vigilance system in Denmark reveals regional

differences in adverse reactions supposedly caused by
variation in the registration

Christina Mikkelsen1,2 | Helene Martina Paarup3 | Mie Topholm Bruun4 |

Louise Ørnskov Pedersen5 | Sys Hasslund5 | Rune Larsen6 | Bitten Aagaard7 |
7
Betina Samuelsen Sørensen

1
Department of Clinical Immunology,
Copenhagen University Hospital, Abstract
Copenhagen, Denmark
Background and Objectives: In recent years, there has been an increased focus
2
Novo Nordisk Foundation Center for Basic
Metabolic Research, Faculty of Health
among blood bank professionals on the health and safety of blood donors. In 2019,
Science, Copenhagen University, the Danish Haemovigilance Committee designed a national donor vigilance system
Copenhagen, Denmark
3
to improve the registration of adverse reactions (AR) in blood donors. The new donor
Danish Medicines Agency, Regulatory and
Clinical Assessment, Copenhagen, Denmark vigilance system was implemented on 1 January 2020 and we here present the
4
Department of Clinical Immunology, Odense results from the first year of registration.
University Hospital, Odense, Denmark
Materials and Methods: AR categories, severity level and imputability score were
5
Department of Clinical Immunology, Aarhus
University Hospital, Aarhus, Denmark defined based on the definitions from the International Society of Blood Transfusion,
6
Department of Clinical Immunology, Næstved AABB and the European Commission directive 2005/61/EC, respectively.
Hospital, Næstved, Denmark
Results: Across all severity levels, AR in Danish blood donors were found to be rare
7
Department of Clinical Immunology, Aalborg
University Hospital, Aalborg, Denmark
(1498 per 100,000 donations). Only 0.2% of the registered reactions were classified
as serious (2.7 per 100,000 donations). Large regional differences were seen in the
Correspondence
registration of citrate reactions and haematomas.
Christina Mikkelsen, Department of Clinical
Immunology, Copenhagen University Hospital, Conclusion: Significant differences across regions in what to categorize as an AR
Blegdamsvej 9, 2100 Copenhagen, Denmark.
were persistent even when including a severity score in the reporting. The Danish
Email: christina.mikkelsen@regionh.dk
Haemovigilance Committee will commence a national work to align the definitions
Funding information but suggests that this matter is raised to an international level as part of the current
None
work to agree upon definitions for assessment of donor AR.

KEYWORDS
blood collection, donor health, donors, haemovigilance

I N T R O D U CT I O N associated risks to blood donors, reporting of AR in donors remains

Haemovigilance is the surveillance of the whole chain from blood
donation to transfusion of blood products. Data on adverse reactions
(AR) are continuously registered and regularly assessed, and have
resulted in changes in policies, products and practises within transfu-
sion medicine [1]. In Europe, however, despite the known donation-
voluntary and heterogeneous [2]. In contrast, registration of the AR in
recipients has been mandatory since introduced in 2002 in the EU
Directive 2002/98/EC.
Research has shown that although blood donation is safe [3–5], it
is still important to monitor donor AR. In Denmark, all blood donations
are from healthy volunteers who do not benefit from the donation

Vox Sanguinis. 2022;117:321–327. wileyonlinelibrary.com/journal/vox © 2022 International Society of Blood Transfusion. 321
322
themselves. Obviously, blood donors deserve a supreme surveillance
of AR in blood donation; and in addition to this, donor AR can have a
negative impact on donor return and thereby potentially affect the
national blood supply [6].
In recent years, there has been increasing work to align the donor
vigilance systems in Europe and the rest of the world in order to
improve donor safety. The International Society of Blood Transfu-
sion’s (ISBT) haemovigilance network [7–10], as well as large consor-
tium projects [11], have worked towards proposing guidelines for a
common international system aiming to improve the quality of the
data collected, including within donor safety and health.
The Danish healthcare system, including blood banks, is divided
into five regions. In each region, blood collection is managed by the
regional Blood Establishments (BE). From 1997 to 2020, the reporting
of AR in donors was a regional matter, and only the serious adverse
reactions (SAR) were reported centrally to the Danish Patient Safety
Authority and to the national organization of Blood donors in Denmark.
In 2019, it was decided by the Danish Haemovigilance Commit-
tee, in collaboration with the five regional BE to make one common
national system for registration of AR in blood donors. A new national
plasma collection strategy and the opening of two new plasmaphere-
sis centres in 2020 emphasized the need to monitor AR. The national
registration was implemented and commenced on 1 January 2020. It
was designed to be user-friendly and easily accessible to multiple staff
groups while still providing sufficient data. We present the results of
the first year with a national Danish donor vigilance system.
MATERIALS AND METHODS
The Danish blood service
Blood donation is regulated by the competent authority according to the
EU directives for blood collection. In addition, the Danish Society of Clini-
cal Immunology publishes the national standards for blood bank activity.
This includes health screening of donors and the donation process. Eligi-
ble donors are 17–70 years of age and weigh at least 50 kg. At their first
attendance, an interview is performed and blood samples are taken. In
one region, donations are also performed at the first attendance. Before
all donations, the donor fulfils a health questionnaire and is interviewed
by trained staff. Until a few years ago, donors donated whole blood as a
standard, whereas apheresis donations were only performed on special
needs, for example, HLA-compatible platelets. The volume of collected
plasma per donation is in the range of 600–800 ml depending on the
weight of the donor. Platelet apheresis is regulated by the number of
platelets collected and not by volume. All regions report that they gener-
ally collect two products, not exceeding the recommended donation vol-
ume for plasma donation. The donor is always verbally encouraged to
contact the blood bank in case of AR occurring after leaving the collection
site, but no active formalized follow-up is performed.
The independent organization, Blood donors in Denmark that relies
mainly on volunteer labour, maintains the recruitment of donors in
order to secure the supply of blood and blood products in Denmark.
MIKKELSEN ET AL.
SAR are reported to the competent authority and in addition to
the Danish Patient Compensation Association. The Danish Patient Com-
pensation Association is responsible for managing the legislation deal-
ing with injuries occurring in connection with examination or
treatment in the public or private healthcare system in Denmark and
hence also includes blood donors. The Danish Patient Compensation
Association has assigned this task to the Blood donors in Denmark. All
SAR are followed by the Blood donors in Denmark until they have
resolved or until 1 year after the AR. The Blood donors in Denmark will
inform the BE if the donor has symptoms 6 months after the symptom
debut. If the reaction has not resolved after 1 year, the Danish Patient
Compensation Association evaluates whether the injury has caused a
degree of disablement and whether the donor is entitled to economic
compensation. The BE will be informed about the decision.
The national Danish donor vigilance system
A working group consisting of blood bank staff and IT specialists, both
from all five regions, designed the new system, which was designed to
be applicable in both of the two IT systems used in the BE in
Denmark: ProSang and Blodflödet. All AR are linked to the ISBT128
Donation Identification Number. The reporting system of AR was built
on three parameters.
First, categorisation of the reaction type as defined in the Standard
for Surveillance of Complications Related to Blood Donation 2014 by
the working group on donor vigilance of the ISBT (https://www.aabb.
org/docs/default-source/default-document-library/resources/donor-
standard-definitions.pdf?sfvrsn=21834fa4_0) (Table 1). Each sub-
category was assigned a one-letter or digit code (A–Z in ProSang and
1–22 in Blodflödet). A few adjustments were made in the categories.
First, it was decided to make separate categories for nerve irritation/
injury caused by direct nerve injury or secondary to a haematoma. This
was done, as the working group considered it relevant to be able to dis-
tinguish between often mild discomfort caused by a haematoma versus
direct nerve injuries, which were considered more serious. Second, to
avoid confusion, the two categories, other serious complications and
other complications, were combined in the category: Other, rare AR.
Second, rating of severity as defined by the severity grading tool
for blood donor adverse events by the AABB (https://www.aabb.org/
docs/default-source/default-document-library/resources/severity-
grading-tool-for-donor-adverse-events.pdf?sfvrsn=ff563263_4).
Each severity grade was assigned a one-digit code from 1 to
5. One being mild AR with no need of treatment and five being AR
leading to death.
And third, a grading of the imputability level categorized from
excluded to certain as defined in the European Commission Directive
2005/61/EC. Imputability level is assigned a one-digit code (four
grades) indicating the degree of possible association to the donation.
An example could be as follows: a donor develops a haematoma after
donations, this is category A (ProSang)/1 (Blodflödet). The haematoma
needs no treatment and symptoms last less than 14 days, this is sever-
ity level 1. The donation is considered to be the certain cause of the
THE NEW DONOR VIGILANCE SYSTEM IN DENMARK 323

T A B L E 1 Overall categories and their subcategories of adverse reactions in blood donors as defined by the working group on donor vigilance
of the International Society of Blood Transfusion

Related to
Categories Local Generalized symptoms apheresis Allergic reactions Other serious complications Other
Haematoma Vasovagal reaction, no loss Citrate reactions Local allergic reaction Acute cardiac symptoms
of consciousnessa (other than myocardial
infarction or cardiac
arrest)
Arterial puncture Vasovagal reaction, loss of Haemolysis Generalized Myocardial infarction
consciousnessa anaphylactic
reaction
Delayed bleeding Air embolism Cardiac arrest
Nerve injury/irritation Infiltration Transient ischaemic attack
Arm pain Cerebrovascular accident
Localized infection/ Death
inflammation of vein
or soft tissues
Other major blood vessel
injuryb

Can be further subdivided by loss of consciousness < or ≥ 60 seconds, with or without injury, on or outside collection site.
a

b
Deep venous thrombosis, arteriovenous fistula, compartment syndrome, brachial artery pseudoaneurysm.

haematoma, this is imputability level 1. All AR with a severity score of
≥level 3 are considered SAR.
A national standard operating procedure (SOP) was written and
made available online at the webpage of the Danish Society of Clinical
Immunology (www.dski.dk). Especially, imputability assessment is
known to be difficult, and to our knowledge, no international guide-
line exists. Therefore, examples of different levels of imputability
were included in the SOP as were rating examples of category and
severity. Furthermore, it was defined in the SOP that AR with a sever-
ity ≥2 must be reported to the Blood donors in Denmark for evaluation
of the need to apply for donor compensation and AR with a severity
≥3 must be reported to the Danish Patient Safety Authority.
Registration of an AR
The code is assigned in the blood bank IT system and can be assigned
in relation to the donation procedure, or it can be assigned later on if
the donor reports an AR at any stage after the donation, for example,
at the following donation. The code can also be changed if needed,
for example, if the severity grade changes.
It was defined by the Haemovigilance Committee that by the time
of notification, AR should always be evaluated and rated in all parame-
ters, for example, category, severity and imputability. In case of ongoing
or unresolved complications where severity could increase due to dura-
tion (symptoms persisting more than 6 months) or development of need
for treatment, an additional severity code should be added to the AR
registration. If the AR has been reported to and is administratively han-
dled by the Blood donors in Denmark, they will notify the responsible BE
so the registered AR can be changed accordingly.
Regional implementation
In each region, a local edition of the national SOP was made and pres-
ented to the regional haemovigilance committees by their local member
of the national committee. The ISBT categories had not previously been
used in any of the five regions. In the IT system, Blodflödet, the three
parameters had to be rated separately, this was a drawback compared
to the previous AR registration system. This introduced the risk of omit-
ting one or more parameters in the registration. To address this, the
staff were trained in using the new system during a 3-month period
prior to the national implementation. In the ProSang IT system, only a
three parameter code was acceptable. In the regions using the ProSang
IT system, the new registration system was introduced at staff meet-
ings. It was decided that no formal training was needed since both the
registration functionality in ProSang and the registration of donor AR
were familiar to the staff. The staff was regularly reminded to use the
new system. Follow-up teaching sessions were done at most sites, but
the frequency, duration and format of the sessions varied from site
to site.
Data collection
The data were collected from January 2020 to December 2020, all
data were harvested from the databases in January 2021. All five
regions were asked to provide the complete raw data set for 2020.
For each AR, the following variables were also asked to be included:
donation ID, donor age, gender, donor status (first time/repeat donor)
and donation type. Furthermore, the denominators for each of the
listed variables were requested.
324 MIKKELSEN ET AL.

TABLE 2 The distribution of severity levels and imputability of the registered adverse reactions

Severity Total

Imputability Grade 1 Grade 2 Grade 3 Grade 4 Grade 5 Grade not defined Total Percentage
Definite 3553 36 3 1 0 41 3634 82.0%
Probable 398 25 3 0 0 4 430 9.7%
Possible 88 6 1 0 0 0 95 2.1%
Unlikely 5 0 0 0 0 0 5 0.1%
Not defined 68 2 0 0 0 196 266 6.0%
Total 4112 69 7 1 0 241 4430 100
Percentage 92.8% 1.6% 0.2% 0.02% 0.0% 5.4% 100
Rate per 100,000 donations 1.391 23 2 0.3 0

TABLE 3 The distribution of adverse reactions by donation type

Category Whole blood Plasmapheresis Platelet-apheresis Total Percentage

Vessel injury
Haematoma 505 940 25 1470 33.2%
Arterial puncture 7 0 0 7 0.2%
Delayed bleeding 47 129 0 176 4.0%
Thrombophlebitis 0 0 0 0 0%
Deep venous thrombosis 0 1 0 1 0.0%
Compartment syndrome 0 0 0 0 0%
Pseudoaneurysm 0 0 0 0 0%
Arteriovenous fistula 0 0 0 0 0%
Pain
Nerve irritation (direct nerve injury) 60 54 0 114 2.6%
Nerve irritation (indirect by haematoma) 23 18 0 41 1.0%
Painful arm 38 35 0 73 1.6%
Vasovagal reaction
On-site without LOC 1057 740 7 1804 40.7%
On-site with LOC 123 77 5 205 4.6%
After leaving site without LOC 29 14 0 43 1.0%
After leaving site with LOC 16 4 0 20 0.5%
Apheresis
Citrate 5a 31 233 269 6.1%
Infiltration 0 43 0 43 1.0%
Air embolus 0 1 0 1 0.0%
Haemolysis 1 1 1 3 0.1%
Allergic reaction
Local reaction 3 5 0 8 0.2%
Anaphylactic reaction 0 0 0 0 0%
Miscellaneous
Other 3 82 0 85 2.0%
No category 33 33 1 67 1.5%
Total 1950 2208 272 4430 100

Note: All categories of adverse reactions in the new donor system are included.
Abbreviation: LOC, loss of consciousness.
a
These are considered a registration error of unknown type.
THE NEW DONOR VIGILANCE SYSTEM IN DENMARK 325

TABLE 4 Number of procedures, registered haematomas and registered citrate reactions by donation type and region

Region 1 Region 2 Region 3 Region 4 Region 5

Number of whole blood donations 69,676 27,796 40,090 45,451 20,459
Number of plasmapheresis 17,171 15,266 26,583 20,944 10,727
Number of platelet apheresis 498 272 299 155 250
Haematomas per 100,000 donations
Whole blood donation 195 133 222 240 65
Plasmapheresis 582 583 673 1810 1799
Platelet apheresis 2811 0 1003 3226 1200
Citrate reactions per 100,000 donations
Plasmapheresis 47 72 11 19 47
Platelet apheresis 45,783 0 334 0 0

TABLE 5 Donor characteristics of the registered adverse reactions according to sex

Rate per 100,000 first-time or

Female Male Total repeat donations, respectively

Donor status N D N D N D Female Male Both gender

First-time donor 410 10,544 217 6551 627 17,095 3888 3312 3668
Repeat donor 2043 131,373 1760 147,169 3803 278,542 1555 1196 1365

Rate per 100,000 donations

Female Male Total in the same age group

Age groups N D N D N D Female Male Both gender

17–18 years 86 2271 28 948 114 3219 3787 2954 3541
19–22 years 327 12,456 186 6469 513 18,925 2625 2875 2711
23–29 years 558 28,334 446 23,535 1004 51,869 1969 1895 1936
≥30 years 1482 98,856 1317 122,768 2799 221,624 1499 1073 1263

Female Male Total Rate per 100,000 donations

Donation type N D N D N D Female Male Both gender

Whole blood 1292 107,934 658 95,538 1950 203,472 1197 689 958
Plasmapheresis 1028 33,614 1180 57,077 2208 90,691 3058 2067 2435
Platelet apheresis 133 369 139 1105 272 1474 36,043 12,579 18,453
Total 2453 141,917 1977 153,720 4430 295,637 1728 1286 1498

Note: The number of cases (N) and number of donors at risk (denominator, D) are presented for all groups.

Statistical analysis
The analysis was performed on both the pooled national data and the
regional data. If more than one severity score was registered for an
AR, the highest score was included in the analysis.
RESULTS
Combined results for all types of donations
A total of 4430 AR were registered among 295,637 donations in
Denmark in 2020. The overall rate of AR was 1498 per 100,000 dona-
tions. Ninety-four percent of the registered reactions were mild with
a severity score ≤2, and among these, 92% were graded definite or
probable (Table 2). Only 0.2% (8/4430) SAR were registered, all with
an imputability of ≥1, giving a SAR rate of 2.7 per 100,000 donations.
The most common AR registered were vasovagal reactions at the
donation site (41% without loss of consciousness [LOC] and 5% with
LOC), followed by haematomas (33%) and citrate reactions in relation
to platelet apheresis (6%) (Table 3). For all three categories, the vast
majority of AR were mild with a severity score of ≤2. For the eight
SAR, five of these were vasovagal reactions (63%) and included both
onsite and off-site reactions with and without loss of consciousness
and the remaining three were nerve injuries.
For haematomas and citrate reactions, large regional differences in
registration were seen (Table 4). In total, 97% of the citrate reactions
registered in relation to platelet apheresis were registered in the same
326
region. The overall differences in registrations of citrate reactions were
not associated with a regional increase in number of apheresis.
Results for the individual types of donation
The rate of AR was 958 per 100,000 whole blood donations, 2435
per 100,000 plasmapheresis and 18,453 per 100,000 platelet aphere-
sis. Compared to whole blood donations, the apheresis procedures
have a higher proportion of AR within all categories.
Results based on donor characteristics
Overall, the majority of AR recorded occurred in returning donors,
predominantly female and 37% were in the age groups below
30 years of age (Table 5). However, only 25% of the total number of
donors donating in 2020 were under the age of 30, and a significant
increase in the AR rate was seen with decreasing age. For the youn-
gest donors between 17 and 18 years of age, a 2.8-fold higher risk
of AR was registered compared to those above 30 years of age.
In 2020, 86% of all AR was registered in return donors, but the
AR rate per 100,000 donations was 2.7-fold higher in first-time
donors. This means that 14% of all AR occurred in 5.8% of the donors.
DISCUSSION
In this study, we present the results of a national registration system
of AR in blood donors build on existing international definitions. This
new system has several advantages.
First, as shown here, it is easily implemented in different IT sys-
tems and intuitive to use for the blood bank staff. Second, by creating
a national guideline, the data registration has been standardized and
together with the existing follow-up system, it now ensures a stan-
dardized reporting to the competent authorities as well as an enor-
mous improvement of the monitoring of donor vigilance in Denmark.
Finally, the system has proven very flexible and can easily be changed
if new international definitions or standards are introduced.
However, some important limitations and findings need to be con-
sidered. First and foremost, the data shows the regional difference. The
overriding example being citrate reactions in platelet apheresis donors.
One region had a significantly higher number of citrate reactions; this
might be because their staff frequently ask the donors about any per-
ceived discomfort during the apheresis procedure and that all reactions
reported by the donors are registered regardless of the level of discom-
fort or need of interventions. Other regions reported that donors were
informed of the risk before the procedure and to let the staff know of
any discomfort, and therefore, only reactions mentioned unsolicited
were registered. We, therefore, anticipate that the regional differences
are caused by differences in what is considered an AR (and, therefore,
must be registered) and what is simply a normal and expected reaction
to the donation procedure. Only by increasing the standardization of
MIKKELSEN ET AL.
definitions at all levels in the blood collection procedure can we make
the data fully standardized and comparable.
Second, registration is performed differently in the two IT systems. In
ProSang system, registration of all three parameters is mandatory and is
registered at the same time, while in the system Blodflödet, the parame-
ters are registered separately. Due to this, approximately 11% of the reg-
istrations are short of at least one code, either a severity and/or an
imputability code. It can be due to simple omission but could also indicate
difficulties in choosing the code to assign. In general, most AR were given
an imputability score of definite or probable and the feedback from the
blood bank staff was that they found it difficult to assess. Third, there are
large regional differences in the educational background of the users of
the new registration system. In some regions, only medical doctors assess
and register donor AR, and in other regions, this is predominantly per-
formed by donation staff or administrative personal. Therefore, it is
needed to revisit the definitions and further specify them, but also to do
so taking into account the broad group of users and their different educa-
tional backgrounds and training. As part of this, we will perform a national
study of the user perception and understanding of the new system.
Fourth, this system relies to a large degree on the feedback from
the donors, giving a risk of underreporting.
Finally, this data was registered in 2020 during the SARS-CoV 2 pan-
demic, which has been shown to have had an effect on donor behaviour
and thereby donor demographics [12–14]. It is, therefore, very likely that
the results presented in Table 5 will vary quite significantly compared to
the future data collections. Currently, no other countries have published
their 2020 data, which means that we by now have no international
2020 data to compare our registrations with. However, when looking at
previous reports, in their 2019 SHOT report, the United Kingdom
reported a SAR rate of 0.23 per 10,000 donations, a rate similar to their
registrations in the previous 4 years. And in their 2018–2019 national
haemovigilance report, Australia reported an AR rate across all types of
donations of 325.50 per 10,000 donations and a significantly higher rate
for platelet apheresis compared to whole blood and plasma donation.
Based on these, our rates seem to be at similar levels.
In Denmark, the collection of plasma for fractionation by plasma-
pheresis has increased substantially, especially in the two regions that
opened a plasmapheresis centre in 2020. At the same time, the num-
ber of whole blood collections has decreased because of a reduction
in the use of red cells during the last years. Collecting of data is impor-
tant to elucidate, for example, potential change in the type of AR due
to changes in the number of donation types, such as a raised number
of plasmapheresis. Data shows that the rate of AR is twice as high
among plasma donations than whole blood donations. As for whole
blood, the most common AR in plasma donations were haematomas
and vasovagal reactions.
In Denmark, the same type of equipment is used nationwide for
plasmapheresis, but not for platelet apheresis. Therefore, it is planned
to analyse data from 2021 to see if the differences in registered AR
are due to differences in registration practices or in the donation pro-
cedure. If the donors in some regions are continuously exposed to
unsolicited questions concerning minor citrate discomfort they might
think that they are not suited for apheresis donation, and therefore,
THE NEW DONOR VIGILANCE SYSTEM IN DENMARK
be likely to have a lower returning rate. However, the opposite may
also occur, that is, the high level of attention from staff causes the
donors to feel well taken care of which might increase the return rate.
Even so, a national work to harmonize definitions must commence,
however, if so, we also propose this to be raised to an international
level to ensure consistent registration across countries.
In the future, the Danish Haemovigilance Committee expects to
publish the annual donor vigilance reports on dski.dk.
In conclusion, Denmark has succeeded in creating a national
donor vigilance system with the use of international standards. We
have found AR in relation to blood donation to be rare. The system
has shown its potential as a valuable tool to identify regional, and
potentially international, differences in order to identify areas of
improvement. However, this first year has also shown that in order to
benefit from the full potential of the system there is a need to define
how an AR is distinguished from harmless and expected donation-
associated discomfort, not only in Denmark but also internationally.
ACKNOWLEDGEMEN TS
B.S.S. compiled and analysed the data; C.M. wrote the first draft of
the manuscript and H.M.P., M.T.B., L.Ø.P., S.H., R.L. and B.A. all
reviewed and edited the manuscript.
CONF LICT OF IN TE RE ST
The authors declare no conflict of interests.
ORCID
Christina Mikkelsen https://orcid.org/0000-0002-2945-6197
Helene Martina Paarup https://orcid.org/0000-0003-1281-1567
Rune Larsen https://orcid.org/0000-0002-7635-8012
RE FE R ENC E S
1. Wood EM, Ang AL, Bisht A, Bolton-Maggs PH, Bokhorst AG,
Flesland O, et al. International haemovigilance: what have we learned
and what do we need to do next? Transfus Med. 2019;29:221–30.
2. Mikkelsen C, Mori G, van Walraven SM, Castrén J, Zahra S,
MacLennan S, et al. Putting the spotlight on donation-related risks
and donor safety - are we succeeding in protecting donors? Vox
Sang. 2021;116:313–23.
3. Sorensen BS, Johnsen SP, Jorgensen J. Complications related to
blood donation: a population-based study. Vox Sang. 2008;94:
132–7.
327
4. Riga A, Sapey T, Bacanu M, Py JY, Dehaut F. Blood donors - serious
adverse reactions (SAR) 2010-2014 EFS Châteauroux, France. Transfus
Clin Biol. 2015;22:62–5.
5. Burkhardt T, Dimanski B, Karl R, Sievert U, Karl A, Hübler C, et al.
Donor vigilance data of a blood transfusion service: a multicenter
analysis. Transfus Apher Sci. 2015;53:180–4.
6. Wiersum-Osselton JC, Marijt-Van Der Kreek T, Brand A,
Veldhuizen I, van der Bom JG, de Kort W. Risk factors for complica-
tions in donors at first and repeat whole blood donation: a cohort
study with assessment of the impact on donor return. Blood Transfus.
2014;12(Suppl 1):28–36.
7. Politis C, Wiersum JC, Richardson C, Robillard P, Jorgensen J,
Renaudier P, et al. The International Haemovigilance Network data-
base for the surveillance of adverse reactions and events in donors
and recipients of blood components: technical issues and results.
Vox Sang. 2016;111:409–17.
8. Goldman M, Land K, Robillard P, Wiersum-Osselton JC. Develop-
ment of standard definitions for surveillance of complications related
to blood donation. Vox Sang. 2016;110:185–8.
9. Land KJ, Townsend M, Goldman M, Whitaker BI, Perez GE,
Wiersum-Osselton JC. International validation of harmonized defini-
tions for complications of blood donations. Transfusion. 2018;58:
2589–95.
10. Wiersum-Osselton JC, Marijt-van der Kreek T, de Kort WLAM.
Donor vigilance: what are we doing about it? Biologicals. 2012;40:
176–9.
11. Mikkelsen C, Mori G, van Walraven SM, Castrén J, Zahra S,
MacLennan S, et al. How donor selection criteria can be evaluated with
limited scientific evidence: lessons learned from the TRANSPOSE
project. Vox Sang. 2021;116:342–50.
12. Masser BM, Hyde MK, Ferguson E. Exploring predictors of
Australian community members’ blood donation intentions and
blood donation-related behavior during the COVID-19 pandemic.
Transfusion. 2020;60:2907–17.
13. Vassallo RR, Bravo MD, Kamel H. Pandemic blood donor demo-
graphics – do changes impact blood safety?. Transfusion. 2021;61:
1389–93.
14. Gammon RR, Prichard AB, Gannett MS, Yordanov B. The effect of
COVID-19 on blood donation habits. Transfusion. 2021;61:1134–40.
How to cite this article: Mikkelsen C, Paarup HM, Bruun MT,
Pedersen LØ, Hasslund S, Larsen R, et al. The new donor
vigilance system in Denmark reveals regional differences in
adverse reactions supposedly caused by variation in the
registration. Vox Sang. 2022;117:321–7.
Received: 5 May 2021 Revised: 9 July 2021 Accepted: 20 July 2021

DOI: 10.1111/vox.13189

ORIGINAL ARTICLE

Challenging the 30-min rule for thawed plasma

Sandra Ramirez-Arcos1,2 | Anita Howell1 | Jennifer Bearne3 | Varsha Bhakta1 |

4 4 5 1
Lucy Bower | Rebecca Cardigan | Mélissa Girard | Yuntong Kou |
Carl McDonald3 | Marie-Ève Nolin5 | Danuta Sawicka3 | William Sheffield1

1
Centre for Innovation, Canadian Blood
Services, Ottawa, Ontario, Canada Abstract
2
Department of Biochemistry, Microbiology Background and Objectives: Frozen plasma (FP) is thawed prior to transfusion and
and Immunology, University of Ottawa,
Ottawa, Ontario, Canada
stored for ≤5 days at 1–6 C. The effect of temperature excursions on the quality and
3
National Bacteriology Laboratory, National safety of thawed plasma during 5-day storage was determined.
Health Service Blood and Transplant, Materials and Methods: Four plasma units were pooled, split and stored at ≤ 18 C
London, UK
4 for ≤90 days. Test units T30 and T60 were exposed to 20–24 C (room temperature
Component Development, National Health
Service Blood and Transplant, Cambridge, UK [RT]) for 30 or 60 min, respectively, on days 0 and 2 of storage. Negative and positive
5
Medicals Affairs and Innovation, control units remained refrigerated or at RT for 5 days, respectively. On Day 5, test
Héma-Québec, Québec, Quebec, Canada
units were exposed once to RT for 5 h. Quality assays included stability of coagulation
Correspondence factors FV, FVII, FVIII, fibrinogen and prothrombin time. Bacterial growth was per-
Sandra Ramirez-Arcos, Centre for Innovation,
formed in units inoculated with ~1 CFU/ml or ~100 CFU/ml of Serratia liquefaciens,
Canadian Blood Services, Ottawa, Ontario,
Canada. Pseudomonas putida, Pseudomonas aeruginosa or Staphylococcus epidermidis on Day 0.
Email: sandra.ramirez@blood.ca
Results: Testing results of all quality parameters were comparable between T30 and
Funding information T60 units (p < 0.05). Serratia liquefaciens proliferated in cold-stored plasma, while
Health Canada; Héma-Québec; Canadian P. putida showed variable viability. Serratia epidermidis and P. aeruginosa survived but
Blood Services; NHSBT
did not grow in cold-stored plasma. Positive and negative controls showed expected
results. Overall, no statistical differences in bacterial concentration between T30 and
T60 units were observed (p < 0.05).
Conclusion: Multiple RT exposures for 30 or 60 min do not affect the stability of
coagulation factors or promote bacterial growth in thawed plasma stored for 5 days.
It is therefore safe to expose thawed plasma to uncontrolled temperatures for limited
periods of 60 min.

KEYWORDS
30-min rule, plasma quality, plasma safety, thawed plasma

I N T R O D U CT I O N cryoprecipitate CPD [1]. For the present study, we focussed on FP,

Plasma components are transfused for the management of patients
who have massive bleeding or require replacement of plasma coagu-
lation factors. Plasma transfusion is also recommended for patients
with clinically significant coagulation abnormalities [1]. Plasma
components include apheresis fresh frozen plasma, frozen plasma
(FP), cryoprecipitate plasma citrate-phosphate-dextrose (CPD) and
which is prepared from whole blood and frozen within 24 and 27 h
of collection in Canada and the United Kingdom, respectively. FP is
stored at temperatures ≤ 18 C for a maximum of 12 months in
Canada and at ≤ 25 C for 3 years in the United Kingdom. Thawing
prior to transfusion is performed in watertight plastic overwraps
under gentle agitation in a water bath set at 30–37 C in Canada,
while in the United Kingdom, most hospitals use plasma thawers.

328 © 2021 International Society of Blood Transfusion. wileyonlinelibrary.com/journal/vox Vox Sanguinis. 2022;117:328–336.
30-MIN RULE OF THAWED PLASMA
Thawed plasma can be stored for a maximum of 120 h (5 days) at
1–6 C in both Canada and the United Kingdom [1, 2].
Plasma collection, manufacturing, thawing conditions and storage
vary widely in different blood centres. It is important to acknowledge
that these conditions in addition to the genetic background and gen-
der of the plasma donor would affect the coagulation factor content
of plasma components [3]. Furthermore, thawing and post-thawing
storage greatly impact the stability of coagulation factors. Sheffield
et al. confirmed previous studies that had demonstrated that the
activity of coagulation factors, especially FVIII, significantly decline
within the first 24 h of thawing and then remain stable for the

remaining 4 days of storage at 1–6 C [4]. Despite the paucity of evi-
dence linking coagulation factor levels to post-transfusion clinical effi-
cacy, transfusion services and their regulators have sought to limit
such losses of procoagulant activity in transfusable plasma to this level
[5].
Little published information is available regarding the potential
increased risk of septic transfusion reactions with thawed plasma. As
stated by Cardigan and Green [2], the risk of a septic transfusion reac-
tion due to bacterially contaminated plasma is very low mainly
because the storage conditions of thawed plasma (1–6 C) limit bacte-
rial growth and the units remain closed after thawing. In 2016, the
Food and Drug Administration (FDA) documented a possible fatal sep-
tic transfusion case involving a plasma unit contaminated with
coagulase-negative Staphylococcus [6]. A thawed plasma contami-
nated with Bacillus sp was also implicated in a transfusion reaction
reported to the National Healthcare Safety Network Hemovigilance
Module [7]. Coutinho et al., [8] reported a case of Staphylococcus
aureus septicaemia involving a contaminated platelet concentrate.
During the investigation of that event, it was found that the associ-
ated FP unit also grew S. aureus. Similarly, during an investigation of a
platelet unit with a positive result for the skin-contaminant Staphylo-
coccus capitis at Canadian Blood Services [9], the associated red blood
cell (RBC) and FP components were found to be contaminated with
the same organism. In a study conducted to investigate the presence
of oral bacteria in the plasma and RBC fractions from blood samples
of healthy donors, the authors reported that a great number and vari-
ety of bacteria are present in the plasma fraction of blood donations,
with Staphylococcus epidermidis being the major contaminant [10].
Most recently, the same authors compared bacteria isolated from
whole blood of healthy blood donors with donors who have under-
gone periodontitis. A higher bacterial concentration was found in
infected donors, with bacteria such as Cutibacterium acnes and
coagulase-negative staphylococci isolated predominantly from RBC
and plasma fractions [11]. Therefore, it seems that contaminated
plasma is not an unusual occurrence. In addition to the blood donor,
another source of contamination for thawed plasma could be the
water bath used for thawing. The Gram-negative bacteria Burkolderia
cepacia and Pseudomonas aeruginosa have been implicated in severe
transfusion reactions involving cryoprecipitate and FP, respectively,
that became contaminated in the water baths during the thawing pro-
cess [12, 13]. More recently, it has been shown that the Gram-
negative species Serratia liquefaciens, P. aeruginosa and Pseudomonas
329
putida were able to proliferate in thawed cryoprecipitate [14]. Frank
septic reactions even from platelet transfusions are rarely recognized
or reported by clinicians [15], despite widespread knowledge of the
higher risk of bacterial contamination. Hence, it is entirely likely that
septic transfusion reactions from FP would rarely be detected by clini-
cians and not reported through passive haemovigilance systems.
Bacterial growth is limited in RBC and plasma components due to
their refrigerated storage conditions. International standards have
established a ‘30-min rule’ that requires the discard of RBC units that
are exposed to uncontrolled temperature for more than 30 min. The
Canadian Standards Association has recently extended the 30-min
rule of RBC units to a 60-min rule in Canada. Similarly, a study con-
ducted by Aplin et al. provided data to propose an extension of
the 30-min rule for RBC units to a 60-min rule in the United
Kingdom [16].
The ‘4-h rule’, which states that transfusion of RBC units should
occur within 4 h after being issued from the blood bank, has also been
challenged. It has been demonstrated that bacterial growth in RBCs is
significantly increased after 2 h of continuous exposure to room tem-
perature (RT) [17]. Although similar studies have not been conducted
with thawed FP, transfusion services often extrapolate these ‘rules’
to FP storage leading to wastage, despite expected risks of bacterial
contamination being even lower than with RBCs. The ‘4-h rule’ was
the basis for the arm of the study conducted herein with plasma expo-
sure to RT for 5 h on Day 5 of storage.
Data from the Ministry of Health in Québec, Canada, show
that out of 427 plasma component discards that occurred between
1 April 2014 and 31 December 2015 due to the 30-min rule,
171 (40%) were FP units. At the Sunnybrook Health Sciences Cen-
tre in Toronto, Canada, 88 FP units were discarded in 2014 for
several reasons including 28 (32%) thrown away due to the 30-min
rule. These data demonstrate that it is important to collect evi-
dence to support or deny the 30-min rule for thawed plasma and
to obtain data related to the 4-h rule that applies during plasma
transfusion, which is the purpose of the multi-centre study
described herein.
M A T E R I A L S A N D M ET H O D S
Study design
The study was comprised of quality and bacterial growth arms with
methodology described in Tables 1 and 2. The quality assays were
repeated five independent times in each of the three testing sites
(Table 1), while bacterial spiking assays were repeated at least three
times for each bacterial species and concentration at each site
(Table 2). FP units collected in CPD anticoagulant were produced fol-
lowing each organization’s standard procedures. Plasma unit charac-
teristics of each site are described in Table S1. In batches of four,
ABO-matched plasma units were pooled together prior to freezing
and splitting to obtain four identical output units with a volume
between 255 and 285 ml. As Factor VIII varies between plasma of
330 RAMIREZ-ARCOS ET AL.

TABLE 1 Experimental design for thawed plasma quality assays

Four pooled and split plasma units (repeat five times per site)

Days Negative control quality (NCq) Positive control quality (PCq) Test unit 30-min quality (Tq30) Test unit 60-min quality (Tq60)

Pre-testing Store plasma frozen at ≤ 18 C for 30–90 days prior to thaw and entry into the study
0a • Thaw plasma unit
• Take and snap freeze aliquots for subsequent quality testingb
• Sample for baseline bacterial testing
Store at 1–6 C Store at 20–24 C • Expose unit at 20–24 C for • Expose unit at 20–24 C for 60 minc
30 minc • Store at 1–6 C
• Store at 1–6 C
2 Take and snap freeze aliquots for subsequent quality testingb
Store at 1–6 C Store at 20–24 C • Expose unit at 20–24 C for • Expose unit at 20–24 C for 60 minc
30 minc • Store at 1–6 C
• Store at 1–6 C
5 Not applicable • Take and snap freeze aliquots for subsequent quality testingb
• Expose units at 20–24 C for 5 hc
• Take and snap freeze aliquots for subsequent quality testingb
• Sample for bacterial testing
a
Day 0 is the day of thawing.
b
For logistical simplicity, all aliquots were snap frozen for subsequent testing.
c
Temperature exposures occur immediately post-thaw or moving out of refrigerated storage and include sampling time.

TABLE 2 Experimental design for bacterial growth assays

Four pooled and split plasma units (repeat three times for each species and spiking concentration, per site)

Days Negative control safety (NCs) Positive control safety (PCs) Test unit 30-min safety (Ts30) Test unit 60-min safety (Ts60)b
Pre-testing Store plasma frozen at ≤ 18 C for 30–90 days prior to thaw and entry into the study
0a • Thaw plasma unit
• Sample for baseline bacterial testing
• Spike at a target concentration of 1 or 100 CFU/ml
• Determine bacterial viability with the BACT/ALERT system
Store at 1–6 C Store at 20–24 C • Expose unit at 20–24 C for • Expose unit at 20–24 C for 60 minb
30 minb • Store at 1–6 C
• Store at 1–6 C
2 • Determine bacterial viability with the BACT/ALERT system
• Sample for determination of bacterial concentration
Store at 1–6 C Store at 20–24 C • Expose unit at 20–24 C for • Expose unit at 20–24 C for 60 minb
30 minb • Store at 1–6 C
• Store at 1–6 C
5 Not applicable • Determine bacterial viability with the BACT/ALERT system
• Sample for determination of bacterial concentration
• Expose units at 20–24 C for 5 hb
• Determine bacterial viability with the BACT/ALERT system
• Sample for determination of bacterial concentration
a
Day 0 is the day of thawing.
b
Temperature exposures occur immediately post-thaw or moving out of refrigerated storage and include sampling time.

groups O and non-O, units were selected at each participating site to
ensure that roughly half of the plasma batches for each arm were
comprised of group O units and half of the plasma batches were non-
group O. After the pool and split was complete, plasma units were

stored at < 18 C for a minimum of 30 days and a maximum of
90 days prior to testing.
Quality assays
Plasma units were tested for the following quality parameters:
FVIII (IU/ml), FVII (IU/ml), FV (IU/ml), prothrombin time (s)
and fibrinogen content (g/L). Automated coagulation analysers,
either from Diagnostica Stago (Canadian Blood Services) or
30-MIN RULE OF THAWED PLASMA 331

Instrumentation Laboratory (Héma-Québec and NHSBT), were
used in clotting-based assays following manufacturer’s instruc-
tions in all cases (see Table S1), as previously described [3, 4].
Bacterial growth assays
Bacterial strains used in this study were chosen based on their
ability to grow in platelet components (S. epidermidis PEI-B-P-06)
[18] or cryoprecipitate (S. liquefaciens CBS02-2006, P. aeruginosa
ATCC 27853 and P. putida) [14]. Importantly, P. aeruginosa and
P. putida have been implicated in septic transfusion
reactions involving contaminated plasma [12, 19]. Previous
studies have demonstrated that RBC units spiked at one colony
forming unit (CFU)/ml bacterial concentration support growth
of pathogenic psychrotrophic (grow at refrigeration tempera-
tures) bacteria [16, 17]. The same approach was therefore used
to spike plasma units. To test a higher bacterial concentration,
the assays were also performed with plasma units spiked with
100 CFU/ml.
Determination of plasma core temperature
Maximum plasma unit core temperatures during RT exposures for
30 or 60 min were determined in dummy (i.e., mock) units con-
taining a similar volume as the test units using temperature data
loggers. Dummy units were paired with the units of two repeti-
tions of the bacterial assays at both concentrations (1 and
100 CFU/ml) for a total of four measurements performed for
each exposure (30 or 60 min). Temperature measurements were
taken with exposures on the 3 days (days 0, 2 and 5) of plasma
storage.
Data analyses
Data from three sites (Canadian Blood Services, Héma-Québec
and the NHSBT) were analysed separately and combined. Bacterial
concentration data were log 10 transformed to obtain better sta-
tistical properties. Mean and standard deviations (SD) were calcu-
lated for each quality parameter and for each bacterium on each

F I G U R E 1 Quality of plasma unit after multiple 30-min (Tq30) or 60-min (Tq60) exposures to 20–24 C throughout storage and a 5-h
exposure to 20-24 C on Day 5 of storage. (a) Factor VIII activity (IU/ml); (b) factor V activity (IU/ml); (c) factor VII activity (IU/ml); (d) prothrombin
time (s) and (e) fibrinogen (g/L). Mean quality is presented with standard deviation indicated by upper error bar
332 RAMIREZ-ARCOS ET AL.

exposure day (Day 0, Day 2, and Day 5 before and after the 5-hour
exposure) by study groups of four unit types: positive control (PC),
negative control (NC), test unit exposed to RT for 30 min (T30) and
test unit exposed to RT for 60 min (T60). Mixed model analysis
was performed to examine if there were significant differences
between study groups and between exposure days. Comparisons
were performed to check significance between T30 and T60 or on
Day 5 before and after the 5-hour exposure. Temperature of
plasma units during exposures was also compared between sites
and between T30 and T60 units by site on each day. Tukey adjust-
ment was applied for the multiple comparisons between sites. All
the analyses were performed in Statistical Analysis System (SAS)
(SAS Institute Inc., SAS/STAT 9.4 User’s Guide, Cary, NC: SAS
Institute Inc., 2002–2012), and a p-value of <0.05 was considered
as statistically significant.
T30 and T60 units at any timepoint for any of the factors, except for
the difference in Factor VIII on Day 5 storage before and after the 5-h
exposure to RT and for the difference in prothrombin time between
Day 0 and Day 2 (Table S2).
Bacterial growth assays
Results of bacterial growth in plasma units inoculated with
100 CFU/ml are shown in Figure 2a–d. Results for units inoculated
with the lower concentration of 1 CFU/ml followed the same pattern
(data not shown).
Staphylococcus epidermidis

This bacterium lacks the ability to proliferate in cold-stored thawed

RESULTS
Quality assays
Results of the quality parameters of thawed plasma after multiple
30- or 60-min exposures are represented in Figure 1a–e. Statistical
analyses of the aggregated data from the three sites are summarized
in Table S2. The effect of temperature excursions during cold storage
of thawed plasma on quality parameters was comparable within sites.
No significant differences (p < 0.05) in quality were seen between
plasma independently of the initial concentration (1 or 100 CFU/ml)
(Figure 2a). Data from Canadian Blood Services at Day 5 pre-exposure
timepoint were marginally different (p = 0.0401) between T30 and
T60 units; however, the difference was <1 log. Similarly, for the aggre-
gated data, a difference was observed on Day 5 pre-exposure
(p = 0.0138) between Ts30 and Ts60 units; however, it was a <1 log
difference. Overall, the data show comparable concentrations of
S. epidermidis in T30 and Ts60 plasma units throughout thawed
plasma storage for 5 days or during a single 5-h exposure on Day
5 (Figure 2a).

F I G U R E 2 Bacterial concentration of plasma units after multiple exposures for 30-min (Ts30) or 60-min (Ts60) to 20–24 C throughout
storage and a 5-h exposure to 20–24 C on Day 5 of storage. (a) Staphylococcus epidermidis 100 CFU/ml; (b) Serratia liquefaciens 100 CFU/ml;
(c) Pseudomonas putida 100 CFU/ml and (d) Pseudomonas aeruginosa 100 CFU/ml. Mean bacterial concentration is presented with standard
deviation indicated by upper error bar. An asterisk (*) denotes statistical difference (p < 0.05) between T30 and T60 units
30-MIN RULE OF THAWED PLASMA 333

TABLE 3 Maximum core temperature of thawed plasma units during room temperature (RT) exposures

Maximum core Maximum core

temperature ( C) of temperature ( C) of
dummy unit paired with Ts30 dummy unit paired with Ts60
Testing T30 versus
Site day Mean (SD) Mean (SD) T60 p-value
Canadian Blood Services 0 22.38 (0.74) 22.38 (0.74) 1.0000
2 13.38 (0.52) 17.38 (0.52) <0.0001
5 21.50 (0.53) 21.25 (0.46) 0.3343
Héma Québec 0 25.98 (4.01) 28.05 (2.59) 0.4181
2 11.90 (0.54) 15.40 (0.35) <0.0001
5 21.65 (0.33) 21.85 (0.70) 0.6259
NHSBT 0 24.20 (2.94) 25.35 (1.91) 0.5368
2 14.50 (0.62) 19.15 (0.47) <0.0001
5 21.55 (0.19) 21.50 (0.12) 0.6704
Combined 0 23.73 (2.76) 24.54 (2.88) 0.4248
2 13.29 (1.08) 17.33 (1.44) <0.0001
5 21.55 (0.41) 21.46 (0.52) 0.5988

Note: Ts30, Test unit 30-min safety; Ts60, Test unit 60-min safety.

Serratia liquefaciens Determination of core plasma unit temperature

This bacterium is psychrotrophic and therefore can proliferate in
cold-stored thawed plasma even at the low initial concentration
of 1 CFU/ml as shown in Figure 2b. Statistical analyses revealed
no differences in bacterial concentration between T30 and T60
units in any of the concentrations or sites (p > 0.05). Importantly,
data from the NHSBT and Héma-Québec show that this species
proliferates during thawed plasma storage for 5 days (approxi-
mately 2 log increase in units with an initial inoculum of
100 CFU/ml from Day 0 to Day 5). Additionally, an increase in
bacterial concentration was observed during the single 5-h expo-
sure on Day 5 at Canadian Blood Services and the NHSBT
(Figure 2b).
Core temperatures of plasma units during RT exposures using
data loggers in dummy units paired with T30 and T60 units were
recorded in the three sites. Table 3 shows the maximum tempera-
tures reached during each exposure on days 0, 2 and 5 of thawed
plasma storage. No significant differences were observed
between maximum core temperatures reached in T30 and T60
units on days 0 and 5. However, significant differences in maxi-
mum core temperatures were observed between T30 and T60
units on Day 2. Significant differences (p < 0.05) were also
observed between sites on Day 2 for T30 and on Days 0 and
2 for T60.

DI SCU SSION
Pseudomonas aeruginosa
This multi-centre study showed that despite differences in produc-
This Gram-negative bacillus survived well but did not proliferate dur- tion methodology across sites, there is no material difference in
ing thawed plasma storage (Figure 2c). Statistical analyses revealed no quality or bacterial growth when plasma units are exposed multiple
differences in bacterial concentration between T30 and T60 units in times to RT for either 30- or 60-min during storage for 5 days. A 5-h
any of the concentrations or between sites (p > 0.05). room temperature exposure at the end of storage coupled with the
30- or 60-min exposures did not result in a materially significant
impact to quality or bacterial counts.
Pseudomonas putida Quality assays did not show significant differences between T30
and T60 units for any of the tested coagulation factor activities or the
This bacterium did not survive during thawed plasma storage at prothrombin time at any point in the study, including samples taken
Héma-Québec even at the highest initial concentration of after a 5-h exposure to RT on Day 5. As expected, 5-day refrigerated
100 CFU/ml, indicating plasma sensitivity. Statistical analyses rev- storage reduced labile factors FV, FVII and FVIII and increased the
ealed no differences in bacterial concentration between T30 and T60 prothrombin time, but had no effect on stable fibrinogen activity.
units in any of the concentrations or between Canadian Blood Ser- Additional temperature excursions of either 30- or 60-min duration,
vices and the NHSBT (p > 0.05) (Figure 2d). or two such excursions coupled with a final 5-h excursion did not
334
increase labile factor losses and therefore did no harm to product
quality. Indeed, for FVIII activity, the quality parameter that is argu-
ably of greatest interest to regulators in both Canada and the United
Kingdom, mean FVIII levels between samples refrigerated for 5 days
with no temperature excursion, and those subjected to the maximum
temperature excursions (T60) did not differ.
Plasma is transfused for a relatively short list of indications in
a variety of clinical situations, ranging from exchange transfusion
in thrombotic thrombocytopaenia purpura to address acquired or
inherited ADAMTS-13 deficiency, to treatment of trauma with
or without activation of massive transfusion protocols (MTP)
[2, 20–23]. The typical aim of plasma transfusion is therefore to
restore or augment coagulation. Pre-hospital plasma transfusion
has been shown to save lives versus saline infusion [24, 25], and
plasma-rich MTP have been associated with better outcomes than
those less reliant on plasma [26]. Nevertheless, there is no evi-
dence available to support the superiority of plasma units con-
taining higher levels of any particular plasma protein over those
containing less, with respect to achieving desirable clinical out-
comes [27, 28]. In the absence of such evidence, transfusion ser-
vices have sought to minimize losses of procoagulant activity in
transfusable plasma, while maintaining operational flexibility.
Plasma is transfused in North America following refrigerated
storage for up to 5 days for any indication [4, 29] and, in the
United Kingdom, only for patients suffering major unexpected
haemorrhage [2], despite the loss of up to half of its initial FVIII
activity. Recently, additional support for this approach has
emerged in a secondary analysis of data from a randomized clinical
trial of pre-hospital plasma transfusion, showing that plasma
thawed and refrigerated for either 0–2 days or 2–5 days showed
equivalent clinical benefit [30]. In this context, in this study, we
found no further loss of labile procoagulant activity resulting from
the temperature excursions studied. It is a reasonable extrapola-
tion that the clinical benefit of transfusing units subjected to these
temperature excursions would be no different from those not
so subjected, given no significant change in the coagulation
factors measured.
Although rare, septic transfusion reactions involving plasma
units have been reported [4, 5], and therefore, it is important not
to increase this safety risk by exposing thawed plasma units to
uncontrolled temperatures during cold storage. Our data showed
that S. liquefaciens proliferated during thawed plasma storage at
the NHSBT and Héma-Québec; however, there was no difference
(greater than one log) in bacterial concentration between T30 and
T60 units for any of the species in any of the testing sites. PC units
supported bacterial growth in all sites and species except for
P. putida, which self-sterilized in all units tested at Héma-
Québec at both concentrations. As described in Table S1, plasma
production for this study differed within the three sites. Canadian
Blood Services manufactured plasma units using a top/
bottom buffy coat separation method, while the NHSBT used a
semi-automated press method, and Héma-Québec produced
plasma units by the Atreus whole blood processing system.
RAMIREZ-ARCOS ET AL.
Whether this impacts residual white blood cells or other immune
factors responsible for plasma sensitivity (e.g., complement) is
unknown. It is also possible that the donor population influenced
the lack of growth of P. putida; however, similar results were not
observed for the other bacterial species at Héma-Québec, and,
therefore, self-sterilization was species-dependent. Notably,
S. liquefaciens increased two logs from Day 0 to Day 5 of thawed
plasma storage at the NHSBT and Héma-Québec independently of
RT exposures, confirming its psychotropic nature. Despite increase
in growth, clinically significant levels ≥105 CFU/ml [31] were not
reached. Additionally, this species showed growth (~1 log) over the
single 5-h RT exposure on Day 5. Similarly, we have shown prolif-
eration of S. liquefaciens in RBC units after exposure to RT for 2 h
[17]. These are important findings to consider as plasma and RBC
units could be exposed for up to 4 h to RT during transfusion
events.
Differences in the maximum core temperature reached during
30-min or 60-min exposures to RT in thawed plasma units were only
observed on Day 2 (Table 3). Temperatures on Day 0 reflect thawing
in warm water baths and temperatures on Day 5 were balanced as
the exposures to RT were for 5 h. Therefore, temperatures docu-
mented on Day 2 reflect real differences of the effect of exposures to
uncontrolled temperatures for either 30 or 60 min. Importantly, differ-
ences in core temperature of the plasma units did not affect quality
and safety outcomes. Similar results have been reported for RBC con-
centrates [16, 17].
In conclusion, results of our study demonstrate that it is safe to
expose thawed plasma to temperatures of 20–24 C for periods of
60 min, up to twice in addition to a single 5-h exposure, during 5 days
of refrigerated storage. Data from this study served as the basis to
update the current 60-min rule in Canada to include plasma units
(CSA Z902-15 Standard 10.10.5.1). Similarly, our data will inform the
Standing Advisory Committee on Blood Components (SACBC) and
recommend changing the Guidelines for the Blood Transfusion Ser-
vices in the United Kingdom and the British Committee for Standards
in Haematology Guidelines, to reflect the conclusions of our study.
Other centres can assess whether the data presented herein are suffi-
cient to extend the 30-min rule for plasma units. This would depend
on whether plasma manufacturing conditions compare to the ones
used by the participant centres of this study and on quality assurance
requirements in each site.
AC KNOW LEDG EME NT S
The authors are grateful to volunteer blood donors and Canadian
Blood Services netCAD Blood4Research Facility for blood collection
and production of plasma units used in this study. We would like to
thank Dr. Qi-Long Yi for assistance with statistical analyses. Funding
for the development study was provided by NHSBT, Héma-Québec,
Canadian Blood Services and Health Canada. The views expressed
herein do not necessarily represent those of the Canadian Federal
government.
S.R.A. conceived the study; S.R.A., C.M., M.G., R.C. and
W.S. designed the study protocols; A.H. led the execution of the
30-MIN RULE OF THAWED PLASMA 335

study, collected and analysed the data; V.B., Y.K., L.B., J.B. and 14. Ramirez-Arcos S, Jenkins C, Sheffield WP. Bacteria can proliferate in
D.S. performed the experiments outlined in this study. thawed cryoprecipitate stored at room temperature for longer than
4 h. Vox Sang. 2017;112:477–9.
S.R.A. wrote the manuscript and A.H., C.M., M.G., L.B. and
15. Hong H, Xiao W, Lazarus HM, Good CE, Maitta RW,
Y.K. provided critical comments. All authors agreed with the con- Jacobs MR. Detection of septic transfusion reactions to platelet
tent of the manuscript. transfusion by active and passive surveillance. Blood. 2016;127:
496–502.
16. Aplin K, Pitt T, Allen J, Roy A, Tidey K, Ball J, et al. Extending the
CONF LICT OF IN TE RE ST
30-minute rule for red cell units - investigation of the bacterial risk
The authors declare no conflicts of interest. of 60-minute exposures to ambient temperature. Vox Sang. 2019;
114:189–97.
ORCID
17. Ramirez-Arcos S, Mastronardi C, Perkins H, Kou Y, Turner T,
Sandra Ramirez-Arcos https://orcid.org/0000-0003-0705-4987 Mastronardi E, et al. Evaluating the 4-hour and 30-minute rules:
effects of room temperature exposure on red blood cell quality and
RE FE R ENC E S bacterial growth. Transfusion. 2013;53:851–9.
18. Störmer M, Arroyo A, Brachert J, Carrero H, Devine D, Epstein JS,
1. Plasma components. Circular of Information for the Use of Human
et al. Establishment of the first international repository for
Blood Components, Canadian Blood Services. https://blood.ca/sites/
transfusion-relevant bacteria reference strains: ISBT working party
default/files/COI_CPDPlasmaFFPA.pdf (2016). Accessed 20 Jan
transfusion-transmitted infectious diseases (WP-TTID), subgroup on
2016.
bacteria. Vox Sang. 2012;102:22–31.
2. Green L, Bolton-Maggs P, Beattie C, Cardigan R, Kallis Y,
19. Brecher ME, Hay SN. Bacterial contamination of blood components.
Stanworth SJ, et al. British society of haematology guidelines on the
Clin Microbiol Rev. 2005;18:195–204.
spectrum of fresh frozen plasma and cryoprecipitate products: their
20. O’Shaughnessy DF, Atterbury C, Bolton Maggs P, Murphy M,
handling and use in various patient groups in the absence of major
Thomas D, Yates S, et al. Guidelines for the use of fresh-frozen
bleeding (Br J Haematol. 2018;181:54-67). Addendum August 2020.
plasma, cryoprecipitate and cryosupernatant. Br J Haematol. 2004;
Br J Haematol. 2020;191:728–9.
126:11–28.
3. Cardigan R, Green L. Thawed and liquid plasma – what do we know?
21. Green L, Bolton-Maggs P, Beattie C, Cardigan R, Kallis Y,
Vox Sang. 2015;109:1–10.
Stanworth SJ, et al. British Society of Haematology
4. Sheffield WP, Bhakta V, Mastronardi C, Ramirez-Arcos S, Howe D,
Guidelines on the spectrum of fresh frozen plasma and
Jenkins C. Changes in coagulation factor activity and content of
cryoprecipitate products: their handling and use in various
di(2-ethylhexyl)phthalate in frozen plasma units during refrigerated
patient groups in the absence of major bleeding. Br J Haematol.
storage for up to five days after thawing. Transfusion. 2012;52:
2018;181:54–67.
493–502.
22. Cooper ES, Bracey AW, Horvath AE, Shanberge JN, Simon TL, et al.
5. Acker JP, Marks DC, Sheffield WP. Quality assessment of established
Practice parameter for the use of fresh-frozen plasma,
and emerging blood components for transfusion. J Blood Transfus.
cryoprecipitate, and platelets. Fresh-frozen plasma, cryoprecipitate,
2016;2016:4860284.
and platelets administration practice guidelines development task
6. Food and Drug Administration. Fatalities reported to FDA following
force of the College of American Pathologists. JAMA. 1994;271:
blood collection and transfusion. Annual summary for Fiscal Year
777–81.
2017. Rockville, MD: CBER Office of Communication, Outreach, and
23. Expert Working Group. Guidelines for red blood cell and plasma
Development. https://www.fda.gov/media/124796/download
transfusion for adults and children. CMAJ. 1997;156:S1–S24.
(2011). Accessed 8 Jul, 2021.
24. Sperry JL, Guyette FX, Brown JB, Yazer MH, Triulzi DJ, Early-
7. Haass KA, Sapiano MRP, Savinkina A, Kuehnert MJ, Basavaraju SV.
Young BJ, et al. Prehospital plasma during air medical transport in
Transfusion-transmitted infections reported to the national
trauma patients at risk for hemorrhagic shock. N Engl J Med. 2018;
healthcare safety network hemovigilance module. Transfus Med Rev.
379:315–26.
2019;33:84–91.
25. Pusateri AE, Moore EE, Moore HB, Le TD, Guyette FX,
8. Couthino H, Galloway A, Ajdukiewicz K, Cleeve V. A case of staphy-
Chapman MP, et al. Association of prehospital plasma transfusion
lococcus septicaemia following platelet transfusion. J Clin Pathol.
with survival in trauma patients with hemorrhagic shock when trans-
2010;63:262–3.
port times are longer than 20 minutes: a post hoc analysis of the
9. Greco-Stewart VS, Ali H, Kumaran D, Kalab M, Rood IGH, de
PAMPer and COMBAT clinical trials. JAMA Surg. 2020;155:
Korte D, et al. Biofilm formation by Staphylococcus capitis strains iso-
e195085.
lated from contaminated platelet concentrates. J Med Microbiol.
26. Brown JB, Cohen MJ, Minei JP, Maier RV, West MA, Billiar TR, et al.
2013;62:1051–9.
Debunking the survival bias myth: characterization of mortality dur-
10. Damgaard C, Magnussen K, Enevold C, Nilsson M, Tolker-Nielsen T,
ing the initial 24 hours for patients requiring massive transfusion.
Holmstrup P, et al. Viable bacterial associated with red blood cells
J Trauma Acute Care Surg. 2012;73:358–64.
and plasma in freshly drawn blood donations. PLoS One. 2015;10:
27. Stanworth SJ, Brunskill SJ, Hyde CJ, McClelland DBL,
e0120826.
Murphy MF. Is fresh frozen plasma clinically effective? A system-
11. Damgaard C, Saekmose SG, Nilsson M, Kilian M, Nielsen CH,
atic review of randomized controlled trials. Br J Haematol. 2004;
Holmstrup P. Periodontitis increases risk of viable bacteria in freshly
126:139–52.
drawn blood donations. Blood Transfus. 2021. https://doi.org/10.
28. Yang L, Stanworth S, Hopewell S, Doree C, Murphy M. Is fresh-
2450/2021.0336-20
frozen plasma clinically effective? An update of a systematic
12. Rhame FS, McCollough J. Nosocomial Pseudomonas cepacia infec-
review of randomized controlled trials. Transfusion. 2012;52:
tion. MMWR. 1979;28:289–90.
1673–86.
13. Casewell MW, Slater NG, Cooper JE. Operating theatre water-baths
29. Scott E, Puca K, Heraly J, Gottschall J, Friedman K. Evaluation and
as a cause of pseudomonas septicaemia. J Hosp Infect. 1981;2:
comparison of coagulation factor activity in fresh frozen plasma
237–47.
336 RAMIREZ-ARCOS ET AL.

and 24-hour plasma at thaw and after 120 hours of 1 to 6 degrees C SUPPORTING INF ORMATION
storage. Transfusion. 2009;49:1584–91. Additional supporting information may be found online in the
30. Reitz KM, Gruen DS, Guyette F, Brown JB, Yazer MH, Vodovotz Y,
Supporting Information section at the end of this article.
et al. Age of thawed plasma does not affect clinical outcomes or
biomarker expression in patients receiving prehospital thawed
plasma: a PAMPer secondary analysis. Trauma Surg Acute Care
How to cite this article: Ramirez-Arcos S, Howell A, Bearne J,
Open. 2021;6:e000648.
31. Jacobs MR, Good CE, Lazarus HM, Yomtovian RA. Relationship Bhakta V, Bower L, Cardigan R, et al. Challenging the 30-min
between bacterial load, species virulence, and transfusion reaction rule for thawed plasma. Vox Sang. 2022;117:328–36.
with transfusion of bacterially contaminated platelets. Clin Infect Dis.
2008;46:1214–20.
Received: 30 June 2021 Revised: 22 August 2021 Accepted: 29 August 2021

DOI: 10.1111/vox.13203

ORIGINAL ARTICLE

A pilot randomized clinical trial of cryopreserved versus

liquid-stored platelet transfusion for bleeding in cardiac
surgery: The cryopreserved versus liquid platelet-New Zealand
pilot trial

Shay McGuinness1,2,3 | Richard Charlewood4 | Eileen Gilder1,5 |

Rachael Parke1,2,3,5 | Katia Hayes6 | Sarah Morley4 Aous Al-Ibousi4 |
|
Renae Deans7 | Belinda Howe3 | Lacey Johnson8 | Denese C. Marks8 |
Michael C. Reade3,7,9 | Australian and New Zealand College of Anaesthetists Clinical
Trials Network | Australian and New Zealand Intensive Care Society Clinical Trials Group

1
Cardiothoracic and Vascular Intensive Care
Unit, Auckland City Hospital, Auckland, Abstract
New Zealand
Background and Objectives: Platelets for transfusion have a shelf-life of 7 days, lim-
2
Medical Research Institute of New Zealand,
Wellington, New Zealand
iting availability and leading to wastage. Cryopreservation at 80 C extends shelf-
3
Australian and New Zealand Intensive Care life to at least 1 year, but safety and effectiveness are uncertain.
Research Centre, School of Public Health and Materials and Methods: This single centre blinded pilot trial enrolled adult cardiac sur-
Preventive Medicine, Monash University,
Melbourne, Victoria, Australia gery patients who were at high risk of platelet transfusion. If treating clinicians deter-
4
New Zealand Blood Service, Auckland, mined platelet transfusion was required, up to three units of either cryopreserved or
New Zealand
liquid-stored platelets intraoperatively or during intensive care unit admission were
5
School of Nursing, The University of
Auckland, Auckland, New Zealand administered. The primary outcome was protocol safety and feasibility.
6
Greenlane Department of Cardiothoracic Results: Over 13 months, 89 patients were randomized, 23 (25.8%) of whom
Anaesthesia, Auckland City Hospital,
received a platelet transfusion. There were no differences in median blood loss up to
Auckland, New Zealand
7
Faculty of Medicine, University of
48 h between study groups, or in the quantities of study platelets or other blood
Queensland, Royal Brisbane and Women’s components transfused. The median platelet concentration on the day after surgery
Hospital, Herston, Queensland, Australia
8
was lower in the cryopreserved platelet group (122  103/μl vs. 157  103/μl,
Australian Red Cross Lifeblood, Alexandria,
New South Wales, Australia median difference 39.5 103/μl, p = 0.03). There were no differences in any of the
9
Joint Health Command, Australian Defence recorded safety outcomes, and no adverse events were reported on any patient.
Force, Canberra, Australian Capital Territory,
Multivariable adjustment for imbalances in baseline patient characteristics did not
Australia
find study group to be a predictor of 24-h blood loss, red cell transfusion or a com-
Correspondence posite bleeding outcome.
Shay McGuinness, Cardiothoracic and
Vascular Intensive Care Unit, Auckland City Conclusion: This pilot randomized controlled trial demonstrated the feasibility of the
Hospital, 2 Park Road, Grafton, Auckland protocol and adds to accumulating data supporting the safety of this intervention.
1023, New Zealand.
Email: shaymc@adhb.govt.nz Given the clear advantage of prolonged shelf-life, particularly for regional hospitals in
New Zealand, a definitive non-inferiority phase III trial is warranted.
Funding information
CVICU Research is supported in part by an
KEYWORDS
unrestricted grant from Fisher & Paykel
blood transfusion, cardiac surgical procedures, cryopreservation, haemorrhage, platelet
Healthcare Corporation Limited, Auckland,
New Zealand transfusion

Vox Sanguinis. 2022;117:337–345. wileyonlinelibrary.com/journal/vox © 2022 International Society of Blood Transfusion. 337
338
I N T R O D U CT I O N
Platelets are essential for haemostasis, providing a mechanical scaffold
for blood clot formation and catalysing the generation of thrombin by
activation of the coagulation cascade on their phosphatidylserine-rich
membrane surface [1]. In New Zealand (NZ), to prolong circulating
survival time in recipients, platelets for transfusion are stored in
 
plasma or additive solution at 20–24 C. The disadvantage of 20–24 C
storage is possible for bacterial growth, limiting shelf-life to 7 days.
While most countries discard 10%–20% of donated units [2], in NZ
the problem is worse due to a scattered population served by many
regional hospitals. In 2019, 29.8% of platelets (>6000 units) were dis-
carded due to expiry, costing NZ$5,260,000 (R. Charlewood, personal
communication, 2020). Consequently, regional hospitals typically only
stock 1–2 platelet units. Patients with life-threatening bleeding can
wait many hours for platelets to be delivered from central blood
banks, or they do not receive any platelets at all.
Cryopreservation using dimethylsulphoxide (DMSO) extends plate-
let shelf life to at least 1 year. Extensive preclinical assessments of
cryopreserved platelets have been published [3, 4]. Around 50% of the
thawed platelets are functional [5, 6], but these have a higher capacity
to bind factor V and produce more thromboxane A2 after adenosine
diphosphate (ADP) stimulation [7]. Platelet-derived microparticles, more
abundant and functionally distinct after cryopreservation, are also
haemostatically active [8]. In baboons, cryopreserved platelets had bet-
ter in vivo survival and function than did liquid platelets stored for
5 days [6]. Phase I human trials of cryopreserved platelets found lower
24-h platelet recovery counts in comparison to liquid-stored platelets,
but with survival times exceeding US Food and Drug Administration
requirements [9].
Only two-phase IIb randomized trials of cryopreserved platelets
have been published. In 1999, a single-centre trial randomized 73 car-
diac surgery patients to receive cryopreserved or liquid-stored platelets
[10]. No adverse effects were observed in the 24 patients who
received cryopreserved platelets. Blood loss in the patients who
received cryopreserved platelets was significantly less, despite lower
post-transfusion platelet increments and a tendency towards
decreased platelet survival. Cryopreserved platelets produced more
thromboxane A2 and generated more procoagulant activity in response
to stimulation, suggesting the freeze/thaw process ‘pre-activated’ the
platelets. However, the sample size was underpowered to assess
safety. More recently, the cryopreserved versus liquid platelet (CLIP)
pilot trial [11] enrolled 121 patients in four Australian hospitals, 41 of
whom were transfused platelets. There were no differences in bleeding
or adverse events. The accompanying editorial [12] commented on the
urgent need for more research in this field and the Australian investiga-
tors are now starting a larger study, CLIP-II (NCT03991481). Differ-
ences in production methods for cryopreserved platelets used by the
New Zealand Blood Service (NZBS) and Australian Red Cross Lifeblood
make a binational study impossible. Therefore, two separate studies
will be run—one in Australia (CLIP-II) and one in New Zealand (CLIP-
NZ). We present here the results of the CLIP-NZ Pilot study testing
the NZ method of producing cryopreserved platelets.
MCGUINNESS ET AL.
M A T E R I A L S A N D M ET H O D S
The CLIP-NZ pilot study (CLIP-NZ Pilot) was a double-blind, parallel-
group, single centre pilot trial conducted in a quaternary cardiotho-
racic surgical unit performing >1000 operations per year. The protocol
was approved by the Northern Region Health and Disability Ethics
Committee (16/NTA/89). Written informed consent was obtained preop-
eratively. The protocol was identical to that which had been prospectively
registered for the Australian CLIP pilot trial (ACTRN12612001261808),
other than the method of platelet preparation.
Study platelets
Group O low antibody titre (universal donor) cryopreserved platelets
apheresis in plasma (leucocyte depleted) were prepared by secondary
processing of the standard NZBS products, platelets apheresis in
plasma leucocyte depleted or platelets apheresis in additive solution
leucocyte depleted. The component is cryopreserved after routine bac-
terial testing and within 48 h of collection using 6% w/v DMSO. Such
platelets can be stored at ≤ 80 C for up to 1 year. The platelet unit is
manufactured in a storage bag that also contains plasma used for
reconstitution, separated from the platelets until after thawing
(Figure 1). When required for transfusion, the platelet–plasma unit is
placed in a 37 C water bath until reaching a temperature of 30 C, at
which point the plasma is gently mixed with the platelets to disperse
any clumps. Reconstituted cryopreserved platelets contain more than
40% of the platelets in the original component, and have a 6-h shelf-
life [13].
Up to three units of study platelets were transfused, after which
open-label platelets were provided for any subsequent orders. Study
platelets were covered by an opaque shroud to maintain blinding. This
shroud was temporarily removed by a clinician not involved in the
care of the patient to facilitate correct patient identification prior to
transfusion.
Patients randomized to receive liquid-stored platelets were trans-
fused leucocyte-depleted apheresis or pooled whole-blood derived
platelets in either additive solution or plasma, according to the avail-
able supply. The hospital blood bank selected the ABO and Rh group
according to its standard practice.
Inclusion and exclusion criteria
Cardiac surgery patients at high risk of platelet transfusion were iden-
tified by application of the Transfusion Risk Understanding Scoring
Tool (TRUST) score [14]: preoperative haemoglobin <13.5 g/dl,
female, redo surgery, preoperative creatinine >120 μmol/L, non-
elective surgery, >65 years, weight <77 kg and non-isolated surgery.
Patients with ≥3 TRUST criteria have a >65% chance of requiring a
red cell transfusion. The incidence of platelet transfusion in cardiac
surgery is 44% that of red cell transfusion [15], so a patient with ≥3/8
TRUST criteria has a 44%  65% = 29% chance of receiving platelets.
CRYOPRESERVED PLATELETS IN CARDIAC SURGERY: CLIP-NZ PILOT
F I G U R E 1 Cryopreserved platelet and plasma unit prior to
reconstitution
Patients were excluded if they had received a platelet transfusion
earlier during that hospital admission, were women of childbearing
age (18–55 years) (to avoid the risk of rhesus immunization), death
was deemed inevitable in <24 h (as mortality was a study endpoint),
had been enrolled previously in this study or in a clinical trial of a med-
ication (with the exception of aspirin) thought to influence bleeding,
had a known bleeding diathesis (for example, haemophilia or Von Wil-
lebrand Disease) associated with abnormal clotting on investigations
taken immediately preoperatively (platelets < 100,000, International
Normalized Ratio (INR) > 1.5, Activated Partial Thromboplastin Time
(aPTT) > 1.5  upper limit of normal), allergy to DMSO, objected to
receipt of human blood products, had intellectual impairment making
them unable to consent to surgery, or if their treating clinician
believed participation was not in their best interest.
Trial procedures
Patients were randomly allocated 1:1 to study groups using
computer-generated permuted block randomization. Indication for
platelet transfusion was not protocolized but left to the judgement of
clinicians informed by standard laboratory tests, thromboelastography
339
(TEG), clinical assessment of bleeding and national guidelines [16].
Study platelet transfusion could be commenced either in the operat-
ing theatre or at any time during the intensive care unit stay.
All trial patients underwent a lower limb duplex venous ultra-
sound between 48 and 96 h after surgery. No other aspect of routine
clinical care was affected by the trial.
Adverse events
Postoperative care involved continuous 1:1 monitoring by qualified
intensive care unit (ICU) nurses in a critical care environment. Every
2 h for the first 6 h after platelet administration the presence or
absence of 11 anticipated adverse events (skin flushing, rash, abdomi-
nal pain, unexplained marked agitation or somnolence, oliguria, 2nd or
3rd-degree heart block, systemic vasoconstriction [systemic vascular
resistance index > 2500 dyne s/cm5/m2], hypertension [Mean Arterial
Pressure (MAP) > 100] or sinus tachycardia or bradycardia [Heart Rate
(HR) > 120 bpm or <55 bpm]) was recorded. As many of these pertur-
bations are common after cardiac surgery, the treating physician was
required to judge whether each was an expected effect of the
patient’s condition or ‘unexplained’ and consequently a possible
effect of the platelet transfusion. Possible adverse events to be
recorded at any time included venous thromboembolic disease and
arterial occlusion. Several other markers of postoperative morbidity
were compared between groups (Table 4 and Table S4).
Statistics
The primary outcome of this pilot study was the safety and feasibility
of the trial protocol, and clinician acceptability assessed by recruit-
ment rate and protocol compliance. Secondary endpoints, assessed
for possible use as the primary endpoint to determine the sample size
and power in a subsequent phase III trial, included volume of blood in
the surgical drains from the time of ICU admission and requirement
for postoperative blood component transfusion. Accordingly, no sam-
ple size calculation was performed. Rather, it was determined that rec-
ruiting 20 patients who were ultimately transfused study platelets
would provide sufficient evidence of feasibility.
Data analysis
Categorical outcomes were compared using χ2 or Fisher exact tests as
appropriate, with mean differences in proportions along with the 95%
confidence interval (95% CI) of these differences presented. Continu-
ous outcomes were similarly expressed as medians, with the median
of differences between individuals in the two groups (and their 95%
CI) calculated using the Hodges Lehmann estimate, and compared
using Mann–Whitney U tests. To explore the effect of any baseline
study group imbalances, multivariable backward stepwise linear and
logistic regression modelling using p < 0.1 for retention of the
340 MCGUINNESS ET AL.

TABLE 1 Baseline characteristics randomized, of whom 23 (25.8%) underwent surgery and were trans-
Cryopreserved Liquid fused platelets (Figure 2). All nine surgeons had at least one patient
(n = 10) (n = 13) transfused study platelets. No patients were lost to follow-up.
Sex, male 9 (90) 5 (38.5) Between-group baseline imbalances were seen in sex, weight and inci-
Age, years, median (IQR) 69 (59–77) 73 (64–77) dence of diabetes (Table 1). Intraoperative complexity was equivalent

Blood group (Table S1).

One patient randomized to liquid-stored platelets was trans-
O 3 (30) 7 (54)
fused one unit of open-label (liquid stored) platelets before subse-
A 6 (60) 4 (31)
quently receiving 3 units of study platelets. This patient was
B 1 (10) 2 (15)
retained in the intention-to-treat analysis as part of the liquid-stored
AB 0 (0) 0 (0)
platelet group.
Rhesus D positive 8 (80) 10 (77)
All study platelets that were ordered from the hospital blood bank
Weight, kilograms, median (IQR) 82 (72–93) 72 (63–78) were transfused; no thawed units were wasted because they
Comorbidity exceeded their 6-h post-thaw shelf-life.
Previous myocardial infarction 0 (0) 1 (8)
Congestive heart failure 2 (20) 1 (8)
Chronic lung disease 2 (20) 1 (8) Blood loss
Chronic renal impairment 1 (10) 0 (0)
Diabetes 4 (40) 1 (8) There were no differences in the median intra- or postoperative blood

Main indication for surgery loss between study groups up to 48 h (Figure 3 and Table S2). Only
one patient returned to the operating theatre to manage bleeding at
Aortic valve 4 (40) 6 (47)
any time in the first three postoperative days. The BARC [17] ‘signifi-
Congestive heart failure 1 (10) 1 (8)
cant’ bleeding outcome was present in a numerically greater propor-
Endocarditis 1 (10) 0 (0)
tion of patients in the cryopreserved platelet group, but this
Mitral–tricuspid disease 1 (10) 4 (31)
difference did not reach statistical significance. Clinicians often only
Stable angina 2 (20) 1 (8)
commence postoperative anticoagulation and anti-platelet agents
Aortic root replacement 1 (10) 1 (8) once confident bleeding has settled; hence, this can be a surrogate for
Surgery included coronary artery 7 (70) 6 (47) haemostasis. There was no between-group difference in when these
bypass grafts
medications were commenced.
Inpatient for >24 h prior to surgery 7 (70) 6 (46)
Urgent surgery 7 (70) 8 (62)
Aspirin given within 7 days of 7 (70) 11 (85) Transfusion requirement
surgery

Note: Data are expressed as number (%) unless otherwise indicated.
Abbreviation: IQR, interquartile range.
variables listed in Table 1 was undertaken, with 24-h blood loss, units
of red blood cells (RBC) transfused and the Bleeding Academic
Research Consortium (BARC) composite bleeding endpoint [17] as
outcomes. In all cases, a 2-sided p-value of <0.05 was considered sig-
nificant. No adjustments were made for multiple comparisons. As
there were <5% missing data for all reported outcomes, no imputation
has been made. Analyses were performed using Stata version 12.1
(StataCorp, College Station, TX).
RESULTS
Protocol feasibility and acceptability to clinicians
All nine cardiac surgeons in our hospital agreed to patient randomiza-
tion. Between 26 June 2018 and 5 August 2019, 89 patients were
Table 2 and Table S3 compare the transfusion requirements in the
two study groups. There were no significant differences in the quanti-
ties of blood components transfused. The platelet concentration on
the day after surgery was lower in the cryopreserved platelet group
(Table 3). No other between-group laboratory indices differences
were seen on day 1.
Adverse events
There were no between-group differences in any of the safety out-
comes (Table 4 and Table S4). None of the 11 prospectively-sought
adverse events were recorded in any patient. Two patients in the
cryopreserved platelet group, but none in the liquid-stored group,
had died by 28-days postoperatively. The causes of death were not
related to any known adverse effect of cryopreserved platelets.
There were no pro-thrombotic arterial or venous complications,
including acute myocardial infarction, in either study group. No
adverse events were reported to the Data and Safety Monitoring
Committee (DSMC).
CRYOPRESERVED PLATELETS IN CARDIAC SURGERY: CLIP-NZ PILOT 341

FIGURE 2 Patient flow diagram

FIGURE 3 Blood loss through chest drains in the 48 h after intensive care unit (ICU) admission
342 MCGUINNESS ET AL.

TABLE 2 Efficacy outcomes: transfusion and haemostasis interventions required

Median of differences between

Cryopreserved (n = 10) Liquid (n = 13) groups (95% CI) p
Patients transfused RBC at any stage 8 (80) 12 (92) 12% ( 41% to 16%) 0.38
Number of RBC units transfused total, median (IQR) 2 (1–7) 1 (1–3) 0.5 ( 1 to 5) 0.47
Patients transfused FFP at any stage 6 (60) 8 (62) 2 ( 42 to 39) 0.94
Number of FFP units transfused total, median (IQR) 2 (0–4) 2 (0–3) 0 ( 2 to 2) 0.95
Patients transfused cryoprecipitate at any stage 4 (40) 4 (31) 9 ( 30 to 49) 0.65
Number of cryoprecipitate units transfused total, 0 (0–5) 0 (0–2) 0 (0–2) 0.40
median (IQR)
Patients transfused study platelet units
1 unit 4 (40) 8 (62)
2 units 4 (40) 4 (31)
3 units 2 (20) 1 (8)
Median number of study platelet units (IQR) 2 (1–2) 1 (1–2) 0 (0–1) 0.27

Note: Data are expressed as number (%) unless otherwise indicated.

Abbreviation: CI, confidence interval; FFP, fresh frozen plasma; IQR, interquartile range; RBC, red blood cells.

TABLE 3 Efficacy outcomes: laboratory indices

Median of differences
Cryopreserved (n = 10) Liquid (n = 13) between groups (95% CI) p
Platelet concentration day 1, 103/μl, 122 (92–154) 157 (140–178) 40 ( 73 to 3) 0.03
median (IQR)
Haemoglobin concentration day 1, g/dl, 86 (79–101) 91 (82–100) 3 ( 14 to 12) 0.75
median (IQR)
INR day 1, median (IQR) 1 (1–1) 1 (1–1) 0 (0–0) 0.36
APTT day 1, median (IQR) 37 (35–45) 35 (33–39) 2 ( 4 to 9) 0.49
Fibrinogen day 1, g/L, median (IQR) 2 (2–3) 2 (2–3) 0 ( 0 to 1) 0.83

Abbreviations: APTT, activated partial thromboplastin time; CI, confidence interval; INR, international normalized ratio; IQR, interquartile range.

TABLE 4 Safety outcomes

Median of differences
Cryopreserved (n = 10) Liquid (n = 13) between groups (95% CI) p
PaO2/FiO2 ratio 3 h post transfusion, median 284 (152–324) 280 (257–325) 17 ( 154 to 65) 0.73
(IQR)
Wound infection 0 (0) 0 (0) 0% (0%–0%) —
Systemic infection 0 (0) 0 (0) 0% (0%–0%) —
Deep venous thrombosis 0 (0) 1 (8) 8% ( 22% to 7%) 0.37
Acute myocardial infarction postoperatively 0 (0) 0 (0) 0% (0%–0%) —
Hospital length of stay, days, median (IQR) 9 (7–12) 12 (8–19) 4 ( 10 to 0) 0.07
28-day mortality, died 2 (20) 0 (0) 20% ( 5% to 45%) 0.09

Note: Data are expressed as number (%) unless otherwise indicated.

Abbreviation: IQR, interquartile range.

Coagulation indices
Changes in TEG indices were measured in 10 patients in the
cryopreserved platelet and 9 patients in the liquid-stored group
(Table S5), comparing values measured before study platelets were
administered with those recorded after the last unit of study platelets
that were transfused, however, many were required. On average,
platelet transfusion shortened R time and K time to a similar extent in
both study groups. These parameters are not typically affected by
platelet transfusion and it is possible that other blood components
CRYOPRESERVED PLATELETS IN CARDIAC SURGERY: CLIP-NZ PILOT
being transfused simultaneously might have been responsible. The
alpha angle and Maximum Amplitude (MA) also increased similarly in
both groups after platelet transfusion, suggesting more rapid forma-
tion of more stable clots (characteristic of platelet function). There
was minimal evidence of thrombolysis in either group.
Adjustment for baseline imbalances between groups
Multivariable regression modelling found, for 24-h blood loss, signifi-
cant (p < 0.05) predictors of higher blood loss were being blood group
B (while group O predicted less blood loss), having been an inpatient
prior to surgery, female sex and certain indications for surgery (aortic
valve or mitral/tricuspid valve surgery). Urgent surgery, premorbid
congestive heart failure and congestive heart failure as the indication
for surgery predicted lower blood loss. Study group allocation did not
predict blood loss at 24 h when adjusted for these factors. Significant
predictors of units of RBC transfused were having been an inpatient
>24 h prior to surgery, weight (as a continuous variable) and
premorbid chronic lung disease. Congestive heart failure or stable
angina as the indication for surgery predicted less RBC transfusion, as
did urgent surgery. Study group was not a significant predictor of
units of RBC transfused when adjusted for these factors. For BARC
bleeding, no significant predictors were identified in multivariable
regression.
DISCUSSION
This pilot randomized controlled trial enrolled an insufficient number
of patients to be sure of anything other than its intended primary out-
come. By randomizing 89 high-risk patients at a single hospital over
13 months, of whom 23 (25.8%) received platelet transfusions, the
overall acceptability of the protocol to participating clinicians was
demonstrated. The single patient transfused a unit of open-label
platelets prior to study platelets suggests that clinicians might occa-
sionally believe it is not in a patient’s interest to wait the slightly lon-
ger time for cryopreserved platelets to be thawed. There were no
safety concerns identified either in adverse event reporting during the
study, or in quantitative comparisons of study safety outcomes after
trial completion. The recruitment rate suggests a phase III trial of an
appropriate design would be feasible.
As expected in a study of this size, there were several potentially
important baseline imbalances between study groups that might
account for trends in differences (or lack thereof) in study outcomes.
While multivariable adjustment for these imbalances did not alter the
study conclusions, patient numbers are small. Consequently, there is a
high likelihood that failure to observe significant between-group dif-
ferences is a type II error. We did not adjust for the possible indepen-
dent effect of ‘surgeon’ on study outcomes, as this data were omitted
from our case report form. However, this is a potentially important
outcome predictor that will be important to understand in any subse-
quent definitive trial. One between-group difference also observed in
343
previous studies [10, 11, 18, 19] is worthy of comment. Patients ran-
domized to cryopreserved platelets had lower platelet count on the
first postoperative day. The mechanism of this effect is thought to be
the more rapid uptake from the circulation of cryopreserved platelets
due to their ‘pre-activated’ phenotype. In the Australian study,
patients randomized to cryopreserved platelets received a greater
number of study platelet units. This was possibly explained by clini-
cians transfusing to a target platelet count (rather than haemostasis
endpoints), less effectively achieved with cryopreserved platelets. We
did not observe the same effect in the CLIP-NZ Pilot trial, but the
numerical trend was in the same direction.
There were several differences between this NZ trial and the
Australian study [11]. Fewer patients had medical co-morbidities (total
number of recorded comorbidities 11 in 23 patients vs. 54 in 41
patients, p = 0.02); more than twice the proportion of patients (65%
vs. 29%, p = 0.005) underwent ‘urgent’ surgery and a higher propor-
tion of NZ patients (78% vs. 51%, p = 0.03) had received aspirin.
Slightly over half (57%) NZ patients received their first platelet trans-
fusion in the operating theatre, fewer than in Australia (80%)
(p = 0.04). These differences reflect the importance of conducting a
separate study in NZ, as many of these factors might interact with the
safety or effectiveness of cryopreserved platelets.
The extended shelf-life of cryopreserved platelets suggests dem-
onstrating non-inferiority in both safety and effectiveness would be
sufficient to change practice. Based on the results of this pilot study,
candidate non-inferiority primary outcomes would include blood loss
in drains at 24 h (we observed very little additional bleeding beyond
this time point), the BARC composite bleeding endpoint, and the total
number of red cell units transfused (noting almost all patients were
transfused red cells). Both this study and the Australian CLIP pilot trial
found adverse events were either very uncommon or did not occur.
A trial would need to be impractically large to have enough power to
be sufficiently sure that there were no differences in outcomes that
occur very rarely.
Despite its small size, our study has several strengths. Unlike the
largest phase IIb trial of cryopreserved platelets [10], which excluded
11 patients post-randomization for arguably invalid reasons (2 because
their cause of death was judged ‘unrelated’ to the transfusion,
3 because they received ε-aminocaproic acid, which was prohibited in
the trial and 6 because their bleeding was judged to have a ‘surgical’
cause), we analysed all randomized patients. We also actively sought
and reported all adverse events that might be anticipated based on
preclinical knowledge. All patients were screened for leg deep venous
thrombosis, and all patients were continuously monitored for possible
myocardial ischaemia. As the pilot study for a phase III pragmatic
effectiveness trial, we did not protocolize any aspect of patient care,
instead allowing physicians to decide when to transfuse platelets and
other blood components, and all other aspects of perioperative care.
The major limitation of our pilot trial is its small size. No conclu-
sion can be drawn from the lack of between-group differences
observed. While we identified no safety concerns with cryopreserved
platelets, absence of evidence is not equivalent to evidence of safety.
Nonetheless, our results enlarge the body of trial evidence in support
344
of safety: no trial [9–11, 18–20] or observational series [5] has found
evidence of coronary graft occlusion, myocardial ischaemia, venous
thrombosis, infection, respiratory complications or any other hypothe-
sized adverse effect of cryopreserved platelets. Clinicians in our trial
were blinded using an opaque shroud that could be removed easily.
We would have preferred to relabel study platelets, but regulatory
requirements prevented this. The opaque shroud method has been
used successfully in a 5000-patient trial of red cell storage duration
[21], and was used in the Australian CLIP study [11]. The dose of plate-
lets in one unit received by each trial group might not have been com-
parable. Cryopreserved platelets prepared by the NZBS contain ‘>40%
of the pre-freeze platelet content’ of a unit of apheresis platelets [13].
Patients in the liquid-stored group received either whole blood-derived
platelets or apheresis platelets, which both contain ‘a minimum platelet
content of 2.4  1011 per pooled unit’ [22]. This difference in platelet
count might explain the differences in day 1 platelet concentrations
observed. Finally, transfusion of a unit of cryopreserved platelets was
accompanied by the mandatory transfusion of plasma (109 ml) in which
the platelets were resuspended. The trial could, therefore, be a compar-
ison of platelets plus plasma versus platelets alone. This is a feature of
the study that must be understood rather than dismissed. In most
counties, cryopreserved platelets are resuspended in plasma. It would
be incorrect to attempt to separate the independent effects of the
plasma from the platelets in any clinical effectiveness trial. Similarly, the
time taken to thaw the plasma means a cryopreserved platelet unit
takes approximately 25 min longer to prepare than a liquid-stored unit.
It would be incorrect to attempt to separate the independent effect of
this delay from the therapeutic efficacy of the cryopreserved platelet
unit. Nonetheless, quantifying this delay is important. This has not been
possible in this pilot study, as the time platelets were requested from
the blood bank was not recorded. This additional information should be
collected in a subsequent definitive trial.
Given the clear advantage of prolonged shelf-life of cryopreserved
platelets, particularly in the dispersed regional hospitals of
New Zealand, a definitive phase III trial using a non-inferiority design
is warranted.
ACKNOWLEDGEMEN TS
Magdalena Butler, Keri-Anne Cowdrey, Jane Hallion, Philippa Neal,
Karina O’Connor, Samantha Wallace and Melissa Woollett, research
nurses in the Cardiothoracic and Vascular Intensive Care Unit,
Auckland City Hospital assisted in patient recruitment and data
collection. The work of the cryopreserved versus liquid platelet inves-
tigators, previously published, upon which this study protocol was
based, is acknowledged.
M.C.R. drafted the trial protocol, analysed the data and drafted
the manuscript. S.Mc.G., E.G., R.P. and K.H. finalized the trial protocol,
secured ethics approval and funding, recruited patients, collected data
and revised the manuscript for intellectual content. Critical elements
of the trial were designed by R.D. and B.H. R.C., S.M. and A.A.-I.
prepared the cryopreserved platelets according to a protocol based
on procedures developed by L.J. and D.C.M., S.Mc.G. and M.C.R. are
accountable for all aspects of the work.
MCGUINNESS ET AL.
CONFLIC T OF INT ER E ST
The authors declare no conflicts of interest.
ORCID
Shay McGuinness https://orcid.org/0000-0003-0620-4787
Richard Charlewood https://orcid.org/0000-0002-1798-1189
Sarah Morley https://orcid.org/0000-0002-2999-4737
Lacey Johnson https://orcid.org/0000-0003-3303-4437
Denese C. Marks https://orcid.org/0000-0002-3674-6934
Michael C. Reade https://orcid.org/0000-0003-1570-0707
RE FE RE NCE S
1. Reddy EC, Rand ML. Procoagulant Phosphatidylserine-exposing
platelets in vitro and in vivo. Front Cardiovasc Med. 2020;7:15.
2. Flint AW, McQuilten ZK, Irwin G, Rushford K, Haysom HE,
Wood EM. Is platelet expiring out of date? A systematic review.
Transfus Med Rev. 2020;34:42–50.
3. Johnson L, Reade MC, Hyland RA, Tan S, Marks DC. In vitro compari-
son of cryopreserved and liquid platelets: potential clinical implica-
tions. Transfusion. 2015;55:838–47.
4. Johnson L, Coorey CP, Marks DC. The hemostatic activity of
cryopreserved platelets is mediated by phosphatidylserine-expressing
platelets and platelet microparticles. Transfusion. 2014;54:1917–26.
5. Lelkens CC, Koning JG, de KB FIB, Noorman F. Experiences with fro-
zen blood products in the Netherlands military. Transfus Apher Sci.
2006;34:289–98.
6. Valeri CR, Giorgio A, MacGregor H, Ragno G. Circulation and distri-
bution of autotransfused fresh, liquid-preserved and cryopreserved
baboon platelets. Vox Sang. 2002;83:347–51.
7. Valeri CR, MacGregor H, Ragno G. Correlation between in vitro
aggregation and thromboxane A2 production in fresh, liquid-pre-
served, and cryopreserved human platelets: effect of agonists, pH,
and plasma and saline resuspension. Transfusion. 2005;45:596–603.
8. Johnson L, Raynel S, Seghatchian J, Marks DC. Platelet microparticles
in cryopreserved platelets: potential mediators of haemostasis.
Transfus Apher Sci. 2015;53:146–52.
9. Dumont LJ, Cancelas JA, Dumont DF, Siegel AH, Szczepiorkowski ZM,
Rugg N, et al. A randomized controlled trial evaluating recovery and
survival of 6% dimethyl sulfoxide-frozen autologous platelets in
healthy volunteers. Transfusion. 2013;53:128–37.
10. Khuri SF, Healey N, MacGregor H, Barnard MR, Szymanski IO,
Birjiniuk V, et al. Comparison of the effects of transfusions of
cryopreserved and liquid-preserved platelets on hemostasis and
blood loss after cardiopulmonary bypass. J Thorac Cardiovasc Surg.
1999;117:172–83.
11. Reade MC, Marks DC, Bellomo R, Deans R, Faulke DJ, Fraser JF,
et al. A randomized, controlled pilot clinical trial of cryopreserved
platelets for perioperative surgical bleeding: the CLIP-I trial (editorial,
p. 2759). Transfusion. 2019;59:2794–804.
12. Cohn CS, Williams S. Cryopreserved platelets: the thaw begins …
(article, p. 2794). Transfusion. 2019;59:2759–62.
13. NZBS Blood Component Monograph. Platelets apheresis in plasma
leucocyte depleted cryopreserved. Auckland: New Zealand Bloor
Service; 2021.
14. Alghamdi AA, Davis A, Brister S, Corey P, Logan A. Development and
validation of Transfusion Risk Understanding Scoring Tool (TRUST)
to stratify cardiac surgery patients according to their blood transfu-
sion needs. Transfusion. 2006;46:1120–9.
15. Weightman WM, Gibbs NM, Weidmann CR, Newman MA, Grey DE,
Sheminant MR, et al. The effect of preoperative aspirin-free interval
on red blood cell transfusion requirements in cardiac surgical
patients. J Cardiothorac Vasc Anesth. 2002;16:54–8.
CRYOPRESERVED PLATELETS IN CARDIAC SURGERY: CLIP-NZ PILOT 345

16. Patient blood management guidelines module 2 - perioperative. Can- 22. Platelet components. Auckland: New Zealand Blood Service.
berra: National Blood Authority; 2012. Available from: https://www.nzblood.co.nz/clinical-information/
17. Mehran R, Rao SV, Bhatt DL, Gibson CM, Caixeta A, Eikelboom J, transfusion-medicine/health-professionals-medicine-datasheets/
et al. Standardized bleeding definitions for cardiovascular clinical tri- platelet-components/
als: a consensus report from the Bleeding Academic Research Con-
sortium. Circulation. 2011;123:2736–47.
18. Bohoněk M, Kutáč D, Landová L, Kořánová M, Sládková E,
Stašková E, et al. Kryokonzervované trombocyty v klinické praxi: SUPPORTING INF ORMATION
srovnávací studie s nativními trombocyty. Transfuze Hematol. 2016; Additional supporting information may be found in the online version
22:268–78. of the article at the publisher’s website.
19. Bohonek M, Kutac D, Landova L, Koranova M, Sladkova E,
Staskova E, et al. The use of cryopreserved platelets in the treatment
of polytraumatic patients and patients with massive bleeding. Trans-
How to cite this article: McGuinness S, Charlewood R,
fusion. 2019;59:1474–8.
20. Slichter SJ, Dumont LJ, Cancelas JA, Jones M, Gernsheimer TB, Gilder E, Parke R, Hayes K, Morley S, et al. A pilot randomized
Szczepiorkowski ZM, et al. Safety and efficacy of cryopreserved clinical trial of cryopreserved versus liquid-stored platelet
platelets in bleeding patients with thrombocytopenia. Transfusion. transfusion for bleeding in cardiac surgery: The cryopreserved
2018;58:2129–38.
versus liquid platelet-New Zealand pilot trial. Vox Sang. 2022;
21. Cooper DJ, McQuilten ZK, Nichol A, Ady B, Aubron C, Bailey M,
et al. Age of red cells for transfusion and outcomes in critically ill
117:337–45.
adults. N Engl J Med. 2017;377:1858–67.
Received: 15 June 2021 Revised: 6 September 2021 Accepted: 7 September 2021

DOI: 10.1111/vox.13208

ORIGINAL ARTICLE

Evaluation of the Sysmex XN-31 automated analyser for blood

donor malaria screening at Malawi Blood Transfusion Services

Bridon M’baya1 | Thom Mfune1 | Aubrey Samon1 | Talent Hwandih2 |

Marion Münster2

1
Malawi Blood Transfusion Service, Blantyre,
Malawi
2
Sysmex Europe, Norderstedt, Germany
Correspondence
Marion Münster, Sysmex South Africa,
5 Hunter Avenue, Ferndale, Randburg 2194,
South Africa.
Email: munster.marion@sysmex.co.za
Funding information
Sysmex Europe funded the study and provided
the XN-31 analyser and related reagents for
the study duration
Abstract
Background and Objectives: Balancing blood supply safety and sufficiency is chal-
lenging in malaria-endemic countries where the risk of transfusion-transmitted
malaria (TTM) is ever-present. In support of reducing this risk, our study aimed at
evaluating the performance of the Sysmex XN-31 analyser in blood donor malaria
screening, as compared with current practice in Malawi.
Materials and Methods: This prospective observational study was conducted on
remnant venous donor blood samples collected at Malawi Blood Transfusion Service
donation sites countrywide for routine blood-borne pathogen screening. XN-31
results were compared with routine thick smear malaria microscopy, using expert
microscopy (phase 1 and 2) plus qualitative malaria polymerase chain reaction (PCR)
(phase 2) to adjudicate discrepancies.
Results: XN-31 detected malaria in 614 (11.6%) of 5281 study samples compared
with 341 (6.5%) for routine microscopy. Of the 273 discrepant samples, 60 smears
(phase 1) could not be retrieved for expert microscopic review. Expert microscopy
confirmed the XN-31 positivity in 78.8% (149/189) and 91.7% (22/24) of discrepant
samples in phase 1 (n = 4416) and phase 2 (n = 975), respectively, with two cases
requiring PCR testing, confirming one each as positive and negative, giving sensitivi-
ties of 100% and 75% and specificities of 99.9% and 100%, respectively, for XN-31
and routine microscopy.
Conclusion: The automated Sysmex XN-31 analyser’s high sensitivity and specificity,
ability to detect all Plasmodium species and high throughput with rapid turnaround-
time, overcomes many of the limitations of currently available diagnostic tests, mak-
ing it well-suited for malaria screening of donated blood in malaria-endemic countries
in support of TTM risk reduction.

KEYWORDS
blood donation testing, blood safety, high throughput testing, malaria and protozoal infections,
patient blood management, transfusion-transmissible infections

This is an open access article under the terms of the Creative Commons Attribution-NonCommercial License, which permits use, distribution and reproduction in any
medium, provided the original work is properly cited and is not used for commercial purposes.
© 2021 The Authors. Vox Sanguinis published by John Wiley & Sons Ltd on behalf of International Society of Blood Transfusion.

346 wileyonlinelibrary.com/journal/vox Vox Sanguinis. 2022;117:346–353.

XN-31 AUTOMATED BLOOD DONOR MALARIA SCREENING
I N T R O D U CT I O N
Balancing blood supply safety and sufficiency is challenging in
malaria-endemic countries with a lack of suitable diagnostics for pre-
transfusion blood screening significantly contributing to transfusion-
transmitted malaria (TTM) [1, 2]. Smear microscopy is laborious and
subjective, with increasing workload compromising sensitivity. Rapid
diagnostic tests, whilst simple to use, lack sensitivity and specificity
and polymerase chain reaction (PCR) is cumbersome and costly.
Pathogen inactivation is a tool aimed at the prevention of TTM [3, 4].
At a reported price of 25 USD/unit, in Ghana, costs hinder its uni-
versal implementation. Prophylactic pre-transfusion antimalarials are
advocated by World Health Organization (WHO), but this practice is
not widely adopted because of cost and drug resistance concerns [5].
Malawi, a high malaria burden country with perennial transmis-
sion and the entire population at risk of infection, is one of three sub-
Saharan African countries that screens donated blood for malaria [2].
In 2019, there were 4 million confirmed malaria cases [6], account-
ing for 34% of hospital admissions and 40% of in-hospital deaths,
impacting mostly pregnant women and young children [7]. In 2015,
68% of whole blood issued by the Malawi Blood Transfusion Service
(MBTS) was for treating malaria, and 62% of recipients were children
and pregnant women [8]. MBTS, contributing 77% of the national
blood supply, utilizes thick smear microscopy for screening. MBTS
donors with sub-microscopic parasitaemias would go undetected, and
only 60% of hospital-based collections are screened for malaria (using
rapid tests); however, there is no official data on the incidence of
TTM in Malawi.
The Sysmex XN-31 analyser (XN-31) is a new higher diagnostic
sensitivity automated malaria detection technology, which has shown
great potential in research [9–11] and clinical settings [12–14]. This
study was undertaken to establish the usefulness of XN-31 for malaria
screening in a malaria-endemic setting. We compared the perfor-
mance of XN-31 against routine MBTS practice of thick smear micros-
copy using expert microscopy (phase 1) for judgement of discrepant
results, with the addition of qualitative malaria PCR in phase 2. The
specific objectives were to determine the sensitivity and specificity of
XN-31 for malaria screening compared with routine microscopy and
to correlate malaria parasite quantification by XN-31 with microscopy
grading.
METHODS
Study design and samples
This prospective observational study used venous blood from 5 ml
sample tubes collected from donors at MBTS donation sites country-
wide for routine blood-borne pathogen screening. Blood tubes were
transported to the central laboratory in Blantyre within 24–72 h of
collection and tested immediately upon receipt. K2EDTA blood left-
over after blood typing and malaria thick smear microscopy from con-
secutive blood donor samples received on low workload days was
347
used for XN-31 testing. The study aimed to collect 4000 samples,
using expert microscopy for the final judgement of discrepant malaria
screening results (XN-31 vs. routine microscopy consensus result).
The sample size was estimated using Buderer’s methodology [15],
incorporating the current MBTS donor malaria prevalence estimate of
1% and a confidence interval (CI) of 95%.
As several samples remained discordant after expert microscopy,
a further 975 consecutive blood donors were included (phase 2),
where qualitative PCR was used for the final judgement of samples
unresolved by expert microscopy.
Ethical considerations
Study approval (protocol number #19/09/2396) was granted by the
National Health Sciences Research Committee of the Malawi Ministry
of Health. Donor informed consent was waived, as there was no addi-
tional blood draw and consent to donate includes consent to use
donated blood samples and biodata for research use to improve blood
safety and/or in studies of public health importance. Donors can opt-
out at any time. In addition, as this study would not influence the
standard of care, consent from recipients of donated blood included
in this study was not required.
Routine testing
Blood typing, serology testing and malaria thick smear microscopy
were performed according to MBTS standard procedures. The deci-
sion to release, quarantine or discard blood units was based exclu-
sively on routine test results.
Routine malaria testing
Each study sample had a unique barcode. Each slide was examined by
two microscopists who scanned 100 high-power fields before assig-
ning a negative judgement. A semi-quantitative parasite density esti-
mate (1+ to 4+) [16] was provided for positive samples. A blinded
third MBTS microscopist served as an adjudicator for positive–
negative discrepancies. Three microscopists shared the study work-
load, each reviewing up to 150 smears/day (over a period of 4–6 h).
Sysmex XN-31 analyser automated malaria screening
The measurement principle of XN-31, an analyser essentially identical
to its research-use-only predecessor, the XN-30, has been detailed
elsewhere [12]. Briefly, a reagent partially permeabilizes the red blood
cell (RBC) membrane allowing entry of a fluorescent reagent that
stains parasite nucleic acids. The RBC count is measured using a
sheath flow direct current detection method, and the malaria-infected
RBCs (MI-RBC) are measured by fluorescence flow cytometry.
348
MI-RBC are quantified and a qualitative judgement of malaria
present–absent provided based on the analytical limit of quantifica-
tion (LOQ) of 20 parasites/μl (p/μl). Where particle counts exceed
20 p/μl, but no distinct cluster is observed in the malaria gating area,
an ‘MI-RBC abnormal scattergram’ flag is generated, and the result is
deemed indeterminate. XN-31 can detect all Plasmodium species caus-
ing human malaria. Differentiation between Plasmodium falciparum
and non-falciparum infections is available as a research-use-only sus-
pect flag. Each measurement takes 1 min with a cost of 3 USD/test
(including analyser and related costs, assuming 20,000 tests/annum
over 5 years).
Establishment of an XN-31 equivalent grading
for parasite densities
The ‘plus grading system’ [16] and estimated thick smear blood vol-
umes [17] were combined to calculate expected parasite density
ranges.
Adjudication of discrepant malaria screening results
XN-31 and microscopy results were cross-checked daily to identify
discrepancies.
Phase 1: Discordant samples were referred to an external WHO-
certified microscopist for expert review using the same method as
MBTS but without time pressure.
Phase 2: After preliminary data analysis, 975 additional samples
were collected, and two dry blood spots were made on those with dis-
crepant results. Qualitative PCR confirmatory testing, using
P. falciparum-specific primers, was undertaken by an external molecu-
lar laboratory, in addition to expert microscopy, for final judgement.
No non-falciparum malaria cases were reported for Malawi in
2019 [6].
Known positive and negative samples were included for expert
microscopy and PCR for quality control purposes.
Study period
Donor blood samples included in phase 1 were collected from
December 2019 to April 2020 and from November to December
2020 for phase 2.
TABLE 1 Diagnostic performance of routine microscopy and XN-31 for blood donor malaria screening against expert microscopy (phase 1)
Routine microscopy
Sensitivity 64.6% (59.8%–69.2%) [272/421]
Specificity 100% (99.9%–100%) [3635/3635]
Note: Values are represented as follows: (95% confidence interval) [sample numbers].
M’BAYA ET AL.
Statistical methods
Data analysis was done using MedCalc® Statistical Software version
19.8 (MedCalc Software Ltd, Ostend, Belgium). Continuous data were
expressed as medians and interquartile ranges (IQR). Chi-squared test
was used for the comparison of two independent proportions.
p Values below 0.05 (two-tailed) were considered statistically signifi-
cant. The sensitivity and specificity (with 95% CIs) of XN-31 and rou-
tine microscopy (consensus of two microscopists) were compared to
that of the reference. For phase 1, the reference method was expert
microscopy, and for phase 2, it was expert microscopy and PCR (for
residual discrepancies post-expert microscopy).
RE SU LT S
Malaria screening
Malaria was observed in 341 (6.5%) of 5281 samples screened by rou-
tine microscopy with 76.3% (260/341) judged to have low
parasitaemia (1+). The routine microscopists differed in parasite den-
sity grading in 21 cases and qualitative malaria assessment in 13 cases,
necessitating the third microscopist. XN-31 judged 11.6% (614/5281)
as malaria positive (MI-RBC present), with a median of 164 p/μl (IQR:
63–448) ranging from 20 to 13,514 p/μl. The detection rates of the
screening methods differed significantly (p < 0.0001).
Diagnostic performance of XN-31 against
routine microscopy
Phase 1: Expert microscopy adjudication of
discordant results
After eliminating 190 samples (3.6%) with MI-RBC abnormal scatter-
gram flags, (all routine microscopy negative), 4116 result pairs were
available for analysis and revealed 249 (6%) samples with mismatched
malaria screening results. For all, the XN-31 result was positive and
routine microscopy negative. The expert microscopist detected
malaria in 78.8% (149/189) of smears available for review. The diag-
nostic performance of routine microscopy and XN-31, using expert
microscopy as the reference method, is shown in Table 1.
Routine microscopy detected 22% of samples with MI-RBC
<100 p/μl, compared with 75% for that ≥100 p/μl. The median MI-
XN-31
100% (99.1%–100%) [421/421]
98.9% (98.5%–99.2%) [3595/3635]
XN-31 AUTOMATED BLOOD DONOR MALARIA SCREENING 349

RBC for samples positive by both methods (n = 341) was 227 p/μl
(IQR 80–553), with 23 p/μl the lowest count. Malaria-infected donors
missed by routine microscopy had low parasitaemias (median 101 p/μl,
IQR 55–153), with one exception (6224 p/μl), which was reported 2+
positive by one microscopist but negative by three others, including the
expert. The XN-31 scattergram of this case showed a distinctive
P. falciparum pattern (Figure 1), which together with the 2+ grading of
one microscopist suggests a sample mix-up during the smear review
process.
After the review of discordant samples, 21.2% (40/189) remained
discrepant as no malaria parasites were observed by expert micros-
copy. The lowest equivalent MI-RBC value detected by the expert
was 20 p/μl.

Phase 2: Expert microscopy and PCR adjudication

of discordant results

Of the additional 975 samples that underwent malaria screening,

F I G U R E 1 XN-31 scattergram of the sample adjudicated as ‘false
positive’ by expert microscopy. (a) Study sample; (b) typical
scattergram of confirmed Plasmodium falciparum infection. RBC, red
blood cells
24 (2.5%) were discordant (XN-31 positive, routine microscopy nega-
tive). Expert microscopy confirmed malaria positivity in 22 cases. PCR
testing of the two negative cases confirmed one positive (MI-RBC
348 p/μl) and one malaria negative. Upon review, the XN-31 scatter-
gram of the PCR negative sample revealed a pattern typically
observed in cases of interference (Figure 2). The diagnostic perfor-
mance of routine microscopy and XN-31 using expert microscopy,
and PCR where needed, as the reference method, is shown in Table 2.
Comparison of microscopy parasite density estimation
with XN-31 MI-RBC quantification

Calculated p/μl values correlating to the ‘plus’ parasite density grad-

ing system are shown in Table 3. MI-RBC values for the semi-
quantitative microscopy grades overlapped substantially (Figure 3).
The agreement between microscopic grading and the corresponding
absolute value ranges is shown in Table 4. Twenty percent (62/312)
of only malaria-infected units (co-infections excluded) would have
been discarded due to higher parasitaemia (≥2+), with the remaining

T A B L E 3 Absolute parasite counts equivalent to the ‘plus’

F I G U R E 2 XN-31 scattergrams of the two samples that required microscopic parasite density grades
polymerase chain reaction (PCR). (a) True positive (PCR confirmed), Microscopic Parasites per HPF (100 oil Parasites/μl
showing a vertically aligned cluster (green ellipse), non-continuous grading immersion objective) of blood
with debris and non-infected red blood cell (RBC) shown in blue along
1+ 1–10 parasites/100 HPF <67
the y axis, typical of malaria-infected RBC. (b) False positive (PCR
negative). The cluster of events is concentrated at a 45 angle (red 2+ 11–100 parasites/100 HPF 67–667
ellipse), continuous with the blue events and associated with 3+ 1–10 parasites/1 HPF 668–6667
generalized scatter (blue oval), typically observed in cases of
4+ >10 parasites/1 HPF >6667
interference. MI-RBC, malaria-infected red blood cells
Abbreviation: HPF, high power field.

T A B L E 2 Diagnostic performance of routine microscopy and XN-31 blood donor malaria-screening against expert microscopy and
polymerase chain reaction (phase 2)

Routine microscopy XN-31

Sensitivity 75.0% (64.9%–83.4%) [69/92] 100% (96%–100%) [92/92]
Specificity 100% (99.6%–100%) [883/883] 99.9% (99.4%–99.997%) [882/883]

Note: Values are represented as follows: (95% confidence interval) [sample numbers].
350 M’BAYA ET AL.

F I G U R E 3 XN-31 malaria-infected red blood cells (MI-RBC) distribution for semi-quantitative microscopy grades. (a) Microscopist 1;
(b) Microscopist 2. The boxplots highlight the respective MI-RBC medians, lower and upper quartiles and mild (orange dots) and extreme
(red squares) outliers

TABLE 4 Comparison of semi-quantitative microscopy grades with expected parasites/μl values as measured by XN-31

XN-31 MI-RBC count based parasite density grading (parasites/μl)

<67 67–667 668–6667 >6667

Microscopy grading Samples (n) 1+ 2+ 3+ 4+

1+ 232 (80%) 31 (13.4%) 165 (71.1%) 36 (15.5%) 0 (0%)
2+ 48 (16.5%) 1 (2.1%) 12 (25%) 34 (70.8%) 1 (2.1%)
3+ 9 (3%) 0 (0%) 0 (0%) 8 (88.9%) 1 (11.1%)
4+ 1 (0.5%) 0 (0%) 0 (0%) 0 (0%) 1 (75%)
Total 290 32 (11%) 179 (61%) 78 (27%) 3 (1%)

Note: Co-infected samples and those without grading consensus were excluded. ‘Bold’, ‘italic’ and ‘regular’ font represent underestimated, overestimated
and correctly estimated microscopic parasite densities, respectively.

80% (250/312) kept in quarantine (for release under special condi-
tions in the event of negative-screened blood stock-outs) in line with
national guidelines [18]. Agreement between the microscopic esti-
mates and XN-31 result was observed in only 17.9% (52/290) sam-
ples, with 81.7% (237/290) underestimation and 1 sample
overestimated. Using XN-31, 143 and 414 malaria-infected units,
after exclusion of co-infections, would have been graded as 1+ and
≥2+, respectively.
DISCUSSION
In this study, we evaluated the performance of the Sysmex XN-31
automated analyser for malaria screening at MBTS, comparing it with
their routine of thick smear microscopy.
The malaria detection rate, in 5281 donor blood samples tested,
was significantly higher (p < 0.0001) using XN-31 (11.6%) compared
with routine microscopy (6.5%). All samples with discrepant results
gave an XN-31 ‘MI-RBC present’ result with ‘no parasites observed’
by routine microscopy. In phase 1, with a 6% (249/4116) discrepancy
rate, a WHO certified expert microscopist observed malaria parasites
in 78.8% (149/189) of cases, concurring with the XN-31 result.
Compared with expert microscopy, the respective sensitivities and
specificities for XN-31 and routine microscopy were 100% versus
64.6% and 98.9% versus 100%. This ‘trade-off’ in specificity is unsur-
prising when new automated technology such as XN-31, with a LOQ
of 20 p/μl, achievable with high precision, is compared with an inher-
ently subjective manual reference method, such as microscopy, even
in the hands of experts, with achievable sensitivities ranging from 5 to
50 p/μl, and up to 500 p/μl under high workload conditions [19, 20].
The median parasite count of microscopically detected malaria-
infected donors was 227 p/μl (IQR 80–553) whereas those missed
had a median of 101 p/μl (IQR 55–153), in line with sensitivities
expected for routine microscopy. Interestingly, although the lowest
parasite counts detected by XN-31, routine and expert microscopy,
were equivalent (20–23 p/μl), routine microscopy detected only
22% of samples <100 p/μl, compared with 75% of samples ≥100 p/
μl, suggesting that accuracy of malaria microscopy is influenced
more by the inconsistency of manual counting when parasite den-
sity is low, rather than the limit of detection. Our findings of differ-
ences between the routine microscopists in 10.0% of cases
(34/341) in qualitative judgement of malaria or parasitaemia
XN-31 AUTOMATED BLOOD DONOR MALARIA SCREENING
grading, further highlight the inherent subjectivity of manual
microscopy [21].
As 21.2% (40/189) XN-31 positive cases remained discrepant
after expert microscopic review and were classified as ‘false positives’
under this study design, we extended the study (phase 2) to incorpo-
rate qualitative PCR, with undisputed superior analytical sensitivity,
for final judgement. In phase 2, the agreement rate between routine
microscopy and XN-31, and expert microscopy and XN-31, was
higher than in phase 1, hence PCR was only required for 2/24 sam-
ples, confirming one positive and one negative result. Upon review of
the XN-31 scattergram (Figure 2), the PCR positive sample showed a
classical malaria pattern whereas the negative sample was clearly a
false positive XN-31 result, which should have triggered an MI-RBC
abnormal scattergram flag making the outcome indeterminate. The
sample was no longer available at the time of data analysis, precluding
further investigation.
Our study showed that XN-31 had superior sensitivity to routine
microscopy (100% vs. 75%) for the detection of malaria-infected
donors, whilst maintaining excellent specificity (99.9%). Deployment
of XN-31 as a routine malaria screening tool within blood transfusion
services in malaria-endemic countries such as Malawi would reduce
the risk of TTM beyond what is currently achievable with microscopy.
Malaria-infected blood is not automatically discarded. At MBTS,
low parasitaemia-infected blood (1+) is kept in quarantine as reserve
in case of negative-screened blood stock depletion [18]. Based on cur-
rent MBTS practices, 62 units would have been discarded exclusively
because of malaria, compared with 414 had the XN-31 MI-RBC value
of >67 p/μl (as equivalent to ≥2+) been applied, with the remaining
4.7% (250/5281) and 2.7% (143/5281) for microscopy and XN-31,
respectively, of the donor pool being kept in quarantine. The signifi-
cant overlap in measured parasite counts for the plus grades, and sub-
stantial microscopic parasite density underestimation (Table 4),
highlight serious limitations of microscopic parasite density estimates
to inform usage of malaria-infected blood products.
Maintaining an adequate safe blood supply is challenging in sub-
Saharan Africa where severe blood shortages are widespread and par-
asitaemic blood donors are common. Malaria drives the demand for
blood in most malaria-endemic countries where those most in need,
namely young children, and pregnant women, are also at greatest risk
of an adverse clinical outcome of TTM [22, 23].
Unsurprisingly, countries with the greatest malaria burden, and
thus need for blood, also have the highest prevalence of parasitaemic
blood donors. Here, identification of low-risk donors is virtually
impossible and rejection of all malaria parasite-containing blood units
untenable, as this would cripple the blood supply. Blood transfusion
practice in malaria-endemic countries is highly complex, where com-
promise is unavoidable to achieve an acceptable balance between
supply and demand, without undue loss of life. Withholding blood
from someone in critical need carries a high certainty of death,
whereas releasing a blood unit, even if malaria-infected may be life-
saving despite the risk of TTM.
Our study has some limitations. Notably, expert microscopy was
evoked only for the assessment of discrepancies, with PCR analysis
351
reserved for selected samples. As there were no ‘XN-31 negative-
microscopy positive’ mismatches, the extent of missed parasitaemias
with <20 p/μl is unknown. An important caveat for determining the
actual prevalence of malaria-infected donors, and thus risk of TTM, is
to detect low-level parasitaemia [22]. This would require PCR for
adjudication of all samples. This was not included in our study design
as it was cost-prohibitive, which is also partly why, despite its excel-
lent sensitivity, PCR is not routinely used for pre-transfusion malaria
screening in malaria-endemic settings. Consequently, assuming a PCR:
microscopy detection ratio of 2:1 [24], we calculated a hypothetical
PCR detection rate of 12.9% (682/5281), and thus that 1.29%
(68/5281) of donors would theoretically have gone undetected as
malaria-infected by XN-31 in this study.
Furthermore, we did not subject the indeterminate XN-31 sam-
ples to adjudication to confirm the routine microscopy finding of
malaria absence, although other studies indicate that such samples are
largely malaria negative [12–14]. Likewise, although we suspected
sample ageing due to transport delays as the primary cause of indeter-
minate results (as these occurred in clusters), absence of individual
sample collection times precluded further analysis. The most notable
reported clinical cause of abnormal scattergrams is reticulocytosis
[12]. Although we were unable to analyse this, we consider reti-
culocytosis an unlikely cause of indeterminate results in our subjec-
tively healthy blood donor study participants based on a recent report
of no increase in reticulocyte counts in asymptomatic malaria in sub-
jects >15 years [25].
In conclusion, we showed that microscopy underestimates
malaria prevalence in blood donors (6.5% vs. 11.6%) and is unreliable
for parasite density estimation when compared with XN-31. Other
advantages of XN-31 include high sensitivity (100%) and specificity
(99.9%), ability to detect all Plasmodium species and automated nature
providing high throughput and rapid result availability. This overcomes
many of the limitations of currently routinely available diagnostic tests
and would thus be well-suited for pre-transfusion malaria screening in
malaria-endemic countries such as Malawi, where 100% of the popu-
lation is considered to have been exposed to the parasite and at high
risk of ongoing exposure [6, 7], to reduce the risk of TTM.
It has been reported that as few as 10 parasites can cause malaria
[26] hence no diagnostic method, including PCR, can eliminate TTM
risk and pathogen inactivation is not universally available nor afford-
able. Controlled human malaria infection studies suggest that a mini-
mal infective dose is required for establishment of malaria [27] and
rodent malaria experiments have shown that clinical severity corre-
lates with parasite inoculation dose [28]. XN-31 will miss very low-
level malaria-infected blood units, but we hypothesize that such units
are less infectious and less likely to cause severe clinical disease than
unscreened blood or malaria-positive blood, when viewed from a pub-
lic health perspective in settings where the probability of prior expo-
sure to malaria is high amongst recipients, compounded by ongoing
risk of mosquito-acquired malaria [6]. In high malaria-burden coun-
tries, the greatest consumers of blood products are also those most
vulnerable to TTM. Consequently, we believe that malaria screening
with XN-31, complemented with selective malaria chemoprophylaxis
352
for high-risk recipients, could provide a balance between ensuring
blood safety and supply. Blood that has tested malaria-negative, could
preferentially be reserved for high-risk recipients, such as young chil-
dren and pregnant women, with malaria-positive blood, selected
based on the lowest parasitaemia available being issued to individuals,
such as adults with semi-immunity and at low-risk of clinical malaria, if
the malaria-negative blood stock is depleted, supplemented with pre-
scription of antimalarials.
Even where rejection of any malaria-infected blood is simply
untenable, such as in Nigeria where prevalence rates reach 55%
[29], screening with a technology such as XN-31 provides an
opportunity for informed matching of blood with recipient, and the
initiation of prophylactic treatment for the recipient as needed,
thereby enhancing overall transfusion safety, without unduly
compromising supply.
Malawi, a high malaria burden country, currently only meets 72%
(86,811/1,200,000) of its estimated annual blood requirements [30].
In the context of chronic blood shortages, and malaria being a treat-
able disease, the Malawian Ministry of Health, aimed at improving
clinical outcomes, permits the issue of low parasitaemia blood when
malaria-negative blood is depleted, upon special request with clini-
cians taking full responsibility for their decision to transfuse malaria-
infected blood, in patients for whom transfusion is deemed to be a
necessary life-saving intervention. In such cases, prophylactic antima-
larials are always prescribed pre-transfusion, a TTM preventive mea-
sure endorsed by WHO [5]. This approach is supported by data
showing that lack of timely access to blood is a major contributor to
mortality in Africa [31], together with critical lack of evidence of the
true prevalence and clinical impact of TTM in malaria-endemic coun-
tries [29]. In this regard, as the primary aim of blood donor/donation
malaria screening is to improve clinical outcomes of recipients, we aim
to conduct a retrospective follow-up of sub-microscopic XN-31 posi-
tive blood unit recipients identified during this study.
XN-31 also provides the added benefit of a full blood count (FBC)
with each malaria analysis, which would be beneficial for donor health
management and quality control testing of blood products, the latter
currently being achieved using haematology analysers, which can only
perform FBCs.
ACKNOWLEDGEMEN TS
B.M., M.M. and T.H. designed and supervised the research; T.M. and
A.S. performed the research; T.H. conducted statistical analysis;
M.M. wrote the manuscript; all authors reviewed and approved the
final version. We thank all the blood donors of Malawi for the gift of
their blood in support of saving lives; MBTS staff for their contribu-
tions throughout the study; James Palapandu for expert microscopy;
Siyanda Mngoma for training and technical support for the XN-31
analyser and Karl Seydel and Andrew Nyambalo of the Blantyre
Malaria Project molecular laboratory for the polymerase chain reac-
tion testing.
CONF LICT OF IN TE RE ST
M.M. and T.H. are full-time Sysmex employees.
M’BAYA ET AL.
ORCID
Marion Münster https://orcid.org/0000-0002-5366-4842
RE FE RE NCE S
1. Owusu-Ofori AK, Betson M, Parry CM, Stothard JR, Bates I. Transfu-
sion-transmitted malaria in Ghana. Clin Infect Dis. 2013;56:
1735–41.
2. World Health Organization. The 2016 global status report on blood
safety and availability. Geneva: WHO; 2017.
3. Drew VJ, Barro L, Seghatchian J, Burnouf T. Towards pathogen inac-
tivation of red blood cells and whole blood targeting viral DNA/RNA:
design, technologies, and future prospects for developing countries.
Blood Transfus. 2017;15:512–21.
4. Allain JP, Owusu-Ofori AK, Assennato SM, Marschner S,
Goodrich RP, Owusu-Ofori S. Effect of Plasmodium inactivation in
whole blood on the incidence of blood transfusion-transmitted
malaria in endemic regions: the African Investigation of the Mirasol
System (AIMS) randomised controlled trial. Lancet. 2016;387:
1753–61.
5. World Health Organization. Screening donated blood for transfusion
transmissible infections–recommendations. Geneva: WHO; 2010.
6. World Health Organization. World malaria report 2020. Geneva:
WHO; 2020.
7. Battle KE, Gumbo A, Hamuza G, Kwizombe C, Banda AT, Chipeta S,
et al. Consultative meeting that examined alignment and discrepan-
cies between health facility and household survey data in Malawi.
Malar J. 2019;18:411.
8. Njolomole SE, M’baya B, Ndhlovu D, Mfune T, Yonamu F, Phiri P,
et al. Post baseline situational analysis of blood safety in Malawi
2015. Results of the 2026 survey. Blantyre, Malawi: Malawi Blood
Transfusion Services; 2017.
9. Tougan T, Suzuki Y, Itagaki S, Izuka M, Toya Y, Uchihashi K, et al. An
automated haematology analyser XN-30 distinguishes developmen-
tal stages of falciparum malaria parasite cultured in vitro. Malar J.
2018;17:59.
10. Tougan T, Suzuki Y, Izuka M, Aono K, Okazaki T, Toya Y, et al. Appli-
cation of the automated haematology analyser XN-30 in an experi-
mental rodent model of malaria. Malar J. 2018;17:165.
11. Tougan T, Toya Y, Uchihashi K, Horii T. Application of the automated
haematology analyzer XN-30 for discovery and development of anti-
malarial drugs. Malar J. 2019;18:8.
12. Pillay E, Khodaiji S, Bezuidenhout B, Litshie M, Coetzer TL. Evalua-
tion of automayed malaria doagnosis using the Sysmex XN-30 ana-
lyser in a clinical setting. Malar J. 2019;18:15.
13. Post A, Kaboré B, Reuling IJ, Bognini J, van der Heiden W,
Diallo S, et al. The XN-30 hematology analyser for rapid sensitive
detection of malaria: a diagnostic accuracy study. BMC Med.
2019;17:103.
14. Zuluaga-Idárraga L, Rios A, Sierra-Cifuentes V, Garzo  n E, Tobo n-
Castaño A, Takehara I, et al. Performance of the hematology analyser
XN-31 prototype in the detection of Plasmodium infections in an
endemic region of Colombia. Sci Rep. 2021;11:5268.
15. Hajian-Tilaki K. Sample size estimation in diagnostic test studies of
biomedical informatics. J Biomed Inform. 2014;48:193–204.
16. World Health Organization. Basic malaria microscopy. Part 1
Learner’s guide. 2nd ed. Geneva: WHO; 2010.
17. World Health Organization. Microscopy for the detection, identifica-
tion and quantification of malaria parasites on stained thick and thin
blood films in research settings–methods manual. Geneva: WHO;
2015.
18. Ministry of Health, Lilongwe, Malawi. Guidelines for the clinical use of
blood and blood products in Malawi. 1st ed. Lilongwe: MOH; 2012.
19. Moody A. Rapid diagnostic tests for malaria parasites. Clin Microbiol
Rev. 2002;15:66–78.
XN-31 AUTOMATED BLOOD DONOR MALARIA SCREENING
20. Milne LM, Kyi MS, Chiodini PL, Warhurst DC. Accuracy of routine
laboratory diagnosis of malaria in the United Kingdom. J Clin Pathol.
1994;47:740–2.
21. Sori G, Zewdie O, Tadele G, Samuel A. External quality assessment
of malaria microscopy diagnosis in selected health facilities in
Western Oromia, Ethiopia. Malar J. 2018;17:233.
22. Ahmadpour E, Foroutan-Rad M, Majidiani H, Moghaddam SM,
Hatam-Nahavandi K, Hosseini S, et al. Transfusion-transmitted
malaria: a systematic review and meta-analysis. Open Forum Infect
Dis. 2019;6:ofz283.
23. Freimanis G, Sedegah M, Owusu-Ofori S, Kumar S, Allain JP. Investi-
gating the prevalence of transfusion transmission of Plasmodium
within a hyperendemic blood donation system. Transfusion. 2013;
53:1429–41.
24. Okell LC, Ghani AC, Lyons E, Drakely CJ. Submicroscopic infection in
Plasmodium falciparum–endemic populations: a systematic review
and meta-analysis. J Infect. 2009;200:1509–17.
25. Kaboré B, Post A, Berendsen MLT, Diallo S, Lompo P, Derra K, et al.
Red blood cell homeostasis in children and adults with and without
asymptomatic malaria infection in Burkina Faso. PLoS One. 2020;15:
0242507.
26. Seed CR, Kitchen A, Davis TME. The current status and potential role
of laboratory testing to prevent transfusion-transmitted malaria.
Transfus Med Rev. 2005;19:229–40.
353
27. Go mez-Pérez GP, Legarda A, Muñoz J, Sim KL, Ballester MR,
Dobaño C, et al. Controlled human malaria infection by intramuscular
and direct venous inoculation of cryopreserved Plasmodium
falciparum sporozoites in malaria-naïve volunteers: effect of injection
volume and dose on infectivity rates. Malar J. 2015;14:306.
28. Timms R, Colegrave N, Chan BHK, Read AF. The effect of parasite
dose on disease severity in the rodent malaria Plasmodium chabaudi.
Parasitology. 2001;123:1–11.
29. Owusu-Ofori AK, Parry C, Bates I. Transfusion-transmitted malaria in
countries where malaria is endemic: a review of the literature from
sub-Saharan Africa. Clin Infect Dis. 2010;51:1192–8.
30. Ministry of Health, Lilongwe. Malawi. HIV and AIDS integrated quar-
terly reports. Lilongwe: MOH; 2018.
31. World Health Organization. Department of essential health technol-
ogies: blood transfusion safety. Geneva: WHO; 2011.
How to cite this article: M’baya B, Mfune T, Samon A,
Hwandih T, Münster M. Evaluation of the Sysmex XN-31
automated analyser for blood donor malaria screening at
Malawi Blood Transfusion Services. Vox Sang. 2022;117:
346–53.
Received: 13 April 2021 Revised: 24 June 2021 Accepted: 29 June 2021

DOI: 10.1111/vox.13182

ORIGINAL ARTICLE

Time–temperature indicators versus temperature indicators for

transfusion practice: Application in the real hospital setting

Mikyoung Park1 | Mina Hur2 | Hanah Kim2 | Kyungmi Oh3 |

Dae-Hyun Ko4 | Yousun Chung5

1
Department of Laboratory Medicine,
Yeungnam University College of Medicine, Abstract
Daegu, South Korea
Background and Objectives: Temperature indicators (TIs) are used to monitor the
2
Department of Laboratory Medicine, Konkuk
University School of Medicine, Seoul, South
surface temperature of red blood cell (RBC) units. We compared the utility of a newly
Korea developed time–temperature indicator (TTI) prototype, Freshzone TTI (FZTTI)
3
Department of Nursing, Kyungbok University, (Freshzone, Seoul, South Korea) and two US Food and Drug Administration–
Namyangju, South Korea
4 approved TIs, Safe-T-Vue 10 (STV10; Temptime Corporation, Morris Plains, NJ) and
Department of Laboratory Medicine,
University of Ulsan College of Medicine and Blood Temp 10 (BT10; Timestrip UK Ltd, Cambridge, UK).
Asan Medical Center, Seoul, South Korea
Materials and Methods: FZTTI, STV10 and BT10 were attached to 91 RBC units
5
Department of Laboratory Medicine, Hallym
University College of Medicine, Seoul, South after issue (including eight units that were stored in refrigerators in the ward before
Korea transfusion). The time for colour change (CC) was monitored based on the 30-min
rule. The CC of FZTTI indicated the total time elapsed since the temperature of RBC
Correspondence
Mina Hur, Department of Laboratory units exceeded 10 C, and the CC of STV10 and BT10 indicated that the temperature
Medicine, Konkuk University School of
of RBC units exceeded 10 C.
Medicine, Konkuk University Medical Center,
120-1, Neungdong-ro, Hwayang-dong, Results: In 83 units, the median time for CC differed significantly between FZTTI and
Gwangjin-gu, Seoul 05030, South Korea.
the TIs (51.4 min in FZTTI vs. 13.9 min in STV10 and 10.5 min in BT10, both at
Email: dearmina@hanmail.net
p < 0.001). In addition, 95.2% (n = 79) of FZTTI tags changed colour after 30 min of
Present address issue, whereas 96.4% (n = 80) of STV10 and 98.8% (n = 82) of BT10 changed colour
Mikyoung Park, Department of Laboratory
Medicine, Eunpyeong St. Mary’s Hospital, within 30 min of issue. In the eight units stored in refrigerators, the time for CC
College of Medicine, The Catholic University between the TTI and TIs was significantly different.
of Korea, Seoul, South Korea
Conclusion: FZTTI outperformed the TIs, indicating that it is a feasible option for use
Funding information in transfusion practice.
Division of Blood Safety Surveillance, Korea
Centers Disease Control and Prevention,
KEYWORDS
Grant/Award Number: 2019E830400
30-min rule, red blood cells, temperature indicator, time–temperature indicator, transfusion

I N T R O D U CT I O N and 60 min of storage at room temperature (RT), respectively [8]. Since

For safe and efficient red blood cell (RBC) transfusion, RBC units
should be stored and transported under a controlled temperature – at
1–6 C during storage and below 10 C during transport – to ensure
their viability and limit the growth of any contaminating bacteria; [1–8].
An early 1970s study reported that the average surface temperature
(ST) and core temperature (CT) of whole blood reach 10 C within 30 min
then, the 30-min rule has been used as a surrogate indicator for tempera-
ture monitoring of RBC units, and in many countries and institutions,
RBC units left for over 30 min at RT are not returned to the blood bank
[2, 3].
Based on this 30-min rule, if RBC transfusion is not initiated
within 30 min after issue, RBC wastage may occur [9–13]. In 2015, up
to 1.4% of RBC units were discarded due to the use of an

354 © 2021 International Society of Blood Transfusion. wileyonlinelibrary.com/journal/vox Vox Sanguinis. 2022;117:354–360.
TIME–TEMPERATURE INDICATOR VERSUS TEMPERATURE INDICATORS
inappropriate transport device or temperature [11]. According to the
National Health Service Blood and Transplant/Hospital Report
2017/18 [12], of the total 35,931 RBC units, 8005 (22.3%) were dis-
carded because of poor temperature control. Recent studies suggest
that the 30-min rule can be extended without increasing the risk to
the recipient and that a 60-min rule should be considered, as it did
not affect RBC quality [9, 13–17]. The 60-min rule has been used in
the United Kingdom and Canada [4, 17, 18], thus significantly reduc-
ing wastage [18].
Temperature indicators (TIs) have been evaluated in transfusion
practice, and the World Health Organization (WHO) and a few studies
have reported that TIs are useful for monitoring the temperature of
RBC units [4, 19–23]. We previously evaluated the performance of two
US Food and Drug Administration (FDA)-approved TIs: Safe-T-Vue
10 (STV10; Temptime Corporation, Morris Plains, NJ) and Blood Temp
10 (BT10; Timestrip UK Ltd, Cambridge, UK) [23]. In most cases, these
TIs showed colour changes (CCs) – indicating that the temperature of
RBC units exceeded 10 C – within 30 min; however, the CC assess-
ments were vulnerable to variation or heterogeneity [23]. Therefore, it
was difficult to determine the clinical utility of these TIs.
A time–temperature indicator (TTI) prototype, Freshzone TTI
(FZTTI; Freshzone, Seoul, Korea), was recently developed. TTI shows
CC indicating the time elapsed since the sample reached a specific
temperature and were developed to overcome the limitations of TIs
[24]. To our knowledge, no study has compared the utility of TTIs and
TIs in RBC transfusion in hospital settings. Thus, this study aimed to
compare the CC of FZTTI with that of two TIs (STV10 and BT10)
approved by US FDA for monitoring RBC units based on the 30-min
rule. We hypothesized that FZTTI would outperform the TIs [23].
MATERIALS AND METHODS
Study design
This study was conducted at three tertiary care hospitals (Konkuk
University Medical Center [KUMC], Asan Medical Center [AMC] and
Kangdong Sacred Heart Hospital [KSHH]) in Seoul, Korea, from July
2019 to November 2019. The study protocol was approved by the
institutional review board of each hospital. Two sets of RBC units
were used: 91 units (71 at KUMC, 11 at AMC and 9 at KSHH; 79 leu-
koreduced) were transfused to patients in the clinical setting and two
units that would have been discarded based on the 30-min rule were
used as controls. The storage time before transfusion ranged from
2 to 19 days, and each unit (170–330 ml) contained 56 ml of citrate-
phosphate-dextrose-adenine. The requirement for informed consent
was waived because the study posed no risk to patients.
Of the 91 RBC units, eight units were stored in blood refrigera-
tors (hereafter, refrigerators) immediately on the arrival in the ward or
in the injection room until transfusion, and the data were analysed
separately according to storage site. On issue, moisture was removed
from the blood bags, and FZTTI, STV10 and BT10 were simulta-
neously attached to the lower part of each bag according to the
355
manufacturer’s instructions [23, 25, 26]. The material was transported
on ice following conventional transfusion practices. The time to CC
was monitored before and after transportation and during transfusion.
The time needed to attach the adhesive tags to the units; time of
issue; time for initiating transfusion; transfusion duration; temperature
in the blood bank, outpatient injection room and ward; and internal
temperature of refrigerators were measured. The refrigerators were
equipped with an automated temperature monitoring system and an
alarm to warn medical staff when the temperature exceeded 6 C. The
internal temperature of all refrigerators was routinely monitored by
nurses every 8 h; for this study, additional checks were performed to
monitor the internal temperature of refrigerators containing the RBC
units. In each hospital, well-trained blood bank physicians conducted
all procedures, including issuing of RBC units and monitoring of time
and temperature, using identical procedures.
For the experimental simulation, two RBC units (190  20
ml/unit) that were to be discarded because of high alanine amino-
transferase levels (>101 IU/L) were purchased from the Korean Red
Cross Blood Center [3, 27]. These units were stored separately in the
refrigerator, and the time from donation to experimental (transfusion)
simulation was 17 and 20 days. The ST and CT of these two units
were monitored using a data logger (CR23X Micrologger, Campbell
Scientific Inc., Logan, UT) and a type K thermocouple probe (OMEGA
Engineering Inc., Stanford, CA) [23, 28]. The probe was attached to
the outside and centre of each unit in a cold room at 3.1 C [23]. The
ST and CT in the cold room and at RT at different time points (0, 5,
15, 30, 45, 60, 120, 180 and 240 min) and the temperature inside and
outside the cold room were also measured using the data logger.
TTIs and TIs
The CCs are summarized in Figure 1. FZTTI is rectangular
(16  28 mm2) and contains a synthetic polyethylene terephthalate
film and a red diffuse material (fatty acid ethyl ester). It has an activa-
tion button and an indicator that shows the time elapsed (30 min and
1, 2, 4, 6 and 8 h) since reaching a temperature of 10 C. This indicator
is applied as follows: (1) The activation button is gently pressed using
the activator at RT; following this, the red diffuse material proceeds to
the activation line. (2) After peeling off the liner, FZTTI is attached
to the lower part of the RBC bag. Once the temperature reaches
10 C, the red diffuse material in the time indicator area begins to
move to the point indicating the elapsed time; it does not move if the
temperature is below 10 C [24].
Before the experiment, three FZTTIs were tested at 5 C and
25 C for quality control (QC). At 5 C, none of the FZTTIs changed col-

our at 30 min after the temperature reached 10 C; however, at 25 C,
the three TTIs changed colour at 30 min. The elapsed time can be
accurately measured using a mobile app provided by the manufac-
turer, although this app was not used in this study.
The procedures for attaching STV10 and BT10 to RBC units have
been described previously [23]. In STV10, red dots begin to fill a white
centre around 9 C and completely fill it at 10 C. STV10 was stored in
356
F I G U R E 1 Interpretation of colour change of TTI and TIs. (a) FZTTI. (b) Standard readings for colour changes in FZTTI, STV10 and BT10.
Abbreviations: FZ, Freshzone; TTI, time–temperature indicator; TIs, temperature indicators
a refrigerator for more than 24 h before use according to the manu-
facturer’s instructions [23, 25]. The manufacturer provides a QC docu-
ment for each lot of STV10. We used two lots, S10020719 and
S10060118, both with QC result of ‘pass’ (CC at 10.1 C and 10.2 C,
respectively). In BT10, a blue dye appears in a white breach window
at temperatures above 10 C/50 F after activation [23, 24]. We used
BT10 lot number 800-278 (AR1804311), and there were no
manufacturer-provided QC results for this lot. All indicators were used
within the expiration dates [23–26].
Statistical analysis
Data are presented as numbers (percentages) or medians (interquartile
ranges). The Shapiro–Wilk test was used to assess the normality of
data distribution. The Mann–Whitney U-test was used to compare
the time for CC across indicators. Fisher’s exact test was used to com-
pare the time for CC between FZTTI and the two TIs in 83 RBC units
according to the 30-min rule. Statistical analyses were performed
using MedCalc version 19.5.3 (MedCalc Software Ltd., Ostend,
Belgium) and Analyse-it (Analyse-it Software Ltd., Leeds, UK). Statisti-
cal significance was set at p < 0.05.
RESULTS
Table 1 shows the characteristics of FZTTI and the TIs for 83 RBC units
that were not stored in refrigerators in the ward. Transfusion started
within 30 min after issue, and the median duration of transfusion was
96.5 min. The results varied across hospitals. Using FZTTI, the median
PARK ET AL.
time for CC differed significantly only between KUMC and KSHH
(52.7 min vs. 37.3 min, p < 0.001). By contrast, using STV10, the median
time for CC differed significantly between KUMC and the other hospitals
(15.2 min vs. 5.0 min [AMC] or 9.7 min [KSHH], both p < 0.05). Using
BT10, a significant difference in the median time for CC was observed
only between KUMC and AMC (10.4 min vs. 16.0 min, p < 0.05).
The median time for CC was considerably higher with FZTTI than
with STV10 and BT10 (51.4, 13.9 and 10.5 min, respectively)
(p < 0.001) (Figure 2) and differed significantly between the two TIs
(p = 0.002). In total, 95.2% (79/83 units) of the FZTTI tags changed
colour after 30 min of issue, whereas 96.4% (80/83 units) of STV10
and 98.8% (82/83 units) BT10 tags changed colour within 30 min of
issue (p < 0.001, data not shown).
Table 2 shows the time and temperature data of FZTTI and the
TIs for the eight RBC units that were stored in refrigerators in
the ward; all units were transfused within 30 min of refrigeration. The
median time for CC for FZTTI differed significantly from that of BT10
(99.5 min vs. 15.5 min, p = 0.016). STV10 and BT10 showed CC dur-
ing transport (n = 4 and 2, respectively), during cold storage (n = 1
and 5) and after cold storage (n = 3 and 1). The internal temperature
of the refrigerators was within normal limits. The ST and CT of the
control RBC units were monitored simultaneously and showed a simi-
lar pattern of change (Figure 3). At RT, the ST and CT of both units
exceeded 10 C at 5 and 15 min, respectively.
DI SCU SSION
This work expands on our previous study that explored the clinical
utility of STV10 and BT10 for temperature monitoring of RBC units
TIME–TEMPERATURE INDICATOR VERSUS TEMPERATURE INDICATORS 357

TABLE 1 Characteristics of a TTI and two TIs for 83 RBC units not stored in refrigerators

Characteristics Total (n = 83) KUMC (n = 68) AMC (n = 6) KSHH (n = 9)

Time required for attaching the TTI and TIs to RBC units (s) 41.0 (28.3–58.0) 39.5 (27.0–60.5) 47.5 (40.0–50.0) 54.0 (42.3–6.8)
Transport time (s) 32.0 (14.8–84.5) 25.0 (12.0–60.0) 360.0 (300.0–420.0) 185.0 (89.8–213.3)
Time for initiating blood transfusion (min) 3.0 (2.1–7.4) 2.7 (2.0–3.9) 9.5 (7.0–12.0) 8.4 (6.4–17.1)
Transfusion duration (min) 96.5 (73.5–115.0) 96.5 (75.5–114.0) 80.0 (73.0–84.8) 149.8 (71.9–185.6)
Temperature in the blood bank ( C) 23.0 (23.0–23.4) 23.0 (23.0–23.3) 23.6 (23.3–23.7) 25.5 (25.1–25.8)

Temperature in the injection room or ward ( C) 25.3 (24.2–25.8) 25.3 (24.2–25.3) 24.8 (24.5–26.8) 26.2 (25.7–26.8)
Time for colour change of the TTI, indicating the time elapsed since the temperature of RBC units reached 10 C
TTI (complete colour change to red by 1/2) (min) 51.4 (38.3–62.2) 52.7 (51.6–62.8)a 48.0 (37.0–57.0) 37.3 (34.2–40.1)
Time for colour change of TIs, indicating that the temperature of RBC units reached 10 C
STV10 (complete colour change to red) (min) 13.9 (9.6–19.4) 15.2 (10.5–21.5)b 5.0 (1.0–11.0) 9.7 (8.8–11.3)
BT10 (initial colour change to blue) (min) 10.5 (8.4–14.0) 10.4 (8.3–13.5) 16.0 (14.0–20.0)c 10.8 (8.8–11.6)

Note: Data are median and interquartile range. The time for colour change was measured from the time of blood issue.
a
p < 0.001 versus 37.3 min in KSHH.
b
p < 0.05 versus 10.4 min in KUMC or 10.8 min in KSHH.
c
p < 0.05 versus 5.0 min in AMC or 9.7 min in KSHH.
Abbreviations: AMC, Asan Medical Center; KSHH, Kangdong Sacred Heart Hospital; KUMC, Konkuk University Medical Center; RBC, red blood cells; TIs,
temperature indicator; TTI, time–temperature indicator.

T A B L E 2 Characteristics of a TTI and two TIs for eight RBC units

stored in refrigerators in the ward

Characteristics Value
Time for attaching the TTI and two TIs to 52.0 (36.0–58.0)
RBC units (s)
Transport time (s) 270.0 (240.0–360.0)
Time for initiating blood transfusion (min) 60.5 (47.0–115.0)
Transfusion duration (min) 98.0 (80.8–112.8)
Temperature in the blood bank ( C) 23.6 (23.0–23.7)

Temperature in the ward ( C) 25.8 (25.1–26.2)
Time for colour change of the TTI, indicating the time elapsed since
the temperature of RBC units reached 10 C
TTI (complete colour change to 99.5 (88.0–157.8)a
red to 1/2) (min)
Time for colour change of TIs indicating that the temperature of RBC
F I G U R E 2 Time for colour change in FZTTI and two TIs (STV10
units reached 10 Cb (min)
and BT10) in 83 RBC units. Middle line and error bars indicate the
STV10 (complete colour change to red) 7.0 (2.5–123.5)
median and IQR, respectively. Dotted line indicates 30 min after issue.
(min)
Abbreviations: FZ, Freshzone; IQR, interquartile range; RBC, red blood
cell; TIs, temperature indicators; TTI, time–temperature indicator BT10 (initial colour change to blue) (min) 15.5 (8.5–69.5)

and concluded that further improvements and standardization are
necessary to increase the utility of TIs [23]. In this study, we assessed
whether the combination of time and temperature would be a more
useful monitoring tool than temperature alone and hypothesized that
TTIs would outperform TIs in RBC transfusion practice.
The CCs of FZTTI, STV10 and BT10 varied across the three ter-
tiary care hospitals (Table 1). Differences in sample size, type of pack-
aging, transport time and RT across the hospitals may have affected
the results. In addition, the performance of FZTTI and the two TIs
may have differed across hospitals. Although the two TIs were US
FDA approved, the QC document was available only for STV10, and
the QC results could not be verified by end users in each hospital.
Note: Data are presented as median and interquartile range. The time for
colour change was measured from the time of blood issue. The median
refrigerator storage time in the ward was 55.5 (41.5–110.0) min.
a
p = 0.016 versus 15.5 min in BT10.
b
In STV10, colour change occurred during transport (n = 4) and
refrigerator storage (n = 1) and after refrigerator storage (n = 3). In BT10,
colour change occurred during transport (n = 2) and refrigerator storage
(n = 5) and after refrigerator storage (n = 1).
Abbreviations: RBC, red blood cell; TTI, time–temperature indicator; TIs,
temperature indicators.
Therefore, the possibility of random errors cannot be ruled out. QC
guidelines are essential to guarantee the performance of TTIs and TIs.
Although the blood bank physicians performed all procedures
358
F I G U R E 3 Monitoring of the surface and core temperatures of two RBC units marked for being discarded according to the 30-min rule.
Dotted line indicates 10 C. In the X-axis, refrigeration and zero indicate the times for which the units were stored in refrigerator and at room
temperature, respectively. Temperatures were monitored for up to 4 h, and the time scale was adjusted arbitrarily to highlight temperature
changes at initial time points. Abbreviation: RBC, red blood cell
identically, inter-observer variability could not be ruled out, and this
type of variability is expected to be higher in clinical practice.
In this study, the median time for CC of FZTTI was 51.4 min, and
most of the FZTTIs changed colour after 30 min of issue (Table 1
and Figure 2). By contrast, most STV10 and BT10 indicators showed
CC within 30 min of issue, consistent with our previous finding [23].
This result was expected because the designs of TTIs and TIs are dif-
ferent. The design of TTIs makes them more suitable than TIs for
applying the 60-min rule. For the set of RBC units that were stored in
the refrigerator in the ward, most STV10 and BT10 tags changed col-
our during transport as well as refrigerator storage (Table 2). Although
seven FZTTI tags changed colour at 30 min at RT, one tag changed
colour at 18 min at RT, suggesting that the CC started during refriger-
ation. Several factors such as RT, volume of RBC units and ventilation
can affect the ST of RBC units [20]. Additionally, although the temper-
ature of refrigerators is automatically maintained below 6 C, medical
personnel should recheck the temperature periodically. This prema-
ture CC indicates that reliable QC data and high performance are
indispensable for the use of TTIs and TIs in transfusion practice. In the
control RBC units, the CT was lower than the ST, and both values
reached 10 C within 15 min of refrigeration (Figure 3), which is in line
with recent reports that the 30-min rule does not reflect the 10 C
limit [19, 23, 29, 30]. The 30-min rule was developed based on an
early 1970s study, wherein the ST and CT of 33 whole blood units
reached 10 C within 30 min in plastic blood bags and within 45–
60 min in glass bottles [8]. However, the 10 C limit is not absolute
with respect to reducing the risk of bacterial growth and RBC quality
deterioration, and recent studies reported that there was no
PARK ET AL.
significant change in RBC quality even at temperatures higher than
10 C or with storage times longer than 30 min [16, 31]. The 30-min
rule has been amended to the 60-min rule in the United Kingdom and
Canada, and it needs to be reconsidered in other countries.
Based on our data, FZTTI seems to be more effective than the
two TIs for RBC temperature monitoring and supporting the decision
for discarding blood units. If RBC units are discarded based on the CC
of TIs, incorrect data interpretation and inadequate use of TIs might
cause wastage [10]. In the current study, the three blood bank physi-
cians who performed the procedures reached a consensus that FZTTI
was easier to use and more intuitive, with less intra- and inter-
observer heterogeneity than STV10 and BT10. However, further
questionnaire studies are needed to confirm this consensus from a
limited number of users. Moreover, the following features of FZTTI
should be improved before its clinical use: (1) the time point indicating
10 C was unclear, and the time required for tag activation and attach-
ment to the RBC bags was longer than that for the TIs; (2) the activation
button needed to be pressed gently; (3) the outer film was too thin and
hence difficult to peel; and (4) similar to the two TIs, FZTTI tags detached
frequently from the RBC bags and needed to be fixed with tape.
There are no guidelines on the use of TTIs or TIs in RBC trans-
fusion practice. With regard to their use in the vaccine supply chain,
the WHO provides guidelines for vaccine vial monitor or vaccine
TTI [32]. To maintain the quality of blood products, it is essential to
use an appropriate temperature monitoring tool for the storage and
transport of RBC units [5] and establish guidelines for the standardi-
zation of measurements, application time, placement of TIs, and so
forth [23].
TIME–TEMPERATURE INDICATOR VERSUS TEMPERATURE INDICATORS
This study has the following limitations. First, the sample size was
small. Of the 91 units, only eight units were stored in refrigerators in
the ward before transfusion. Although this small number was insuffi-
cient to allow appropriate statistical comparison, this set of RBC units
revealed the limitations of current TIs with respect to QC and reliabil-
ity. Second, only two blood units were used as controls to obtain data
on ST and CT changes. Third, we did not assess RBC quality and steril-
ity. However, this is the first study to compare the utility of a TTI pro-
totype with that of US FDA–approved TIs in a hospital setting.
In conclusion, this study demonstrated the superiority of the
FZTTI prototype with respect to the 30-min rule and the feasibility of
using this indicator in transfusion practice. This study also revealed
the practical issues with the use of current TTIs and TIs with regard to
heterogeneity and the lack of standardization. Thus, continuous
efforts are needed to enhance the clinical utility of TTIs and TIs, and
conventional transfusion practices based on the 10 C limit and/or
30-min rule need to be further discussed.
ACKNOWLEDGEMEN TS
M.P. performed experiments, analysed the data and drafted the manu-
script; M.H. conceived the study, analysed the data and finalized the
manuscript; H.K. and K.O. discussed the data and reviewed the manu-
script; D.-H.K. and Y.C. participated in the experiments and data anal-
ysis. All authors critically reviewed the manuscript and approved the
final manuscript.
CONF LICT OF IN TE RE ST
The authors declare no conflicts of interest.
ORCID
Mina Hur https://orcid.org/0000-0002-4429-9978
Dae-Hyun Ko https://orcid.org/0000-0002-9781-0928
RE FE R ENC E S
1. Alquist CR, Harm S. Transfusion-service-related activities:
pretransfusion testing and storage, monitoring, processing, distribu-
tion, and inventory management of blood components. In: Cohn CS,
editor. Technical manual. 20th ed. Bethesda, Maryland: American
Association of Blood Banks; 2020. p. 503–35.
2. Gehrie EA, Chandler J, Snyder EL. Clinical and technical aspects of
blood administration. In: Simon T, editor. Rossi’s principles of trans-
fusion medicine. 5th ed. Chichester: John Wiley & Sons; 2016.
p. 23–9.
3. Korea Centers for Disease Control and Prevention: Transfusion
guideline. 4th ed. http://www.transfusion.or.kr/KOR/images/file/4_
file01.pdf. Accessed 9 Mar 2021.
4. SPECIFICATION SPN223/10 NHSBT Portfolio of blood components
and guidance for their clinical use. https://nhsbtdbe.blob.core.
windows.net/umbraco-assets-corp/16494/spn223v10.pdf.
Accessed 9 Mar 2021.
5. World Health Organization: The blood cold chain. https://www.who.
int/bloodsafety/processing/who_eht_11_04_en.pdf?ua=1. Accessed
9 Mar 2021.
6. Gibson JG 2nd, Sack T, Evans RD, Peacock WC. The effect of varying
temperatures on the post-transfusion survival of whole blood during
depot storage and after transportation by land and air. J Clin Invest.
1947;26:747–55.
359
7. Parpart AK, Gregg JR, Lorenz PB, Ethel R, Parpart ER, Chase AM.
Whole blood preservation; a problem in general physiology: an
in vitro analysis of the problem of blood storage. J Clin Invest. 1947;
26:641–54.
8. Pick P, Fabijanic J. Temperature changes in donor blood under differ-
ent storage conditions. Transfusion. 1971;4:213–5.
9. Hamill TR. The 30-minute rule for reissuing blood: are we needlessly
discarding units? Transfusion. 1990;30:58–62.
10. Collins RA, Wisniewski MK, Waters JH, Triulzi DJ, Yazer MH. Effec-
tiveness of multiple initiatives to reduce blood component wastage.
Am J Clin Pathol. 2015;143:329–35.
11. Yazer MH, Abraham S, Beckman N, Folléa G. International Society
for Blood Transfusion international survey on blood product wastage
in hospitals. ISBT Sci Ser. 2016;11:24–31.
12. NHS Blood Stocks Management Scheme: NHS Blood and
Transplant/Hospital Report 2017/18. https://nhsbtdbe.blob.core.
windows.net/umbraco-assets-corp/15951/nhsbt-annual-report-
2017-18.pdf. Accessed 9 Mar 2021.
13. Brunskill S, Thomas S, Whitmore E, McDonald CP, Dorée C,
Hopewell S, et al. What is the maximum time that a unit of red blood
cells can be safely left out of controlled temperature storage? Trans-
fus Med Rev. 2012;26:209–23.
14. Dumani D, Goldfinger D, Ziman A. Is the 30-minute rule still applica-
ble in the 21st century? Transfusion. 2013;53:1150–2.
15. Foley K, Poles D, Mistry H, Gray A, Bolton-Maggs PH. Are the ‘rules’
for times in set up and duration of red cell transfusion too strict?
Transfus Med. 2016;26:166–9.
16. Thomas S, Hancock V, Cardigan R. The 30 minute rule for red blood
cells: in vitro quality assessment after repeated exposure to 30 C.
Transfusion. 2013;53:1169–77.
17. Ramirez-Arcos S, Kou Y, Ducas E,  Thibault L. Changing the 30-min
rule in Canada: the effect of room temperature on bacterial growth
in red blood cells. Transfus Med Hemother. 2016;43:396–9.
18. Aplin K, Pitt T, Allen J, Roy A, Tidey K, Ball J, et al. Extending the
30-minute rule for red cell units - investigation of the bacterial risk
of 60-minute exposures to ambient temperature. Vox Sang. 2019;
114:189–97.
19. Johnson V, Langeberg A, Taye-Makuria A, Sandler SG. Temperature-
sensitive labels for containers of RBCs. Am J Clin Pathol. 2006;126:
406–10.
20. Sigle JP, Holbro A, Lehmann T, Infanti L, Gerull S, Stern M, et al. Tem-
perature-sensitive indicators for monitoring RBC concentrates out of
controlled temperature storage. Am J Clin Pathol. 2015;144:145–50.
21. Tiwari AK, Sharma P, Pandey PK, Rawat GS, Dixit S, Raina V, et al. A
cost effective model for appropriate administration of red cell units
and salvaging un-transfused red cell units by using temperature sen-
sitive indicators for blood unit transportation in a hospital setting.
Asian J Transfus Sci. 2015;9:36–40.
22. Bots M, de Grouw EP, van Rooyen-Schreurs IH, van den Akker GJ,
Sturk A, Klinkspoor JH, et al. Strategies to reduce wastage of red
blood cell units. Vox Sang. 2016;110:143–9.
23. Park M, Hur M, Yi A, Kim H, Lee HK, Jeon EY, et al. Utility of
temperature-sensitive indicators for temperature monitoring of red-
blood-cell units. Vox Sang. 2019;114:487–94.
24. FRESHZONE: TTI type. http://www.freshzone.co.kr/tti/tti1.php.
Accessed 11 Mar 2021.
25. Temptime Corporation: COMM Instructions for Use STV10 Doc
#2269 rev 11 2020-09-29. https://temptimecorp.com/wp-content/
uploads/2021/02/COMM-Instruction-for-Use-STV10.pdf. Accessed
11 Mar 2021.
26. Timestrip UK Ltd: Blood Temp 10. https://timestrip.com/products/
blood-temp-10/. Accessed 11 Mar 2021.
27. Korea National Law Information Center: Enforcement Rules of the
Blood Management Act. [Attachment 1] Scope of ineligible blood
and criteria for determining eligibility for blood and blood products
360
(related to Article 2). https://www.law.go.kr/%EB%B2%95%EB%
A0%B9/%ED%98%88%EC%95%A1%EA%B4%80%EB%A6%AC%EB
%B2%95%EC%8B%9C%ED%96%89%EA%B7%9C%EC%B9%99. Ac
cessed 11 Mar 2021.
28. Campbell Scientific: CR23X Micrologger operator’s manual. http://s.
campbellsci.com/documents/us/manuals/cr23x.pdf. Accessed 11 Mar
2021.
29. Reiter U, Wagner T, Kozma N, Reiter G, Lanzer G. Core and surface
temperatures in a red-blood-cell unit during storage and transport.
Vox Sang. 2011;101:10–5.
30. Perry HE, Prasad P, Kirwan S, Perry HE, Huang YQ. Core temperature
changes in resuspended red blood cells (RBCs) and pediatric RBCs
removed from refrigerated storage. Transfusion. 2010;50:174–7.
31. Ramirez-Arcos S, Mastronardi C, Perkins H, Kou Y, Turner T,
Mastronardi E, et al. Evaluating the 4-hour and 30-minute rules:
PARK ET AL.
effects of room temperature exposure on red blood cell quality and
bacterial growth. Transfusion. 2013;53:851–9.
32. World Health Organization: [PQS/E006/IN05.4] Vaccine Vial Moni-
tor Performance Specification. https://apps.who.int/immunization_
standards/vaccine_quality/pqs_catalogue/catdocumentation.aspx?
id_cat=35. Accessed 11 Mar 2021.
How to cite this article: Park M, Hur M, Kim H, Oh K, Ko D-H,
Chung Y. Time–temperature indicators versus temperature
indicators for transfusion practice: Application in the real
hospital setting. Vox Sang. 2022;117:354–60.
Received: 17 April 2021 Revised: 15 July 2021 Accepted: 19 July 2021

DOI: 10.1111/vox.13188

ORIGINAL ARTICLE

Plasma, platelet and red blood cell transfusion ratios for

life-threatening non-traumatic haemorrhage in medical
and post-surgical patients: An observational study

Luke J. Matzek1 | Emil B. Kurian2 | Ryan D. Frank3 | Timothy J. Weister3 |

Ognjen Gajic4 | Daryl J. Kor1,5 | Matthew A. Warner5,6

1
Department of Anesthesiology and
Perioperative Medicine, Mayo Clinic, Abstract
Rochester, Minnesota, USA
Background and Objectives: Despite the broad utilization of component-based transfu-
2
Mayo Clinic Alix School of Medicine, Mayo
Clinic, Rochester, Minnesota, USA
sion strategies that aim to reconstitute whole blood during acute traumatic
3
Department of Biomedical Statistics and haemorrhage, data for haemorrhage occurring outside of trauma and surgery are limited.
Informatics, Mayo Clinic, Rochester, Methods: This is an observational cohort study of adults experiencing critical non-
Minnesota, USA
4 traumatic, non-intraoperative haemorrhage during hospitalization at an academic
Department of Medicine, Division of
Pulmonary and Critical Care Medicine, Mayo medical centre from 2011 to 2015. The primary goal was to evaluate differences in
Clinic, Rochester, Minnesota, USA
plasma and platelet to red blood cell (RBC) transfusion ratios across patient demo-
5
Patient Blood Management Program, Mayo
Clinic, Rochester, Minnesota, USA graphic, clinical and laboratory characteristics. Secondarily, associations between
6
Department of Anesthesiology and transfusion ratios and clinical outcomes were assessed.
Perioperative Medicine, Division of Critical
Results: Seven hundred nine patients were included: 498 (70.2%) medical and
Care Medicine, Mayo Clinic, Rochester,
Minnesota, USA 211 (29.8%) post surgical. The gastrointestinal tract (36.7%) was the most common
site of bleeding. Most patients received RBCs without plasma (35.5%) or platelets
Correspondence
Matthew A. Warner, Department of (54.2%). Among those receiving plasma, 82.3% received a plasma to RBC
Anesthesiology and Perioperative Medicine, ratio < 1:1 at 24 h. For platelets, the most common ratio was 1–2:1 (52.9%). Transfu-
Division of Critical Care Medicine, Mayo
Clinic, 200 1st Street S.W., Rochester, MN sion ratios were generally consistent across comorbid disease severity, admission
55905, USA. type and anatomic sites of bleeding. Higher plasma utilization was observed in the
Email: warner.matthew@mayo.edu
emergency department, while greater platelet utilization occurred in intensive care
Funding information units. Higher transfusion ratios were observed in those with greater laboratory
Mayo Clinic Department of Anesthesiology
haemostatic abnormalities prior to the haemorrhagic event. Clinical outcome differ-
and Perioperative Medicine and the Critical
Care Integrated Multidisciplinary Practice, ences were limited, though greater platelet utilization in the first 24 h was associated
Rochester, Minnesota; Foundation for the
with higher mortality and fewer hospital-free days.
National Institutes of Health, Grant/Award
Number: HL121232; National Center for Conclusions: Transfusion ratios for critical non-traumatic haemorrhage were primar-
Advancing Translational Sciences, Grant/
ily related to laboratory abnormalities preceding the haemorrhagic event and practice
Award Number: KL2 TR002379; National
Heart, Lung, and Blood Institute, Grant/Award environments. Clinical outcome differences across ratios were limited.
Number: K23HL153310
KEYWORDS
bleeding, critical administration threshold, haemorrhage, massive transfusion, transfusion ratios

The content is solely the responsibility of the authors and does not necessarily represent the
official views of the NIH.

Vox Sanguinis. 2022;117:361–370. wileyonlinelibrary.com/journal/vox © 2021 International Society of Blood Transfusion. 361
362
I N T R O D U CT I O N
Transfusion of plasma, platelets and red blood cells (RBCs) in relatively
fixed high ratios (i.e., 1:1:1) as part of a balanced resuscitation strategy
has become a standard of care for patients suffering acute traumatic
haemorrhage [1–4]. Extrapolating from the trauma experience, most
institutions adopted ‘massive transfusion’ protocols with empiric high
ratio strategies to facilitate standardized blood component delivery in
times of acute exsanguination, irrespective of any perceived relation-
ship to traumatic injury [5, 6].
Most massive transfusion events occur in patients without
trauma, yet the safety and efficacy of extrapolation of trauma-based
resuscitation strategies to non-trauma populations remain unclear
[7–10]. While recent observational data suggest that higher transfu-
sion ratios may not be associated with improved outcomes in surgical
patients with non-traumatic intraoperative haemorrhage [11], evi-
dence for optimal transfusion ratios outside of operative and acute
trauma resuscitation settings is limited. Patients who suffer life-
threatening haemorrhage secondary to non-traumatic insults are likely
to be phenotypically and physiologically distinct from their trauma
counterparts. Hence, it is important to assess the application of ratio-
based transfusions outside of trauma, with a focus on clinical and
environmental factors that may lead to differences in resuscitation
strategies and clinical outcomes.
The primary goal of this study is to assess plasma, platelet and
RBC transfusion strategies in patients with critical non-traumatic
and non-intraoperative haemorrhage, with an emphasis on differences
in transfusion ratios based upon anatomic sources of bleeding and
patient demographic, clinical and laboratory features. Additionally, we
assess the relationships between transfusion ratios and clinical out-
comes, which may be utilized for hypothesis generation to inform
future clinical trials regarding optimal resuscitation strategies for non-
traumatic haemorrhage.
METHODS
This is an observational cohort study conducted under approval of the
local institutional review board (Mayo Clinic, Rochester, MN) at a sin-
gle academic medical centre with waived requirement for written
informed consent, though patients previously declining medical record
use for observational research were excluded. The study was con-
ducted in accordance with the Strengthening the Reporting of Obser-
vational Studies in Epidemiology guidelines [12].
Inclusion criteria were hospitalized patients aged 18 years or
older experiencing haemorrhage requiring large-volume transfusion
according to the critical administration threshold (CAT) during a study
period of 1 January 2011 and 31 December 2015. The CAT is used to
identify patients with rapid life-threatening bleeding requiring large
volume transfusion and is defined by transfusion of three or more
units of RBCs within a 1-h time period [13]. It has several advantages
over other commonly employed definitions of ‘massive transfusion’
(e.g., ≥10 units of RBCs in 24 h). It reduces the potential impact of
MATZEK ET AL.
survivor bias in observational studies, facilitates earlier identification
of patients with life-threatening haemorrhage and is predictive of
mortality [13–15]. Exclusion criteria included traumatic injury, transfu-
sions administered intraoperatively for surgical patients and previous
denial of authorization of medical record use for observational
research. Post-surgical patients meeting CAT criteria who subse-
quently returned to the operating room due to bleeding were
included, though patients with primary intraoperative haemorrhage
were not included, as these data have previously been reported [11].
Patients were only included in the study once, such that only the
first CAT event was included for any given patient. CAT events
were pre-specified to extend 24 h from the time of the first
transfused unit.
A transfusion protocol for critical haemorrhage (i.e., massive
transfusion protocol) was implemented at the study institution in
2006, which facilitated emergent release of blood products to all clini-
cal areas. This protocol remained unchanged throughout the study
period and was activated by direct communication with the blood
bank via phone call, face-to-face dialogue or electronically. Activation
triggered release of six units of uncrossmatched O-negative RBCs, six
units of type A or AB plasma and 1 unit of Rh-negative apheresis
platelets (equivalent to a six pack of pooled platelets), with the goal of
approximating 1:1:1 whole blood resuscitation. Administration of indi-
vidual components was at the discretion of the attending clinician.
All adult patients meeting CAT criteria were identified using
the Transfusion DataMart, an institutional data warehouse con-
taining comprehensive data surrounding each unit of ordered allo-
geneic blood, including transfusion timing and associated
laboratory values. Clinical features were obtained through the
intensive care unit (ICU) DataMart, another institutional datamart
containing detailed information of patient features in acute-care
environments and the Advanced Cohort Explorer, which provide a
real-time feed of the electronic medical record. These resources
are highly accurate and undergo continuous monitoring and valida-
tion, as reported previously [16, 17].
Baseline demographic and clinical characteristics were
extracted for all patients, including age, sex, Charlson comorbidity
score, past medical history, pre-transfusion laboratory values
including haemoglobin, platelet count and international normalized
ratio (INR) (i.e., the most recent values in the 24 h preceding the
first blood product administration during the CAT event) and
administration of antiplatelet, antithrombotic, antifibrinolytic and
haemostatic therapies. The physical location (i.e., ICU, emergency
department [ED] or hospital floor) of the first transfused product
was also extracted. Manual chart review (L.J.M., E.B.K.) was utilized
to categorize anatomic locations of bleeding. Transfusions of
plasma, platelets and RBCs were extracted throughout hospitaliza-
tion. Recognizing that transfusion ratios change throughout resus-
citation, plasma to RBC and platelet to RBC ratios were calculated
at 3, 12 and 24 h, with appropriate censoring for those dying prior
to the interval of interest. Patients meeting massive transfusion
criteria by both CAT and traditionally defined metrics (i.e., ≥10
RBCs within 24 h) were also identified.
TRANSFUSION RATIOS AND CLINICAL OUTCOMES 363

FIGURE 1 Patient flow diagram. CAT, critical administration threshold

FIGURE 2 Anatomic location of source of CAT+ haemorrhagic event

TABLE 1 Patient demographics and clinical characteristics by plasma:red blood cell (RBC) ratio at 24 h
364

0 0.1–0.4 0.5–0.9 1.0+ Total

Characteristic N = 252 N = 172 N = 204 N = 81 N = 709 p-value
Demographics
Age 66.5 (54.2, 76.9) 65.4 (55.6, 76.3) 63.3 (50.9, 74.4) 61.9 (47.1, 71.9) 64.6 (52.8, 75.8) 0.03a
Male sex 143 (56.7%) 104 (60.5%) 125 (61.3%) 42 (51.9%) 414 (58.4%) 0.44b
Charlson score 6 (4, 9) 6 (4, 9) 6.0 (3.5, 8.0) 5 (2, 8) 6 (4, 9) 0.07a
Massive transfusion+ 16 (6.3%) 52 (30.2%) 70 (34.3%) 11 (13.6%) 149 (21.0%) <0.001b
Patient location 0.02b
ICU 208 (82.5%) 146 (84.9%) 164 (80.4%) 59 (72.8%) 577 (81.4%)
Emergency room 23 (9.1%) 17 (9.9%) 29 (14.2%) 19 (23.5%) 88 (12.4%)
Floor 21 (8.3%) 9 (5.2%) 11 (5.4%) 3 (3.7%) 44 (6.2%)
Anatomical site 0.76b
Gastrointestinal 95 (37.7%) 59 (34.3%) 73 (35.8%) 33 (40.7%) 260 (36.7%)
Intra-abdominal 42 (16.7%) 36 (20.9%) 36 (17.6%) 23 (28.4%) 137 (19.3%)
Thoracic 31 (12.3%) 21 (12.2%) 28 (13.7%) 8 (9.9%) 88 (12.4%)
Haematologic 15 (6.0%) 9 (5.2%) 11 (5.4%) 5 (6.2%) 40 (5.6%)
Multifactorial 9 (3.6%) 8 (4.7%) 13 (6.4%) 1 (1.2%) 31 (4.4%)
Retroperitoneal 12 (4.8%) 9 (5.2%) 9 (4.4%) 0 (0.0%) 30 (4.2%)
Vascular 11 (4.4%) 9 (5.2%) 7 (3.4%) 3 (3.7%) 30 (4.2%)
Other 16 (6.3%) 11 (6.4%) 13 (6.4%) 6 (7.4%) 46 (6.5%)
Unknown 21 (8.3%) 10 (5.8%) 14 (6.9%) 2 (2.5%) 47 (6.6%)
Medical or post-surgical 0.34b
Medical 181 (71.8%) 126 (73.3%) 140 (68.6%) 51 (63.0%) 498 (70.2%)
Post-surgical 71 (28.2%) 46 (26.7%) 64 (31.4%) 30 (37.0%) 211 (29.8%)
PLT:RBC ratio <0.001b
0 202 (80.2%) 81 (47.1%) 68 (33.3%) 33 (40.7%) 384 (54.2%)
0.1–0.9 6 (2.4%) 37 (21.5%) 45 (22.1%) 12 (14.8%) 100 (14.1%)
1.0–2.0 31 (12.3%) 46 (26.7%) 69 (33.8%) 26 (32.1%) 172 (24.3%)
2.1+ 13 (5.2%) 8 (4.7%) 22 (10.8%) 10 (12.3%) 53 (7.5%)
RBC units 4 (3, 5) 6 (5, 9) 6.5 (4.0, 10.0) 4 (3, 7) 5 (4, 7) <0.001a
Laboratory values before CAT+
Haemoglobin, g/dl 7.1 (6.0, 8.8) 7.3 (5.7, 8.7) 7.7 (6.3, 9.1) 7.4 (6.5, 10.3) 7.3 (6.0, 9.0) 0.07a
9
Platelet count, 10 /L 164 (100, 258) 146 (90, 216) 135 (81, 195) 139.5 (80.0, 209.0) 148 (89, 225) 0.03a
INR 1.2 (1.1, 1.4) 1.4 (1.2, 1.8) 1.4 (1.2, 2.0) 1.7 (1.3, 2.4) 1.3 (1.1, 1.8) <0.001a
(Continues)
MATZEK ET AL.
TABLE 1 (Continued)

0 0.1–0.4 0.5–0.9 1.0+ Total

Characteristic N = 252 N = 172 N = 204 N = 81 N = 709 p-value
Medications before CAT+
Heparin 29 (11.5%) 17 (9.9%) 15 (7.4%) 8 (9.9%) 69 (9.7%) 0.53b
Direct thrombin inhibitor 2 (0.8%) 2 (1.2%) 1 (0.5%) 0 (0.0%) 5 (0.7%) 0.74c
Warfarin 42 (16.7%) 25 (14.5%) 29 (14.2%) 23 (28.4%) 119 (16.8%) 0.02b
Aspirin 126 (50.0%) 75 (43.6%) 83 (40.7%) 24 (29.6%) 308 (43.4%) 0.01b
LMW heparin 25 (9.9%) 10 (5.8%) 11 (5.4%) 6 (7.4%) 52 (7.3%) 0.24b
Clopidogrel within 7 days 30 (11.9%) 13 (7.6%) 16 (7.8%) 3 (3.7%) 62 (8.7%) 0.10c
Factor Xa 5 (2.0%) 1 (0.6%) 2 (1.0%) 1 (1.2%) 9 (1.3%) 0.61c
Haemostatic medications
TRANSFUSION RATIOS AND CLINICAL OUTCOMES

Vitamin K 12 (4.8%) 28 (16.3%) 25 (12.3%) 20 (24.7%) 85 (12.0%) <0.001b

Antifibrinolytic agents 3 (1.2%) 7 (4.1%) 9 (4.4%) 8 (9.9%) 27 (3.8%) 0.004c
PCCs 2 (0.8%) 5 (2.9%) 3 (1.5%) 1 (1.2%) 11 (1.6%) 0.38c

Note: Numbers indicate N (%) unless otherwise noted. Massive transfusion + defined as administration of ≥10 units of RBCs within 24 h.
Abbreviations: CAT, critical administration threshold; ICU, intensive care unit; INR, international normalized ratio; LMW, low-molecular-weight heparin; PCC, prothrombin complex concentrate; PLT, platelets;
RBC, red blood cells.
a
Kruskal–Wallis.
b
Chi-square.
c
Fisher exact.
365
TABLE 2 Patient demographics and clinical characteristics by platelet:red blood cell (RBC) ratio at 24 h
366

0 0.1–0.9 1.0–2.0 2.1+ Total

Characteristic N = 384 N = 100 N = 172 N = 53 N = 709 p-value
Demographics
Age 67.1 (55.4, 76.7) 61.8 (51.0, 73.4) 61.9 (50.9, 73.4) 60.9 (47.1, 70.7) 64.6 (52.8, 75.8) 0.003a
Male sex 226 (58.9%) 71 (71.0%) 90 (52.3%) 27 (50.9%) 414 (58.4%) 0.02b
Charlson score 6.0 (3.5, 9.0) 6 (3, 8) 6 (3, 9) 6 (4, 8) 6 (4, 9) 0.77a
Massive transfusion+ 21 (5.5%) 63 (63.0%) 54 (31.4%) 11 (20.8%) 149 (21.0%) <0.001b
Patient location 0.009b
ICU 300 (78.1%) 76 (76.0%) 150 (87.2%) 51 (96.2%) 577 (81.4%)
Emergency room 54 (14.1%) 17 (17.0%) 16 (9.3%) 1 (1.9%) 88 (12.4%)
Floor 30 (7.8%) 7 (7.0%) 6 (3.5%) 1 (1.9%) 44 (6.2%)
Anatomical site 0.10b
Gastrointestinal 160 (41.7%) 37 (37.0%) 50 (29.1%) 13 (24.5%) 260 (36.7%)
Intra-abdominal 71 (18.5%) 19 (19.0%) 37 (21.5%) 10 (18.9%) 137 (19.3%)
Thoracic 45 (11.7%) 13 (13.0%) 23 (13.4%) 7 (13.2%) 88 (12.4%)
Haematologic 19 (4.9%) 11 (11.0%) 7 (4.1%) 3 (5.7%) 40 (5.6%)
Multifactorial 15 (3.9%) 3 (3.0%) 11 (6.4%) 2 (3.8%) 31 (4.4%)
Retroperitoneal 15 (3.9%) 4 (4.0%) 9 (5.2%) 2 (3.8%) 30 (4.2%)
Vascular 12 (3.1%) 2 (2.0%) 9 (5.2%) 7 (13.2%) 30 (4.2%)
Other 25 (6.5%) 4 (4.0%) 12 (7.0%) 5 (9.4%) 46 (6.5%)
Unknown 22 (5.7%) 7 (7.0%) 14 (8.1%) 4 (7.5%) 47 (6.6%)
Medical or post-surgical 0.84b
Medical 270 (70.3%) 73 (73.0%) 120 (69.8%) 35 (66.0%) 498 (70.2%)
Post-surgical 114 (29.7%) 27 (27.0%) 52 (30.2%) 18 (34.0%) 211 (29.8%)
Plasma:RBC ratio <0.001b
0 202 (52.6%) 6 (6.0%) 31 (18.0%) 13 (24.5%) 252 (35.5%)
0.1–0.4 81 (21.1%) 37 (37.0%) 46 (26.7%) 8 (15.1%) 172 (24.3%)
0.5–0.9 68 (17.7%) 45 (45.0%) 69 (40.1%) 22 (41.5%) 204 (28.8%)
1.0+ 33 (8.6%) 12 (12.0%) 26 (15.1%) 10 (18.9%) 81 (11.4%)
RBC units 4 (3, 6) 10 (8, 14) 6 (4, 9) 5 (4, 6) 5 (4, 7) <0.001b
Laboratory values before CAT+
Haemoglobin, g/dl 7.3 (6.0, 9.1) 7.7 (6.3, 9.1) 7.3 (6.1, 9.0) 6.8 (6.0, 8.0) 7.3 (6.0, 9.0) 0.14b
9
Platelet count, 10 /L 181 (128, 269) 159 (105, 254) 104 (60, 146) 43 (29, 69) 148 (89, 225) <0.001b
INR 1.3 (1.1, 1.7) 1.3 (1.2, 1.8) 1.4 (1.2, 1.8) 1.5 (1.3, 1.9) 1.3 (1.1, 1.8) 0.02b
Medications before CAT+
Heparin 37 (9.6%) 10 (10.0%) 18 (10.5%) 4 (7.5%) 69 (9.7%) 0.94c
(Continues)
MATZEK ET AL.
 TRANSFUSION RATIOS AND CLINICAL OUTCOMES 367

Statistical considerations

0.003b
p-value
0.23b

0.66b

0.32b
0.01c

0.14c
0.63c

0.25c
0.02c
Data were descriptively summarized using frequency and percent for
categorical variables and medians and interquartile ranges (IQRs)
for continuous variables. Between-group comparisons of demo-
graphic, clinical and laboratory variables based on plasma to RBC or
platelet to RBC ratios were performed using Chi-square and Fisher
exact tests for categorical variables and Kruskal–Wallis tests for con-
119 (16.8%)
308 (43.4%)

85 (12.0%)
5 (0.7%)

62 (8.7%)
52 (7.3%)
9 (1.3%)

27 (3.8%)
11 (1.6%)
tinuous variables, respectively. Missing data were handled using multi-
N = 709

Abbreviations: CAT, critical administration threshold; INR, international normalized ratio; LMW, low-molecular-weight heparin; PCC, prothrombin complex concentrate; RBC, red blood cells.
Total

ple imputation with 25 independent imputed datasets. Missing

variables included pre-transfusion INR (18.6%), pre-transfusion plate-
let count (1.4%) and pre-transfusion haemoglobin (0.2%).
For exploratory analyses of clinical outcomes across transfusion
strategies, plasma to RBC ratios were divided into four quartiles
designed to maximize group size while also encompassing the most
commonly utilized and clinically applicable transfusion ratios of 1:1
7 (13.2%)
17 (32.1%)

10 (18.9%)
0 (0.0%)

5 (9.4%)
2 (3.8%)
1 (1.9%)

4 (7.5%)
0 (0.0%)

and 1:2, consistent with previous research [11]. These quartile ratios
N = 53
2.1+

were as follows: 0 (no plasma), 0.1–0.4 (i.e., ratio > 0 but <1:2),
0.5–0.9 (i.e., ratio ≥ 1:2 but <1:1) and >1 (i.e., ratio ≥ 1:1). Platelet to
RBC ratios were similarly divided into four quartiles: 0 (no platelets),
0.1–0.9 (i.e., ratio > 0 but <1:1), 1.0–2.0 (i.e., ratio ≥ 1:1 but ≤2:1) and
Note: Numbers indicate N (%) unless otherwise noted. Massive transfusion + defined as administration of ≥10 units of RBCs within 24 h.

>2 (i.e., ratio > 2:1).

Clinical outcomes included all-cause hospital mortality and
19 (11.0%)
67 (39.0%)

22 (12.8%)

hospital-free days. Free days were calculated as 28 minus the hospital

0 (0.0%)

11 (6.4%)
10 (5.8%)
2 (1.2%)

9 (5.2%)
7 (4.1%)
N = 172

length of stay in days, with patients dying prior to day 28 or those

1.0–2.0

with lengths of stay greater than 28 days receiving a score of 0. The

relationships between clinical outcomes and plasma to RBC and plate-
let to RBC ratios at 3, 12 and 24 h were analysed utilizing multi-
variable regression models adjusted for age, sex, Charlson score, pre-
CAT+ labs (e.g., haemoglobin, platelet count, INR), antiplatelet ther-
apy, anticoagulants, haemostatic agents and the transfused vol-
10 (10.0%)
36 (36.0%)
10 (10.0%)

13 (13.0%)

umes of plasma, platelets and allogeneic RBCs at the time of the

0 (0.0%)

4 (4.0%)
0 (0.0%)

3 (3.0%)
1 (1.0%)
N = 100
0.1–0.9

outcome assessment interval (i.e., 3, 12 and 24 h). For analyses of

plasma to RBC ratios, we additionally adjusted for the
corresponding platelet to RBC ratio at the same time interval and
vice versa. The prothrombin complex concentrate (PCC) utilized
during the study period was a three-factor PCC (Bebulin®, Shire
Plc). Hospital mortality was assessed with multivariable logistic
regression, while hospital-free days were modelled using linear
83 (21.6%)
188 (49.0%)

40 (10.4%)
5 (1.3%)

36 (9.4%)
36 (9.4%)
6 (1.6%)

11 (2.9%)
3 (0.8%)

regression. Pre-defined sensitivity analyses were performed

N = 384

excluding patients not receiving plasma or platelet therapies in the

first 24 h and limited to those receiving traditional massive transfu-
0

sion (≥10 units RBCs within 24 h). A two-tailed p-value <0.05 was
utilized to determine statistical significance without correction for
multiple comparisons, given the hypothesis-generating nature of
secondary clinical outcome analyses.
Direct thrombin inhibitor
(Continued)

Haemostatic medications

Antifibrinolytic agents

RE SU LT S
LMW heparin
Characteristic

Kruskal–Wallis.
Clopidogrel

Vitamin K
Factor Xa
Warfarin

Fisher exact.
TABLE 2

Chi-square.
Aspirin

A total of 709 patients were included (Figure 1): 498 (70.2%)

PCCs

with medical haemorrhage and 211 (29.8%) with post-surgical

haemorrhage. The median (IQR) age was 65 (53, 76) years. Most
b
a

c
368
FIGURE 3 Unadjusted mortality based on plasma to red blood cell (RBC) and platelet to RBC ratios at 3, 12 and 24 h
patients were male (58.4%) with median Charlson comorbidity index
scores of 6 (4, 9). Most bleeds originated in the gastrointestinal tract
(36.7%) followed by intra-abdominal (19.3%) and thoracic (12.4%)
bleeding (Figure 2).
Patient demographic and clinical characteristics stratified by
plasma to RBC and platelet to RBC ratios are displayed in Tables 1
and 2, respectively. There were no clear differences in transfusion
ratios based upon patient sex, Charlson score, admission type (medical
vs. post-surgical) or anatomic source of bleeding. Transfusion ratios
decreased modestly with increasing age. The median RBC transfusion
volume was 5 (4, 7) units, which did not increase uniformly with
MATZEK ET AL.
transfusion ratios. There were significant differences in plasma
(p = 0.02) and platelet to RBC (p = 0.009) ratios based upon the hos-
pital location in which transfusion was initiated such that the propor-
tion of patients transfused in the ED increased with higher plasma to
RBC ratios and the proportion of patients transfused in the ICU
increased with higher platelet to RBC ratios. As an example, 21.6%
(19/88) of patients transfused in the ED achieved a plasma to RBC
ratio > 1 compared to 10.2% (59/577) of patients first transfused in
the ICU. Conversely, 34.8% (201/577) of patients transfused in the
ICU achieved a platelet to RBC ratio > 1 compared to 19.3% (17/88)
in the ED. Abnormalities in haemostatic laboratory tests (i.e., platelet
TRANSFUSION RATIOS AND CLINICAL OUTCOMES
count, INR) prior to the event were more frequently observed with
higher ratios. Higher rates of warfarin therapy were observed in
patients receiving higher plasma to RBC ratios. Aspirin therapy was
greatest in those not receiving plasma or platelets, with the lowest
rate of therapy in those receiving the highest platelet to RBC ratio.
Antifibrinolytic therapy was utilized in only 3.8% of cases, with
increasing use with higher transfusion ratios. PCCs were administered
in less than 2% of cases.
Patients commonly received RBCs without plasma therapy (35.5%)
with median RBC totals of 4 (3, 5) units. Of those receiving plasma, the
most common plasma to RBC ratio interval was 0.5–0.9 (44.6%)
followed by 0.1–0.4 (37.6%) and ≥1 (17.7%). Unadjusted mortality rates
by plasma to RBC ratios at 24 h were 16.1%, 13.4%, 19.0% and 21.8%
for ratios of 0, 0.1–0.4, 0.5–0.9 and >1, respectively (Figure 3,
p = 0.38). In multivariable regression models, hospital mortality and free
days were not associated with plasma to RBC ratios (Table S1).
Similarly, patients often received RBCs without platelets
(54.2%) with median RBC totals of 4 (3, 6) units. Of those receiving
platelets, the most common platelet to RBC ratio interval was 1–2
(52.9%) followed by 0.1–0.9 (30.8%) and >2 (16.3%). Unadjusted
mortality rates by platelet to RBC ratios at 24 h were 13.4%,
24.7%, 17.9% and 25.5% for ratios of 0, 0.1–0.9, 1–2 and >2
(Figure 3, p = 0.03). In multivariable analyses (Table S2), a platelet
to RBC ratio of 0.1–0.9 at 24 h was associated with increased hos-
pital mortality (odds ratio [OR] 95% confidence interval [CI] 2.2
[1.0, 4.8]; p = 0.04) and decreased hospital-free days (mean [95%
CI] decrease 3.2 [0.4, 6.0] days; p = 0.02; reference no platelets).
Patients with platelet to RBC ratios >2 at 12 and 24 h also had
decreased hospital-free days. Outcomes were consistent in
predefined sensitivity analyses excluding patients not receiving
plasma or platelets and limited to those receiving massive transfu-
sion (Tables S3 and S4).
DISCUSSION
In this investigation of critical non-traumatic, non-intraoperative
haemorrhage, transfusion ratios were generally consistent across
patient sex and comorbidity burden but increased concordantly with
haemostatic laboratory derangements. There were differences in
transfusion strategies based upon the practice environments in which
transfusion was initiated but not by anatomical sites of bleeding. Our
findings suggest that transfusion strategies for critical non-traumatic
haemorrhage are predominantly tailored to laboratory characteristics
and clinical practice features. Clinical outcome differences across
transfusion strategies were generally limited.
The primary goal of this investigation was to investigate patient
and clinical features that may influence transfusion strategies during
critical non-traumatic haemorrhage in a large inpatient medical prac-
tice. To this end, there were limited differences in transfusion utiliza-
tion across patient comorbidity burden, sex, admission type
(i.e., medical vs. post-surgical) and haemorrhage types, suggesting that
providers are less inclined to consider these features when
369
resuscitating abrupt haemorrhage. Additionally, patient age differed
only modestly across transfusion ratios, such that patients with
advancing age received slightly lower ratios of plasma and platelets to
RBCs compared to their younger counterparts. However, there were
more obvious differences across transfusion ratio groups in
haemostatic laboratory abnormalities, such that patients having more
severe derangements in INR and platelet counts received higher
ratios. This suggests that clinicians use available laboratory data to
drive plasma and platelet component utilization. Further, warfarin use
was associated with higher plasma to RBC ratios, likely related to
higher INR values in those receiving warfarin at the time of
haemorrhage, but aspirin use was not associated with greater platelet
to RBC ratios, which may in part be related to the fact that aspirin
does not cause clinically relevant quantitative platelet defects. Addi-
tionally, there were clear differences in transfusion ratios across prac-
tice environments. Patients first transfused in the ED received higher
ratios of plasma to RBCs, while patients first transfused in the ICU
received higher ratios of platelets to RBCs. Future studies are needed
to understand transfusion practices and associated clinical outcomes
in unique medical environments and by medical professional demo-
graphic and training characteristics. This could potentially lead to qual-
ity improvement efforts to ensure consistency in blood product
utilization across practice locations.
Several prior observational studies focussing primarily on patients
with acute intraoperative haemorrhage have demonstrated that
higher plasma and platelet to RBC ratios are not associated with
improvements in mortality [7, 8, 11]. The findings of the current inves-
tigation limited to non-traumatic, non-intraoperative haemorrhage are
consistent with these results. We assessed differences in clinical out-
comes to inform hypothesis generation for future clinical trials of opti-
mal transfusion strategies. Outcome differences were limited,
particularly with regards to plasma utilization. However, patients
receiving platelet to RBC ratios of 0.1–0.9 at 24 h experienced higher
mortality compared to those not receiving platelets, with a similar but
non-significant relationship observed in those with ratios >2. Addi-
tionally, increasing platelet to RBC ratios were associated with fewer
hospital-free days. Previous investigations in surgical patients and the
critically ill have noted inferior outcomes with platelet transfusion
[18–20]. While these findings may represent negative consequences
of platelet transfusion, observed associations may alternatively be
indicative of greater severity of illness in those receiving platelets with
inferior clinical outcomes occurring independently of transfusion. The
presented analyses represent associations not causal relationships,
and future trials are critically needed to definitively evaluate clinical
outcomes across transfusion strategies.
Limitations of this investigation are primarily related to clinical out-
come analyses, which must be considered hypothesis-generating. First,
the potential for residual confounding exists despite pre-defined statis-
tical adjustment. Second, we were unable to assess several important
clinical factors that may influence clinical outcomes such as the severity
and rapidity of acute blood loss and the timing of haemorrhage detec-
tion. As such, the presented analyses of clinical outcome relationships
represent important yet imperfect associations that should not be
370
interpreted causally. Third, the included study cohort was heteroge-
neous, including both medical and post-surgical patients to reflect real-
world clinical practice. The aetiologies of haemorrhage and optimal
treatment approaches may be distinct in these groups. Fourth, the
assessment of multiple clinical outcomes increases type-I error rate.
Results should be interpreted cautiously with future confirmation.
Finally, these results are representative of a large academic medical
centre. Generalizability to other practice environments is unclear.
In conclusion, transfusion strategies in a diverse cohort of patients
with acute haemorrhage occurring outside of trauma and surgery were
primarily associated with pre-haemorrhage laboratory values and the
hospital environment in which treatment was initiated rather than
baseline patient features or anatomic sources of bleeding. Clinical
outcomes were not superior in those receiving higher ratios of
plasma and platelets to RBCs. Additional investigations are neces-
sary to evaluate the principle drivers of differences in resuscitation
strategies across hospital environments and define optimal resusci-
tation strategies in accordance with unique patient characteristics.
ACKNOWLEDGEMEN TS
L.M., O.G., D.K. and M.W. helped in concept and design, data acquisi-
tion, interpretation of data, critical writing, revision of intellectual con-
tent and final approval of the manuscript. E.K., R.F. and
T.W. helped in analysing and interpretation of data, critical writ-
ing, revision of intellectual content and final approval of the
manuscript.
CONF LICT OF IN TE RE ST
The authors declare no conflicts of interest.
ORCID
Luke J. Matzek https://orcid.org/0000-0001-7515-3739
Timothy J. Weister https://orcid.org/0000-0003-1485-2338
RE FE R ENC E S
1. Holcomb JB, Tilley BC, Baraniuk S, Fox EE, Wade CE, Podbielski JM,
et al. Transfusion of plasma, platelets, and red blood cells in a 1:1:1 vs a
1:1:2 ratio and mortality in patients with severe trauma: the PROPPR
randomized clinical trial. JAMA. 2015;313:471–82.
2. Borgman MA, Spinella PC, Perkins JG, Grathwohl KW, Repine T,
Beekley AC, et al. The ratio of blood products transfused affects
mortality in patients receiving massive transfusions at a combat sup-
port hospital. J Trauma. 2007;63:805–13.
3. Holcomb JB, Wade CE, Michalek JE, Chisholm GB, Zarzabal LA,
Schreiber MA, et al. Increased plasma and platelet to red blood cell
ratios improves outcome in 466 massively transfused civilian trauma
patients. Ann Surg. 2008;248:447–58.
4. Holcomb JB, del Junco DJ, Fox EE, Wade CE, Cohen MJ, Schreiber MA,
et al. The prospective, observational, multicenter, major trauma transfu-
sion (PROMMTT) study: comparative effectiveness of a time-varying
treatment with competing risks. JAMA Surg. 2013;148:127–36.
5. Beckwith H, Manson L, McFarlane C, Reed MJ. A review of blood
product usage in a large emergency department over a one-year
period. Emerg Med J. 2010;27:439–42.
6. Sinha R, Roxby D, Bersten A. Experience with a massive transfusion
protocol in the management of massive haemorrhage. Transfus Med.
2013;23:108–13.
MATZEK ET AL.
7. Etchill EW, Myers SP, McDaniel LM, Rosengart MR, Raval JS,
Triulzi DJ, et al. Should all massively transfused patients be treated
equally? An analysis of massive transfusion ratios in the nontrauma
setting. Crit Care Med. 2017;45:1311–6.
8. Mesar T, Larentzakis A, Dzik W, Chang Y, Velmahos G, Yeh DD.
Association between ratio of fresh frozen plasma to red blood cells
during massive transfusion and survival among patients without trau-
matic injury. JAMA Surg. 2017;152:574–80.
9. McDaniel LM, Neal MD, Sperry JL, Alarcon LH, Forsythe RM,
Triulzi D, et al. Use of a massive transfusion protocol in nontrauma
patients: activate away. J Am Coll Surg. 2013;216:1103–9.
10. Morse BC, Dente CJ, Hodgman EI, Shaz BH, Winkler A,
Nicholas JM, et al. Outcomes after massive transfusion in non-
trauma patients in the era of damage control resuscitation. Am
Surg. 2012;78:679–84.
11. Warner M, Frank R, Weister T, Madde NR, Gajic O, Kor DJ. Ratios of
plasma and platelets to red blood cells in surgical patients with acute
intraoperative hemorrhage. Anesth Analg. 2019;131:483–93.
12. von Elm E, Altman DG, Egger M, Pocock SJ, Gøtzsche PC,
Vandenbroucke JP. The strengthening the reporting of observational
studies in epidemiology (STROBE) statement: guidelines for
reporting observational studies. Lancet. 2007;370:1453–7.
13. Savage SA, Zarzaur BL, Croce MA, Fabian TC. Redefining massive
transfusion when every second counts. J Trauma Acute Care Surg.
2013;74:396–400; discussion 400-402.
14. Meyer DE, Cotton BA, Fox EE, Stein D, Holcomb JB, Cohen M, et al.
A comparison of resuscitation intensity and critical administration
threshold in predicting early mortality among bleeding patients: a
multicenter validation in 680 major transfusion patients. J Trauma
Acute Care Surg. 2018;85:691–6.
15. Savage SA, Sumislawski JJ, Zarzaur BL, Dutton WP, Croce MA,
Fabian TC. The new metric to define large-volume hemorrhage:
results of a prospective study of the critical administration threshold.
J Trauma Acute Care Surg. 2015;78:224–9; discussion 229-230.
16. Chute CG, Beck SA, Fisk TB, Mohr DN. The enterprise data trust at
Mayo Clinic: a semantically integrated warehouse of biomedical data.
J Am Med Inform Assoc. 2010;17:131–5.
17. Herasevich V, Kor DJ, Li M, Pickering BW. ICU data mart: a non-iT
approach. A team of clinicians, researchers and informatics personnel
at the Mayo Clinic have taken a homegrown approach to building an
ICU data mart. Healthc Inform. 2011;28:42, 44–5.
18. Warner M, Jia Q, Clifford L, Wilson G, Brown MJ, Hanson AC, et al.
Preoperative platelet transfusions and perioperative red blood cell
requirements in patients with thrombocytopenia undergoing
noncardiac surgery. Transfusion. 2016;56:682–90.
19. Weil I, Kumar P, Seicean S, Neuhauser D, Seicean A. Platelet count
abnormalities and peri-operative outcomes in adults undergoing
elective, non-cardiac surgery. PLoS One. 2019;14:e0212191.
20. Glance L, Blumberdg N, Eaton M, Lustik SJ, Osler TM, Wissler R,
et al. Preoperative thrombocytopenia and postoperative outcomes
after noncardiac surgery. Anesthesiology. 2014;120:62–75.
SUPPORTING INF ORMATION
Additional supporting information may be found online in the
Supporting Information section at the end of this article.
How to cite this article: Matzek LJ, Kurian EB, Frank RD,
Weister TJ, Gajic O, Kor DJ, et al. Plasma, platelet and red
blood cell transfusion ratios for life-threatening non-traumatic
haemorrhage in medical and post-surgical patients: An
observational study. Vox Sang. 2022;117:361–70.
Received: 2 March 2021 Revised: 20 July 2021 Accepted: 22 July 2021

DOI: 10.1111/vox.13191

ORIGINAL ARTICLE

Differential effects of speed and volume on

transfusion-associated circulatory overload:
A randomized study in rats

Robert B. Klanderman1,2,3 | Marije Wijnberge3 | Joachim J. Bosboom3 |

Joris J. T. H. Roelofs4 | Dirk de Korte5,6 | Robin van Bruggen6 |
Markus W. Hollmann2,3 | Margreeth B. Vroom1 | Denise P. Veelo3 |
Nicole P. Juffermans1,2 | Bart F. Geerts3 | Alexander P. J. Vlaar1,2

1
Department of Intensive Care, Amsterdam
UMC, Amsterdam, The Netherlands Abstract
2
Laboratory of Experimental Intensive Care Background and Objectives: Transfusion-associated circulatory overload (TACO) is
and Anesthesiology, Amsterdam UMC,
Amsterdam, The Netherlands
the primary cause of transfusion-related mortality. Speed and volume of transfusion
3
Department of Anesthesiology, Amsterdam are major risk factors. The aim of this study was to investigate the interaction of red
UMC, Amsterdam, The Netherlands blood cell (RBC) transfusion speed and volume on the development of TACO.
4
Department of Pathology, Amsterdam UMC,
Materials and Methods: A validated model for TACO in anaemic Lewis rats with an
Amsterdam, The Netherlands
5
Department of Product and Process acute myocardial infarction was used. The effect on pulmonary hydrostatic pressure
Development, Sanquin Blood Bank – of one, two or four units of packed RBCs transfused in either 30 or 60 min was eval-
Amsterdam, Amsterdam, The Netherlands
6
uated (3.3–26.6 ml
kg 1

hr 1
). Pulmonary capillary pressure was measured as left
Department of Blood Cell Research, Sanquin
Research and Landsteiner Laboratory – ventricular end-diastolic pressure (LVEDP). Cardiac stress biomarkers atrial
Amsterdam, Amsterdam, The Netherlands
natriuretic-peptide (ANP) and N-terminal pro-brain natriuretic peptide (NT-proBNP)

Correspondence were measured 1-h post-transfusion.

Robert B. Klanderman, Department of
Intensive Care Medicine, Amsterdam UMC,
Meibergdreef 9, 1105AZ, Amsterdam,
The Netherlands.
Email: r.b.klanderman@amsterdamumc.nl
Funding information
This work was supported by departmental
resources and a grant from the Landsteiner
Foundation for Blood Transfusion Research to
Alexander P. J. Vlaar
Results: Thirty animals were included (n = 5 per group). Transfusion of RBCs
increased LVEDP in a volume-dependent manner (ΔLVEDP [mmHg]: 0.95, +0.50,
+6.26, p < 0.001). Fast transfusion increased overall ΔLVEDP by +3.5 mmHg and up
to +11.8 mmHg in the four units’ group (p = 0.016). Doubling transfusion speed
increased ΔLVEDP more than doubling volume in the larger volume groups. No dif-
ference in ANP or NT-proBNP were seen in high transfusion volume or groups.
Conclusion: Transfusion volume dose-dependently increased LVEDP, with speed of
transfusion rapidly elevating LVEDP at higher transfusion volumes. ANP and NT-
proBNP were not impacted by transfusion volume or speed in this model. TACO is
seen as purely volume overload, however, this study emphasizes that limiting trans-
fusion speed, as a modifiable risk factor, might aid in preventing TACO.

KEYWORDS
animal, hemodynamics, pulmonary edema, TACO, transfusion reaction

This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium,
provided the original work is properly cited.
© 2021 The Authors. Vox Sanguinis published by John Wiley & Sons Ltd on behalf of International Society of Blood Transfusion.

Vox Sanguinis. 2022;117:371–378. wileyonlinelibrary.com/journal/vox 371

372
I N T R O D U CT I O N
Transfusion-associated circulatory overload (TACO) is the leading
cause of transfusion-related respiratory distress, ICU admission and
death [1–3]. The incidence of TACO in those transfused is 1% of
in-hospital patients [4, 5], and up to 6% in the ICU [6, 7]. Both the
speed and volume of transfusion are associated with TACO [5, 6, 8].
Even though millions of transfusions are carried out each year, surpris-
ingly few studies address transfusion speed or volume.
TACO is the result of hydrostatic pulmonary oedema, where tran-
sudate is driven into alveoli restricting gas exchange [9, 10]. Both
speed of transfusion and large volumes acutely increase circulating
volume which can back-up the pulmonary circulation and increase
pulmonary capillary pressure (Pcap) [11]. Our previously published ani-
mal model has shown that after an equivalent volume, blood transfu-
sion increases Pcap more than crystalloids [12]. Similarly, in ICU
patients transfusion increases Pcap and is associated with increased
mortality [13]. Only two studies in humans have investigated Pcap
related to transfusion speed, which increases in a speed-dependent
fashion [14, 15], transfusion volume however has not previously been
investigated.
Investigating modifiable risk factors including speed and volume
effects of transfusion individually as well as their interaction is neces-
sary to understand TACO. Measuring Pcap is difficult and can differ
throughout the pulmonary capillary bed, therefore, left-atrial pressure
(LAP - the pressure downstream) is used in clinical research. In
humans, this requires a Swan-Ganz catheter to estimate LAP which is
invasive and not without risk [16]. In animals direct intra-cardiac mea-
surement of left ventricular end-diastolic pressure (LVEDP), which is
equal to the maximum LAP, can be investigated through [12].
The study aimed to investigate the relative contribution of
transfusion speed and volume on the development of TACO.
F I G U R E 1 Experiment design comparing speed versus volume of transfusion. A two-hit model for TACO in anaemic rats was employed. The
first hit, an MI results in volume incompliance. Animals were randomized to speed of transfusion (30 or 60 min) and further randomized to receive
one, two or four units – a total of six groups. Art.line, Arterial cannula; CVC, Central venous cannula; LAD, Left anterior descending coronary
artery; PV-Catheter, Pressure-volume (catheter)
KLANDERMAN ET AL.
Atrial natriuretic peptide (ANP) and N-terminal pro-brain natriuretic
peptide (NT-proBNP) will be evaluated as volume overload bio-
markers. We hypothesize that both a rapid speed of infusion, as well
as larger transfused volumes will increase LVEDP and cardiac stress
biomarkers. Using a previously validated rat model of TACO, animals
will be randomized and the effect of one, two or four units of packed
red blood cells (RBC) transfused in either 30 or 60 min on LVEDP will
be measured.
M A T E R I A L S A N D M ET H O D S
This experiment was approved by the Dutch Central Commission for
Animal Experiments (licence: AVD118002017814). Experiments were
performed in accordance with The Guide for the Care and Use of Lab-
oratory Animals and results were reported according to ARRIVE
guidelines. Adult male Lewis rats between 300 and 350 grams were
used (LEW/SsNHsd, Envigo, UK) because of reproducibility of myo-
cardial ischemic damage [17]. Animals were housed in a specialized
animal care facility, exposed to standard light–dark cycle and fed stan-
dard rat chow with ad-libitum access to water.
A two-hit model for TACO was used as previously published [12],
which is a clinically relevant anaemia-transfusion model in a mechani-
cally ventilated, cardiac comprised setting (Figure 1). Two hits are
required for TACO to develop as healthy anaemic animals were able
to accommodate large transfusion volumes. Anaemia was induced by
replacing blood with an equivalent volume of colloids, maintaining cir-
culating blood volume (CBV). Isovolemia is important as intravascular
hypovolemic patients will be able to accommodate volume, evidenced
by the highest incidence of TACO in normovolemic patients with
chronic anaemia [18, 19] and INR correction through plasma transfu-
sion in non-bleeding patients [20]. The first hit is a patient risk factor,
TRANSFUSION SPEED VERSUS VOLUME ON TACO
resulting in volume-incompliance, in this case myocardial dysfunction [21].
This lowers the threshold to develop TACO following a second hit – a
blood transfusion.
Animal procedures
General anaesthesia was induced in healthy animals through brief use
of isoflurane (5%) followed by an intra-peritoneal injection of racemic
ketamine (9 mg
100 g 1
), dexmedetomidine (12.5 μg
100 g
atropine (5 μg
100 g 1
). Ketamine was continuously infused through a
tail-vein cannula to maintain anaesthesia (5 mg
100 g 1

h 1
sen for its limited cardiovascular depressive profile. Animals were
ventilated via a tracheostomy secured with a suture around the
trachea.
Cardiac catheterization and line placement
An ultraminiature rat pressure-volume catheter (SPR-838, Millar, USA)
was passed through the right carotid artery into the left-ventricle.
Calibrations of the PV-catheter include: a two-point pressure calibration,
blood conductivity calibration using the cuvette method and cor-
rection for parallel conductance using hypertonic saline boluses
(NaCl 30%, 10 μl bolus) [22]. Conductivity calibrations were
performed at fixed timepoints following changes in blood electro-
lyte, that is: (1) baseline, (2) pre-transfusion, (3) post-transfusion
and (4) at termination. The right jugular vein was cannulated to
record central venous pressure (CVP) and the left carotid artery to
measure mean arterial pressure (MAP) and perform blood draws.
Isovolemic anaemia and first hit – Myocardial ischemia
Approximately 20% of CBV was replaced over a period of 15 min with
an equivalent volume of colloid solution (Tetraspan 6%, B. Braun,
Germany) until a haematocrit of 30% was achieved. CBV (ml) was
calculated as 6.5% of body weight (g) [23]. Afterwards animals were
allowed to stabilize for 15 min.
A myocardial infarction (MI) was induced as first hit. A continuous
norepinephrine infusion was started and titrated to a MAP of
65 mmHg. Through a left-anterior thoracotomy (2 cm incision
through the fourth intercostal rib) the left-anterior descending artery
(LAD) was permanently ligated using a 5-0 Prolene suture [12, 24].
Ischemia was confirmed visually by blanching of the myocardium
distal to the ligation and ST-elevations on a three-lead ECG.
An intrapleural chest drain (20G) was placed one rib below the
incision and the thorax and skin were closed in two layers using a 3-0
Vicryl suture. After closing the chest, the drain was removed under
negative pressure while simultaneously a recruitment manoeuvre was
performed to minimize residual air. Animals were allowed to stabilize
for 30 min.
373
Randomization and second hit – Transfusion
A sealed envelope, block randomization method was used to stratify
animals to either one, two, or four units to be transfused using a
volumetric pump, performed in equal groups per week (a 1:1:1 ratio).
Animals were then again randomized by sealed envelope to rapid or
slow transfusion (over 30 or 60 min). From randomization onward,
no further alterations were allowed to ventilator settings, fluid,
norepinephrine or anaesthetic infusion rates. Volume of RBC units
1
) and was predetermined and fixed (1.0 ml per unit) calculated as 5% of
CBV – equivalent to 80 kg male humans. Hemodynamic parameters
), cho- were recorded continuously until the experiment ended at 1-h post-
transfusion and the rats were terminated. The RBC units were buffy
coat reduced packed red blood cells products, manufactured following
Dutch blood banking procedures, made from the whole blood
harvested from donor animals outside the experimental group
(Supplementary Appendix A).
Tissue harvesting and laboratory methods
Animals were exsanguinated 1-h post-transfusion. Collected blood
was processed within 2 h, centrifuged at 2000g for 10 min and the
supernatant stored at 80.0 C for later analysis. Rat ANP and NT-
proBNP levels were determined according to manufactures guidelines
(products: E-EL-R0670/R0017, Elabscience, China). The lungs were
harvested, the right upper lobe was fixed in formalin for histopatho-
logical analysis and the lower lobe used to calculate the wet-dry ratio:
wet-weight/dry-weight. The myocardial infarct size (volume percent-
age) was determined to ensure equal infarct sizes between groups
(Supplementary Appendix B).
Outcomes
The primary outcome was ΔLVEDP (post minus pre-transfusion
LVEDP) compared between all six groups that is, number of units
transfused (one, two or four units) and speed of transfusion (rapid or
slow). Secondary outcomes included change in heart rate (HR), mean
arterial pressure (MAP), cardiac output (CO), central venous pressure
(CVP), systemic vascular resistance (SVR), stroke work (calculated as
the area within the PV-loop) and cardiac relaxation ( dP/dt).
Biomarkers included the difference in ANP and NT-proBNP
between groups. Pulmonary outcomes included oxygenation
capacity PaO2/FiO2-ratio (PF-ratio), wet-dry ratio and histopathological
examination.
Sample size
Sample size was determined using previously published data [12], and
further extrapolated assuming a linear correlation between ΔLVEDP
 374

TABLE 1 Characteristics pre-transfusion

1 unit (n = 10) 2 units (n = 10) 4 units (n = 10)

Characteristics Slow (n = 5) Fast (n = 5) Slow (n = 5) Fast (n = 5) Slow (n = 5) Fast (n = 5)

Weight (g): 335 (325–340) 325 (315–340) 325 (320–325) 320 (310–330) 315 (315–335) 330 (315–330)
P/F-ratio: 343 (247–381) 394 (366–423) 423 (395–453) 366 (333–396) 370 (281–440) 374 (374–408)
LVEDP (mmHg): 10.9 (9.9–14.3) 10.3 (9.8–12.3) 12.9 (11.2–14.1) 10.6 (9.5–10.9) 10.4 (9.3–13.0) 9.5 (7.5–11.9)
1
Heart rate (min ): 253 (221–257) 204 (193–225) 245 (236–250) 238 (231–263) 287 (257–289) 244 (239–246)
Mean arterial pressure (mmHg): 65  7 72  8 63  8 63  12 62  13 59  8
LVPmax (mmHg): 98 (90–103) 102 (95–103) 99 (93–102) 90 (85–99) 100 (93–102) 115 (95–117)
Stroke volume (μl): 52 (46–57) 55 (37–70) 58 (57–60) 59 (55–62) 46 (34–59) 70 (63–75)
1
Cardiac output (ml
min ) 13 (12–15) 11 (7–17) 14 (14–16) 15 (13–15) 13 (9–15) 17 (15–18)
Ejection fraction (%): 65 (38–67) 50 (33–59) 44 (35–58) 47 (44–49) 66 (51–80) 48 (47–53)
Myocardial infarct (%): 47 (43–52) 44 (43–48) 46 (45–56) 41 (40–43) 39 (34–46) 37 (33–50)
3
Rate pressure product (mmHg
min
103): 22.9 (22.8–23.0) 20.7 (20.7–20.8) 22.9 (22.8–26.4) 21.2 (19.8–22.8) 29.6 (24.0–30.6) 26.9 (23.3–28.0)
Stroke work (mmHg
μl
103): 3.9 (3.9–4.5) 4.0 (3.8–4.8) 4.5 (4.1–4.8) 5.0 (4.2–5.4) 4.2 (3.5–4.7) 5.5 (5.1–6.4)
Central venous pressure (mmHg): 5.3  1.15 3.9  0.93 6.3  2.97 6.5  2.24 5.3  1.71 4.5  0.89
5
Systemic vascular resistance (dyn
s
cm ): 373 (310–377) 381 (303–524) 317 (303–338) 415 (339–417) 332 (259–401) 235 (230–300)
1
Norepinephrine (μg
kg ): 6.5 (3.6–11.4) 7.7 (6.2–9.5) 5.0 (4.0–7.9) 7.7 (3.9–9.1) 8.8 (2.5–12.9) 12.1 (2.5–13.3)
Fluid balance (ml): 2.6 (2.5–2.7) 2.3 (2.1–2.6) 2.5 (2.4–2.5) 2.7 (2.5–2.8) 2.3 (2.2–2.9) 3.3 (3.1–4.7)

Note: Characteristics at randomization, prior to transfusion. Results presented as median (IQR) or mean  SD.
Abbreviations: LVEDP, left ventricular end-diastolic pressure; LVPmax, left-ventricular maximum pressure; P/F-ratio, PaO2/FiO2-ratio.
KLANDERMAN ET AL.
TRANSFUSION SPEED VERSUS VOLUME ON TACO 375

and the number of units transfused. The median ΔLVEDP following RE SU LT S

four units of RBCs was +8.0 mmHg (IQR 7.5–14.1). Based on an α of
0.05 and β of 20% we calculated that n = 3 animals in each arm were
required to detect a clinically relevant difference [18] (4.0 mmHg dif-
ference in ΔLVEDP) between one and four units transfused. A total of
five animals per group was chosen to account for variation in the
model.
Statistical analysis
A total of 30 animals were included, randomized to one, two or
four units transfused (n = 10 per group) and further randomized
to either slow or rapid infusion (n = 5 per group). Prior to ran-
domization seven animals died during cannulation due to cardiac
tamponade (n = 2), during thoracotomy (n = 1) or due to arrhyth-
mia’s following myocardial infarction (n = 4). Animals that died
prior to randomization were replaced; no animals died after
randomization.

Statistical analysis was performed in R Statistics v3.3.2 (R Foundation

for Statistical Computing, Austria), using RStudio v1.0.136 (RStudio,
Inc, USA). Data were assessed for normality using histograms. Cardiac
parameters including ΔLVEDP (post-transfusion minus pre-transfusion)
and biomarkers were compared between the number of units transfused
using the Kruskal-Wallis test and post-hoc Mann–Whitney-U test.
Effects dependent on speed of transfusion were compared using
the Mann–Whitney-U test. Lung pathology scores were compared
using a chi-squared test. A p-value of <0.05 was considered
significant.
Isovolemic anaemia, validation of myocardial
dysfunction and characteristics
Isovolemic anaemia resulted in a significant haematocrit decreased
from median 43% (IQR: 42–44) to 30% (IQR: 29–31, p = 1.70  10 6).
The effects of the first hit were seen as (1) a ventricle infarction percent-
age of 43% (IQR: 38–49); (2) stroke work decreased from baseline by
1347 mmHg
μl (IQR: 847–1781, p = 4.90  10 4); and (3) dP/dt, a
parameter for left-ventricular relaxation, worsened from baseline 6874
1
mmHg
s (IQR: 7274 to 6404) to 5244 (IQR: 5587 to 4586, p
= 1.60  10 7). Because of left-ventricular conformational changes, fol-
lowing ligation of the LAD, ejection fraction has proven to be unreliable
[12]. Characteristics at the time of randomization are shown per number
of units transfused in Table 1. Following transfusion haematocrit increased
significantly for all groups, from 29.7  1.6 prior to transfusion, to 39.7  1.8
(p = 2.02  10 7) for one unit, 43.8  1.6 (p = 2.02  10 9) for two and
48  2.4 (p = 2.76  10 9) for four units.

Changes in LVEDP between volume transfused and

speed of infusion

Depending on the number of units transfused the overall ΔLVEDP

F I G U R E 2 Change in LVEDP per transfusion volume and speed.
Data presented in a Tukey boxplot. ΔLVEDP increases significantly
with more units transfused (top brackets). Speed was significantly
associated with an increase in ΔLVEDP only in the group transfused
with four units. *: p < 0.05; **: p < 0.01; ***: p < 0.001
increased significantly (Kruskal-Wallis test, p = 8.06  10 4), with
ΔLVEDP after one unit 0.95 (IQR: 2.4 to 0.5), two units 0.50 (IQR:
0.0–3.7) and four units 6.3 (IQR: 3.0–12.8). Post-hoc testing showed an
increase between one versus two units (p = 4.87  10 4), two versus
four units (p = 0.043) and one versus four units (p = 0.003). Speed was

TABLE 2 Effect of speed compared to volume on LVEDP

Doubling infusion speed Doubling infusion volume

Fast infusion Volume

ΔLVEDP ΔLVEDP
(mmHg) CI 95% p-value (mmHg) CI 95% p-value
1 Unit - Slow +0.74 3.52 to 3.41 0.841 +1.37 0.11 to 6.98 0.056
2 Units - Slow +3.01 2.60 to 5.59 0.421 +2.05 6.52 to 3.56 0.691
4 Units - Slow +11.77 2.94 to 17.60 0.016 - - -

Note: Side-by-side comparison of effects of doubling transfusion speed versus doubling transfused volume on ΔLVEDP. Results presented as median
(CI 95%).
376
F I G U R E 3 Volume overload biomarkers. Data presented in a
Tukey boxplot
significantly associated with an increase in ΔLVEDP only in the group
transfused with four units (Figure 2).
A secondary analysis was performed to determine the contribu-
tion of speed compared to transfused volume on LVEDP. Both dou-
bling of speed and volume of transfusion increased ΔLVEDP (Table 2).
At low volumes the changes were not-clinically relevant, however at
larger volumes, a doubling of transfusion speed resulted in an expo-
nential increase ΔLVEDP (four-times higher).
Changes in haemodynamics following transfusion
With increasing transfused volume and increased preload, seen as
increased LVEDP, no increase in overall CO was detected (Table S1,
p = 0.468). In addition, stroke work decreased in all groups (p = 2.48
 10 3
). Also, overall HR (+21.7 bpm [IQR: 20.2–27.7, p = 3.90
 10 7
]), MAP (+15.4 mmHg [IQR: 10.3–22.1, p = 4.40  10 5
]) and
SVR increased significantly (+97.7 dyn
s
cm 5
[IQR: 77.1–167.1, p =
2.48  10 3
]).
KLANDERMAN ET AL.
Pulmonary outcomes
Overall, no differences were found in pulmonary outcomes (Table S2).
P/F-ratio at termination nor wet-dry ratio or histopathological
examination of the lungs (where pulmonary oedema was ranked on a
0–3-point scale by an experienced pathologist) differed between the
number of units transfused, nor the speed of transfusion.
Biomarkers
Overall, ANP and NT-proBNP were elevated (Figure 3), however they
were not significantly difference in between the number of units
(respectively p = 0.894 and p = 0.931) or the speed of transfusion
(respectively p = 0.931 and p = 0.074). Secondary analyses including
log-transformation did not change results.
DI SCU SSION
TACO can result in major morbidity including ICU admission, mechanical
ventilation and death. Both speed and volume of transfusion are modifi-
able risk factors for developing TACO [8, 25]. The primary findings of this
study are (1) the increase in hydrostatic pulmonary capillary pressure is
transfusion speed and volume-dependent; (2) increasing transfusion speed
or volume both increase LVEDP; and (3) both ANP and NT-proBNP bio-
markers of cardiac overload were not significantly increased in this animal
model within 1-h following transfusion.
An increased LAP is the mechanism behind developing TACO.
A landmark study in dogs showed that hydrostatic pulmonary oedema
started developing at pressures above 25 mmHg [26]. There is limited
evidence of how speed and volume individually contribute to the
development of TACO. Mechanistic transfusion studies have been
performed in both healthy dogs [27] and swine [28]. Both show an
increase in pulmonary pressures following transfusion, similar to our
results. Two studies in humans [15, 18] showed a transfusion speed-
dependent increase, also similar to our model. Our model is the first
to employ packed red blood cells contrary to use of whole blood.
Rheological properties of units with 60% haematocrit are likely to alter
hemodynamic outcomes unpredictably. Second, this is the first study to
investigate both transfused volume and speed. There is a clear stepwise
increase in LVEDP as result of increasing transfusion volume. Transfusion
speed seems particularly important to higher transfusion volumes
doubling of speed increased LVEDP exponentially (Figure 1 and Table 2).
Our data suggesting transfusion speed is a critical factor is an important
signal to clinicians that could prevent TACO.
Successful interventions to reduce over-transfusion include patient
blood management programs, transfusion triggers and a single-unit trans-
fusion in non-emergency situations [29]. Splitting an RBC unit can also
reduce the volume infused over time, allowing transfusion over days with-
out exposing a patient to multiple donors. Finally, volume-reduced RBC
units, hyperconcentrated platelets and partially reconstituted lyophilized
TRANSFUSION SPEED VERSUS VOLUME ON TACO
plasma have been suggested to reduce the volume load of transfusion
[9, 30]. Reducing transfusion speed in non-emergency settings is an easy
intervention, even so, there is likely room for improvement as retrospec-
tively in 50% of TACO cases infusion speed was not specified [31]. There
is limited guidance on speed of transfusion, aside from a 4-h maximum to
prevent bacterial growth. Noted is that transfusion speed may be higher if
tolerated by the patients circulatory system [32]. Specifically, in at-risk
patients guidance regarding the speed of transfusion is warranted.
Cardiac overload biomarkers
While markers are elevated, ANP and NT-proBNP levels did not contrib-
ute in discerning different volumes or speeds of transfusion (Figure 3).
ANP is used experimentally and is secreted from preformed vesicles and
the atria, ready for rapid release [33]. NT-proBNP is widely used in clini-
cal practice as an intermediate to long-term biomarker (hours to days) of
congestive heart failure, rising over hours. Elevated levels of biomarkers
are not required for the diagnosis of TACO, but rather provide additional
evidence of circulatory overload. The lack of a volume-dependent
increase in these biomarkers may be explained by the follow-up of only
1-h. While transfusion directly increases preload, the negative spiral of
progressive heart failure and overdistention might require up to 12 h to
manifest in line with TACO criteria [10]. Also, the myocardial damage fol-
lowing an MI may confound biomarker results in this model. Further
study is required to assess the value of biomarkers in TACO.
An inherent limitation to our model is the fluid balance in rats, as
they consume daily a volume of water equal to their CBV. Since rats
are used to large changes in volume per day an RBC unit is less likely
to overwhelm the circulation, where one unit was calculated as 5% of
CBV like humans. Furthermore, we chose a limited follow-up duration
of 1 h, as not to induce bias. Previous experiments have shown that it
is difficult to keep animals stable for longer than 1 h without interven-
tions. Fluid boluses, vasopressor or ventilatory changes introduce bias
and are difficult to correct for. Another limitation is baseline differ-
ences at randomization (Table 1), showing a higher fluid balance and
norepinephrine dose in the group receiving 4-units fast. Based on
both CVP and LVEDP this group does not appear to have an increased
preload thereby directly increasing the risk of TACO. Increased nor-
epinephrine after cardiac surgery hints at a systemic inflammatory
response, the degree of which will always differ between subjects.
Finally, we did not find a transfusion volume or speed-dependent
increase in pulmonary oedema. Rather this is a hydrostatic pressure
model, an advantage being the use of syngeneic rats, which limits the
immunological component of transfusion. It cannot be ruled out that pul-
monary oedema could still develop within the 12-h TACO window. The
results of this model remain relevant, as even in the absence of pulmo-
nary oedema transfusion in ICU patients is associated with both an
increased LAP as well as increased mortality [13].
We utilized a specialized rat model involving an acute MI and transfu-
sion. This model provides a mechanistic approach to circulatory overload
and simplifies how TACO develops in humans, who are often older and
have different predisposing conditions. We have previously shown that
377
transfusion increases LVEDP not only after an MI but also with underlying
acute kidney injury (AKI) [14]. Therefore transfusion of RBC’s increases
Pcap in volume incompliant rats independent of cardiac function, which
broadens the generalizability of our results using an MI model.
Interestingly a recent RCT found very low incidences of acute
heart failure following liberal transfusion (3.7%) versus restrictive
transfusion (3.2%, n.s.) [34]. Unfortunately, the study did not specifi-
cally score TACO, nor was the speed of transfusion documented. The
low incidence of TACO may additionally be explained by other inter-
ventions such as routine echocardiograms and two-thirds of patients
were either already using or started on diuretics within 24-h of admis-
sion, all of which being interesting targets for TACO research.
Translating our findings will inevitably require humans studies to
guide transfusion speed. While slower is likely better, not all patients
will require this, and an individual risk-assessment should be per-
formed. Future studies using this model should also focus on interven-
tions to prevent and treat TACO, for example through loop-diuretics
or volume-reduced blood products. The upcoming challenge will be
the development of a TACO phenotype model with evident pulmo-
nary oedema, in which interventions can start targeting pulmonary
oedema. Future studies in humans should make sure transfusion
speed is equal between groups. This study paves the way to a study
in high-risk patients (i.e., non-bleeding patients >60-years-of-age with
either pre-existing renal or cardiac dysfunction) to be randomized to
receive either a split or full RBC unit over 1 or 2 h.
In conclusion, this study demonstrates a stepwise transfusion
volume-dependent increase of LVEDP which is key in the development
of TACO. Transfusion speed appears critical in developing circulatory
overload, specifically when larger volumes were transfused. Cardiac bio-
markers ANP and NT-proBNP were not correlated with the volume or
transfusion speed 1-h after transfusion. This study underlines a policy of
slow transfusion in non-urgent cases.
AC KNOW LEDG EME NT S
The authors acknowledge Adrie Maas, for his surgical expertise in
helping to perform the experiments and A.M. Tuip-de Boer for her
assistance and expertise in processing samples.
R.B.K., M.W., J.J.B., D.P.V., M.W.H., N.P.J., B.F.G. and A.P.J.V.
designed the experiment. R.B.K., M.W. and J.J.B. performed the
experiments. M.W. and J.J.T.H.R. assisted in reviewing the results.
R.B.K., J.J.B. and A.P.J.V. wrote the manuscript. All authors critically
evaluated the manuscript.
CONFLIC T OF INT ER E ST
The authors declare that they have no competing interest.
ORCID
Robert B. Klanderman https://orcid.org/0000-0001-5820-4530
Joachim J. Bosboom https://orcid.org/0000-0003-0149-7349
RE FE RE NCE S
1. Food and Drug Administration: Fatalities reported to FDA following
blood collection and transfusion - annual summary for fiscal year
378
2018. Silver Spring–MD, USA. https://www.fda.gov/media/136907/
download 2018 Accessed May 2020.
2. Mounchili A, Leduc S, Archibald C, Miller J, Hyson C. A summary of
the transfusion transmitted injuries surveillance system: 2006–2012.
Can Commun Dis Rep. 2014;40:379–84.
3. Narayan S, Bellamy M, Spinks C, Poles D, Mistry H, Carter-
Graham S, et al. The 2019 Annual SHOT Report. https://www.
shotuk.org/shot-reports/report-summary-and-supplement-2019/
(2020). Accessed Jun 2020.
4. Hendrickson JE, Roubinian NH, Chowdhury D, Brambilla D,
Murphy EL, Wu Y, et al. Incidence of transfusion reactions: a multi-
center study utilizing systematic active surveillance and expert adju-
dication. Transfusion. 2016;56:2587–96.
5. Roubinian NH, Hendrickson JE, Triulzi DJ, Gottschall JL,
Chowdhury D, Kor DJ, et al. Incidence and clinical characteristics of
transfusion-associated circulatory overload using an active surveil-
lance algorithm. Vox Sang. 2017;112:56–63.
6. Li G, Rachmale S, Kojicic M, Shahjehan K, Malinchoc M, Kor DJ, et al.
Incidence and transfusion risk factors for transfusion-associated
circulatory overload among medical intensive care unit patients.
Transfusion. 2011;51:338–43.
7. Bosboom JJ, Klanderman RB, Zijp M, Hollmann MW, Veelo DP,
Binnekade JM, et al. Incidence, risk factors, and outcome of transfusion-
associated circulatory overload in a mixed intensive care unit population: a
nested case-control study. Transfusion. 2018;58:498–506.
8. Murphy EL, Kwaan N, Looney MR, Gajic O, Hubmayr RD,
Gropper MA, et al. Risk factors and outcomes in transfusion-
associated circulatory overload. Am J Med. 2013;126:357.e29–38.
9. Andrzejewski C Jr, Casey M, Popovsky M. How we view and
approach transfusion-associated circulatory overload: pathogenesis,
diagnosis, management, mitigation, and prevention. Transfusion.
2013;53:3037–47.
10. Wiersum-Osselton JC, Whitaker B, Grey S, Land K, Perez G,
Rajbhandary S, et al. Revised international surveillance case defini-
tion of transfusion-associated circulatory overload: a classification
agreement validation study. Lancet Haematol. 2019;6:e350–8.
11. Ganter C, Jakob S, Takala J. Pulmonary capillary pressure. A review.
Minerva Anestesiol. 2006;72:21–36.
12. Klanderman R, Bosboom J, Maas M, Roelofs JJTH, Korte D,
Bruggen R, et al. Volume incompliance and transfusion are essential
for transfusion-associated circulatory overload: a novel animal
model. Transfusion. 2019;59:3617–27.
13. Cullison M, Mahon R, McGwin G, McCarron R, Browning R, Auker C.
Blood transfusions, blood storage, and correlation with elevated pul-
monary arterial pressures. Transfusion. 2019;59:1259–66.
14. Gupta S, Nand N, Gupta M, Mohan JC. Haemodynamic changes fol-
lowing blood transfusion in cases of chronic severe anemia: increased
safety with simultaneous furosemide administration. Angiology. 1983;
34:699–704.
15. Nand N, Gupta S, Gupta M. Hemodynamic evaluation of blood trans-
fusion in chronic severe anemia with special reference to speed of
transfusion. Jpn Heart J. 1985;26:759–65.
16. Hadian M, Pinsky M. Evidence-based review of the use of the pulmonary
artery catheter: impact data and complications. Crit Care. 2006;10:S8.
17. Liu Y, Yang X, Nass O, Sabbah HN, Peterson E, Carretero OA.
Chronic heart failure induced by coronary artery ligation in Lewis
inbred rats. Am J Phys. 1997;272:H722–7.
18. Gupta S, Nand N, Gupta M. Left ventricular filling pressures after
rapid blood transfusion in cases of chronic severe anemia. Angiology.
1982;33:343–8.
19. Agrawal A, Hsu E, Quirolo K, Neumayr LD, Flori HR. Red blood cell
transfusion in pediatric patients with severe chronic anemia: how
slow is necessary? Pediatr Blood Cancer. 2012;58:466–8.
20. Goldstein J, Refaai M, Milling T Jr, Lewis B, Goldberg-Alberts R,
Hug BA, et al. Four-factor prothrombin complex concentrate versus
KLANDERMAN ET AL.
plasma for rapid vitamin K antagonist reversal in patients needing
urgent surgical or invasive interventions: a phase 3b, open-label, non-
inferiority, randomised trial. Lancet. 2015;385:2077–87.
21. Semple JW, Rebetz J, Kapur R. Transfusion-associated circulatory over-
load (TACO): Time to shed light on the pathophysiology. ISBT Sci Ser.
2019;14:136–9.
22. Pacher P, Nagayama T, Mukhopadhyay P, Bátkai S, Kass DA. Mea-
surement of cardiac function using pressure-volume conductance
catheter technique in mice and rats. Nat Protoc. 2008;3:1422–34.
23. Diehl K, Hull R, Morton D, Pfister R, Rabemampianina Y, Smith D, et al.
A good practice guide to the administration of substances and removal
of blood, including routes and volumes. J Appl Toxicol. 2001;21:15–23.
24. Zuurbier C, Heinen A, Koeman A, Stuifbergen R, Hakvoort TBM,
Weber NC, et al. Cardioprotective efficacy depends critically on
pharmacological dose, duration of ischaemia, health status of animals
and choice of anaesthetic regimen: a case study with folic acid.
J Transl Med. 2014;12:325.
25. Li G, Kojicic M, Reriani M, Fernández Pérez ER, Thakur L, Kashyap R, et al.
Long-term survival and quality of life after transfusion-associated pulmo-
nary edema in critically ill medical patients. Chest. 2010;137:783–9.
26. Guyton AC, Lindsey AW, Johnnie OH, John WW, Malcolm AF. Effect of
elevated left-atrial pressure and decreased plasma protein concentration
on the development of pulmonary edema. Circ Res. 1959;7:649–57.
27. Courtois M, Mechem C, Barzilai B, Gutierrez F, Ludbrook PA. Delin-
eation of determinants of left ventricular early filling. Saline versus
blood infusion. Circulation. 1994;90:2041–50.
28. Masuda R, Iijima T, Kondo R, Itoda Y, Matsuhashi M, Hashimoto S,
et al. Preceding haemorrhagic shock as a detrimental risk factor for
respiratory distress after excessive allogeneic blood transfusion. Vox
Sang. 2018;113:51–9.
29. Callum J, Waters J, Shaz B, Sloan SR, Murphy MF. The AABB recom-
mendations for the choosing wisely campaign of the American board
of internal medicine. Transfusion. 2014;54:2344–52.
30. Bosboom J, Klanderman R, Migdady Y, Bolhuis B, Veelo DP,
Geerts BF, et al. Transfusion-associated circulatory overload: a clini-
cal perspective. Transfus Med Rev. 2019;33:69–77.
31. Lieberman L, Maskens C, Cserti-Gazdewich C, Hansen M, Lin Y,
Pendergrast J, et al. A retrospective review of patient factors, trans-
fusion practices, and outcomes in patients with transfusion-
associated circulatory overload. Transfus Med Rev. 2013;27:206–12.
32. American Association of Blood Banks: Circular of information for the
use of human blood and blood components. https://www.aabb.org/
tm/coi/Documents/coi1017.pdf (2017). Accessed Jun 2020.
33. Klanderman R, Bosboom J, Migdady Y, Veelo DP, Geerts BF, Murphy MF,
et al. Transfusion-associated circulatory overload-a systematic review of
diagnostic biomarkers. Transfusion. 2019;59:795–805.
34. Ducrocq G, Gonzalez-Juanatey J, Puymirat E, Lemesle G, Cachanado M,
Durand-Zaleski I, et al. Effect of a restrictive vs liberal blood transfusion
strategy on major cardiovascular events among patients with acute
myocardial infarction and anemia: the REALITY randomized clinical trial.
JAMA. 2021;325:552–60.
SUPPORTING INF ORMATION
Additional supporting information may be found in the online version
of the article at the publisher’s website.
How to cite this article: Klanderman RB, Wijnberge M,
Bosboom JJ, Roelofs JJTH, de Korte D, van Bruggen R, et al.
Differential effects of speed and volume on transfusion-
associated circulatory overload: A randomized study in rats.
Vox Sang. 2022;117:371–8.
Received: 12 January 2021 Revised: 16 June 2021 Accepted: 27 July 2021

DOI: 10.1111/vox.13194

ORIGINAL ARTICLE

Prevalence of iron deficiency and red blood cell transfusions

in surgical patients

Rik Paulus Bernardus Tonino1,2,3 | Michael Wilson4 | Jaap Jan Zwaginga2,3,5 |

Martin Roelof Schipperus1,2,5,6

1
Haematology, Haga Teaching Hospital, The
Hague, The Netherlands Abstract
2
TRIP Haemovigilance and Biovigilance Office, Background and Objectives: While iron deficiency (ID) is the most common cause of
Leiden, The Netherlands
3
anaemia, little is known about the prevalence and type of ID in preoperative surgical
Haematology, Leiden University Medical
Centre, Leiden, The Netherlands patients. The aims of the present study were to investigate the prevalence and types
4
Surgery, Erasmus Medical Centre, Rotterdam, of ID in a large cohort of surgical patients, and how these are related to perioperative
The Netherlands
blood use after correction for confounders such as haemoglobin level.
5
CCTR, Sanquin Blood Supply, Amsterdam,
The Netherlands Materials and Methods: Data were retrospectively extracted from electronic case
6
Haematology, University Medical Centre records of all patients who underwent elective surgery between September 2016
Groningen, Groningen, The Netherlands
and November 2017 (n = 2711). Iron parameters, haemoglobin and details of periop-
Correspondence erative red cell transfusions were collected.
Rik Paulus Bernardus Tonino, Haematology, Results: Of 2711 patients, 618 (22.8%) were iron deficient (= transferrin saturation
Leiden University Medical Centre,
Albinusdreef 2, Leiden, Zuid-Holland, 2333 [TSAT] < 16%) preoperatively, 173 (6.4% of the cohort) had an absolute iron
ZA, The Netherlands. deficiency (AID; TSAT < 16% and ferritin < 30 μg/L) and 445 (16.4%) had functional/
Email: r.p.b.tonino@lumc.nl
mixed ID (TSAT < 16% and ferritin ≥ 30 μg/L). Corrected for Hb level, iron-deficient
Funding information patients received significantly more red cell units than patients without ID
TRIP Haemovigilance and Biovigilance Office
(p = 0.026). AID was not associated with a significantly higher incidence of transfu-
sions (7.5% of patients transfused; p = 0.12 after correction for Hb) than patients
without ID, whereas patients with functional/mixed deficiency did receive signifi-
cantly more transfusions (6.1%; p = 0.021) as compared to patients without
ID (1.7%).
Conclusion: Preoperative ID, in particular the functional/mixed type, was associated
with a higher risk of receiving perioperative red cell transfusions as compared to
patients without ID. Adequately treating ID might, therefore, reduce the need for
perioperative red cell transfusions.

KEYWORDS
anaemia, iron deficiency, iron-deficiency anaemia, iron parameters, patient blood management,
perioperative management, red blood cell transfusion

This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium,
provided the original work is properly cited.
© 2021 The Authors. Vox Sanguinis published by John Wiley & Sons Ltd on behalf of International Society of Blood Transfusion.

Vox Sanguinis. 2022;117:379–385. wileyonlinelibrary.com/journal/vox 379

380
I N T R O D U CT I O N
Background
Patient blood management (PBM) refers to the application of
evidence-based medical and surgical concepts to optimize the preop-
erative haemoglobin concentration and haemostatic potential and to
minimize blood loss during surgery. PBM aims to improve patient out-
come by improving low preoperative haemoglobin levels and reducing
perioperative red blood cell transfusion (RBCT) support [1–5]. Correc-
tion of iron deficiency (ID)–associated anaemia is one of the most
applied measures and has received much attention in recent years.
ID is commonly found in patients undergoing surgery and is associated
with increased risk not only for receiving an RBCT but also of prolonged
hospitalization and postoperative mortality and morbidity [6–10].
ID can either be an absolute ID (AID) due to blood loss or insufficient
dietary intake, or functional, as a consequence of chronic inflammation lead-
ing to insufficient utilization of the iron stores and decreased uptake by the
enterocytes [11]. In the case of functional ID, intravenous iron administra-
tion is often needed because of the poor enteric iron uptake.
The preoperative assessment of iron parameters is not standard
practice in the Netherlands. In risk groups, in which iron parameters
are assessed more often, the use of preoperative iron therapy has
become a pragmatic standard of care, with orthopaedic, abdominal
and cardiac surgery using the intravenous route of administration as
the most effective and fast-acting modality [1, 3, 12–15].
Objectives
Our objectives are to investigate the preoperative prevalence and type of
ID and whether the different types of ID are associated with perioperative
RBCTs. If such an association is found, the presence and type of ID will be
relevant to define the target population in which to evaluate whether iron
administration has an impact on perioperative RBTC and the clinical
outcome. If the effect depends on the type of ID, this will allow the identi-
fication of patients who may benefit from iron supplementation in a cost-
effective way [7]. Therefore, we performed a retrospective study in a large
cohort of surgical patients to investigate whether ID is associated with
perioperative RBCTs, corrected for predefined confounders such as
haemoglobin (Hb) and whether the transfusion requirement is additionally
associated with the absolute or functional/mixed type of ID.
METHODS
Study design
This is a retrospective single-centre study in the Haga Teaching Hospi-
tal, a large clinical referral centre in the Netherlands. The requirement
for written informed consent was waived by the Leiden-Den Haag-
Delft ethics committee. Permission was granted by the board of the
Haga Teaching Hospital. The trial was performed in accordance with
TONINO ET AL.
the Good Clinical Practice guidelines and the Declaration of
Helsinki 2013.
Study population
The study population was comprised of all adult patients who underwent
any form of elective inpatient surgery between September 2016 and
November 2017. Patients who underwent non-elective or outpatient
surgery or in whom iron parameters were not tested were excluded.
Data collection
In September 2016, testing iron parameters (ferritin, transferrin, trans-
ferrin saturation [TSAT] and iron) preoperatively (<30 days before sur-
gery) was introduced as the standard of care, but in November 2017,
this practise was stopped due to cost reduction considerations. Iron
parameters, Hb level, C-reactive protein (CRP), administration of peri-
operative RBCTs (30 days before to 30 days after surgery), type of sur-
gery, age and sex of patients were collated. Data were obtained from
electronic medical records by the authors.
Definition of anaemia, ID and classifications
into subtypes of ID
In accordance with the WHO criteria, anaemia was defined as an Hb con-
centration of <13 g/dl for adult men and Hb < 12.0 g/dl for adult, non-
pregnant women [16]. With the collected data, we attempted to determine
the origin of the ID (functional ID; AID and mixed). No universally accepted
definitions of absolute, functional and mixed ID exist. Therefore, we chose
to divide the cases into groups based on TSAT and ferritin. Reference values
were taken from published literature, as indicated.
Patients were considered iron deficient when TSAT was <16%
[17, 18]. In order to assess whether the type of ID was of influence on
the need of RBCTs, we made a subdivision for all ID patients: a patient
was considered to have AID when ferritin was <30 μg/L and not AID
(FMID: functional/mixed ID) when ferritin was ≥30 μg/L [17, 19].
The prevalence of ID and the subtypes were calculated with the
aforementioned criteria. We compared demographic data and periop-
erative RBCTs between patients with ID (AID and FMID) and non-ID
(TSAT ≥ 16%) to assess the association between ID and RBCTs.
Statistical analysis
Categorical variables are summarized as frequencies and percentages,
and compared with the chi-square test; continuous variables are
reported as means and standard deviations, and analysed with a one-
way analysis of variance.
We stratified our data by anaemia (binary) to evaluate additional
value of iron parameters over Hb. Odds ratios are presented to show
PREOPERATIVE IRON AND TRANSFUSION 381

the association between preoperative ID and perioperative RBCTs.
The Dunn–Bonferroni correction was used to compensate for multi-
ple hypothesis testing. Ordinal regression modelling was carried out
to explore the predictive value of iron parameters for RBCTs. In the
ordinal regression model, the variables assessed included Hb level
(in this case non-binary), ferritin, TSAT, perioperative RBCTs, age,
CRP, sex and type of surgery. All analyses were conducted using SPSS
(version 25.0, SPSS Inc., Chicago, IL). A p-value <0.05 (two-sided) was
considered statistically significant.

RE SU LT S

Inclusion and data collection

From September 2016 to November 2017, 6551 adult patients

underwent surgery. Of these patients, 3239 had no iron parameters
determined. The major part of the missing iron parameters can be
attributed to non-elective surgery, in which the testing of iron param-
eters was not standard care. Among the 3312 patients for whom iron
parameters were available, 601 underwent outpatient surgery, like
dermatologic or ophthalmologic and were excluded. Leaving 2711
who were included in our analyses (Figure 1). Iron parameters were
tested <30 days before surgery (median = 21 days). Baseline charac-
teristics of included patients are shown in Table 1.

Prevalence of ID and anaemia

Of patients 2711, 618 (22.8%) had ID preoperatively, 173 (6.4%) had

AID and 445 (16.4%) had FMID. Of the 618 patients with ID, 32.4%
F I G U R E 1 Inclusion of patients who underwent inpatient
surgery. Patients were excluded if they did not have iron parameters were anaemic (54.9% of patients with AID and 23.6% of FMID). In the
tested or if they underwent an outpatient type of surgery group without ID, 7.8% were anaemic (Figure 2). Conversely, among

TABLE 1 Patient demographics and perioperative variables

AID FMID Non-ID

(TSAT < 16% and ferritin (TSAT < 16% and ferritin (TSAT ≥ 16%)
Variables < 30 μg/L) n = 173 > 30 μg/L) n = 445 n = 2093
Demographics
Age mean (SD) 55 (17)a,b 65 (14) 64 (13)
Female gender, n (%) 145 (84%)a,b 288 (65%)a 1173 (56%)
Preoperative blood analysis
CRP, mean (SD) 4.4 (5.4)b 13,6 (25.8)a 3,2 (4.7)
a,b a
Ferritin, mean (SD) 17.9 (7.0) 160 (163) 197 (171.3)
TSAT, mean (SD) 9.2 (3.6)a,b 12,7 (2.6)a 25,3 (7.4)
Anaemia, n (%) 95 (54.9%)a,b 105 (23.6%)a 163 (7.8%)
a,b
Mean Hb, g/dl (SD) 11.9 (1.6) 13.2 (1.6)a 14.0 (1.3)
Perioperative RBCTs n (%)
0 RBCT 160 (92.5%) 418 (93.9%) 2058 (98.3%)
1 RBCT 2 (1.2%) 4 (0.9%) 7 (0.3%)
2–3 RBCTs 7 (4.0%) 15 (3.4%) 22 (1.1%)
>3 RBCTs 4 (2.3%) 8 (1.8%) 6 (0.3%)

Abbreviations: AID, absolute iron deficiency (TSAT < 16% and ferritin < 30 μg/L); FMID, functional and mixed iron deficiency (TSAT < 16% and ferritin
≥ 30 μg/L; Hb, haemoglobin; non-ID, non-iron deficiency (TSAT ≥ 16%); RBCT, red blood cell transfusion; TSAT, transferrin saturation.
a
p < 0.05 compared to non-ID;
b
p < 0.05 compared to FMID.
382 TONINO ET AL.

F I G U R E 2 Prevalence of iron deficiency in the preoperative population. ID, iron deficiency (TSAT < 16%); AID, absolute iron deficiency
(TSAT < 16% and ferritin < 30 μg/L); FMID, functional and mixed iron deficiency (TSAT < 16% and ferritin ≥ 30 μg/L; non-ID, non-iron deficiency
(TSAT ≥ 16%); TSAT, transferrin saturation

F I G U R E 3 Iron deficiency per field of surgery, subdivided in non-anaemic patients (a) and anaemic patients (b). (% of patients with AID and
FMID per surgical group are given). AID, absolute iron deficiency (TSAT < 16% and ferritin < 30 μg/L); FMID, functional and mixed iron deficiency
(TSAT < 16% and ferritin ≥ 30 μg/L; non-ID, non-iron deficiency (TSAT ≥ 16%); TSAT, transferrin saturation

the 363 (13.4%) anaemic patients, 95 (26.2%) had AID and
105 (28.9%) FMID (Table 1). For anaemic patients, the mean Hb was
11.0  1.1 g/dl in the ID group (AID: 10.8  1.3 g/dl; FMID:
11.3  0.8 g/dl) and 11.7  0.6 g/dl in the non-ID group.
The prevalence of preoperative ID for the different surgical spe-
cialties is shown in Figure 3. As can be expected, in each surgical field,
the prevalence of ID is significantly higher in anaemic patients than in
non-anaemic patients. The prevalence of AID was highest at 20.3% in
gynaecological surgery patients (51/251).
ID and red cell transfusions
Overall, including both anaemic and non-anaemic patients, we found
that patients with ID receive more RBCTs than non-ID patients (6.5%
and 1.7%, resp.; p < 0.001). This is the case for both AID: 7.5%
(13/173) and FMID: 6.1% (27/445; p < 0.001 for both types, com-
pared to non-ID) (Table 2).
Evaluating the surgical specialties separately, we found that more
patients in cardiac surgery (p = 0.003) and orthopaedics (p < 0.001)
PREOPERATIVE IRON AND TRANSFUSION 383

TABLE 2 Number of RCTs in patients with and without iron deficiency, anaemic and non-anaemic patients separately

AID FMID Non-ID

(TSAT < 16% and ferritin (TSAT < 16% and ferritin (TSAT ≥ 16%) Total
No anaemia < 30 μg/L) n = 78 > 30 μg/L) n = 340 n = 1930 n = 2348
No RBCT 76 (97.4%) 331 (97.4%) 1904 (98.6%) 2311 (98.4%)
1 RBCT 0 2 (0.6%) 5 (0.3%) 7 (0.3%)
2-3RBCTs 0 5 (1.4%) 17 (0.9%) 22 (0.9%)
>3 RBCTs 2 (2.6%)a 2 (0.6%) 4 (0.2%) 8 (0.3%)
RBCT odds 2/76 (2.63%) 9/331 (2.72%) 26/1904 (1.37%) 37/2311 (1.60%)
Anaemia n = 95 n = 105 n = 163 n = 363
No RBCT 84 (88.4%) 87 (82.9%)a 154 (94.5%) 325 (89.5%)
1 RBCT 2 (2.1%) 3 (2.9%) 2 (1.2%) 6 (1.7%)
2-3RBCTs 7 (7.4%) 9 (8.6%) 5 (3.1%) 22 (6.1%)
>3 RBCTs 2 (2.1%) 6 (5.7%) 2 (1.8%) 10 (2.7%)
a
RBCT odds 11/84 (13.10%) 18/87 (20.69%) 9/154 (5.84%) 38/325 (11.69%)

Abbreviations: AID, absolute iron deficiency (TSAT < 16% and ferritin < 30 μg/L); FMID, functional and mixed iron deficiency (TSAT < 16% and ferritin
≥ 30 μg/L; non-ID, non-iron deficiency (TSAT ≥ 16%); RBCT, red blood cell transfusion; TSAT, transferrin saturation.
a
p < 0.05 compared to non-ID; no significant differences were found comparing AID to FMID in this table.

receive RBCTs when they have ID as compared to patients of the
same specialties who do not have ID. In the other surgical specialties,
a comparable trend was found, but no significant difference in RBCTs
between ID and non-ID patients.
ID, anaemia and patients receiving RBCTs
We stratified for the presence and absence of anaemia to see whether
the association between ID and RBCTs remained. Of all patients with
neither ID nor anaemia, 1.35% (26/1930) received RBCTs. In patients
with ID but without anaemia, 2.6% (11/418) received RBCTs (2.6%
and 2.7% for AID and FMID, respectively). Of the patients with ID
and anaemia, 14.5% (29/200) received RBCs (11.6% and 17.1% for
AID and FMID, respectively) while among patients with anaemia but
no ID, 5.5% (9/163) were transfused perioperatively (Table 2).
The odds ratio for receiving RBCTs in iron-deficient patients ver-
sus non-iron-deficient patients is 1.99 (Confidence interval (CI): 0.97–
4.05) for non-anaemic patients and 2.90 (CI: 1.33–6.32) for anaemic
patients.
ID and number of RBCTs, corrected for Hb level
RBCTs were initially analysed as a binary variable (no RBC units
vs. ≥1 units). Subsequently, we grouped patients according to the
number of RBC units (0, 1, 2–3 or > 3 units as an ordinal variable) to
evaluate whether the number of RBC units per transfused patient dif-
fered between the various groups. Because a severely anaemic
patient (e.g., Hb = 6.0 g/dl) is more likely to receive one or more RBC
units than a mildly anaemic patient (e.g., Hb = 12.0 g/dl), we also eval-
uated the influence of Hb level as a continuous variable (instead of
the binary presence or absence of anaemia) among other possible
confounders using ordinal regression.
After correction for Hb level, sex and age, ID was still correlated
with a significantly larger number of RBC units transfused compared
to non-ID (p = 0.026). In the subgroup analysis, AID was not indepen-
dently associated with a larger number of RBCTs than non-ID
(p = 0.12), whereas patients with FMID did receive more RBCTs than
non-ID (p = 0.021).
DI SCU SSION
In this study, we show that 22.8% of patients have ID preoperatively.
Having ID resulted in a four-fold increase in RBCT in our cohort.
While anaemia is more often present in ID patients, stratification for
anaemia shows that RBCTs are only transfused significantly more in
ID patients if they are also anaemic. In the non-anaemic group, there
is a non-significant trend of increased RBCT in ID patients.
Interestingly, the ordinal regression model indicated that patients
with FMID received significantly more RBCTs compared to non-ID,
whereas patients with AID did not. This could be a first indication that
we may need to specifically target FMID patients in order to cost-
effectively improve PBM. However, these findings may also be caused
by underpowering, as the AID group (n = 173) is smaller than the
FMID group (n = 445). Moreover, gynaecology patients have AID
more often. Inclusion of gynaecology patients—who are more likely to
have AID and anaemia, especially when pre-menopausal [20]—might
potentially be a confounding factor. These patients may often be
young and healthy enough to tolerate anaemia well, and therefore, do
not need transfusions, which would lead to a lower transfusion rate in
the AID group. Exclusion of the gynaecology patients from our ana-
lyses, however, yielded the same results. Given the difference
384
between FMID and AID, distinguishing between these types of ID
may prove to be useful in the context of PBM [21, 22].
A recent observational study found that intravenous (IV) iron pre-
operatively reduced the risk of perioperative RBCTs [23]. In line with
our results, Hubert et al. also found associations in elective cardiac
surgery patients between ID and anaemia and between ID and the
number of RBCTs (p = 0.03) perioperatively [24]. However, they did
not correct the latter analysis for the Hb level, nor was the type of ID
taken into consideration. Our findings, in contrast, clearly show a rela-
tion between preoperative ID and perioperative RBCTs after correc-
tion for the Hb level.
A smaller study of 100 patients undergoing cardiac surgery showed
results consistent with ours: patients with ID but without anaemia
received more RBCTs than patients with neither ID nor anaemia [25].
Conflicting with the latter and our findings, Fotland et al. did not find
such a correlation in a group of 175 orthopaedic patients [26].
A small randomized controlled trial in cardiac surgery did not find
a reduction in RBC transfusions after oral and IV iron [12]. However,
the iron supplementation started when patients were admitted just
before surgery, which may very well be too late for effective iron
therapy. Another small trial in the UK with anaemic patients undergo-
ing colorectal cancer surgery found that IV iron had no effect on peri-
operative blood use compared to oral iron supplementation [14],
while a small Australian trial found that IV iron for iron-deficient anae-
mic patients did improve perioperative blood use [3]. The larger PRE-
VENTT trial randomized major open elective abdominal surgery
patients to IV iron or placebo. Despite not selecting patients for ID,
the authors showed the efficacy of IV iron for improving the Hb level
by the time of surgery and at 8 weeks and 6 months following the
intervention. Nevertheless, they concluded that there was no reduc-
tion in perioperative RBC transfusions, but there was a reduced risk in
readmissions to the hospital for complications in the group that
received IV iron [27]. It has been argued, however, that without a
standardized approach to transfusion it should not be concluded that
improving preoperative red cell mass does not reduce the need for
blood transfusion [28].
In contrast to the above-mentioned studies, the present study
spanned the whole scope of surgery in a real-life setting, which
strengthens the external validity of our results. In general, we found a
clear association between ID and the number of RBCTs after correction
for predefined confounders, the most obvious being Hb level, but also
age and sex. Other possible confounders (e.g., CRP, type of surgery) were
also assessed to maximize the chance of finding a true effect.
Our study is limited, first, by its retrospective nature. The patients
received standard care, which makes selection bias unlikely. However,
we lack data about perioperative iron supplementation in our cohort,
and iron parameters and Hb were not measured immediately before
surgery, but any time in the 30 days before. This could lead to an
underestimation of the effect because RBCTs may have been avoided
in the group most at risk for receiving RBCTs, for example, if they
received IV iron supplementation. We also lack information on periop-
erative blood loss. Having this data, as well as Hb and iron parameters
measured precisely before surgery would have made our dataset and
TONINO ET AL.
results more complete. Second, our data contain some outliers—for
example, one patient in cardiac surgery received 43 RBCTs. The use
of RBCTs as a continuous variable would have resulted in unbalanced
data with a high impact of such outliers. Therefore, the number of
RBC units transfused was used as an ordinal variable (0, 1, 2–3 or > 3
RBCTs) instead of a continuous variable. Third, even though we
included 2711 patients, RBCT support was limited to only 77 patients
(39 who were anaemic and 38 non-anaemic). This obviously leads to a
lack of statistical power. Last, the real-life dataset did not comprise
enough iron parameter testing results to properly distinguish between
absolute, mixed and functional ID, forcing us to merge the mixed and
function ID into the FMID group.
To find a conclusive answer to the question of whether IV iron
preoperatively truly lowers the need for perioperative RBCTs, large
prospective randomized controlled trials in various surgical fields are
needed. Based on our data, such a trial would need at least 127 anae-
mic patients per group to acquire enough transfusion events to
conclude on the effects of preoperative iron supplementation. For
non-anaemic patients, the number would need to be many times
larger. An additional and more important question to resolve is
whether iron supplementation with an increased Hb in consequence
also leads to the hoped-for better short- and long-term outcomes.
Although a lower Hb level and a higher amount of blood use are both
correlated with inferior outcomes, we should keep in mind that this is
likely to be confounded by the severity of the underlying pathology in
these patients. Therefore, it remains unclear whether Hb correction
by iron supplementation improves outcome. Until this is established,
we recommend IV iron over oral iron when aiming to correct ID pre-
operatively. Particularly, because we found a stronger association of
ID with the incidence of transfusions in the FMID patients, in whom
the enteric uptake is impaired [11]. In addition, we recommend
starting treatment at least 1 week before surgery so that the therapy
has sufficient time to exert a beneficial effect.
In conclusion, our data show that preoperative ID, corrected for Hb
level, is clearly associated with the number of RBCTs given to patients.
As the association of FMID with the need for RBCTs is stronger than
that of AID, our data support distinguishing between the types of
ID. Further research should be undertaken to assess the potential and
cost-effectiveness of adequate ID correction preoperatively for reducing
RBCTs. Treating ID even in patients without anaemia might also contrib-
ute to reduced need for perioperative RBCTs.
AC KNOW LEDG EME NT S
The authors would like to thank Dr. C. So-Osman and Dr. D. Swinkels
for their advice on the definitions of the types of iron deficiencies.
Furthermore, we would like to thank Dr. J.C. Wiersum-Osselton for
her contributions to the manuscript.
M.R.S. conceived the study design; M.W. provided data; R.P.B.T.
performed the statistical analysis; all authors participated in the interpreta-
tion of the results; R.P.B.T. wrote the first draft; all authors reviewed the
draft and all authors agreed to be accountable for all aspects of the work,
thereby ensuring that questions related to the accuracy or integrity of any
part of the work are appropriately investigated and resolved.
PREOPERATIVE IRON AND TRANSFUSION
CONF LICT OF IN TE RE ST
All authors attest that they have no conflict of interest to declare.
ORCID
Rik Paulus Bernardus Tonino https://orcid.org/0000-0002-6775-
6617
RE FE R ENC E S
1. Shander A, Van Aken H, Colomina MJ, Gombotz H, Hofmann A,
Krauspe R, et al. Patient blood management in Europe. Br J Anaesth.
2012;109:55–68.
2. Abdullah H, Ang A, Froessler B, Hofmann A, Jang JH, Kim YW, et al.
Getting patient blood management pillar 1 right in the Asia-Pacific: a
call for action. Singap Med J. 2019;61:297–6.
3. Froessler B, Palm P, Weber I, Hodyl NA, Singh R, Murphy EM. The
important role for intravenous iron in perioperative patient blood
management in major abdominal surgery. Ann Surg. 2016;264:41–6.
4. Kotzé A, Carter LA, Scally AJ. Effect of a patient blood management
programme on preoperative anaemia, transfusion rate, and outcome
after primary hip or knee arthroplasty: a quality improvement cycle.
Br J Anaesth. 2012;108:943–52.
5. Spahn DR. Anemia and patient blood Management in hip and knee surgery
a systematic review of the literature. Anesthesiology. 2010;113:482–95.
6. Muñoz M, Acheson AG, Auerbach M, Besser M, Habler O, Kehlet H,
et al. International consensus statement on the peri-operative manage-
ment of anaemia and iron deficiency. Anaesthesia. 2017;72:233–47.
7. Cappellini MD, Comin-Colet J, de Francisco A, Dignass A,
Doehner W, Lam CS, et al. Iron deficiency across chronic inflamma-
tory conditions: international expert opinion on definition, diagnosis,
and management. Am J Hematol. 2017;92:1068–78.
8. Patteril MV, Davey-Quinn AP, Gedney JA, Murdoch SD,
Bellamy MC. Functional iron deficiency, infection and systemic
inflammatory response syndrome in critical illness. Anaesth Intensive
Care. 2001;29:473–8.
9. Enjuanes C, Bruguera J, Grau M, Cladellas M, Gonzalez G, Meroño O,
et al. Iron status in chronic heart failure: impact on symptoms, func-
tional class and submaximal exercise capacity. Rev Española Cardiol
(Engl Ed). 2016;69:247–55.
10. Cleland JGF, Zhang J, Pellicori P, Dicken B, Dierckx R, Shoaib A, et al.
Prevalence and outcomes of anemia and hematinic deficiencies in
patients with chronic heart failure. JAMA Cardiol. 2016;1:539–47.
11. Fleming RE, Sly WS. Hepcidin: a putative iron-regulatory hormone
relevant to hereditary hemochromatosis and the anemia of chronic
disease. Proc Natl Acad Sci U S A. 2001;98:8160–2.
12. Garrido-Martín P, Nassar-Mansur MI, De La Llana-Ducro  s R, Virgos-
Aller TM, Fortunez PMR, Avalos-Pinto R, et al. The effect of intravenous
and oral iron administration on perioperative anaemia and transfusion
requirements in patients undergoing elective cardiac surgery: a random-
ized clinical trial. Interact Cardiovasc Thorac Surg. 2012;15:1013–8.
13. Theusinger OM, Leyvraz P-FO, Schanz U, Seifert B, Spahn DR. Treat-
ment of iron deficiency anemia in orthopedic surgery with intrave-
nous iron: efficacy and limits a prospective study. Anesthesiology.
2007;107:923–7.
14. Keeler BD, Simpson JA, Ng O, Padmanabhan H, Brookes MJ,
Acheson AG, et al. Randomized clinical trial of preoperative oral
385
versus intravenous iron in anaemic patients with colorectal cancer.
Br J Surg. 2017;104:214–21.
15. Keeler BD, Dickson EA, Simpson JA, Ng O, Padmanabhan H,
Brookes MJ, et al. The impact of pre-operative intravenous iron on
quality of life after colorectal cancer surgery: outcomes from the
intravenous iron in colorectal cancer-associated anaemia (IVICA) trial.
Anaesthesia. 2019;74:714–25.
16. World Health Organisation: Nutritional anaemias: tools for effective
prevention and control. Geneva: WHO; 2017.
17. Wouters HJCM, van der Klauw MM, de Witte T, Stauder R,
Swinkels DW, Wolffenbuttel BHR, et al. Association of anemia with
health-related quality of life and survival: a large population-based
cohort study. Haematologica. 2019;104:468–76.
18. United nations, World Health Organisation: Iron deficiency anaemia
assessment, prevention and control: a guide for programme man-
agers. Geneva: WHO; 2001.
19. Lopez A, Cacoub P, Macdougall IC, Peyrin-Biroulet L. Iron deficiency
anaemia. Lancet. 2016;387:907–16.
20. Spahn DR, Schoenrath F, Spahn GH, Seifert B, Stein P,
Theusinger OM, et al. Effect of ultra-short-term treatment of
patients with iron deficiency or anaemia undergoing cardiac surgery:
a prospective randomised trial. Lancet. 2019;393:2201–12.
21. Litton E, Xiao J, Ho KM. Safety and efficacy of intravenous iron ther-
apy in reducing requirement for allogeneic blood transfusion: sys-
tematic review and meta-analysis of randomised clinical trials. BMJ.
2013;347:f4822.
22. Muñoz M, Garciá-Erce JA, Cuenca J, Bisbe E, Naveira E. On the role
of iron therapy for reducing allogeneic blood transfusion in ortho-
paedic surgery. Blood Transfus. 2012;10:8–22.
23. Triphaus C, Judd L, Glaser P, Goehring MH, Schmitt E, Westphal S,
et al. Effectiveness of preoperative iron supplementation in major
surgical patients with iron deficiency. Ann Surg. 2019;274:212–9.
24. Hubert M, Gaudriot B, Biedermann S, Gouezec H, Sylvestre E, Bouzille G,
et al. Impact of preoperative iron deficiency on blood transfusion in elec-
tive cardiac surgery. J Cardiothorac Vasc Anesth. 2019;33:2141–50.
25. Piednoir P, Allou N, Driss F, Longrois D, Philip I, Beaumont C, et al.
Preoperative iron deficiency increases transfusion requirements and
fatigue in cardiac surgery patients: a prospective observational study.
Eur J Anaesthesiol. 2011;28:796–801.
26. Fotland SS, Reikvam H, Hervig T, Seghatchian J. Does the preopera-
tive iron status predict transfusion requirement of orthopedic
patients? Transfus Apher Sci. 2009;40:213–7.
27. Richards T, Baikady RR, Clevenger B, Butcher A, Abeysiri S, Chau M,
et al. Preoperative intravenous iron to treat anaemia before major
abdominal surgery (PREVENTT): a randomised, double-blind, con-
trolled trial. Lancet. 2020;396:1353–61.
28. Keegan A, Crispin P, Ormerod A, Brown K, Akers C, King F. Iron defi-
ciency in PREVENTT. Lancet. 2021;397:669.
How to cite this article: Tonino RPB, Wilson M, Zwaginga JJ,
Schipperus MR. Prevalence of iron deficiency and red blood
cell transfusions in surgical patients. Vox Sang. 2022;117:
379–85.
Received: 9 June 2021 Revised: 12 August 2021 Accepted: 23 August 2021

DOI: 10.1111/vox.13201

ORIGINAL ARTICLE

Psychological intervention in children with transfusion-

dependent β-thalassaemia

Meichun Wang1 | Meixia Huang2 | Yijin Hong3

1
Department of Hematology, Quanzhou First
Hospital, Quanzhou, Fujian, China Abstract
2
Department of Pediatrics, Quanzhou First Background and Objectives: Transfusion-dependent β-thalassaemia can lead to severe
Hospital, Quanzhou, Fujian, China
3
psychological issues in paediatric and adolescent patients. However, the psychological
Department of Radiation Oncology,
Quanzhou First Hospital, Quanzhou, Fujian, interventions for these patients are limited in clinical practice. We aimed to investigate
China the impact of a 3-month psychological intervention on the quality of life (QOL) of children

Correspondence
Yijin Hong, Department of Radiation
Oncology, Quanzhou First Hospital, 250 East
Street, Licheng District, Quanzhou, Fujian
362000, China.
Email: hyj20216666@163.com
Funding information
This study was supported by the Natural
Science Foundation of Fujian Province, China
(No. 2017J01349).
with β-thalassaemia (12–18 years old) who relied on blood transfusion in this study.
Materials and Methods: In the current randomized controlled trial, a total of 143 paediat-
ric or adolescent patients (12–18 years old) with transfusion-dependent β-thalassaemia
were recruited. They were randomized into the control group (n = 71) who received stan-
dard physiological treatment and the intervention group (n = 72) who received a 3-month
intervention in addition to standard physiological treatment. The effects of the interven-
tions on the QOL and psychological outcomes of these participants were analysed.
Results: The 3-month intervention significantly improved the scores of PedsQoL 4.0
Generic Core Scales of paediatric patients with transfusion-dependent β-thalassae-
mia. It also significantly improved the psychological status and alleviated the depres-
sion among children and adolescent patients by alleviating anhedonia, negative mood
and negative self-esteem among them.
Conclusion: Psychological intervention has positive effects on the treatment for chil-
dren with transfusion-dependent β-thalassaemia.

KEYWORDS
β-thalassaemia, depression, psychological intervention, quality of life

I N T R O D U CT I O N (QOL) of children in developing regions [5, 6]. However, Allo-HSCT is

β-thalassaemia is a hereditary haemolytic anaemia [1]. Deletions or
mutations in genes that regulate globin synthesis result in an imbal-
anced ratio of β-streptoglobin that constitutes haemoglobin [2].
β-thalassaemia can shorten the lifespan of red blood cells and thus
cause broad red blood cell destruction [3]. Severe β-thalassaemia, if
left untreated, can also lead to complications such as growth retarda-
tion, pallor, jaundice, hepatosplenomegaly and osteoporosis [4]. Allo-
geneic haematopoietic stem cell transplantation (Allo-HSCT) is
currently the only potential cure for the disease, and previous studies
have shown that Allo-HSCT significantly improves the quality of life
currently difficult to popularize clinically due to limited marrow
sources and its high cost [7]. The possible sequelae of Allo-HSCT,
such as chronic graft-versus-host disease and subsequent cancers,
also cannot be ignored [8, 9]. Blood transfusion and standard iron-
chelation therapy are common alleviating treatments against β-thal-
assaemia, even though the treatment technology for improving the
ineffective production of red blood cells and the technique for reg-
ulating globin imbalance are progressing [10, 11]. However, the
need for regular blood transfusions and developmental abnormali-
ties in children with β-thalassaemia seriously affect their mental
health [12].

386 © 2021 International Society of Blood Transfusion. wileyonlinelibrary.com/journal/vox Vox Sanguinis. 2022;117:386–392.
PSYCHOLOGICAL INTERVENTION OF β-THALASSAEMIA CHILDREN
Paediatric patients have limited expression ability, impaired men-
tal development and limited cognitive ability compared with adult
patients [13]. Inappropriate treatment methods and the psychological
and physical pain caused by chronic diseases often lead to depression,
isolation and other psychological problems in children and adolescents [14].
Therefore, it is very important to pay attention to the mental health of
children and adolescents in the long-term treatment of chronic diseases.
Accumulating evidence has demonstrated the statistical correlation
between β-thalassaemia and the incidence of psychological morbidity,
especially in children and adolescents [12]. It has been reported that
transfusion-dependent β-thalassaemia significantly impacts the life quality
of paediatric and adolescent patients in upper Egypt, and the same
disease also causes considerable psychological issues for patients in
Sri Lanka [15, 16]. However, minimal attempts are made to intervene
psychological problems and improve the QOL among patients, especially
in developing countries [16–18]. Therefore, it is of great significance to
provide psychological interventions for patients, especially paediatric
patients, with transfusion-dependent β-thalassaemia as early as possible.
In this study, we hypothesized that psychological intervention,
including psychological counselling, mindfulness training and attention
shifting methods, could improve the mental state and QOL of children
with transfusion-dependent β-thalassaemia. We conducted a 3-month
psychological intervention for children with β-thalassaemia (12–18 years
old) who depended on blood transfusion. Our research could provide
new evidence supporting the application of psychological intervention
for β-thalassaemia treatment, especially in developing countries.
MATERIALS AND METHODS
Study design
A total of 143 patients with transfusion-dependent β-thalassaemia
were recruited for this trial. The impact of psychological intervention
on their QOL and psychological status was analysed.
Participants
A randomized controlled trial of patients with transfusion-dependent
β-thalassaemia was performed in this research. Inclusion criteria:
(1) patients between 12 and 18 years old; (2) patients with
transfusion-dependent β-thalassaemia; (3) patients without severe
complications; (4) patients with no severe liver or kidney damage and
(5) patients who were literate and able to read and understand the
informed consent form. Exclusion criteria: (1) patients with congenital
immunodeficiency; (2) patients with severe infectious or inflammatory
diseases and (3) patients with cardiac, hepatic or renal insufficiency.
Randomization
A complete randomization procedure was used to produce the alloca-
tion sequence of patients. A researcher not involved in study data
387
collection randomly assigned participants into the control group and
intervention group using a computer-generated random number
sequence. The random number produced by the procedure and the
associated allocated treatment were kept in sequentially numbered
sealed opaque envelopes.
Intervention
A total of 143 participants were randomized into the intervention
group (n = 72) and the control group (n = 71). Patients in the control
group received a standard blood transfusion for their diseases.
Patients in the intervention group received extensive psychological
intervention in addition to traditional blood transfusion. The strategy
of the psychological intervention was shown in Table 1 following
previous studies [15, 19]. Researchers blind to group allocation
performed all data collection.
QOL score
The PedsQoL 4.0 Generic Core Scale was used to evaluate the QOL
of patients. Patients were asked to answer questions, including ath-
letic ability, independent living ability, emotional state, etc. PedsQoL
4.0 Generic Core Scale scores have been converted to a percentile
system. A high score indicated a better QOL for the patient [20].
Children’s depression inventory
The Children’s depression inventory (CDI) is a tool used by mental
health professionals to measure the cognitive, emotional and behav-
ioural signs of depression in children and adolescents from 7 to 17 years
old. CDI was used to analyse the severity of depression symptoms in chil-
dren. The detailed measurement was reported in previous studies [21].
TABLE 1 Intervention contents
Session Content
1 Introduction: education about the disease and treatment
measures, explain the goals of the study.
2 Managing stress: reduce negative thoughts by replacing
them with positive thoughts or stopping thoughts.
3 Relaxation: demonstration of distraction, deep breathing,
progressive muscle relaxation and guided imagery.
4 Negative emotions: identify their negative emotions,
schedule pleasant activities and encourage them to
develop new hobbies to distract attention.
5 Promoting acceptance: encourage them to accept their
imperfections and let them understand that even if
they are not perfect, they can still do a lot of
meaningful things.
6 Communication: encourage them to make friends and
share their feelings with friends.
388 WANG ET AL.

Statistical analysis

The categorized variables were frequency and percentage, and the contin-
uous variables were mean and standard deviation. Chi-square test
(or Fishers’ exact test) was used to compare the classification variables.
One-way analysis of variance and Tukey’s post hoc test were used to ana-
lyse the continuous variables. Contingency table chi-square test was used
for the comparison of outcomes among different groups. The statistical
analysis was performed by SAS 9.3 software (SAS Institute Inc., Cary, NC).

RE SU LT S

Process of the study

As shown in Figure 1, the 143 patients who met our requirements

were randomly divided into two groups: the intervention group
(n = 72) and the control group (n = 71). Patients in the control
FIGURE 1 Study flow group received a standard blood transfusion, and patients in the

TABLE 2 Participants’ characteristics

Control Intervention
(n = 62) (n = 64) p Value

Age (years) 14.4  2.1 14.2  1.9 0.577

Gender
Male 33 (53.2) 30 (46.9) 0.476
Female 29 (46.8) 34 (53.1)
Attend school
Yes 40 (64.5) 39 (60.9) 0.678
No 22 (35.5) 25 (39.1)
Father’s education
≤High school 28 (45.2) 24 (37.5) 0.383
>High school 34 (54.8) 40 (62.5)
Mother’s education
≤High school 35 (56.5) 29 (45.3) 0.211
>High school 27 (43.5) 35 (54.7)
Annual transfusion requirement (ml/kg/year) 196  82 208  88 0.430
Average serum ferritin (ng/ml) 1033  68 1014  77 0.144
Pretransfusion haemoglobin (g/dl) 8.6  2.0 8.9  2.5 0.458
Liver status
Hepatomegaly 31 (50.0) 42 (65.6) 0.076
No hepatomegaly 31 (50.0) 22 (34.4)
Spleen status
No splenomegaly 34 (54.8) 30 (46.9) 0.364
Splenomegaly 27 (43.5) 34 (53.1)
Splenectomized 1 (1.6) 0 (0.0)
Hepatitis C infection 17 (27.4) 20 (31.3) 0.640
Type of chelation used
No chelation 0 (0.0) 1 (1.6) 0.611
Deferoxamine 11 (17.7) 8 (12.5)
Deferasirox 46 (74.2) 48 (75.0)
Deferiprone 5 (8.1) 7 (10.9)

Note: Data were shown as mean  standard deviation or n (%).

PSYCHOLOGICAL INTERVENTION OF β-THALASSAEMIA CHILDREN 389

intervention group received an additional psychological intervention. T A B L E 4 Changes in Children’s depression inventory scores for
Sixty-two participants in the control group and 68 participants in the participants in control and intervention groups over time

intervention group received the 3 months follow-up assessment. Control Intervention

(n = 62) (n = 64) p Value
Total score
Demographics characteristics of the patients Baseline 23.5  9.3 24.1  10.2 0.731
3 months 24.4  11.5 20.0  11.0* 0.030
The demographics characteristics of the patients in the intervention 6 months 23.0  10.7 19.2  9.8* 0.040
and control groups were shown in Table 2. There were no statistical Anhedonia
differences in the characteristics, including gender, family education,
Baseline 7.6  3.3 7.9  2.9 0.589
transfusion sequence, organ status or type of chelation used
3 months 7.5  3.8 6.0  3.5* 0.023
(all p > 0.05).
6 months 7.8  3.8 6.4  3.3* 0.029
Negative mood
Baseline 5.7  3.0 5.6  3.2 0.857
Changes in QOL scores for participants
3 months 6.1  2.8 4.8  2.4 0.006

Our 3-month psychological intervention significantly improved the 6 months 5.5  3.1 4.2  2.9* 0.017

total score of PedsQoL 4.0 Generic Core Scale immediately after Negative self-esteem
the 3-month intervention (53.7  12.5 vs. 58.3  13.4, p = 0.048) Baseline 4.6  1.7 4.8  1.9 0.534
and 3 months after the end of the intervention (55.1  14.0 3 months 5.0  2.2 4.2  1.6 0.022
vs. 64.7  13.8, p < 0.001) (Table 3). The psychological intervention 6 months 4.4  1.8 3.9  2.1* 0.153
also improved the physical functions of patients in the Ineffectiveness
Baseline 3.7  1.7 4.0  1.6 0.177
3 months 3.9  1.5 3.5  1.7 0.164
T A B L E 3 Changes in quality of life scores for participants in 6 months 3.5  1.9 3.1  1.6* 0.204
control and intervention groups over time
Interpersonal problems
Control Intervention Baseline 1.9  0.8 1.8  0.6 0.430
(n = 62) (n = 64) p Value
3 months 1.9  0.9 1.5  1.0* 0.020
Total score
6 months 1.8  0.9 1.6  0.8 0.190
Baseline 54.3  13.6 52.7  14.1 0.518
Note: Data were shown as mean  standard deviation.
3 months 53.7  12.5 58.3  13.4* 0.048
*p < 0.05 compared with baseline in the same group.
6 months 55.1  14.0 64.7  13.8* **,
<0.001
Physical functioning
Baseline 50.8  16.1 51.2  15.5 0.887 T A B L E 5 Logistic regression analysis of factors predicting poor
quality of life (QOL) and Children’s depression inventory (CDI)
3 months 50.0  15.7 53.4  17.3 0.250
outcomes in the intervention group at 3 months
6 months 49.4  14.5 54.9  16.0 0.045
QOL CDI
Emotional functioning
Attend school (yes)
Baseline 54.8  16.2 53.9  17.3 0.763
OR (95% CI) 0.88 (0.74–1.22) 0.79 (0.66–0.94)
3 months 56.5  15.3 63.1  16.5* 0.022
p Value 0.371 0.044
6 months 57.4  17.1 65.7  17.2* 0.008
Father’s education (>high school)
Social functioning
OR (95% CI) 1.14 (0.63–1.65) 1.32 (0.67–2.04)
Baseline 49.4  12.8 48.8  13.2 0.796
p Value 0.562 0.710
3 months 50.6  11.2 54.9  12.0* 0.040
Mother’s education (>high school)
6 months 51.4  14.1 56.2  11.3* 0.038
OR (95% CI) 0.94 (0.65–1.37) 0.77 (0.47–1.31)
School functioning
p Value 0.649 0.342
Baseline 47.8  16.4 47.5  18.2 0.923
3 months 48.5  15.2 54.8  16.6* 0.028 Abbreviations: CI, confidence intervals; OR, odd ratio.

6 months 49.9  17.1 56.3  16.7* 0.036

Note: Data were shown as mean  standard deviation. intervention group compared to the control group (49.4  14.5
*p < 0.05 compared with baseline in the same group. **p < 0.05 compared vs. 54.9  16.0, p = 0.045). The emotional functioning, social func-
with 3 months in the same group.
tioning and school functioning of children with transfusion-dependent
390
β-thalassaemia were also improved immediately (56.5  15.3
vs. 63.1  16.5, p = 0.022; 50.6  11.2 vs. 54.9  12.0, p = 0.040
and 48.5  15.2 vs. 54.8  16.6, p = 0.028) and at 3 months after the
psychological intervention (57.4  17.1 vs. 65.7  17.2, p = 0.008;
51.4  14.1 vs. 56.2  11.3, p = 0.038; 49.9  17.1 vs. 56.3  16.7,
p = 0.036).
Changes in CDI scores for participants
Our 3-month psychological intervention significantly decreased the
total score of CDI immediately (24.4  11.5 vs. 20.0  11.0,
p = 0.030) and at 3 months after the 3-month intervention
(23.0  10.7 vs. 19.2  9.8, p = 0.040) (Table 4). Our 3-month psy-
chological intervention significantly alleviated the anhedonia and neg-
ative mood of patients with transfusion-dependent β-thalassaemia
immediately (7.5  3.8 vs. 6.0  3.5, p = 0.023; 6.1  2.8
vs. 4.8  2.4, p = 0.006) and 3-months after the psychological inter-
vention (7.8  3.8 vs. 6.4  3.3, p = 0.029; 5.5  3.1 vs. 4.2  2.9,
p = 0.017). The psychological intervention also improved the self-
esteem (p = 0.022) and ameliorated the interpersonal problems
(p = 0.020) among the participants.
Predicting factors for QOL and CDI outcomes
Regression analysis in Table 5 showed that years of education of thal-
assaemia patients was a predicting factor for better CDI outcomes
(odd ratio = 0.79, p = 0.044). On the other hand, either parent’s edu-
cation level was not a predicting factor for either QOL or CDI out-
comes of thalassaemia patients.
DISCUSSION
In this study, we focused on the mental health of patients aged
12–18 years with β-thalassaemia. We conducted a 3-month psycho-
logical intervention on adolescent patients with β-thalassaemia who
suffered from blood transfusion dependence and evaluated the QOL
and mental state of these children immediately after the psychological
intervention and at 3 months later. Our results showed that our
3-month psychological intervention significantly improved the total
score of the PedsQoL 4.0 Generic Core Scale immediately after and at
3 months after the end of the intervention. In addition, the total score
of CDI was also significantly decreased immediately after and at
3 months after the end of the intervention.
Patients with β-thalassaemia are unable to produce effective red
blood cells due to insufficient haemoglobin synthesis and often suffer
from chronic hypoxia. Patients with β-thalassaemia usually develop
severe anaemia (haemoglobin level <70 g/L), pale complexion and
lethargy within 1 year of age [22]. Red blood cell infusion can effec-
tively improve the symptoms of anaemia. At present, it is clinically
believed that regular infusion of red blood cells can maintain the
WANG ET AL.
haemoglobin level of patients with thalassaemia between 90 and
120 g/L, which is beneficial to improve their QOL, as well as growth
and development, and significantly reduce the economic burden of
patients and their family [23].
Adverse reactions of blood transfusion are the main side effects
of blood transfusion therapy for patients with transfusion-dependent
β-thalassaemia [24]. Red blood cell preparations can cause red blood
cell damage and accumulation of certain non-cellular components dur-
ing storage, which aggravates with prolonged storage [25]. Accumu-
lating evidence has demonstrated that 2,3-DPG and ATP
consumption, red blood cell deformability and oxygen-carrying capac-
ity damage, consumption of lactic acid and potassium ions produced
by red blood cells stored for more than 2 weeks can cause various
adverse reactions after blood transfusion [26]. Serious adverse reac-
tions of blood transfusion in patients with thalassaemia include head-
ache, convulsions, cerebral haemorrhage, fever and rash.
Children with β-thalassemia begin to receive blood transfusion
treatment from infancy and early childhood. Chronic disease state and
the pressure of long-term disease directly affect their psychological
behaviour and development of personality [27]. A study among chil-
dren with thalassaemia found that these children tend to be
introverted and emotionally unstable in their personality characteris-
tics, which were mainly manifested as being alone, withdrawn, indif-
ferent to others, inactive, socially passive, low self-confidence,
sensitive, depressed, insomnia, anxiety, depression, etc [28]. Psycho-
logical counselling and psychological maintenance based on the per-
sonality characteristics of children with β-thalassaemia, as well as
cultivating their personal abilities related to their psychological flexi-
bility, are important measures to inspire children to disperse negative
emotions and overcome difficulties. Most scholars at home and
abroad have focused their attention on the treatment and diagnosis
of thalassaemia, and there are few studies on the psychological and
behavioural characteristics of children with β-thalassaemia [29].
Therefore, alleviating the children’s negative emotions through psy-
chological flexibility, helping the children to recover, rebuilding their
confidence in life and promoting physical and mental health should
also be the focus of medical practitioners today [30, 31].
Psychological intervention, although limited in clinical treatment,
is essential for children with β-thalassaemia. Previous studies have
shown that resilience plays a protective role in coping with the stress
resulted from this disease, which improves the psychology of children
with β-thalassaemia [32]. It has also been reported that the allocation
of a specific ward with easy access to health care staff and social sup-
port for patients may contribute to the moderate to good self-efficacy
in children with thalassaemia, and better self-confidence is conducive
to their improved physical condition [33]. In this study, we also
employed various methods to improve the mental state of children.
We provided β-thalassaemia patients with additional disease and
treatment-related education to reduce their anxiety about the disease.
We also helped them control social and family pressure, and relax
through distractions and other methods. We guided them to identify
their negative emotions, scheduled pleasant activities and encouraged
them to develop new hobbies to distract their attention through the
PSYCHOLOGICAL INTERVENTION OF β-THALASSAEMIA CHILDREN
psychological intervention. We also encouraged them to accept their
imperfections and let them understand that even if they were not per-
fect, they could still do a lot of meaningful things. In the end, our
3-month intervention achieved a significant psychological treatment
effect.
In fact, this study also has some limitations. First, we only rec-
ruited 143 participants in our research due to resource and time con-
straints. The limited sample size may affect the accuracy of our study.
We will conduct multi-centre joint research and expand the sample
pool size to obtain more statistically significant clinical data. Second,
the participants recruited often suffered from other chronic diseases
in addition to β-thalassaemia due to their dysplasia and side effects of
transfusion. The combined medications and other treatment behav-
iours might affect their psychological status and subsequently the
accuracy of our results. These issues need to be addressed in future
research.
In conclusion, we hereby report the alleviating effects of a
3-month psychological intervention on the life quality and psychologi-
cal status of adolescent patients with transfusion-dependent β-thalas-
saemia. The 3-month psychological intervention significantly
improved the PedsQoL 4.0 Generic Core Scale and the psychological
status, and alleviated the depression of paediatric patients with
transfusion-dependent β-thalassaemia, likely by attenuating their
anhedonia, negative mood and negative self-esteem.
CONF LICT OF IN TE RE ST
The authors declare that they have no conflicts of interest.
AUTHOR CONTRIBUTIONS
M.W., M.H. and Y.H. did the experiments, collected and analyzed
the data, wrote the manuscript. M.W. and Y.H. conceived the study.
Y.H. supervised the study.
ORCID
Yijin Hong https://orcid.org/0000-0003-2789-6508
RE FE R ENC E S
1. Origa R. beta-Thalassemia. Genet Med. 2017;19:609–19.
2. Galanello R, Origa R. beta-Thalassemia. Orphanet J Rare Dis. 2010;
5:11.
3. Muncie HL Jr, Campbell J. Alpha and beta thalassemia. Am Fam
Physician. 2009;80:339–44.
4. Cao A, Galanello R. beta-Thalassemia. Genet Med. 2010;12:61–76.
5. Asadov C, Alimirzoeva Z, Mammadova T, Aliyeva G, Gafarova S,
Mammadov J. beta-Thalassemia intermedia: a comprehensive over-
view and novel approaches. Int J Hematol. 2018;108:5–21.
6. Caocci G, Efficace F, Ciotti F, Roncarolo MG, Vacca A, Piras E, et al.
Prospective assessment of health-related quality of life in pediatric
patients with beta-thalassemia following hematopoietic stem cell
transplantation. Biol Blood Marrow Transplant. 2011;17:861–6.
7. Alonso L, Gonzalez-Vicent M, Belendez C, Badell I, Sastre A,
Rodríguez-Villa A, et al. Hematopoietic stem cell transplantation in
pediatric patients with thalassemia and sickle cell disease: an
experience of the Spanish Working Group for Bone Marrow
Transplantation in Children (GETMON). Med Clin (Barc). 2019;
152:135–40.
391
8. Schaar DA, Pirsl F, Holtzman N, Steinberg SM, Nashed J, Ruben C,
et al. Subsequent cancers in patients affected with moderate or
severe chronic graft-versus-host disease. Transplant Cell Ther. 2021.
https://doi.org/10.1016/j.jtct.2021.08.001
9. Yoshimura K, Kimura SI, Kawamura M, Kawamura S, Takeshita J,
Yoshino N, et al. Chronic liver graft-versus-host disease in allogeneic
hematopoietic stem cell transplantation recipients during tapering or
after stopping calcineurin inhibitors. Int J Hematol. 2021. https://doi.
org/10.1007/s12185-021-03202-x
10. de Dreuzy E, Bhukhai K, Leboulch P, Payen E. Current and future
alternative therapies for beta-thalassemia major. Biom J. 2016;39:
24–38.
11. Manara R, Ponticorvo S, Perrotta S, Barillari MR, Costa G, Brotto D,
et al. Auditory cortex hypoperfusion: a metabolic hallmark in Beta
thalassemia. Orphanet J Rare Dis. 2021;16:349.
12. Shamsi A, Amiri F, Ebadi A, Ghaderi M. The effect of partnership care
model on mental health of patients with thalassemia major. Depress
Res Treat. 2017;2017:3685402.
13. Bardach NS, Burkhart Q, Richardson LP, Roth CP, Murphy JM,
Parast L, et al. Hospital-based quality measures for pediatric mental
health care. Pediatrics. 2018;141:e20173554.
14. Nahata L, Quinn GP, Caltabellotta NM, Tishelman AC. Mental health
concerns and insurance denials among transgender adolescents.
LGBT Health. 2017;4:188–93.
15. Cayabyab CR, O’Reilly P, Murphy AM, O’Gorman C. Psychological
morbidity among forcibly displaced children-a literature review. Ir J
Med Sci. 2020;189:991–7.
16. Hakeem GLA, Mousa SO, Moustafa AN, Mahgoob MH, Hassan EE.
Health-related quality of life in pediatric and adolescent patients
with transfusion-dependent ss-thalassemia in upper Egypt (single
center study). Health Qual Life Outcomes. 2018;16:59.
17. Mettananda S, Pathiraja H, Peiris R, Bandara D, de Silva U,
Mettananda C, et al. Health related quality of life among children
with transfusion dependent beta-thalassaemia major and
haemoglobin E beta-thalassaemia in Sri Lanka: a case control study.
Health Qual Life Outcomes. 2019;17:137.
18. Alzahrani RA, Almutairi OM, Alghoraibi MS, Alabdulwahed MS,
Abaalkhail MK, Alhawish MK, et al. Quality of life in transfusion-
dependent thalassemia patients. J Taibah Univ Med Sci. 2017;12:
465–70.
19. Erden S, Kuskonmaz BB, Cetinkaya DU, Ünal F, Özsungur B. Pediat-
ric bone marrow transplantation: psychopathologic features in recipi-
ents along with siblings. Psychooncology. 2019;28:1995–2001.
20. Adam S, Afifi H, Thomas M, Magdy P, el-Kamah G. Quality of life
outcomes in a pediatric thalassemia population in Egypt. Hemoglo-
bin. 2017;41:16–20.
21. Watson HJ, Egan SJ, Limburg K, Hoiles KJ. Normative data for
female adolescents with eating disorders on the Children’s Depres-
sion Inventory. Int J Eat Disord. 2014;47:666–70.
22. Thein SL. Molecular basis of beta thalassemia and potential thera-
peutic targets. Blood Cells Mol Dis. 2018;70:54–65.
23. Karimi M, Cohan N, De Sanctis V, Mallat NS, Taher A. Guidelines for
diagnosis and management of beta-thalassemia intermedia. Pediatr
Hematol Oncol. 2014;31:583–96.
24. Frazier SK, Higgins J, Bugajski A, Jones AR, Brown MR. Adverse reac-
tions to transfusion of blood products and best practices for preven-
tion. Crit Care Nurs Clin North Am. 2017;29:271–90.
25. Raval JS, Griggs JR, Fleg A. Blood product transfusion in adults: indi-
cations, adverse reactions, and modifications. Am Fam Physician.
2020;102:30–8.
26. Semple JW, Rebetz J, Kapur R. Transfusion-associated circulatory
overload and transfusion-related acute lung injury. Blood. 2019;133:
1840–53.
27. Elzaree FA, Shehata MA, El Wakeel MA, El-Alameey IR, AbuShady MM,
Helal SI. Adaptive functioning and psychosocial problems in children
392
with beta thalassemia major. Open Access Maced J Med Sci. 2018;6:
2337–41.
28. Gharaibeh H, Amarneh BH, Zamzam SZ. The psychological burden of
patients with beta thalassemia major in Syria. Pediatr Int. 2009;51:630–6.
29. Thanarattanakorn P, Louthrenoo O, Sittipreechacharn S,
Sanguansermsri T. Family functioning in children with thalassemia.
Clin Pediatr (Phila). 2003;42:79–82.
30. Anie KA, Massaglia P. Psychological therapies for thalassaemia.
Cochrane Database Syst Rev. 2014;2014:CD002890.
31. Ul Hassan Rashid MA, Abbasi SS, Manzoor MM. Socio-religious
prognosticators of psychosocial burden of beta thalassemia major.
J Relig Health. 2020;59:2866–81.
32. Parviniannasab AM, Rakhshan M, Momennasab M, Soltanian M, Bijani M.
The relationship between coping strategies and resilience among
WANG ET AL.
adolescents with beta-thalassemia major. J Child Adolesc Psychiatr Nurs.
2021. https://doi.org/10.1111/jcap.12339
33. Baghersalimi A, Darbandi B, Kazemnezhad Leyli E, Kamran
Mavardiani Z, Ahmad Sharbafi M, Rezasefat Balesbaneh A. Evalua-
tion of self-efficacy in children and adolescents with thalassemia
major. J Pediatr Hematol Oncol. 2021;43:e754–8.
How to cite this article: Wang M, Huang M, Hong Y.
Psychological intervention in children with transfusion-
dependent β-thalassaemia. Vox Sang. 2022;117:386–92.
Received: 5 May 2021 Revised: 25 August 2021 Accepted: 31 August 2021

DOI: 10.1111/vox.13205

ORIGINAL ARTICLE

Profile of the single-use, multiple-pass protein A adsorber

column in immunoadsorption

Nadine Schossee1 | Gabriele Veit1 | Julia Gittel1 | Johannes Viebahn1 |

Marius Niklaus1 | Philipp Klingler1 | Nurcan Üçeyler2 | Erdwine Klinker1 |
Anna Kobsar1 | Markus Boeck1 | Juergen Koessler1

1
Institute of Transfusion Medicine and
Haemotherapy, University of Wuerzburg,
Wuerzburg, Germany
2
Department of Neurology, University of
Wuerzburg, Wuerzburg, Germany
Correspondence
Juergen Koessler, Institute of Transfusion
Medicine and Haemotherapy, University
of Wuerzburg, Oberduerrbacher Straße
6, D-97080 Wuerzburg, Germany.
Email: koessler_j@ukw.de
Funding information
None
Abstract
Background and Objectives: Immunoadsorptions (IA) are used to remove autoanti-
bodies from the plasma in autoimmune disorders. In this study, we evaluated the
effects of a single-use, recombinant staphylococcal protein A-based immunoadsorber
on blood composition of the patient.
Materials and Methods: In a cohort of patients with myasthenia gravis or stiff-person
syndrome, essential parameters of blood cell count, coagulation, clinical chemistry or
plasma proteins and immunoglobulins (Ig) were measured before and after IA (n = 11).
Results: In average, IA reduced the levels of total IgG, IgG1, IgG2 and IgG4 by
approximately 60%, the acetylcholine receptor autoantibody levels by more than
70%. IgG3, IgA or IgM were diminished to a lower extent. In contrast to fibrinogen or
other coagulation factors, the column markedly removed vitamin K-dependent coag-
ulation factors II, VII, IX and X by approximately 40%–70%. Accordingly, international
normalized ratio and activated partial thromboplastin time were increased after IA by
59.1% and 32.7%, respectively. Coagulation tests almost returned to baseline values
within 24 h. Blood cell count, electrolytes, total protein or albumin were not essen-
tially affected. No clinical events occurred.
Conclusion: The single-use, multiple-pass protein A adsorber column is highly effi-
cient to remove IgG1, IgG2 and IgG4 or specific acetylcholine receptor autoanti-
bodies from the plasma. Coagulation parameters should be monitored, since the
column has the capacity to largely reduce vitamin K-dependent factors.

KEYWORDS
apheresis technologies, apheresis-therapeutic, blood processing, haemostasis, plasma

I N T R O D U CT I O N depletion of autoantibodies is associated with clinical benefits, for

example, in several neurological disorders like crisis of myasthenia
The removal of autoantibodies from plasma is an option for the treat- gravis caused by acetylcholine receptor antibodies or stiff-person-
ment of patients with severe autoimmune-mediated diseases [1]. The syndrome triggered by glutamic acid decarboxylase antibodies [2–5].

This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any
medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.
© 2021 The Authors. Vox Sanguinis published by John Wiley & Sons Ltd on behalf of International Society of Blood Transfusion.

Vox Sanguinis. 2022;117:393–398. wileyonlinelibrary.com/journal/vox 393

394
For that purpose, therapeutic plasma exchanges (TPE) or
immunoadsorptions (IA) can be used as technical procedures [1, 3]. In
both, plasma separation can be performed by membrane filtration or
centrifugation. In TPE, plasma is unselectively wasted and substituted
by albumin, electrolyte solutions or fresh-frozen plasma. In IA, plasma
is redirected to the patient after passing an adsorber column for the
elimination of autoantibodies without the need of additional fluid sub-
stitution. A number of adsorber columns have been developed for
clinical use, characterized by different affinities and efficacies [6].
Immune adsorber columns can be designed for single-use or for
regenerative use, designed as single-column or a double-column sys-
tem. Recently, a single-use, multiple-pass immunoadsorber based on
recombinant staphylococcal protein A as ligand became available for
clinical practice [7].
For the estimation of potential adverse effects, it is important to
analyse the impact of the novel column on blood composition. The
aim of this study was to investigate the performance of IA with the
column focusing on blood count, coagulation, plasma proteins and
clinical chemistry parameters before and after the procedures in a
cohort of patients with myasthenia gravis or stiff-person-syndrome.
MATERIALS AND METHODS
In total, 16 IA procedures were performed in seven patients with
autoimmune-mediated neurological disorders (six patients with myas-
thenia gravis, one patient with stiff-person-syndrome) during their
treatment series. The preanalytical requirements for the projected lab-
oratory investigations were met in 11 IA procedures, which were
included in the study. Detailed characteristics of patients are listed in
Table 1.
The study was performed according to the Declaration of Helsinki
and approved by the local ethics committee of the university of
Wuerzburg (approval number 256/12). All participants provided their
written informed consent.
Contraindications for IA according to the manufacturer’s instruc-
tions like severe cardiovascular diseases or acute systemic infections
were ruled out. The patients had no history of bleeding episodes, no
current surgical interventions or fresh wounds. Platelet counts were
within the normal range.
IA were performed with the single-use, regenerative, multiple-
pass protein A adsorber column (Ligasorb, Fresenius Medical Care
AG & Co. KGaA, Bad Homburg, Germany) connected with the
ADAsorb device (Medicap Clinic GmbH, Ulrichstein, Germany) follow-
ing the manufacturers´ instructions. In this column, the ligand, recom-
binant staphylococcal protein A, is covalently bound to the matrix
consisting of polymethacrylate beads. During the procedure, the col-
umn is initially loaded with plasma enabling the attachment of immu-
noglobulins (Ig) to protein A. Processed plasma is redirected to the cell
separator and finally back to the patient. In a consecutive regenera-
tion step, plasma is displaced and immunoglobulins are eluted from
the column. Fluids from elution are discarded. These cycles are
SCHOSSEE ET AL.
performed repeatedly, automatically controlled by the ADAsorb
device, allowing the treatment of several litres plasma volume [7].
Plasma was generated by the cell separator Spectra Optia
(Terumo BCT, Lakewood, CO). Plasma volume was calculated using
nomograms considering height, weight and haematocrit [8]. As target
of the IA, approximately one and a half of the calculated patient’s
plasma volume was processed by the column and redirected to the
patient. The ratio of anticoagulant (anticoagulant citrate dextrose
solution A) to inlet blood volume was 1:12.
Directly before and 15 min after finalization of the IA, blood sam-
ples were drawn from a peripheral vein for the analysis of blood com-
position. The samples were collected in appropriate tubes (Sarstedt,
Nuembrecht, Germany) containing 3.2% citrate buffer (106 mM
trisodium citrate) for the analysis of coagulation parameters or con-
taining 1.6 mg/ml ethylenediaminetetraacetic acid for blood cell
count. Tubes without anticoagulant served for the analysis of plasma
proteins and immunoglobulins. The tubes were directly sent to the
laboratory for further processing.
Blood cell count was performed with the haematology analyser
Sysmex KX-21 N (Sysmex Europe GmbH, Norderstedt, Germany).
Coagulation parameters were determined on a BCS XP analyser
(Siemens Healthcare Diagnostics, Marburg, Germany), clinical chemis-
try and plasma proteins on Roche cobas analysers (Roche Diagnostics
GmbH, Mannheim, Germany) using appropriate reagents. Acetylcho-
line receptor autoantibodies were measured by a specific
radioimmunoassay.
Statistical analysis
Descriptive and statistical data were calculated with the GraphPad
PRISM 7 programme (GraphPad Software, San Diego, CA). Data distri-
bution analysis was performed with the Shapiro–Wilk test. Differ-
ences of variances between groups were analysed by one-way
analysis of variance or by paired Student’s t-test as appropriate.
p < 0.01 was considered statistically significant.
RE SU LT S
Performance of IA with the single-use, multiple-pass
protein A adsorber
The mean duration of the IAs was 295  35 min resulting in the mean
processed volume of 183  24.7% in relation to the patients´ plasma
volume (Table 2). The administered citrate solution was 1038  132 ml.
Adverse clinical events did not occur, the procedures were well tolerated
by the patients.
Before hospital stay, the disease-specific symptoms had increased
in all patients despite drug therapy providing the indication for aphe-
resis treatment to alleviate immobility and severe pain or to avoid
mechanical ventilation (in the case of myasthenia gravis). The patients
 PROFILE OF PROTEIN A ADSORBER COLUMN 395

TABLE 2 Details on performed immunoadsorption

Abbreviations: A, azathioprine; AChR, acetylcholine receptor; B, benzodiazepine; C, cyclosporin; IA, immunoadsorption; M, mycophenolate mofetil; MuSK, muscle-specific kinase; O, opioid; P, pyridostigmine; S,
IA-TPE-IA-TPE-TPE
IA-IA-IA-TPE-TPE
Number of procedures 11

Note: The patients received a series of apheresis treatments, in individual combinations of IA and TPE. IA procedures indicated by bold letters were included into the evaluation (n = 11). Other IA were not
Processed volume (ml) (mean  SD) 5486  744

IA-IA-TPE-IA
treatments

IA-TPE-IA

IA-IA-TPE
Processed volume/plasma volume (%) (mean  SD) 183  24.7
Series of

IA-IA
IA-IA
Citrate volume (ml) (mean  SD) 1038  132
Mean duration (min) (mean  SD) 295  35.4
Vein access central/peripheral 0/11
Adverse events None
(days)
Time

9
17
substantially recovered from symptoms after completed series of
Specific

M, P, S
A, P, S
drugs

treatments consisting of an individual combination of IA and TPE as

M, P

M, P
B, O

A, P

C, P
depicted in Table 1. In the clinical course, none of the patients
required mechanical ventilation. The time period from starting aphere-
sis procedures until discharge from hospital was 3 to 17 days.
Ocular impairment, dysphagia,

Ocular impairment, dysphagia,

Ocular impairment, muscle

Muscle weakness, ocular

Muscle rigidity, cramps

Immunoglobulins and proteins

Dysarthria, dysphagia
Dysarthria, dysphagia
muscle weakness

muscle weakness
Main symptoms

impairment

In eight of the procedures with patients suffering from myasthenia

weakness

gravis, measurable levels of acetylcholine receptor antibodies were

included in the study, since it was not possible to ascertain the preanalytical requirements for laboratory analysis at every time.

detected before IA, with a wide range from 0.2 nmol/L to almost
30 nmol/L. In each individual, the IA led to a substantial reduction of
the autoantibody level as depicted in Figure 1. In average, the level
steroid; time, time from starting apheresis treatment until discharge from hospital; TPE, therapeutic plasma exchange.

dropped by 70.3% (Table S1). The total amount of immunoglobulins

antibodies

was depleted by 58.9%. Regarding the immunoglobulin subclasses, IA

MuSK

diminished IgG, IgG1, IgG2 and IgG4 by approximately 60% or more

Auto-

AChR

AChR

AChR

AChR
AChR

(Figure 2). The reductive effect was less prominent for IgG3, IgA or
—

IgM with approximately 20%–40%, and similarly weak for the comple-
ment factors 3 and 4 (Table S1).
Myasthenia gravis

Myasthenia gravis

Myasthenia gravis

Myasthenia gravis

Myasthenia gravis
Myasthenia gravis

The total protein concentration of plasma showed lower values

syndrome
Stiff-person-

after the procedure, for albumin by 14.7% and for total protein by
Diagnosis

22%, presumably caused by the dilutive effect of administered citrate

solutions with more than 1 L during the IA rather than column-
dependent depletion (Table S1).
Estimated patient

Blood cell count and clinical chemistry

volume (ml)
plasma

2100

3400

2200

3200

3400

2700
4000

Blood cell count remained stable during the IA, except for a small
Characteristics of treated patients

decrease of platelets from 216  40 103/μl to 184  40 103/μl

(Table S2). Remarkably, the leukocyte levels remained unchanged.
Parameters of clinical chemistry were not relevantly affected. The
weight (kg)

increase of total calcium from 2.3  0.1 to 2.8  0.2 mmol/L is

Body

explained by continuous administration of low-dose calcium during

53

80

60

79

79

60
92

the IA, added into the line back to the patient.

22/female

60/female

31/female

50/female
77/male

51/male

72/male
(years)/
gender

Coagulation factors
Age
TABLE 1

The global coagulation tests showed distinct deviations after the pro-
Patient

cedures (Table S3). In average, values of international normalized ratio

1

6
7

(INR) rose by 59.1%. Activated partial thromboplastin time (aPTT)

396
F I G U R E 1 Reductive effect of immunoadsorption (IA) on
acetylcholine receptor antibody levels. The individual autoantibody
levels in patients with myasthenia gravis before and after IA are
shown; n = 8
F I G U R E 2 Depletion of plasma proteins and immunoglobulins by
immunoadsorption (IA). The relative reduction after IA is shown for
each parameter as mean  SD (in % related to the value before IA).
*p < 0.01 (compared to IgG3, IgA, IgM, C3, C4, TP or alb); #p < 0.01
(compared as indicated); n = 11. AChR, acetylcholine receptor
antibody; alb, albumin; C3, complement factor 3; C4, complement
factor 4; Ig, immunoglobulin; TP, total protein
developed a prolongation from 34.7  5.8 s to 45.8  8.2 s. Fibrino-
gen (factor I) was only slightly reduced by approximately 25% from
2.24  0.35 g/L to 1.71  0.49 g/L, comparable to the coagulation
factors V, VIII, XI, XII, XIII or to the von Willebrand parameters
(Table S3). In contrast, the vitamin K-dependent coagulation factors
showed a pronounced reduction, with factor II by almost 67%, factor
VII by 51%, factor IX by 42% and factor X by 66% as outlined in
Figure 3. The d-dimer levels were generally very low with stable
values after the IA.
SCHOSSEE ET AL.
F I G U R E 3 Reduction of coagulation factors by
immunoadsorption (IA). The relative reduction after IA is shown for
different coagulation factors as mean  SD (in % related to the value
before IA). *p < 0.01 (compared to all parameters with the exception
of factors II and X); #p < 0.01 (compared to all parameters with the
exception of factors II, VII and X); p < 0.01 (compared to all
parameters with the exception of factors II, VII, IX and X); n = 11
In six patients, the following IA was performed the next day
(16–20 h after the initial IA). In these cases, before starting IA, the
analysis of blood coagulation revealed an increase of factors II, VII, IX
and X to values within or close to the reference range (Figure S1). In
addition, INR values recovered from 1.65  0.13 to 1.16  0.10. aPTT
returned to remarkably lower values from 43.8  4.9 s to 34.9  6.0 s
in average. According to liver enzymes and to liver synthesis parameters,
the six patients had no impairment of liver function. The increase of fibrin-
ogen was less emphasized from 1.75  0.56 g/L to 2.20  0.50 g/L.
DI SCU SSION
In accordance to a previous report by Sufke et al. [7], the single-use,
multiple-pass protein A adsorber column has proved to be highly effi-
cient to remove immunoglobulins of type IgG1, IgG2 and IgG4 from
the plasma, with a reduction of approximately 60% after performance
of a single IA. The depletion rate for specific acetylcholine receptor
autoantibodies was more than 70% and is comparable to the charac-
teristics of the tryptophan immune adsorber [9, 10].
There were no adverse clinical effects associated with the per-
formed IA and no technical problems occurred. The number of proce-
dures provided sufficient and consistent data on effects related to
blood composition. However, further trials with larger patient cohorts
are required to obtain profound evidence for the safety profile of the
column.
The adsorber as a single-use device is favourable to patients
requiring only few treatment sessions without need of recurrent ther-
apy due to lower costs. In contrast to the tryptophan immune
adsorber with limited loading volumes [11], the single-use, multiple-
pass protein A adsorber column is technically able to process large
amounts of plasma. However, the intermittent regeneration cycles of
the single column contribute to time-consuming procedures. The long
PROFILE OF PROTEIN A ADSORBER COLUMN
duration of IA with almost 6 h should be considered as a disadvantage
and could, for example, raise problems with peripheral vein access.
Regarding the influence on blood composition, the blood cell
count or the electrolyte levels were not essentially tampered by the
IA. The slightly reduced levels of albumin or other plasma proteins by
10%–20% may be interpreted as a dilutive effect, since a large volume
of citrate solution (with more than 1 L) was administered during the
procedures. Benny et al. showed that IA using protein A agarose col-
umns do not relevantly remove albumin [12], similarly to IA with tryp-
tophan immune adsorber column [13].
Since anticoagulation is required for extracorporeal circuits, the
occurrence of bleeding complications is a major concern [14]. In TPE,
the removal of coagulation factors is a limitation of treatment fre-
quencies or exchanged plasma quantities unless wasted plasma is at
least partially substituted by fresh-frozen plasma [15, 16]. In this con-
text, the redirection of the patient’s plasma from the column without
need for substitution is an important advantage of IA.
Although efficacious for the removal of autoantibodies, IA with
tryptophan immune adsorber were associated with the strong
depletion of fibrinogen [11, 17]. In this case, fibrinogen obviously
exerts strong hydrophobic and electrostatic interactions with the
tryptophan’s bulky indole ring [18]. The single-use, multiple-pass
protein A adsorber column has only weak effects on fibrinogen
levels, with an average reduction of 25%, which is most likely cau-
sed by dilution and in line with the recent study by Sufke et al. [7]. A
low impact on fibrinogen levels have also been reported for other
adsorbers using the ligand protein A from Staphylococcus aureus,
sheep antibodies against human IgG or the specific oligopeptide
Gam 146 [19].
However, IA with the investigated column led to deviations of
the global coagulation tests, INR and aPTT. The analysis of single fac-
tors revealed that the depletion of vitamin K-dependent coagulation
factors II, VII, IX and X by approximately 40%–70% is responsible for
that phenomenon. In contrast, other coagulation factors were only
diminished by 20%, compatible with the dilutive effect as described.
The molecular mechanisms in the column contributing to the
reduction of vitamin K-dependent coagulation factors was not subject
of this study and deserves further experimental investigations. For
example, the depletion could refer to γ-carboxyglutamic acid residues
as a typical characteristic of these proteins [20], but the adherence to
surfaces is dependent on complex interactions between plasma pro-
teins and the column matrix. Interestingly, the use of an adsorber with
polymethacrylate-bound albumin for endotoxin elimination led to pro-
longation of aPTT [21]. These processes could be influenced by elec-
trostatic, hydrophobic characteristics of the protein or mediated by
specific-site binding. In addition, the nature of protein A, in this case
as a recombinant protein, may have an influence on binding
characteristics.
The kind of anticoagulant or chemical properties of the plasma
like the pH value or the calcium ion concentration may also interfere
with binding [22]. In this regard, it would also be of interest to exam-
ine protein C and S, as further vitamin K-dependent coagulation
factors.
397
As a practical approach in patient care, the global coagulation
tests should be monitored during IA therapies with single-use,
multiple-pass protein A adsorber, especially before invasive diagnostic
or therapeutic procedures. In patients without liver dysfunction, the
recovery of the coagulation system may be expected within 24 h
since the values of vitamin K-dependent factors, aPTT and INR almost
returned to baseline values in this time span.
AC KNOW LEDG EME NT S
The authors wish to thank their colleagues of the Institute of Transfu-
sion Medicine and Haemotherapy, of the Central Laboratory and of
the Department of Neurology, University of Wuerzburg, for patient
management and support.
CONFLIC T OF INT ER E ST
The authors declare that there is no conflict of interest .
AUTHOR CONTRIBU TIONS
N.S. contributed to the research design, acquisition of data, analysis
and interpretation of data. G.V., J.G., J.V., M.N. and P.K. contributed
to the acquisition of data. N.Ü. and E.K. contributed to the drafting
and revising the paper. A.K. contributed to the analysis and interpreta-
tion of data. M.B. contributed to the research design, drafting and
revising the paper. J.K. contributed to the research design, analysis
and interpretation of data, drafting and revising the paper.
ORCID
Juergen Koessler https://orcid.org/0000-0001-8400-9552
RE FE RE NCE S
1. Padmanabhan A, Connelly-Smith L, Aqui N, Balogun RA, Klingel R,
Meyer E, et al. Guidelines on the use of therapeutic apheresis in clini-
cal practice - evidence-based approach from the Writing Committee
of the American Society for apheresis: the eighth special issue. J Clin
Apher. 2019;34:171–354.
2. Schröder A, Linker RA, Gold R. Plasmapheresis for neurological disor-
ders. Expert Rev Neurother. 2009;9:1331–9.
3. Klingel R, Heibges A, Fassbender C. Neurologic diseases of the central
nervous system with pathophysiologically relevant autoantibodies–
perspectives for immunoadsorption. Atheroscler Suppl. 2013;14:161–5.
4. Klingel R, Heibges A, Fassbender C. Plasma exchange and immuno-
adsorption for autoimmune neurologic diseases - current guidelines and
future perspectives. Atheroscler Suppl. 2009;10:129–32.
5. Kohler W, Bucka C, Klingel R. A randomized and controlled study
comparing immunoadsorption and plasma exchange in myasthenic
crisis. J Clin Apher. 2011;26:347–55.
6. Sanchez AP, Cunard R, Ward DM. The selective therapeutic aphere-
sis procedures. J Clin Apher. 2013;28:20–9.
7. Sufke S, Lehnert H, Uhlenbusch-Körwer I, Gebauer F. Safety aspects
of immunoadsorption in IgG removal using a single-use, multiple-
pass protein A immunoadsorber (LIGASORB): clinical investigation in
healthy volunteers. Ther Apher Dial. 2017;21:405–13.
8. Sprenger KB, Huber K, Kratz W, Henze E. Nomograms for the pre-
diction of patient’s plasma volume in plasma exchange therapy from
height, weight, and hematocrit. J Clin Apher. 1987;3:185–90.
9. Yoshida M, Tamura Y, Yamada Y, Yamawaki N, Yamashita Y. Immu-
sorba TR and Immusorba PH: basics of design and features of func-
tions. 1998. Ther Apher. 2000;4:127–34.
398
10. Shibuya N, Sato T, Osame M, Takegami T, Doi S, Kawanami S.
Immunoadsorption therapy for myasthenia gravis. J Neurol Neu-
rosurg Psychiatry. 1994;57:578–81.
11. Koessler J, Kobsar A, Kuhn S, Koessler A, Yilmaz P, Weinig E, et al.
The effect of immunoadsorption with the Immusorba TR-350 col-
umn on coagulation compared to plasma exchange. Vox Sang. 2015;
108:46–51.
12. Benny WB, Sutton DM, Oger J, Bril V, McAteer MJ, Rock G. Clinical
evaluation of a staphylococcal protein A immunoadsorption system
in the treatment of myasthenia gravis patients. Transfusion. 1999;
39:682–7.
13. Yeh JH, Chiu HC. Comparison between double-filtration plasmaphe-
resis and immunoadsorption plasmapheresis in the treatment of
patients with myasthenia gravis. J Neurol. 2000;247:510–3.
14. Kaplan A. Complications of apheresis. Semin Dial. 2012;25:
152–8.
15. Weinstein R. Hypocalcemic toxicity and atypical reactions in thera-
peutic plasma exchange. J Clin Apher. 2001;16:210–1.
16. Shunkwiler SM, Pham HP, Wool G, Ipe TS, Fang DC, Biller E, et al.
The management of anticoagulation in patients undergoing thera-
peutic plasma exchange: a concise review. J Clin Apher. 2018;33:
371–9.
17. Fadul JE, Danielson BG, Wikström B. Reduction of plasma fibrinogen,
immunoglobulin G, and immunoglobulin M concentrations by
immunoadsorption therapy with tryptophan and phenylalanine
adsorbents. Artif Organs. 1996;20:986–90.
18. Hatanaka Y, Tsukiji M, Itoh A, Haruyama T. Selective adsorption of
immunoglobulin G and immunoglobulin M from plasma without
SCHOSSEE ET AL.
adsorption of fibrinogen by using thienyl amino acids as ligands.
J Chromatogr Separat Techniq. 2013;4:6.
19. Zollner S, Pablik E, Druml W, Derfler K, Rees A, Biesenbach P.
Fibrinogen reduction and bleeding complications in plasma exchange,
immunoadsorption and a combination of the two. Blood Purif. 2014;
38:160–6.
20. Furie B, Furie BC. Molecular and cellular biology of blood coagula-
tion. N Engl J Med. 1992;326:800–6.
21. Ullrich H, Jakob W, Fröhlich D, Rothe G, Prasser C, Drobnik W, et al.
A new endotoxin adsorber: first clinical application. Ther Apher.
2001;5:326–34.
22. Nelsestuen GL, Ostrowski BG. Membrane association with multiple
calcium ions: vitamin-K-dependent proteins, annexins and
pentraxins. Curr Opin Struct Biol. 1999;9:433–7.
SUPPORTING INF ORMATION
Additional supporting information may be found in the online version
of the article at the publisher’s website.
How to cite this article: Schossee N, Veit G, Gittel J,
Viebahn J, Niklaus M, Klingler P, et al. Profile of the single-use,
multiple-pass protein A adsorber column in
immunoadsorption. Vox Sang. 2022;117:393–8.
Received: 2 April 2021 Revised: 8 July 2021 Accepted: 12 July 2021

DOI: 10.1111/vox.13184

ORIGINAL ARTICLE

Comparison between tube test and automated column

agglutination technology on VISION Max for anti-A/B
isoagglutinin titres: A multidimensional analysis

Minjeong Nam1 | Mina Hur1 | Hyunkyung Lee1 | Hanah Kim1 |

Mikyoung Park2 | Hee-Won Moon1 | Yeo-Min Yun1

1
Department of Laboratory Medicine,
Konkuk University School of Medicine,
Seoul, South Korea
2
Department of Laboratory Medicine,
Yeungnam University College of Medicine,
Daegu, South Korea
Correspondence
Mina Hur, Department of Laboratory
Medicine, Konkuk University School of
Medicine, Konkuk University Medical Center,
120-1, Neungdong-ro, Hwayang-dong,
Gwangjin-gu, Seoul 05030, South Korea.
Email: dearmina@hanmail.net
Funding information
Konkuk University 2019
Abstract
Background and Objectives: VISION Max (Ortho Clinical Diagnostics, Raritan, NJ)
measures anti-A/B isoagglutinin titres using automated column agglutination
technology (CAT). We compared tube test (TT) and CAT of VISION Max comprehen-
sively, including failure mode and effect analysis (FMEA), turnaround time (TAT) and
cost, and suggested modified CAT (MCAT).
Materials and Methods: For 100 samples (each 25 for blood type A, B and O with
anti-A and anti-B), anti-A/B isoagglutinin titres were measured by TT and CAT
(1:2–1:1024 dilution), as well as by MCAT (with agglutination at 1:32 dilution, then
perform additional testing from 1:64 to 1:1024). We assessed the agreement and
correlation between TT and CAT and compared FMEA (risk priority number [RPN]
score), TAT (h:min:sec) and cost (US dollar, US $) among TT, CAT and MCAT.
Results: TT and CAT showed overall substantial agreement (k = 0.73) and high corre-
lation (ρ ≥ 0.75) except blood type O with anti-A (ρ = 0.68). Compared with TT, CAT
showed lower RPN scores in FMEA and similar TAT and cost (FMEA, 33,700 vs.
184,300; TAT, 15:23:00 vs. 14:26:40; cost, 1377.4 vs. 1312.4, respectively).
Regarding FMEA, TAT and cost, MCAT was superior to CAT or TT (43,810;
13:28:00; 899.2, respectively).
Conclusion: This is the first multidimensional analysis on VISION Max CAT for
measuring anti-A/B isoagglutinin titres. The results of anti-A/B isoagglutinin titres by
CAT were comparable with those of TT. MCAT would be a safe, time-saving and
cost-effective alternative to TT and CAT in high-volume blood bank laboratories.

KEYWORDS
column agglutination technology, cost, failure mode and effect analysis, isoagglutinin titre, tube
test, turnaround time, VISION Max

I N T R O D U CT I O N after ABO-incompatible organ transplantation [1–3]. Tube test (TT) is

a conventional method for measuring anti-A/B isoagglutinin titre;
Anti-A/B isoagglutinin titre measurement is important to mitigate however, it is labour-intensive, subjective in interpretation process and
haemolysis by the transfusion of blood components containing anti- difficult to standardize and automatize [4, 5]. Although TT remains stan-
A/B-incompatible plasma and to assess antibody-mediated rejection dard of care, various technologies have been introduced for measuring

Vox Sanguinis. 2022;117:399–407. wileyonlinelibrary.com/journal/vox © 2021 International Society of Blood Transfusion. 399
400
anti-A/B isoagglutinin titres, including column agglutination technology
(CAT), erythro-magnetic technology, flow cytometry and solid-phase red
cell adherence technique [6, 7]. The introduction of automated methods
would improve the workflow in the blood bank laboratories with
decreased manual workloads [7, 8].
According to the antibody titration (ABT) survey by the College
of American Pathologists (CAP), TT is more commonly used than CAT
(ABT-A 2020 anti-A titre: TT vs. CAT, 79.6% vs. 20.4%) [9]; it may be
related to various reasons, including technical difficulties, laboratory
cost and turnaround time (TAT). Due to the lack of standardization
and harmonization across the test methods, the results of anti-A/B
isoagglutinin titre have shown significant interlaboratory differences
[10–12].
The International Organization for Standardization and the Clinical
Laboratory Standards Institute guidelines [13, 14] recommended a
failure mode and effect analysis (FMEA) before a new assay or
instrument is introduced in clinical laboratories [15]. FMEA is a risk
management tool characterizing potential failures, identifying the
causes and consequences of failures and finally reducing the failures
[16]. FMEA could compare the relative risk between manual and
automated methods; the risk is represented by a numerical number
called risk priority number (RPN) and calculated by multiplying the
severity (S), occurrence (O) and detectability (D) score of the
potential failures [17].
To reduce the potential failures and report accurate results,
FMEA would be an essential tool, especially in blood bank with a large
burden of manual workload [17]. Previous studies compared FMEA
between manual (slide or TT) and automated methods (ORTHO
AutoVue Innova/Ultra, Ortho Clinical Diagnostics, Raritan, NJ; VISION
Max, Ortho Clinical Diagnostics, Bridgend, UK) for ABO blood group-
ing or cross-matching testing [17, 18]. To our knowledge, no study
has evaluated FMEA for measuring anti-A/B isoagglutinin titres. In
this study, we compared CAT on VISION Max with TT for measuring
anti-A/B isoagglutinin titres comprehensively, including FMEA, TAT
and cost. Furthermore, we wanted to suggest a modified CAT (MCAT)
on VISION Max to improve laboratory efficiency. We hypothesized
that this multidimensional analysis could highlight the potential bene-
fit of automated CAT and rationalize the utility of CAT for measuring
anti-A/B isoagglutinin titres.
MATERIALS AND METHODS
Study design
This study was conducted from September to October 2020 at the
Konkuk University Medical Center (KUMC), Seoul, Korea. The institu-
tional review board of the KUMC exempted the approval of study
protocol with waived informed consent (IRB 2020-10-006). Whole
blood samples (6 ml) were obtained into Vacuette tubes (Greiner
Bio-One, GmbH, Kremsmunster, Austria) for ABO typing and cross-
match testing. After testing (centrifugation at 2415g for 10 min), 100
residual serum samples were collected, consisting of 25 samples of
NAM ET AL.
each blood type (blood type A, B and O with anti-A and O with anti-B).
They were randomly collected during the working time (from 2 PM to
4 PM), after excluding samples with insufficient volume (<1.5 ml), long
storage (>24 h), gross haemolysis and inappropriate labelling.
Measurement of anti-A/B isoagglutinin titre
One medical technician performed all tests. TT was performed manu-
ally with the immediate spin method [19]. Briefly, 0.2 ml of normal
saline was aliquoted into 10 plain tubes with a label from 1 to 10.
Patient serum (0.2 ml) was mixed into the first tube and serially two-
fold diluted from 1:2 to 1:1024. After adding 0.2 ml of 3% Affirmagen
A1 cell or B cell (Ortho Clinical Diagnostics) into all tubes, the mixture
was immediately centrifuged for 15 s at 1000g. When the last tube
with agglutination showed >1+ strength by visual inspection, the max-
imum dilution factor was indicated as the IgM anti-A/B isoagglutinin
titre for the sample.
CAT was performed on VISION Max with ORTHO Biovue neutral
cassette (Ortho Clinical Diagnostics), according to the manufacturer’s
instruction. The technician placed normal saline (diluents), dilution
tray, patients’ samples, 0.8% Affirmagen A1 cell or B cell and ORTHO
Biovue neutral cassette into each rack. Then, the technician selected
dilution factor (1:2–1:1024) by touching the screen button. VISION
Max was initialized by scanning the barcodes of reagents, samples and
cassette. Automated pipetting arms of VISION Max serially diluted
160 μl of samples with 160 μl of normal saline in a dilution tray,
according to the dilution factor. Diluted samples (40 μl) and 0.8%
Affirmagen A1 cell or B cell (50 μl), including low-ionic-strength solu-
tion, were mixed in the chamber of microcolumn of ORTHO Biovue
neutral cassette. The cassette was sequentially centrifuged at 850g
for 2 min and 1500g for 3 min. The maximum dilution factor with an
agglutination strength >1+ was automatically determined as IgM anti-
A/B isoagglutinin titre. The technician re-checked the results dis-
played on the screen and confirmed the results. The whole process of
MCAT was almost identical to CAT except for the dilution factor.
MCAT was first performed at 1:2–1:32. If >1+ agglutination was
observed at 1:32, an additional test from 1:64 to 1:1024 was per-
formed. In this study, additional tests were performed in 29 out of
100 samples (29%).
Multidimensional analysis: FMEA, TAT and cost
FMEA was conducted as following steps: (1) assembling team
members; (2) establishing the protocol for TT, CAT and MCAT; (3)
identifying potential failures, causes and consequences; (4) scoring S,
O and D; (5) calculating RPN for each failure and (6) suggesting possi-
ble interventions [16]. FMEA was assessed by three medical techni-
cians, one medical doctor and one analyser specialist. They all
reviewed every step for TT, CAT and MCAT and identified potential
failures, causes and consequences based on their experiences and
information in the literature. The overall RPN was determined by
VISION MAX CAT FOR anti-A/B ISOAGGLUTININ TITRES
multiplying all parameters after assigning individual scores of S, O and
D for each step [17]. After assessing RPN, the members suggested a
protocol with reduced risk.
The TAT was accessed only in the analytical phases from when
TT, CAT and MCAT were started to when the results of anti-A/B iso-
agglutinin titre were reported to the laboratory information system
(LIS). TAT was measured six times and recorded by video camera dur-
ing the TT, CAT and MCAT runs. Every record was expressed in sec-
onds. Hands-on time was defined as the time required for the medical
technicians to perform manual process during the run.
The total cost was calculated by summation of direct and indirect
costs for testing 1, 3, 10, 30, 50 and 100 samples. For the direct cost,
consumables and reagents were calculated based on the cost for a sin-
gle test (1:2–1:1024). Depreciation cost was included in the direct
cost by the lease contract of VISION Max. For the indirect cost, labour
costs were calculated based on the average salaries per min (0.42 US
dollars [$] per minute) and medical technician’s hands-on time in each
method. For calculating FMEA, TAT and cost for multiple samples,
MCAT was considered to perform additional tests with a 29%
increase in the number of samples compared with TT and CAT.
Statistical analysis
Data were presented as number (percentage) or median (interquartile
range), after checking distribution normality and homogenous variation
by Shapiro–Wilk test. To evaluate concordance, correlation and differ-
ence, anti-A/B isoagglutinin titres were transformed with base 2 log.
Anti-A/B isoagglutinin titres with 0, 1 and +1 titre differences were
considered concordant and those with ≥ 2 titre differences discordant.
Agreement between TT and CAT was evaluated by Cohen’s kappa with
95% confidence interval (CI) as follows: <0.20, slight; 0.201–0.40, fair;
0.401–0.60, moderate; 0.601–0.80, substantial and 0.801–1.0, almost
perfect [20]. Correlation between TT and CAT was analysed by Passing–
Bablok regression, and Spearman’s correlation coefficient (ρ) with 95% CI
was interpreted as follows: <0.30, negligible; 0.30–0.50, low; 0.50–0.70,
moderate; 0.70–0.90, high and 0.90–1.00, very high [21]. Mean differ-
ence (1.96 standard deviation) between TT and CAT was evaluated by
the Bland–Altman plot. The distribution of anti-A/B isoagglutinin titres
using TT and CAT was compared using box-and-whisker plot and fre-
quency histogram. Statistical analysis was performed using MedCalc
TABLE 1 Comparison of anti-A/B isoagglutinin titres between TT and CAT
Concordance, n (%)
Blood type Antibody (n) Total TT = CAT TT > CAT
Type A Anti-B (25) 13 (52) 2 (8) 11 (44)
Type B Anti-A (25) 15 (60) 5 (20) 10 (40)
Type O Anti-A (25) 22 (88) 9 (36) 7 (25)
Anti-B (25) 24 (96) 11 (44) 7 (28)
Note: Overall concordance rate between TT and CAT was 74%, and the overall agreement was substantial (kappa = 0.73, 95% CI, 0.63–0.82).
Abbreviations: CAT, column agglutination technology; CI, confidence interval; n, number; TT, tube test.
401
statistical software (19.7.4 version, MedCalc Software Bvba, Ostend,
Belgium), and p-value <0.05 was considered statistically significant.
RE SU LT S
Overall agreement between TT and CAT was substantial (k = 0.73),
ranging from moderate (k = 0.46 and k = 0.43 in blood type A and B,
respectively) to almost perfect (k = 0.81 and k = 0.96 in blood type O
with anti-A and anti-B, respectively). The discordant results were
mostly due to the higher titres by TT than by CAT in blood types A and
B (Table 1). Overall correlation between TT and CAT was high (ρ = 0.81,
p < 0.001); except for moderate correlation in blood type O with anti-A
(ρ = 0.68), anti-A/B isoagglutinin titres between TT and CAT showed
high correlations (ρ = 0.75–0.88) in the other blood types. The mean dif-
ferences between TT and CAT were 1.56 and 1.28 in blood type A and
B, respectively, and 0.24 and 0.12 in blood type O with anti-A and O
with anti-B, respectively (Table 2).
Figure 1 shows the distribution of anti-A/B isoagglutinin titres in
TT and CAT according to each blood type. Using TT and CAT, the
respective median titres were 1:8 (1:2–1:64) and 1:4 (1:2–1:32) in
blood type A; 1:16 (1:2–1:32) and 1:4 (1:2–1:16) in blood type B; 1:32
(1:4–1:128) and 1:32 (1:4–1:256) in blood type O with anti-A; and
both 1:16 (1:2–1:128) in blood type O with anti-B. Among the 100
samples, 84 samples using TT and 87 samples using CAT showed 1:32
or less anti-A/B isoagglutinin titres.
Based on this distribution, MCAT on VISION Max was
suggested and simulated together with TT and CAT (Table 3 and
Figure S1). TT consisted of 10 process steps, and CAT consisted of
eight process steps. For one sample, compared with TT, CAT
showed lower risk (337 vs. 1843 RPN score), slightly longer TAT
(15:30 vs. 8:40 min:s) and similar cost (14.4 vs. 13.1 US $). For
three samples in a batch, MCAT showed lower TAT and cost than
CAT (MCAT vs. CAT: TAT, 31:00 vs. 33:50 min:s; cost 28.2 vs. 41.8
US $, respectively). As the number of samples increased up to 100
samples, CAT indicated significantly lower RPN scores in FMEA
and similar TAT and cost compared with TT (FMEA, 33,700 vs.
184,300 RPN score; TAT, 15:23:00 vs. 14:26:40 h:min:s; cost,
1377.4 vs. 1312.4 US $, respectively). MCAT was superior to TT or
CAT for FMEA, TAT and cost (43,810 RPN score; 13:28:00 h:min:s;
899.2 US $, respectively) (Table 4).
Discordance, n (%)
TT < CAT TT > CAT TT < CAT Kappa (95% CI)
0 (0) 12 (48) 0 (0) 0.46 (0.26–0.67)
0 (0) 10 (40) 0 (0) 0.43 (0.20–0.67)
6 (24) 0 (0) 3 (12) 0.81 (0.60–1.00)
6 (24) 1 (4) 0(0) 0.96 (0.88–1.00)
402 NAM ET AL.

TABLE 2 Correlation of anti-A/B isoagglutinin titres between TT and CAT

Mean difference Correlation

Blood type Antibody (n)  1.96 SD Slope (95% CI) Intercept (95% CI) coefficient (95% CI) p
Type A Anti-B (25) 1.56  1.70 0.04 ( 0.21–0.29) 1.46 (0.75–2.17) 0.87 (0.72–0.94) <0.001
Type B Anti-A (25) 1.28  1.75 0.09 ( 0.44–0.26) 1.50 (0.56–2.46) 0.75 (0.50–0.88) <0.001
Type O Anti-A (25) 0.24  2.14 0.04 ( 0.32–0.41) 0.45 ( 2.25–1.34) 0.68 (0.39–0.85) 0.002
Anti-B (25) 0.12  1.63 0.15 ( 0.36–0.07) 0.68 ( 0.21–1.57) 0.88 (0.74–0.95) <0.001

Note: Overall correlation coefficient between TT and CAT was 0.81 (95% CI 0.73–0.87, p < 0.001). The mean difference between TT and CAT was
calculated as the average of the TT minus CAT because anti-A/B isoagglutinin titres were transformed with base 2 log, the unit associated with the mean
difference is not available.
Abbreviations: CAT, column agglutination technology; CI, confidence interval; n, number; SD, standard deviation; TT, tube test.

F I G U R E 1 Distribution of anti-A/B isoagglutinin titres in each blood type. (a) and (b) represent the box-and-whisker plot and frequency
histogram using TT, respectively, and (c) and (d) using CAT, respectively. In the box-and-whisker plot, the central box represents the values from
the lower to upper quartile, the middle line represents the median and the vertical line extends from the minimum to the maximum value.
Abbreviations: See Table 1
TABLE 3 Evaluation of risk, TAT and cost for TT, CAT and MCAT

FMEA TAT (min:s) Cost (US $)

Potential M-3 M-3

Process step Potential defect intervention Consequence S P D RPN 1 sample 3 samples samples Category 1 sample 3 samples samplesa
Tube test
1. Prepare plain tube Contamination Repeat Delay 1 1 1 1 0:10 0:30 - Glass tube 0.44 1.3
2. Label the tube Wrong information, Relabel WR 10 1 7 70 1:25 4:15 - - - -
manually mislabelling
3. Add NS into each Wrong amounts, missed Repeat Delay, WR 5 1 4 20 1:30 4:30 - 0.03 0.09
tube addition
4. Add patient’s serum Wrong sample or amounts, Repeat Delay, WR 10 3 4 120 0:25 1:15 - Plastic tube 0.02 0.06
missed addition, RBC Serum separator 0.02 0.06
contamination
VISION MAX CAT FOR anti-A/B ISOAGGLUTININ TITRES

5. After mixing, serially Wrong sample or amounts, Repeat Delay, WR 6 3 6 1080b 2:33 7:39 - - - -
dilute 1:2 10 times missed addition, RBC
contamination
6. Discard 0.2 ml in last Wrong sample or amounts, Repeat Delay, WR 6 3 8 144 0:15 0:45 - - -
tube missed addition, RBC
contamination, forgot to
discard
7. Add 3% A1 or B cell Wrong reagents or amounts, Repeat Delay, WR 8 3 9 216 0:53 2:39 - 3% Affirmagen 9.4 28.2
into each tube missed addition,
insufficient mixing
8. Centrifuge (15 sec at Spill, mechanical error, Repeat Delay 5 2 1 10 1:09 3:27 - - - - -
3400 rpm)
9. Interpret the Incorrect interpretation Repeat WR 8 2 7 112 0:05 0:15 - - - - -
agglutination
10. Input the result on Clerical error Correct WR 10 1 7 70 0:15 0:45 - - - - -
LIS manually Labour 3.2 9.2
Total - - - 1843 8:40 26:00 Total 13.1 38.9
Column agglutination technology/modified column agglutination technology
1. Prepare worklist LIS malfunction Re-boot Delay 1 1 1 1 0:15 0:15 0:15 - - -
from LIS
2. Load the cassette Contamination, wrong Repeat Delay 2 1 1 2 0:20 0:20 0:20 Neutral cassette 10.9 32.7 21.8
and reagent cassette or reagent, 0.8% Affirmagen 2.5 7.5 5.0
expired reagent,
mechanical error. Dilution tray 0.3 0.9 0.6
NS 0.012 0.036 0.024
(Continues)
403
TABLE 3 (Continued)
404

FMEA TAT (min:s) Cost (US $)

Potential M-3 M-3

Process step Potential defect intervention Consequence S P D RPN 1 sample 3 samples samples Category 1 sample 3 samples samplesa
3. Load patient’s Wrong sample, uncapped Repeat, relabel Delay, WR 10 2 6 120 0:05 0:15 0:20 - - -
sample sample tube, no
centrifuged sample,
wrong barcode position,
damaged barcode
4. Create an order on Wrong order Repeat Delay, WR 6 2 6 72 0:35 0:35 0:35 - - -
the instrument
screen
5. Select dilution factor Wrong dilution factor, wrong Repeat Delay, WR 7 2 6 84 0:03 0:09 0:12 - - -
RBC cell reagent
6. Test Insufficient sample volume Retest Delay 3 3 6 54 14:00 32:00 29:00 - - -
7. Interpret the Incorrect interpretation Repeat WR 2 1 1 2 0:02 0:06 0:08 - - -
agglutination
8. Send data to LIS Data transfer error Re-send Delay 2 1 1 2 0:10 0:10 0:10 - - -
Labour 0.64 0.67 0.73
Total 337 15:30 33:50 31:00 Total 14.4 41.8 28.2

Note: Hands-on time is shown in bold in the TAT column for one sample.
Abbreviations: CAT, column agglutination technology; D, detectability; FMEA, failure mode and effects analysis; LIS, laboratory information system; M-3 samples, modified test in three samples; MCAT, modified
CAT; NS, normal saline; O, occurrence; RPN, risk priority number; S, severity; TAT, turnaround time; TT, tube test; WR, wrong results.
a
The cost was calculated by summation of the consumables and reagents, required to perform tests from 1:2 to 1:32 dilution and one additional test from 1:64 to 1:1024.
b
Serial dilution was repeated 10 times up to 1:1024 as a maximum endpoint titre, so the RPN value for the step was calculated by multiplying the original RPN value (108) and 10.
NAM ET AL.
VISION MAX CAT FOR anti-A/B ISOAGGLUTININ TITRES 405

TABLE 4 Comparison of FMEA, TAT and cost for testing anti-A/B isoagglutinin titres by using TT, CAT and MCAT

Method 1 sample 3 samples 10 samples 30 samples 50 samples 100 samples

FMEA (RPN score) TT 1843 5529 18,430 55,290 92,150 184,300
CAT 337 1011 3370 10,110 16,850 33,700
MCAT 337 1348 4381 13,143 21,905 43,810
TAT (h:min:s) TT 0:08:40 0:26:00 1:26:40 4:20:00 7:13:20 14:26:40
CAT 0:15:30 0:33:50 1:38:00 4:41:20 7:44:40 15:23:00
MCAT 0:12:30 0:31:00 1:26:30 4:06:50 6:47:10 13:28:00
Cost (US $) TT 13.1 38.9 129.3 393.7 656.2 1312.4
CAT 14.4 41.8 138.2 413.6 689.0 1377.4
MCAT 10.4 28.2 90.4 270.1 450.3 899.2

Abbreviations: CAT, column agglutination technology; FMEA, failure mode and effects analysis; MCAT, modified CAT; RPN, risk priority number; TAT,
turnaround time; TT, tube test.

DISCUSSION
In this study, anti-A/B isoagglutinin titres between CAT and TT
showed overall substantial agreement and high correlation (Tables 1
and 2). However, the range of agreement was wide from moderate in
blood type A and B to almost perfect in blood type O. Several studies
compared the performances between TT and automated methods for
measuring anti-A/B isoagglutinin titres, and they all showed discrep-
ant results using different protocols [22–31]. In our results, TT and
CAT showed high correlation except for blood type O with anti-A,
and this is in line with previous findings [22, 32]. Our results also
showed that anti-A/B isoagglutinin titres by CAT was lower than
those by TT in blood types A and B; concordance rates were lower,
and mean differences were larger in blood types A and B than in blood
type O. These findings are different from some previous findings that
anti-A/B isoagglutinin titres by CAT showed more sensitive results
than those by TT [22, 24, 26–29]. A few studies that evaluated TT
and CAT on VISION Max also showed different results from ours, due
to different incubation times for TT, different cassettes of CAT and
different end points for both TT and CAT [25, 26, 31]. The CAP
suggested the uniform method with a w+ end point and 30-min incu-
bation time for both TT and CAT; the Korean standard protocol
suggested w+ or 1+ end point and 30-min incubation time for TT and
+
1 end point and 15-min incubation for CAT [10, 11, 30]. In spite of
these suggestions, the protocols for TT and CAT have not yet been
firmly established and standardized, and each laboratory use different
protocols and materials, including diluent, incubation time, the
strength of interpretation end point and testing phase [11]. Taken
together, all these findings show that standardization of anti-A/B
isoagglutinin titre measurement is still an unmet need requiring
further effort.
In addition to the data comparison, to our knowledge, a multi-
dimensional analysis encompassing FMEA, TAT and cost has never
been performed so far for measuring anti-A/B isoagglutinin titres. We
demonstrated that compared with TT, CAT showed lower risk scores
and similar TAT and cost. The newly suggested MCAT with the
reduced number of dilution factors than CAT showed lower risk
scores, TAT and cost than TT and CAT. FMEA could be widely used in
clinical laboratories for managing risk, reviewing test processes and
removing possible failures [15]. Although there is no cut-off for RPN,
the process with the highest RPNs should be a priority for modifica-
tion [17]. In this study, FMEA demonstrated that CAT on VISION Max
could be performed using simplified measuring process for anti-A/B
isoagglutinin titres with less risk (Tables 3 and 4). The remarkably high
RPN score in TT implied the potential harm related to the multi-step
manual processes and the relative benefit of adopting automated
methods. In this study, one technologist performed all testing; as this
is not typical and may not reflect routine practice, the actual differ-
ence would be more profound than the present findings.
Automated analysers may introduce safe working conditions,
improved productivity and decreased laboratory costs [33]. However,
automation cannot guarantee reduced TAT and cost, especially in
blood banks with high manual workload. Regarding the sample num-
ber, TAT for one sample in CAT was remarkably longer than that in TT
(15:30 vs. 8:40, min:s). It is also noteworthy that, compared with TT,
CAT required less hands-on time for pipetting, mixing (reagents and
samples) and inputting the results to LIS. Regarding the cost, the total
cost to test one sample in CAT was higher than that in TT (14.4 vs.
13.1 US $), and the difference was still present even though several
samples were analysed simultaneously. Labour and reagent costs were
the majority in TT, whereas reagent and cassette costs were the
majority in CAT. With VISION Max introduction, the labour cost was
reduced by decreasing hands-on times, but the cost of materials was
still expensive.
Based on the distribution of anti-A/B isoagglutinin titres in this
study, we modified the CAT protocol (MCAT) into two-step pro-
cesses; after performing CAT from 1:2 to 1:32, an additional test was
followed only if >1+ agglutination was observed at 1:32 (Figure 1 and
Figure S1). In this study, additional tests were performed in 29 sam-
ples. Considering all 100 samples, MCAT showed higher RPN scores
than CAT because more tests were performed. However, MCAT sig-
nificantly decreased TAT compared with TT and CAT by reducing the
time for adding samples and reagents. Unlike CAT that used two
neutral cassettes (from 1:2 to 1:1024 dilution), MCAT used only one
406
cassette; thus, the cost of materials can be drastically reduced as the
number of samples increase.
The implementation of CAT and MCAT on VISION Max enables
measuring anti-A/B isoagglutinin titres in many samples with short
TAT and low costs. Furthermore, the concept of damage control
resuscitation is changing from transfusing packed red blood cells,
fresh frozen plasma and platelets in a balanced ratio (1:1:1) to trans-
fusing low-titre group O whole blood (LTOWB) [34]. The American
Association of Blood Banks (AABB) recommended the emergency
release and use of LTOWB in traumatic patients with haemorrhage
shock [35]. A short TAT and low cost of CAT and MCAT on VISION
Max could impact on the expansion of LTOWB availability.
This study has several limitations. The test protocol in this study
was not the same as the suggested standard protocols, although we
performed the automated CAT following the manufacturer’s instruc-
tion [10, 11, 30]. Accordingly, further comparison studies using the
uniform method would be necessary. Furthermore, this study included
patient samples with unknown clinical information. In our institution,
almost all test requests for anti-A/B isoagglutinin titres are from the
patients with ABO-incompatible kidney transplant or haematopoietic
stem cell transplant. The distribution of anti-A/B isoagglutinin titres
would be different according to the patients’ group in each hospital.
Thus, MCAT should be applied after clinical validation of anti-A/B iso-
agglutinin titre distribution in blood bank.
In conclusion, this is the first multidimensional analysis on CAT
for measuring anti-A/B isoagglutinin titres. We demonstrated that
anti-A/B isoagglutinin titres measured by TT and CAT on VISION
Max were comparable, showing substantial agreement and high
correlation. In terms of risk, TAT and cost, implementing auto-
mated methods such as CAT would be beneficial to improve the
efficiency in blood bank laboratories. MCAT would be a safe, time-
saving and cost-effective alternative to TT and CAT and would
help optimize the laboratory workflow, especially in laboratories
with high burden of manual workload. Clinical studies validating
automated gel titres with tube titre testing may be warranted prior
to widespread implementation.
FUND ING INFORMATION
This paper was supported by Konkuk University in 2019.
[Correction added on 06 August 2021 after first online publica-
tion: The university name was previously misspelt and was corrected
in this version.]
ACKNOWLEDGEMEN TS
M.N. analysed the data and wrote the draft; M.H. designed the study
and finalized the draft; H.L., H.K. and M.P. participated in data
collection; H.-W.M. and Y.-M.Y. participated in data analysis and
reviewed the draft. All authors have accepted responsibility for the
entire content of this manuscript and approved the final version.
CONF LICT OF IN TE RE ST
The authors declare no conflict of interests.
NAM ET AL.
ORCID
Mina Hur https://orcid.org/0000-0002-4429-9978
RE FE RE NCE S
1. Hosoba S, Jaye DL, Cohen C, Roback JD, Waller EK. Successful
treatment of severe immune hemolytic anemia after allogeneic
stem cell transplantation with bortezomib: report of a case and
review of literature. Transfusion. 2015;55:259–64.
2. Gilbert AJ. Kidney transplantation across minor ABO incompatibility:
the use of A2 to B transplants. Curr Opin Organ Transplant. 2019;
24:365–9.
3. Moinuddin IA, Millward P, Fletcher CH. Acute intravascular
hemolysis following an ABO non-identical platelet transfusion: a
case report and literature review. Am J Case Rep. 2019;20:
1075–9.
4. Mehta N, Chakraborty IR, Rane M, Ambre V. Verification of column
agglutination technology with conventional tube technology for
naturally occurring antibody titration. Glob J Transfus Med. 2016;1:
46–50.
5. Kang SJ, Lim YA, Baik SY. Comparison of ABO antibody titers on the
basis of the antibody detection method used. Ann Lab Med. 2014;
34:300–6.
6. Nayak S, Makroo RN, Prakash B, Chandra T, Agrawal S,
Chowdhry M, et al. Comparative evaluation of five different methods
of anti-ABO antibody titration: an aid for ABO-incompatible organ
transplants. Ther Apher Dial. 2019;23:86–91.
7. Bajpai M, Kaur R, Gupta E. Automation in immunohematology. Asian
J Transfus Sci. 2012;6:140–4.
8. Gupte SC. Automation in blood Centre: its impact on blood safety.
Asian J Transfus Sci. 2015;9:S6–S10.
9. College of American Pathologists. ABO proficiency testing sur-
vey A. Northfield, IL: College of American Pathologists; 2020.
10. AuBuchon JP, Wildt-Eggen J, Dumont LJ. Reducing the variation in
performance of antibody titrations. Arch Pathol Lab Med. 2008;132:
1194–201.
11. Bachegowda LS, Cheng YH, Long T, Shaz BH. Impact of uniform
methods on interlaboratory antibody titration variability: antibody
titration and uniform methods. Arch Pathol Lab Med. 2017;141:
131–8.
12. Denomme GA, Anani WQ. ABO titers: harmonization and identifying
clinically relevant ABO antibodies. Transfusion. 2020;60:441–3.
13. International Organization for Standardization: Medical laboratories-
reduction of error through risk management and continual improve-
ment. ISO/TC 212. Geneva: ISO, 2008.
14. Clinical and Laboratory Standards Institute (CLSI) document EP23-A.
Laboratory quality control based on risk management; approved
guideline. 2nd ed. Wayne, PA: CLSI; 2011.
15. Njoroge SW, Nichols JH. Risk management in the clinical laboratory.
Ann Lab Med. 2014;34:274–8.
16. Chiozza ML, Ponzetti C. FMEA: a model for reducing medical errors.
Clin Chim Acta. 2009;404:75–8.
17. Han TH, Kim MJ, Kim S, Kim HO, Lee MA, Choi JS, et al. The role of
failure modes and effects analysis in showing the benefits of automa-
tion in the blood bank. Transfusion. 2013;53:1077–82.
18. Chung HJ, Hur M, Choi SG, Lee HK, Lee S, Kim H, et al. Benefits of
VISION max automated cross-matching in comparison with manual
cross-matching: a multidimensional analysis. PLoS One. 2019;14:
e0226477.
19. Fung MK, editor. Technical manual. 20th ed. Bethesda, MD:
American Association of Blood Banks; 2020.
20. Landis JR, Koch GG. The measurement of observer agreement for
categorical data. Biometrics. 1977;33:159–74.
21. Mukaka MM. A guide to appropriate use of correlation coefficient in
medical research. Malawi Med J. 2012;24:69–71.
VISION MAX CAT FOR anti-A/B ISOAGGLUTININ TITRES
22. Matsuura H, Akatsuka Y, Matsuno T, Sugiura Y, Arakawa S,
Oikawa S, et al. Comparison of the tube test and column agglutina-
tion techniques for anti-A/-B antibody titration in healthy individ-
uals. Vox Sang. 2018;113:787–94.
23. Park SH, Kim J, Lim JH, Jeong J, Lee SH. Performance evaluation of
automated immunohematology analyzer IH-500 for blood bank
testing. Indian J Hematol Blood Transfus. 2019;35:731–5.
24. Lally K, Kruse RL, Smetana H, Davis R, Roots A, Marshall C, et al.
Isohemagglutinin titering performed on an automated solid-phase
and hemagglutinin-based analyzer is comparable to results obtained
by manual gel testing. Transfusion. 2020;60:628–36.
25. Onpuns S, Jaipian J, Lorucharoen N, Chongpison Y. Comparative
study of ABO antibody titers using conventional tube technique and
automated column agglutination technique. J Hematol Transfus
Med. 2020;30:147–55.
26. Shim H, Hwang JH, Kang SJ, Seo H-S, Park EY, Park KU, et al. Com-
parison of ABO isoagglutinin titers by three different methods: tube
haemagglutination, micro-column agglutination and automated
immunohematology analyzer based on erythrocyte-magnetized tech-
nology. Vox Sang. 2020;115:233–40.
27. Yang JJ, Seo SW, Kim JS, Chung Y, Kim H, Ko DH, et al. A compari-
son of the automated blood bank system IH-500 and manual tube
method for anti-blood group antibody titration: a quantitative
approach. Transfus Apher Sci. 2020;59:102806.
28. Park ES, Jo KI, Shin JW, Park R, Choi TY, Bang HI, et al. Comparison of
total and IgG ABO antibody titers in healthy individuals by using tube
and column agglutination techniques. Ann Lab Med. 2014;34:223–9.
29. Khalili I, Koch M, Thaiss F, Plaetke R, Bruegger J, Peine S. Systematic
comparison of IgM and IgG ABO antibody titers by using tube and
gel card techniques and its relevance for ABO-incompatible kidney
transplantation. Clin Lab. 2017;63:1393–401.
30. Lim YA, Kang SJ. Standardization of ABO antibody titer measurement
at laboratories in Korea. Ann Lab Med. 2014;34:456–62.
407
31. Adkins BD, Egloff SAA, Fahey-Ahrndt K, Kjell AL, Cohn CS,
Young PP. An exploration of the advantages of automated titration
testing: low inter-instrument variability and equivalent accuracy for
ABO and non-ABO antibody titres relative to tube testing. Vox Sang.
2020;115:314–22.
32. Bhangale A, Pathak A, Pawar S, Jeloka T. Comparison of antibody
titers using conventional tube technique versus column agglutination
technique in ABO blood group incompatible renal transplant. Asian J
Transfus Sci. 2017;11:131–4.
33. Shin KH, Kim HH, Chang CL, Lee EY. Economic and workflow
analysis of a blood bank automated system. Ann Lab Med. 2013;33:
268–73.
34. Weymouth W, Long B, Koyfman A, Winckler C. Whole blood in
trauma: a review for emergency clinicians. J Emerg Med. 2019;56:
491–8.
35. Gammon R, editor. Standards for blood banks and transfusion
service. 32nd ed. Bethesda, MD: American Association of Blood
Banks; 2020.
SUPPORTING INF ORMATION
Additional supporting information may be found online in the
Supporting Information section at the end of this article.
How to cite this article: Nam M, Hur M, Lee H, Kim H,
Park M, Moon H-W, et al. Comparison between tube test and
automated column agglutination technology on VISION Max
for anti-A/B isoagglutinin titres: A multidimensional analysis.
Vox Sang. 2022;117:399–407.
Received: 6 January 2021 Revised: 9 July 2021 Accepted: 23 July 2021

DOI: 10.1111/vox.13190

ORIGINAL ARTICLE

Transfusion requirements and alloimmunization to red blood

cell antigens in orthotopic liver transplantation

Ajna Uzuni1 | Jaber El-Bashir2 | Dragos Galusca2 | Sirisha Yeddula3 |

Shunji Nagai3 | Atsushi Yoshida3 | Marwan S. Abouljoud3 | Zaher K. Otrock1

1
Department of Pathology, Wayne State
University School of Medicine, Transfusion
Medicine, Henry Ford Hospital, Detroit,
Michigan, USA
2
Department of Anesthesiology, Pain
Management and Perioperative Medicine,
Henry Ford Hospital, Detroit, Michigan, USA
3
Transplant and Hepatobiliary Surgery, Henry
Ford Hospital, Detroit, Michigan, USA
Correspondence
Zaher K. Otrock, Department of Pathology,
Wayne State University School of Medicine,
Transfusion Medicine, Henry Ford Hospital,
K6, 2799 West Grand Blvd, Detroit, MI
48202, USA.
Email: zotrock1@hfhs.org; zaherotrock@
hotmail.com
Funding information
None.
Abstract
Background and Objectives: Orthotopic liver transplantation (OLT) has been associ-
ated with high blood transfusion requirements. We evaluated the transfusion needs
and frequency of alloimmunization to RBC antigens among OLT recipients pre- and
post-transplantation.
Materials and Methods: We reviewed the medical records of patients who under-
went a first OLT between January 2007 and June 2017. Transfusions given only dur-
ing the perioperative period, defined by 1 week before OLT until 2 weeks following
OLT, were included in this study. Records were reviewed in June 2019 for updated
antibody testing results.
Results: A total of 970 patients underwent OLT during the study period. The median
age of patients was 57 years; 608(62.7%) were male. During the perioperative
period, transfused patients received an average of 10.7 (10.7) RBC units, 15.6
(16.2) thawed plasma units and 4.1 (4.3) platelet units. At the time of OLT, a total
of 101 clinically significant RBC alloantibodies were documented in 58(5.98%)
patients. Fifty-three of these antibodies were directed against Rh blood group
antigens. Twenty-two (37.9%) patients had more than one alloantibody. Patients
with alloimmunization before OLT (N = 58) received perioperatively comparable
number of RBCs to non-alloimmunized patients (10.5  10.6 vs. 9.6  10.7;
p = 0.52). There was no significant difference in perioperative or intraoperative RBC
transfusion between patients with one alloantibody and those with multiple alloanti-
bodies. Only 16 patients (16/737; 2.17%) developed new alloantibodies at a median
of 61 days after OLT. The overall alloimmunization rate was 9.8% (72/737), and
female patients were more likely to be alloimmunized.
Conclusion: Blood transfusion requirements in OLT remain high. However, the rate
of RBC alloimmunization was not higher than the general patient population.

KEYWORDS
alloimmunization, orthotopic liver transplantation, RBC, transfusion

This work was presented, in part, at the American Association of Blood Banks Annual Meeting, October 19-22, 2019.

408 © 2021 International Society of Blood Transfusion. wileyonlinelibrary.com/journal/vox Vox Sanguinis. 2022;117:408–414.
TRANSFUSION AND ALLOIMMUNIZATION IN OLT
I N T R O D U CT I O N
Orthotopic liver transplantation (OLT) has advanced throughout the
years and has become the standard of care for end-stage liver disease [1].
It has significantly improved the outcome and survival rate of patients with
acute liver failure [2]. With the improvement of surgical techniques,
implementing preoperative optimization, use of antifibrinolytic medications
and better transfusion management, OLT has witnessed a significant
decrease in transfusion requirements [3, 4]. In addition, accumulating
evidence in the medical literature indicates that high transfusion require-
ments on any blood component are associated with adverse events,
prolonged hospital stays and poor postoperative outcomes [5–9].
However, OLT is still associated with major blood loss and consequently
high blood transfusion requirements [10], which can extend postoperatively
due to bleeding complications and abnormal haemostasis [11].
Immunohaematologic complications can result from a blood transfu-
sion and can complicate patient management [12]. Due to multiple blood
transfusions, liver transplant patients can get alloimmunized to red blood
cell (RBC) antigens. RBC alloimmunization can cause adverse events
resulting in acute or delayed haemolytic transfusion reactions and can
result in difficulty locating compatible blood [13]. With the institution of
patient blood management in most institutions and with the evidence
supporting restrictive haemoglobin thresholds, there has been a decline
in transfused RBC units [14]. However, blood transfusion remains the
most common procedure performed during a patient’s hospitalization
with more than 11 million RBC units transfused annually in the United
States [15]. Studies have reported an alloimmunization incidence of
6%–23% in OLT [16, 17], which is higher than the 1%–5% of the general
patient population [18–20].
With a very active liver transplant programme at our institution,
we aimed, through the current study, to determine the transfusion
needs in OLT during an 11-year period. In addition, we wanted to
evaluate the frequency of alloimmunization and its specificity to RBC
antigens among liver transplantation recipients.
MATERIALS AND METHODS
This study was performed at Henry Ford Hospital, an 877-bed tertiary
academic medical centre located in Detroit, Michigan. The study was
approved by our institutional review board and was carried out in
accordance with the Helsinki declaration. Informed consent was
waived due to the study design. Patients were identified through the
Liver Transplant database. Electronic medical records and blood bank
files of 970 consecutive patients who underwent a first OLT over an
11-year period (January 2007 through June 2017) were reviewed.
Patients undergoing combined liver and other organ transplants
were included in the analysis. Patients who had a second OLT
were excluded. Transfusions given only during the perioperative
period were included in this database. The perioperative period was
defined as the period spanning 1 week before OLT until 2 weeks
following OLT.
409
The following variables were collected for each patient: gender;
age; race; diagnosis; recipient ABO blood group and Rh type; antibody
screening (indirect antiglobulin test [IAT]) and antibody specificity;
transfusion requirements (number of units of RBCs, thawed plasma,
platelets and cryoprecipitate) during the perioperative period and
alloimmunization at any time after OLT with antibody specificity. Records
were reviewed in June 2019 for updated antibody testing results.
Antibody screening (IAT) was performed using solid-phase tech-
nology on a fully automated analyser Galileo Neo (GALILEO: Immucor
Inc., Norcross, GA) using a two-cell screen. Positive samples were
investigated for antibody identification with a 14-cell panel. Advanced
immunohaematologic investigations would include manual methods,
such as adsorption and elution, whenever required. All tests were per-
formed according to manufacturers’ instructions.
During the study period, the blood bank utilized leukoreduced
blood products, pooled platelet concentrates (available until 2015) or
apheresis platelets, fresh frozen plasma (FFP) or plasma frozen within
24 h (PF24) and cryoprecipitate (each unit was a pool of five units).
For OLT, the blood bank would start issuing irradiated RBCs and
platelets on the day of the transplant.
Immunosuppressive regimen
Per our protocol, induction immunosuppression included rabbit anti-
thymocyte globulin at a dose of 0.5–1.0 mg/kg on postoperative days 1, 3
and 5 or basiliximab at 20 mg on postoperative days 0 and 4. The mainte-
nance immunosuppression regimen consisted of tacrolimus, mycophenolate
mofetil and steroids. Tacrolimus was started within 5 days after transplanta-
tion. The target trough levels of tacrolimus were 8–12 ng/ml during the first
3 months, 6–10 ng/ml between months 3 and 12 and 5–8 ng/ml after
12 months. Mycophenolate mofetil was administered 500 mg every 12 h
and was withdrawn by 1 year. Steroids were tapered off by 3 months.
Anaesthetic and surgical procedures
Prior to liver transplant surgery, patients were always evaluated by
the anaesthesia and surgery teams. All patients received general
anaesthesia with endotracheal intubation, standard American Society
of Anaesthesiologists intraoperative monitoring, central venous and
invasive arterial blood pressure monitoring, pulmonary artery pressure
monitoring and transesophageal echocardiography assessment of
cardiac function. For patients who required intraoperative continuous
veno-venous haemofiltration, dialysis access was obtained. Optimally
balanced anaesthesia with inhaled agents, opioids and muscle relax-
ants was provided by the liver transplant anaesthesiologist. Donor’s
livers were flushed with histidine-tryptophan-ketoglutarate solution.
Surgical techniques were used as described previously [21]. Blood
product transfusion was managed based on the clinical judgement of
the anaesthesiologist utilizing intraoperative monitoring parameters,
cell salvage, antifibrinolytics and coagulation testing results.
410 UZUNI ET AL.

Transfusion management by haemodynamic instability, intraoperative course, blood loss, oozing

The liver transplant coordinator notified the blood bank of a potential
liver transplant as soon as a donor was identified. The blood bank
records of recipients were reviewed for previous alloimmunization to
RBC antigens. A recipient sample was sent for antibody screening
(IAT). If the previous and current antibody screening were negative,
20 ABO-compatible RBC units were reserved for the recipient. If
clinically significant alloantibodies to RBC antigens were identified by
history or on the current antibody screening, 30 antigen-negative
serologically cross-matched RBC units were reserved. The blood bank
would keep an additional 10–15 antigen-negative uncross-matched
RBC units for patients with more than one alloantibody; during
massive bleeding, we would use the uncross-matched units and
reserve the compatible units for the end of surgery. Blood would be
stocked in the blood bank 24 h in advance of the day of the trans-
plant. Thawed plasma units were kept in the blood bank inventory
at all times (6–10 Group A units, 4 Group B, 2 Group O and 2 Group
AB units). Additional plasma units would be thawed as needed.
Platelet units were provided as needed, and cryoprecipitate units
were thawed upon request. Blood products were ordered by the
anaesthesiologist.
The criteria for transfusion were the available AABB criteria at the
time for the pre- and post-operative transfusion. During transplant sur-
gery, transfusion was dictated by the intraoperative needs as reflected
from the surgical field or other surgical complications, which may
extend the duration of the procedure. In addition, laboratory values,
mostly haemoglobin, platelet count international normalized ratio (INR)
and fibrinogen level, were used to support the transfusion needs.
Thromboelastography was not available during the study period.
Statistical analysis
Descriptive statistics were presented for variables. Results were
expressed as mean  SD or median plus range for continuous vari-
ables, and as numbers with percentages for categorical variables. The
Mann–Whitney U-test for continuous variables was used to compare
the groups when applicable. Pearson’s Chi-square test or Fisher’s
exact test was used to compare categorical variables. Results were
considered significant at p < 0.05 using two-sided tests. SPSS version
17.0 software was used for the statistical analysis of data.
RE SU LT S
A total of 970 patients underwent OLT from January 2007 to June
2017. The median age of patients was 57 years (range: 16.6–74.6 years);
608 (62.7%) were male. Most of the patients were Caucasian (N = 815;

TABLE 1 Blood component usage in patients undergoing orthotopic liver transplantation (N = 970)

Number of transfused
Blood component patients (%) Mean (units) SD Median (units) Minimum Maximum
Perioperative
RBC 874 (90.1) 10.7 10.7 7 1 101
FFP/PF24 877 (90.4) 15.6 16.2 11 1 128
Platelets 559 (57.6) 4.1 4.3 3 1 32
Cryoa 584 (60.2) 3.6 3.6 2 1 32
Preoperative
pRBC 134 (13.8) 3.6 5.1 2 1 55
FFP/PF24 151 (15.6) 8.7 8.8 6 1 54
Platelets 71 (7.3) 2.0 1.8 1 1 11
Cryoa 40 (4.1) 2.8 3.3 2 1 17
Intraoperative
pRBC 782 (80.6) 5.9 6.5 4 1 57
FFP/PF24 831 (85.7) 10.2 8.9 8 1 82
Platelets 422 (43.5) 2.0 1.4 2 1 10
Cryoa 490 (50.5) 2.7 2.2 2 1 17
Postoperative
pRBC 729 (75.2) 5.8 6.6 4 1 88
FFP/PF24 508 (52.4) 7.6 12.4 4 1 117
Platelets 385 (39.7) 3.4 4.0 2 1 31
a
Cryo 249 (25.7) 2.5 3.2 2 1 31

Abbreviations: Cryo, cryoprecipitate; FFP, fresh frozen plasma; PF24, plasma frozen within 24 h; RBC, red blood cells; SD, standard deviation.
a
Each cryo unit represents a pool of five units.
TRANSFUSION AND ALLOIMMUNIZATION IN OLT 411

TABLE 2 Alloantibodies to RBC antigens identified serologically or by history prior to orthotopic liver transplantation

No. of patients
Number of patients Blood group with alloantibodies
Antibody specificity (total N = 58) system/antibody (total N = 101)
E 11 Rh
Jka 6 Anti-E 26
D 5 Anti-D 13
M 4 Anti-C 10
C 3 Anti-c 4
c 1 Kell
E, K 4 Anti-K 16
K 3 Kidd
Lea 2 Anti-Jka 11
a
E, Jk 2 Anti-Jkb 3
C, E, K 1 Duffy
E, c, K 1 Anti-Fya 5
S 1 MNS
E, c 1 Anti-M 4
a
E, Fy 1 Anti-S 4
E, Fya, Jkb 1 Lewis
E, K, Jkb 1 Anti-Lea 4
D, C, S 1 Colton
D, C, Lea 1 Anti-Cob 1
a
D, Fy 1
D, K 1
C, D, E, K, Fya, Jka, Lea 1
a
C, D, K, Jk 1
C, D, K 1
b
C, D, K, S, Co 1
E, c, Fya, Jkb 1
a
E, K, S, Jk 1

84%). Sixty-eight patients had a simultaneous liver-kidney transplant and
eight patients had multivisceral transplant.
During the perioperative period, transfused patients received
an average of 10.7 (10.7) RBC units, 15.6 (16.2) thawed plasma
units, 4.1 (4.3) platelet units and 3.6 (3.6) cryoprecipitate units.
Table 1 summarizes the perioperative blood component usage
in OLT.
At the time of OLT, a total of 101 clinically significant RBC allo-
antibodies were documented in 58 (5.98%) patients through posi-
tive antibody screening and/or history of alloimmunization to RBC
antigens. The patients included 21 males and 37 females, with a
median age of 56 years (range: 20–70 years). Forty-nine (84.5%) of
these patients were Caucasian. These antibodies were formed
against a range of antigens as listed in Table 2. Fifty-three (53%) of
these antibodies were directed against the Rh blood group
antigens; the next common antibodies were against the Kell
(16 antibodies), Kidd (14 antibodies), MNS (8 antibodies) and Duffy
(5 antibodies) blood group antigens. Twenty-two (37.9%) patients
had more than one alloantibody. Of these, 10 had two antibodies,
7 had three, 3 had four, 1 had five and 1 had seven antibodies
(Table 2). One patient had warm autoantibodies, and another had
cold autoantibodies on antibody screens at the time of liver trans-
plantation. In addition, six patients had a positive antibody screen
with non-specific findings.
Patients with history of RBC alloimmunization before OLT (N = 58)
received perioperatively comparable number of RBCs to non-alloimmunized
patients (10.5  10.6 vs. 9.6  10.7; p = 0.518); 54 (93.1%) of the
alloimmunized patients received perioperative RBC transfusions. There was
no significant difference in perioperative or intraoperative RBC transfusion
between patients with one alloantibody and those with multiple alloanti-
bodies (9.6  7.9 units vs. 12.2  13.8 units perioperatively; p = 0.36 and
4.6  5.3 units vs. 5.6  7.8 units intraoperative; p = 0.67, respectively).
Serological follow-up with antibody screen was available for
737 (76%) patients with a median follow-up of 23 (interquartile range
[IQR], 14–260) days following OLT; 696/737 (94.4%) patients received peri-
operative RBC transfusion. The average number of antibody screening
412 UZUNI ET AL.

TABLE 3 Characteristics and immunohaematologic findings of patients who had alloimmunization after liver transplantation

No. of transfused Interval (OLT - last ab Post-OLT new DAT Interval

Pts Age (yrs) Gender Race RBC units periop screen before Allo) ab specificity at Allo (OLT – Allo)
1 56.3 F C 27 15.3 months Anti-E NP 15.6 months
2 53.6 M A 10 NP Anti-E Negative 3.5 months
3 59.9 M C 10 13 days Anti-E Negative 81 days
4 58.9 M A 17 NP Anti-E NP 8 days
5 43.0 M C 12 4 days Anti-D* Positive (IgG) 14 days
6 37.4 F C 8 NP Anti-D* Positive (IgG) 3 days
7† 55.0 F C 19 58 days Anti-c NP 67 days
8 57.8 M C 6 10 days Anti-K NP 28 days
9 62.5 F C 5 NP Anti-K NP 21.5 months
10 69.0 F C 20 NP Anti-K NP 3.7 months
11 59.9 M A 6 NP Anti-K NP 55 days
12 52.6 F C 11 4.7 months Anti-Kpa NP 7.3 months
a
13 38.7 F C 5 NP Anti-Kp Positive (IgG) 15 days
14 62.0 F C 7 NP Anti-Jkb Positive (IgG) 22 days
b
15 41.4 F A 6 7.2 months Anti-Jk NP 20.4 months
16† 22.2 F A 6 NP Anti-C, Fya, K Positive (IgG, C3) 15 days

Abbreviations: A, African American; Ab, antibody; Allo, alloimmunization; C, Caucasian; DAT, direct antiglobulin test; F, female; M, male;
NP, not performed; OLT, orthotopic liver transplantation; Pts, patients; yrs, years.
*Passenger lymphocyte syndrome.
†
Patients 7 and 16 had anti-E + Jka and anti-E, respectively, before OLT.

post-OLT was 1.49. Only 16 patients (16/737; 2.17%) developed new allo-
antibodies after OLT: anti-E (four patients), anti-K (four patients), anti-K and
anti-C and anti- Fya (1), anti-Jkb (2), anti-Kpa (2), anti-D (2) and anti-c (1).
These patients included 6 males and 10 females, with a median age of
55.6 years (range: 22.2–69 years). Identification of alloantibodies was at a
median of 61 (IQR, 15–191.5) days after OLT. Table 3 summarizes the char-
acteristics and immunohaematologic findings of these patients. The overall
RBC alloimmunization rate in our cohort was 9.8% (72/737). Female
patients were more likely to be alloimmunized compared to males (45/362
[12.4%] females and 27/608 [4.4%] males; p < 0.001). We had a signifi-
cantly higher number of African American patients transfused peri-
operatively compared to Caucasian patients (149/155, 96.1% vs. 725/
815, 89%; p = 0.006). However, there was no significant difference in
overall alloimmunization between African American patients and Cauca-
sian patients (13/155, 8.4% vs. 59/815, 7.2%; p = 0.62).
Two D-positive patients receiving OLT from D-negative donors
developed anti-D antibodies with positive direct antiglobulin test
(DAT) due to passenger lymphocyte syndrome. The first patient was a
37-year-old female with primary sclerosing cholangitis who developed
anti-D antibodies 3 days following OLT. She did not have evidence of
haemolysis, was managed with immunosuppressive therapy and her
DAT was negative 43 days after OLT. The second patient was a
43-year-old male with liver cirrhosis secondary to hepatitis C who devel-
oped anti-D antibodies 14 days following OLT. He did not show evi-
dence of increased haemolysis. We did not have a close follow-up on
his DAT.
Twenty-four D-negative patients were transfused with D-positive
RBC units (median 8.5 units; range: 1–90 units) perioperatively. None
of the patients with available serological follow-up (N = 19) devel-
oped a positive antibody screen after a median serological follow-up
of 41.9 months (range: 17 days–127.7 months).
DI SCU SSION
We reviewed the medical records of OLT patients to determine their
perioperative transfusion requirements and the overall rate of
alloimmunization to RBC antigens. During the perioperative period,
transfused patients received an average of 10.7 (10.7) RBC units,
15.6 (16.2) thawed plasma units, 4.1 (4.3) platelet units and 3.6
(3.6) cryoprecipitate units. A total of 101 clinically significant RBC
alloantibodies were documented in 58(5.98%) patients at the time of
OLT. Only 16 patients (16/737; 2.17%) developed new alloantibodies
after OLT. The overall alloimmunization rate was 9.8% (72/737), and
female patients were more likely to be alloimmunized.
More than 90% of our OLT patients required RBC and plasma
transfusions perioperatively, with an average of 10.7 and 15.6 units,
respectively. Most of the blood products were transfused intra-
operatively – RBCs and FFPs were transfused in almost 81% and 86%
of patients, respectively. Our experience with the transfusion require-
ments of blood products, especially intraoperative transfusions, is
consistent with the published literature on OLT [22, 23]. Still, higher
TRANSFUSION AND ALLOIMMUNIZATION IN OLT
transfusion requirements have been reported by others [7]. Although
the AABB transfusion guidelines are widely used [24, 25], transfusion
practices remain variable among transplant centres.
The results of our study showed that more plasma has been
transfused than RBCs, which is consistent with some studies [7, 26].
In fact, there is emerging literature that a higher plasma to packed
RBC transfusion ratio during liver transplantation is associated with a
decreased need for RBC transfusions. In a retrospective study by
Pagano and colleagues, 188 patients were evaluated for the volume
ratio of transfused plasma (PL Vol) to RBC (RBC Vol). A low PL
Vol/RBC Vol was associated with excess RBC transfusion with signifi-
cant findings using logistic regression [26].
Several studies reported on RBC alloimmunization before and,
some of them, after OLT [12, 16, 17, 27–29]. Alloimmunization fre-
quency ranged from 4% to 23% pre-OLT and from 1% to 7.5% post-
OLT. Patients having multiple antibodies accounted for up to 45% of
alloimmunized patients. The results of the current study are compara-
ble to previous findings: we documented pre-OLT and post-OLT
alloimmunization in 6% and 2% of patients, respectively; 38% of
alloimmunized patients had multiple antibodies. The profile of anti-
body specificity, most commonly against the Rh and Kell blood group
systems, is consistent with the reported literature [16, 17]. We identified
two patients with passenger lymphocyte syndrome due to anti-D anti-
bodies. We cannot tell with certainty if these were the only two cases in
our cohort as most passenger lymphocyte syndrome cases are subclini-
cal, and even now, there is no standardized consensus on screening for
passenger lymphocyte syndrome in transplant patients [30].
In the current study, patients with RBC alloimmunization before
OLT received a comparable number of RBCs perioperatively to non-
alloimmunized patients. Our findings did not concur with others’ find-
ings [28, 29]. Solves and colleagues [28] reviewed 654 OLT patients
from Spain, 27 of whom were alloimmunized before OLT. The investi-
gators found that patients who suffered “any immunohaematologic
incident” including those who were alloimmunized received more
RBCs during hospital admission. The authors did not give a discussion
about their results. In another study [29], only 192 Chinese recipients
of liver transplants were surveyed with 17 (8.8%) patients having RBC
alloantibodies. The authors found that the presence of RBC alloanti-
bodies was associated with increased blood requirements; however,
they acknowledged that the numbers of cases and events were small
and that their perioperative variables were highly heterogeneous, and
thus cautioned the readers that conclusions were to be verified. The
findings of these two studies did not seem to be based on biologic basis,
and definitive conclusions in regard to alloimmunization and increased
blood requirements need to be investigated in large prospective studies.
We did not find a statistically significant difference in RBC trans-
fusion requirements in patients with single versus multiple antibodies.
Contrary to our findings, Shariatmadar and colleagues noted that
patients with multiple antibodies required more RBCs compared to
those with a single antibody; however, this statistical significance was
only applicable when patients required 40 units of RBCs. The cause of
this increase in blood utilization was not clear to the authors [16].
413
The majority of our patients (68%) were alloimmunized to the Rh
and Kell blood group antigens at the time of liver transplantation. The
question remains whether phenotypically matched blood for Rh and
Kell would have a potential benefit in preventing alloimmunization in
liver transplant candidates. A definitive answer to this question cannot
be provided based on our study. However, we can argue based on our
findings that phenotypically matched RBCs might not be of great ben-
efit in this patient population. First, the rate of alloimmunization in
our cohort at the time of liver transplantation (5.98%) was not
greater than the general patient population, and the rate of new
alloimmunization post-liver transplant was even lower at 2.17%.
This makes it not worth the efforts needed to find phenotypically
matched RBCs during the pre-transplant period. Second, although
our study did not specifically assess the challenges in finding com-
patible blood for alloimmunized patients, we generally did not face
difficulties in securing blood during the perioperative period. Based
on these observations, we believe providing phenotypically mat-
ched RBCs for Rh and Kell blood group antigens might be demand-
ing and not of great benefit in liver transplant candidates. The risks
of alloimmunization to RBC antigens need to be evaluated in large
prospective studies.
This study has several strengths including the large number of
patients undergoing OLT over a long period of institution experience.
One of the limitations of this study is its nature and being dependent
on medical record documentation. The possibility of data recording
bias cannot be excluded. Some parameters that would affect
alloimmunization were not collected and these include pregnancy his-
tory of female patients, transfusion history before 7 days prior to OLT
and transfusion requirements after 14 days after OLT. Another limita-
tion relates to the lack of systematical time course for antibody
screening as reflected in the relatively short median antibody screen
follow-up time of 23 days; thus, new alloantibodies might have been
missed. The lack of a protocol for detecting delayed serologic/
haemolytic transfusion reactions is another limitation.
In conclusion, despite blood management, blood transfusion
requirements in OLT remain high during the perioperative period.
However, the rate of alloimmunization to RBC antigens was not
higher than the general patient population. More importantly, RBC
alloimmunization in this patient population did not increase RBC utili-
zation. Implementing a patient blood management programme is
needed to address preoperative anaemia optimization, minimizing
blood loss, implementation of restrictive transfusion thresholds and
other principles to minimize blood transfusion and improve outcome.
There is also a need to evaluate the appropriateness of blood transfu-
sions in OLT, a process that might not be easy to apply especially in
the intraoperative setting.
AC KNOW LEDG EME NT S
Z.K.O. study design and analysis of data; A.U., S.Y., S.N., M.S.A. and
Z.K.O. acquisition of data; A.U. and Z.K.O. drafting the paper or revising it
critically; A.U., J.E., D.G., S.Y., S.N., A.Y., M.S.A. and Z.K.O. approval of the
submitted and final version.
414
CONF LICT OF IN TE RE ST
The authors declare no conflicts of interest.
ORCID
Ajna Uzuni https://orcid.org/0000-0001-6955-2792
Zaher K. Otrock https://orcid.org/0000-0002-5823-2694
RE FE R ENC E S
1. Jadlowiec CC, Taner T. Liver transplantation: current status and
challenges. World J Gastroenterol. 2016;22:4438–45.
2. Olivo R, Guarrera JV, Pyrsopoulos NT. Liver transplantation for acute
liver failure. Clin Liver Dis. 2018;22:409–17.
3. Tischer S, Miller JT. Pharmacologic strategies to prevent blood loss
and transfusion in orthotopic liver transplantation. Crit Care Nurs Q.
2016;39:267–80.
4. Nedelcu E, Wright MF, Karp S, Cook M, Barbu O, Eichbaum Q.
Quality improvement in transfusion practice of orthotopic liver
transplantation reduces blood utilization, length of hospital stay, and
cost. Am J Clin Pathol. 2019;151:395–402.
5. de Boer MT, Christensen MC, Asmussen M, van der Hilst CS,
Hendriks HGD, Slooff MJH, et al. The impact of intraoperative trans-
fusion of platelets and red blood cells on survival after liver
transplantation. Anesth Analg. 2008;106:32–44.
6. Pereboom IT, de Boer MT, Haagsma EB, Hendriks HG, Lisman T,
Porte RJ. Platelet transfusion during liver transplantation is associ-
ated with increased postoperative mortality due to acute lung injury.
Anesth Analg. 2009;108:1083–91.
7. Rana A, Petrowsky H, Hong JC, Agopian VG, Kaldas FM,
Farmer D, et al. Blood transfusion requirement during liver trans-
plantation is an important risk factor for mortality. J Am Coll Surg.
2013;216:902–7.
8. Bertacco A, Barbieri S, Guastalla G, Boetto R, Vitale A, Zanus G, et al.
Risk factors for early mortality in liver transplant patients. Transplant
Proc. 2019;51:179–83.
9. Johnson DJ, Scott AV, Barodka VM, Park S, Wasey JO, Ness PM,
et al. Morbidity and mortality after high-dose transfusion. Anesthesi-
ology. 2016;124:387–95.
10. Roullet S, Biais M, Millas E, Revel P, Quinart A, Sztark F. Risk factors
for bleeding and transfusion during orthotopic liver transplantation.
Ann Fr Anesth Reanim. 2011;30:349–52.
11. Yokoyama APH, Kutner JM, Sakashita AM, Nakazawa CY, de Paula TAO,
Zamper RPC, et al. Risk factors for transfusion after orthotopic liver trans-
plantation. Transfus Med Hemother. 2019;46:431–9.
12. Boyd SD, Stenard F, Lee DK, Goodnough LT, Esquivel CO, Fontaine MJ.
Alloimmunization to red blood cell antigens affects clinical outcomes in
liver transplant patients. Liver Transpl. 2007;13:1654–61.
13. Tormey CA, Hendrickson JE. Transfusion-related red blood cell
alloantibodies: induction and consequences. Blood. 2019;133:1821–30.
14. Yazer MH, Jackson B, Beckman N, Chesneau S, Bowler P, Delaney M,
et al. Changes in blood center red blood cell distributions in the era
of patient blood management: the trends for collection (TFC) study.
Transfusion. 2016;56:1965–73.
15. US Department of Health and Human Services (FDA): Fatalities reported
to the FDA following blood collection. http://www.fda.gov/Biologics
BloodVaccines/SafetyAvailability. Accessed 1 Aug 2018.
UZUNI ET AL.
16. Shariatmadar S, Pyrsopoulos NT, Vincek V, Noto TA, Tzakis AG.
Alloimmunization to red cell antigens in liver and multivisceral trans-
plant patients. Transplantation. 2007;84:527–31.
17. Luzo AC, Pereira FB, de Oliveira RC, Azevedo PR, Cunha RD,
Leonardi MI, et al. Red blood cell antigen alloimmunization in liver
transplant recipients. Transplant Proc. 2010;42:494–5.
18. Evers D, Middelburg RA, de Haas M, Zalpuri S, de Vooght KMK, van
de Kerkhof D, et al. Red-blood-cell alloimmunisation in relation to
antigens’ exposure and their immunogenicity: a cohort study. Lancet
Haematol. 2016;3:e284–92.
19. Zaman S, Chaurasia R, Chatterjee K, Thapliyal RM. Prevalence and
specificity of RBC alloantibodies in Indian patients attending a
tertiary care hospital. Adv Hematol. 2014;2014:749218.
20. Tormey CA, Fisk J, Stack G. Red blood cell alloantibody frequency,
specificity, and properties in a population of male military veterans.
Transfusion. 2008;48:2069–76.
21. Nagai S, Yoshida A, Facciuto M, Moonka D, Abouljoud MS,
Schwartz ME, et al. Ischemia time impacts recurrence of hepatocellular
carcinoma after liver transplantation. Hepatology. 2015;61:895–904.
22. Cywinski JB, Alster JM, Miller C, Vogt DP, Parker BM. Prediction of
intraoperative transfusion requirements during orthotopic liver trans-
plantation and the influence on postoperative patient survival.
Anesth Analg. 2014;118:428–37.
23. Tsai HW, Hsieh FC, Chang CC, Su MJ, Chu FY, Chen KH, et al.
Clinical practice of blood transfusion in orthotopic organ transplantation: a
single institution experience. Asian Pac J Cancer Prev. 2015;16:8009–13.
24. Kaufman RM, Djulbegovic B, Gernsheimer T, Kleinman S, Tinmouth AT,
Capocelli KE, et al. Platelet transfusion: a clinical practice guideline from
the AABB. Ann Intern Med. 2015;162:205–13.
25. Carson JL, Guyatt G, Heddle NM, Grossman BJ, Cohn CS, Fung MK,
et al. Clinical practice guidelines from the AABB: red blood cell trans-
fusion thresholds and storage. JAMA. 2016;316:2025–35.
26. Pagano MB, Metcalf RA, Hess JR, Reyes J, Perkins JD, Montenovo MI. A
high plasma: red blood cell transfusion ratio during liver transplantation is
associated with decreased blood utilization. Vox Sang. 2018;113:268–74.
27. Ramsey G, Cornell FW, Hahn LF, Larson P, Issitt LB, Starzl TE. Red
cell antibody problems in 1000 liver transplants. Transfusion. 1989;
29:396–400.
28. Solves P, Carpio N, Moscardo F, Lancharro A, Cano I, Moya A, et al.
Transfusion management and immunohematologic complications in
liver transplantation: experience of a single institution. Transfus Med
Hemother. 2015;42:8–14.
29. Au WY, Liu CL, Lo CM, Fan ST, Lam MF, Lam CK. Red blood cell allo-
antibodies and liver transplantation in Chinese patients. Transplantation.
2003;76:324–6.
30. Moosavi MM, Duncan A, Stowell SR, Roback JD, Sullivan HC. Passen-
ger lymphocyte syndrome; a review of the diagnosis, treatment, and
proposed detection protocol. Transfus Med Rev. 2020;34:178–87.
How to cite this article: Uzuni A, El-Bashir J, Galusca D,
Yeddula S, Nagai S, Yoshida A, et al. Transfusion requirements
and alloimmunization to red blood cell antigens in orthotopic
liver transplantation. Vox Sang. 2022;117:408–14.
Received: 10 May 2021 Revised: 23 July 2021
DOI: 10.1111/vox.13195
ORIGINAL ARTICLE
ABO haemolytic disease of the newborn: Improved prediction
by novel integration of causative and protective factors
in newborn and mother
Grethe Risum Krog1 | Henriette Lorenzen2 | Frederik Banch Clausen1
1 3,4
Anne Todsen Hansen | Mette Line Donneborg
1
Department of Clinical Immunology,
Copenhagen University Hospital
(Rigshospitalet), Copenhagen, Denmark
2
Faculty of Health, University College
Copenhagen, Copenhagen, Denmark
3
Department of Pediatrics, Aalborg University
Hospital, Aalborg, Denmark
4
Department of Clinical Medicine, Aalborg
University, Aalborg, Denmark
5
Department of Clinical Medicine, University
of Copenhagen, Copenhagen, Denmark
Correspondence
Grethe Risum Krog, Department of Clinical
Immunology KI 2031, Copenhagen University
hospital, (Rigshospitalet), Blegdamsvej 9, 2100
Copenhagen, Denmark.
Email: grethe.risum.krog@regionh.dk
Funding information
dbio’s Research Foundation; Rigshospitalet’s
Research Foundation
Vox Sanguinis. 2022;117:415–423.
Accepted: 30 July 2021
|
1,5
| Morten Hanefeld Dziegiel
Abstract
Background and Objectives: Prediction of haemolytic disease of the foetus and
newborn (HDFN) caused by maternal anti-A/-B enables timely therapy, thereby
preventing the development of kernicterus spectrum disorder. However, previous
efforts to establish accurate prediction methods have been only modestly
successful.
Materials and Methods: In a case–control study, we examined 76 samples from
mothers and 76 samples from their newborns; 38 with and 38 without haemolysis.
The IgG subclass profile of maternal anti-A and anti-B was determined by flow cyto-
metry. Samples from newborns were genetically analysed for the A2 subgroup, secre-
tor and FcγRIIa receptor alleles.
Results: Surprisingly, we found a correlation between the newborn secretor allele
and haemolysis (p = 0.034). No correlation was found for FcγRIIa alleles. The A2
subgroup was found only in newborns without haemolysis. Unexpectedly, different
reaction patterns were found for maternal anti-A and anti-B; consequently, the
results were treated separately. For the prediction of haemolysis in A-newborns,
the maternal IgG1 subclass determination resulted in an accuracy of 83% at birth.
For B-newborns, an accuracy of 91% was achieved by the maternal IgG2 subclass
determination.
Conclusion: We improved the prediction of ABO-HDFN by characterizing mater-
nal anti-A and anti-B by flow cytometry and we presented genetic traits in new-
borns with correlation to haemolysis. We propose a new understanding of A- and
B-substances as immunogens that enhance the maternal immune response and
protect the newborn, and we suggest that the development of ABO-HDFN is dif-
ferent when caused by maternal anti-A compared to maternal anti-B.
KEYWORDS
blood groups, genotyping, haemolytic disease of the foetus and newborn, RBC antigens and
antibodies, serological testing
wileyonlinelibrary.com/journal/vox © 2021 International Society of Blood Transfusion. 415
416 KROG ET AL.

I N T R O D U CT I O N ABO-incompatibility occurs in 20% of all pregnancies while the

ABO-incompatibility between the pregnant woman (group O) and foe-
tus (group A or B) may lead to the development of the haemolytic
disease of the foetus and newborn (HDFN) and may cause hyper-
bilirubinaemia in the newborn due to immune-mediated haemolysis.
Maternal IgG anti-A/-B cross the placenta, bind to paternally inherited
A or B antigens on newborn red blood cells (RBCs) and interact
with effector cells bearing IgG Fc receptors (FcγRs) leading to the
destruction of newborn RBCs [1, 2].
Hyperbilirubinaemia requires medical attention because uncon-
jugated bilirubin is neurotoxic and can cause acute bilirubin
encephalopathy and kernicterus spectrum disorder (KSD) [3].
Currently, phototherapy is the most common treatment for
neonatal hyperbilirubinaemia and the prevention of KSD [3].
Predictive markers enabling more accurate identification of preg-
nancies at risk of ABO-mediated haemolysis could be beneficial
especially when the early discharge of the newborn is considered.
Early detection and timely phototherapy are most often effective
in controlling excessive bilirubin levels and to avoid invasive treatment
such as IVIg [2].
incidence of ABO-HDFN is higher among newborns of black or Asian
origin (3%–5%) than European origin (<1%) [2]. The reason for this dif-
ference is not fully understood [2].
The maternal anti-A/-B IgG titre is predictive of the risk of
developing severe hyperbilirubinaemia, however, with a modest
accuracy of 73%–80% [4, 5]. We have previously reported an
association measured by two different methods: the solid phase
red cell adherence assay (SPRCA) with an accuracy of 80% and the
column agglutination technology method with an accuracy of
79% [6].
Previous studies hypothesized the existence of protective
mechanisms preventing maternal anti-A/-B IgG-mediated destruc-
tion of RBC, thus interfering with the maternal anti-A/-B IgG titre as
an absolute predictor of severe hyperbilirubinaemia [7]. Different
traits such as density of RBC antigens and secretor status of the
newborn have previously been examined using cumbersome proce-
dures with limited general applicability [7]. Another study examining
maternal IgG subclasses showed that the IgG2 titre in most cases is
higher compared to other IgG subclasses [8]. Moreover, a study
suggested that the affinity of different allotypes of FcγRIIa to IgG

TABLE 1 Newborn characteristics

Newborns with Newborns without

haemolysis (cases) (n = 38) haemolysis (controls) (n = 38) p-value
Blood group A subgroup frequency
A1 (n) 1.00 (23) 0.75 (24)
2
A (n) 0 (0) 0.25 (6) 0.030a
Blood group B
Phenotype frequency (n) 0.39 (15) 0.21 (8) 0.08b
FCGR2A (rs1801274)
Allele frequency
His (131H) 0.564 0.586
Arg (131R) 0.436 0.414 0.791c
Genotype frequency (n) (NA = 3)
131H/H 0.37 (14) 0.34 (12)
131R/R 0.24 (9) 0.17 (6)
131H/R 0.42 (16) 0.49 (17)
FUT2 (rs601338)
Allele frequency
se 0.355 0.526
Se 0.645 0.473 0.034c
Predicted secretor phenotype frequency (n)
Non-secretor 0.13 (5) 0.26 (10)
Secretor 0.87 (33) 0.74 (28) 0.150c

Note: Bold value indicates p-value < 0.05.

Abbreviation: NA, not available.
a
Fisher’s exact test.
b
Published in Krog et al. [6].
c
Pearson chi-squared test.
ABO HAEMOLYTIC DISEASE OF THE NEWBORN 417

in the newborn could be important for the development of
ABO-HDFN [1].
The aim of this study was to explore the value of new technology,
molecular genetic methods and flow cytometry, and to explore predic-
tive factors in the pregnant woman and newborn in order to improve
the understanding of ABO-HDFN and improve the accuracy of
predicting the risk of developing hyperbilirubinaemia. We investigated
(i) the IgG1,-2,-3 subclass profile of maternal ABO antibodies and
(ii) potential protective factors in the newborn, specifically the A2 sub-
group, the secretor status and the FcγRIIa receptor 167 Arg/His
variant.
Flow cytometric determination of maternal IgG1,-2,-3
subclasses
Primary and secondary antibodies were diluted in 1% bovine serum albu-
min immediately before use: mouse-anti-human IgG1 (1:100), IgG2 and
IgG3 (1:400) (ref. MH1013, 05-3500, 05-3600; Invitrogen, Thermo Fisher
Scientific Inc.) and donkey anti-mouse IgG (H + L) R-phycoerythrin conju-
gated (1:100) (ref. 715-116-150; Jackson ImmunoResearch Laboratories
Inc.). We checked if the potentially different binding capacity of these
secondary antibodies in combination with the fluorophore-labelled

MATERIALS AND METHODS

Subjects

This study is a further investigation of a previously published case–

control study, and details of inclusion criteria of the subjects are given
there [6]. Briefly, blood group O-mothers and their incompatible new-
borns (group A or B) born gestational age ≥ 35 weeks were eligible
for the study. The case group consisted of 38 O-mothers and their
newborns, receiving phototherapy due to hyperbilirubinaemia, and
the control group consisted of 38 O-mothers and their newborns,
who did not receive phototherapy [6]. For the sake of clarity, we will
henceforth refer to cases as newborns with haemolysis and controls
as newborns without haemolysis.

Material

Newborn and maternal blood samples were collected in EDTA tubes

at inclusion (median 50 h after birth), separated into plasma and cell-
rich suspensions and stored below 20 C [6]. Residual maternal
plasma from the first trimester was collected from a biobank set up
for this study [6]. Newborn DNA was extracted from the cell-rich sus-
pension by the QIAamp DNA Blood Mini Kit (ID: 51104, Qiagen Inc.)
according to the protocol.

Genotyping

Genotyping for the A2 subgroup and the secretor status was

performed with the two single nucleotide polymorphisms (SNPs)
rs56392308 (1061delC) and rs601338 (428G > A), respectively [9].
KASP primers and the High Rox KASP 2X Master mix (KBS-
1016-021V 4.0) were purchased from the LGC Group (Hoddesdon,
Herts, UK). For the FcγRIIa receptor SNP, the rs1801274 (497 A > G)
(Cat.no. 4351379) was used in combination with the Universal
F I G U R E 1 Mean level of maternal IgG1 (a), IgG2 (b) and IgG3
Master Mix with uracil-N-glycosylase (Applied Biosystems Inc.
(c) in relation to secretor status of newborns with haemolysis (cases)
[ABi]). All PCRs were performed in a 10-μl reaction volume using the and newborns without haemolysis (controls). In the IgG3 assay, three
ABi 7500 fast real-time qPCR system. Thermal profiles were as extreme outliers with the following values 2668 (A2, non-secretor,
recommended by the manufacturer. control), 3356 and 5059 (A1, secretor, cases) were included
418 KROG ET AL.

anti-mouse would influence the results of the three IgG subclass assays—
for a given antigen. For this, we used a set of in-house recombinant IgG1,
IgG2 and IgG3 anti-D, all with the same variable region and the same
D-positive RBCs [10]. Each assay was tested in duplicate with all reagents
in excess (including anti-D) on four separate days using the setup
described in the following section—except for fixation of the D-positive
RBCs that were omitted. We found similar signal-to-noise (S/N) ratios for
the IgG1 and IgG2 assays, whereas the IgG3 assay consistently showed a
five times higher S/N ratio. We interpret this finding as caused by five
times more anti-human IgG3 binding to each IgG3 molecule as compared
with IgG1 and IgG2. The same number of IgG3 on an RBC will give a five
times higher readout than IgG1 and IgG2. We assume that the same
applies to the IgG1,-2,-3 assays towards A and B antigens. Based on this
finding, we adjusted the IgG3 level to one-fifth when compared with the
level of IgG1 and IgG2.
To prevent agglutination of antigen-positive RBCs, blood group
A1 (ABO*A1/O.01) and B (ABO*B/O.01) reagent RBCs were fixed as
described by Hult et al., except for the glutaraldehyde concentration,
which was 0.05%, and diluted to 1  108 RBCs/ml in ID-CellStab (ref.
005650, Bio-Rad Laboratories Inc.) [11].
For sensitization, 10 μl of A1 or B RBC suspension was incubated
with 100-μl plasma for 30 min at 37 C. RBCs were washed in PBS
and incubated with 100-μl diluted anti-human IgG1, IgG2 or IgG3 for
30 min at RT. For fluorescent staining, RBCs were washed in PBS and
incubated with 100-μl donkey anti-mouse in the dark for 30 min at
RT. RBCs were washed and the pellet was resuspended in 400-μl BD
FACSFlow Sheath Fluid (ref. 342003).
Twenty thousand events were analysed (BD FACSCanto). Log fluo-
rescence data were gated on a linear forward scatter versus side scatter
plot. A negative control plasma (AB donor) and a positive control plasma
(high titre anti-A/-B, O donor) were used in all setups. A cut-off was set
at 0.5% positive (sensitized RBCs) on the negative control.
Results of flow cytometry were expressed in two statistics, as per-
centage positive events (%Positive) and median fluorescence intensity
(MFI) determined on all events. The amount of ABO antibodies binding to
each RBC was determined semi-quantitatively as the signal-to-noise
(S/N) ratio (sample MFI/negative control MFI). The S/N ratio of the posi-
tive control was used to calibrate results between setups to adjust for
any differences between runs, for example, background fluorescence
from reagent RBCs following fixation. A multiplication algorithm was used
to express the final results: %Positive events were multiplied with the
S/N ratio [12]. This was done to account for samples where a decrease in
%Positive was not reflected in a decrease in S/N ratio and vice versa [12].
Using this multiplication algorithm improved correlation with haemolysis

F I G U R E 2 Comparison of IgG subclasses of maternal anti-A/-B at first trimester (a), newborns with haemolysis (cases, A-newborns: n = 9; B-
newborns: n = 9) and without (controls, A-newborns: n = 21; B-newborns: n = 6) and at birth (b), newborns with haemolysis (cases, A-newborns:
n = 23; B-newborns: n = 15) and without (controls, A-newborns: n = 30; B-newborns: n = 8)). The IgG3 level is adjusted for the five times higher
S/N ratio
ABO HAEMOLYTIC DISEASE OF THE NEWBORN 419

F I G U R E 3 Cut-off for IgG1 anti-A at first trimester (a) was 30.7 with a sensitivity of 89%, specificity of 48% and Youden-index of 0.37. Cut-
off for IgG1 anti-B was 78 with a sensitivity of 100%, specificity of 83% and Youden-index of 0.83. At birth (b) cut-off for IgG1 anti-A was
286 with a sensitivity of 87%, specificity of 80% and Youden-index of 0.70. Cut-off for IgG2 anti-B was 897 with a sensitivity of 93%, specificity
of 88% and Youden-index of 0.81. All data are derived from arbitrary units determined by flow cytometry

and linearity with the maternal IgG titre compared to the use of the S/N
ratio. These semi-quantitative results were expressed in arbitrary units,
and for convenience, named IgG1, IgG2 and IgG3.
Ethics
The study was approved by Danish Data Protection Agency
(RH-2017-295) and the Regional Scientific Ethical Committee of the
Capital region of Denmark (H-17029655). Verbal and written consent
were obtained from the women and parents of the newborns.
Statistical analyses
Statistical differences between groups were assessed using Pearson
chi-squared test or Fisher’s exact test (if the expected count is less
than five) for categorical variables, the Wilcoxon signed-rank
test for paired continuous variables (Tables S1 and S2) and
Mann–Whitney U test for unpaired continuous variables. No correc-
tions were made to adjust probability values (p), as in this context,
we would not miss a possible effect, worthy of further investigation.
Antibody titres were transformed into a logarithmic scale for statistical
analyses [13].
420 KROG ET AL.

Sensitivity and specificity were determined by the ROC curve.
Box plots illustrate differences in arbitrary levels of maternal
subclasses.
The relationship between maternal IgG titre measured by SPRCA
determined in a previous study [6] and the flow cytometric subclass
determinations were examined by scatter plots and linear regression
analysis. Ideally, the routine IgG titre must reflect the quantity of all
clinically important subclasses. As IgG titres were expressed as log2
titres so were the flow cytometric results.
Statistical analyses were performed using IBM SPSS statistics 25.
Comparing arbitrary levels of maternal subclasses between the
first trimester and birth showed that the difference varied depending
on antibody specificity and subclass (Table S1). The level of maternal
anti-A IgG1 showed a significant increase from first trimester till birth
for both newborns with and without haemolysis. In contrast, the level
of maternal anti-B IgG2 decreases significantly between the first tri-
mester and birth for both newborns with and without haemolysis.
Based on a ROC curve analysis (Figure 3 and Table S2), predicting
haemolysis in A-newborns, the maternal anti-A IgG1 assay obtained
the highest accuracy: 60% in the first trimester (negative predictive
value (NPV) 91% and positive predictive value (PPV) 42%) and 83% at

RESULTS

We examined 152 samples from 76 mothers and their 76 newborns

divided into two groups: 38 cases (with haemolysis) and 38 controls
(without haemolysis).

Newborn characteristics

As shown in Table 1, newborns with the A2 subgroup, defined by the

1061delC SNP, were only found in newborns without haemolysis (6 of
30). The 131H allele defined by the 497A > G SNP in FCGR2A showed
no correlation to haemolysis (p = 0.79). For the secretor allele defined
by the 428G > A SNP in FUT2, we found the correlation to haemolysis
(p = 0.034). The frequency of the secretor phenotype was higher in
newborns with haemolysis (87%) than in the group without haemolysis
(74%) without achieving significance (p = 0.150). However, mothers of
secretors had a higher level of IgG1 than mothers of non-secretors
(p = 0.037) (Figure 1). Higher IgG2 was only observed in mothers of
secretor newborns without haemolysis. The occurrence of extreme out-
liers with high levels of IgG3 influenced the mean, and therefore, limited
the possibility of observing a tendency.

Determination of the maternal IgG subclasses

of anti-A/-B

Comparison of IgG1, IgG2 and IgG3 anti-A and anti-B

by flow cytometry

Detailed results of the flow cytometric IgG subclass determination of

maternal anti-A and anti-B are shown in Table S1. As seen in
Figure 2a, a considerable overlap shows that none of the anti-A sub-
class assays performed in the first trimester completely distinguished
newborns with and without haemolysis. In contrast, all subclass assays
of anti-B in the first trimester distinguished the two groups. At birth,
however, the anti-A IgG1 assay distinguished the two groups almost
F I G U R E 4 Scatter plots of maternal IgG1 (a), IgG2 (b) and IgG3
completely, while for anti-B, the IgG2 subclass assay distinguished the
(c) subclass levels in relation to IgG titre of cases (newborns with
groups (Figure 2b). As for the IgG3 assay at birth, anti-A distinguished haemolysis, n = 38; A-newborns: n = 23, B-newborns: n = 15) and
the two groups except from two outliers, both with the foetal A2 sub- controls (newborns without haemolysis, n = 38, A-newborns: n = 30,
group and, in contrast, only poorly for anti-B. B-newborns: n = 8)
ABO HAEMOLYTIC DISEASE OF THE NEWBORN
birth (NPV 89% and PPV 77%). In B-newborns, the highest accuracy
was found with the maternal anti-B IgG1 assay: 93% in the first tri-
mester (NPV 100% and PPV 90%) and with the IgG2 assay at birth:
91% (NPV 88% and PPV 93%).
Comparison of routine methods for total IgG (anti-A
and anti-B) and determination of IgG subclasses
by flow cytometry
The maternal anti-A and anti-B IgG subclasses were determined semi-
quantitatively by flow cytometry as well as by total IgG titre used in the
routine setting. A linear relationship was observed between the IgG titre
and the level of all subclasses (p ≤ 0.008) (Figure 4). The anti-A IgG1
assay achieved the best correlation coefficient (Figure 4a), whereas it
was the IgG2 assay for anti-B (Figure 4b). The linear relationship for
anti-A IgG3 was influenced by three extreme outliers (Figure 4c). One
was a mother to an A2 non-secretor newborn without observed
haemolysis. Two others were from mothers to A1 newborn secretors,
with observed haemolysis and receiving double phototherapy [6].
DISCUSSION
Newborn factors of potential importance for ABO-HDFN were exam-
ined in this study. Genetic variants of the FcγRIIa receptor, the secre-
tor phenotype and the ABO subgroup A2 were determined in
76 newborns: 38 newborns with haemolysis and 38 newborns with-
out haemolysis. In addition, the anti-A/-B IgG subclass profile of the
76 mothers was determined at first trimester and at birth.
We improved the previously reported 80% accuracy for the pre-
diction of ABO-HDFN at birth based on the maternal anti-A/-B IgG
titre [6] to 83% for anti-A and 91% for anti-B. This improvement was
achieved by separating results for maternal anti-A from results for
maternal anti-B and using the semi-quantitative IgG1 subclass deter-
mination for anti-A and the IgG2 subclass determination for anti-B.
None of the A2-newborns were affected; there was a correlation
between the A2 subgroup and newborns without haemolysis. This is
not surprising, as low antigen density in the A2 phenotype has been
shown to protect against antibody-mediated haemolysis [7, 14, 15].
However, the A2 phenotype of a newborn cannot be determined [15]
and here, we demonstrated the feasibility of using a genetic method.
We found no correlation between haemolysis and the FcγRIIa
receptor variants 131H and 131R, nor did the homozygosity of any of
the variants show a correlation to haemolysis. The difference in recep-
tor affinity between the two variants might, therefore, play a less
important role in immune-mediated haemolysis, in agreement with
recent findings from other studies [16, 17].
We found a significantly higher level of IgG1 anti-A/-B in
mothers to newborns with the secretor phenotype. A possible
explanation for the higher level of specifically IgG1 could be that
A and B substances produced by the secretor foetus are liberated
to the maternal immune system and preferentially induce an IgG1
421
production. The secretor phenotype, albeit based on the observa-
tion of very few cases, seems to protect the child from developing
severe hyperbilirubinaemia reflected in the prescription of less
intense light exposure (single light vs. double/triple light). Secre-
tors were prescribed single light in 17 out of 33 cases (52%) com-
pared to only one of five (20%) in non-secretors (data not shown) [6].
We thus hypothesize a dual role of secretor status (i) stimulating the
maternal immune system and (ii) at the same time, in the foetus,
reducing the destructive capacity of maternal antibodies by the
secreted antigen acting as a decoy diverting maternal antibodies
from foetal RBCs.
Though the amount of IgG2 greatly exceeded IgG1 in especially
the first trimester, a linear correlation between the total maternal IgG
titre and the anti-A/-B level of both IgG1 and IgG2 subclasses was
found at birth. This suggests that the routine IgG titre reflects the
sample level of IgG1 and IgG2 subclasses. However, three extreme
outliers in the IgG3 assay were not reflected by the overall IgG titre,
indicating that the IgG3 subclass determination may be useful in
predicting newborn haemolysis. This is supported by the fact that two
newborns of mothers with high levels of IgG3 belonged to the A1 sub-
group and were treated with double light at phototherapy [6], while
no haemolysis was observed for the third newborn belonging to the
A2 protecting subgroup.
Others have revisited ABO-HDFN in order to assess the frequency
of the disease and at the same time identify predictive parameters
[18, 19]. They both found the direct antiglobulin testing of the newborns
more informative than the maternal anti-A/B IgG titre [18, 19]. Our
approach with IgG subclass determination of maternal anti-A/B seems
to point in a new direction for predicting haemolysis in the newborn.
When comparing the maternal IgG subclasses between the
groups of newborns with and without haemolysis, distinct (reaction)
patterns of anti-A and anti-B were found: (i) in the first trimester, all
anti-A IgG subclasses distinguished the groups poorly; in contrast,
all anti-B IgG subclasses almost separated the groups and (ii) at birth,
the anti-A IgG1 separated groups significantly, in contrast to anti-B
where IgG2 did so.
Only the level of anti-A IgG1 increased significantly during pregnancy.
We expected a decrease in the IgG1 level between first trimester and birth
since a previous study showed that the maternofoetal transport of IgG1
has the highest capacity: IgG1 > IgG4 > IgG3 > IgG2 [20]. It also showed
that maternal IgG1 and IgG2 levels decreased by half at birth [20].
The IgG subclasses of maternal anti-B resulted in a completely
different distribution between groups. We showed comparable flow
cytometric signals for IgG1 and IgG2, while the signal from IgG3 was
five times higher, probably due to the rather large hinge region of
anti-IgG3, which increased the number of available binding sites for
anti-IgG3. Under the cautious assumption that each subclass
measurement of anti-A and anti-B are comparable, the following
observations were made: In mothers to newborns with haemolysis,
the IgG1 and IgG3 flow cytometric signals of anti-B were half of
anti-A, whereas the IgG2 level of anti-B and anti-A were almost
identical. At the same time, in mothers to newborns without
haemolysis, the IgG2 level of maternal anti-B was five times lower
422
compared to anti-A. The latter is in agreement with reports of
O-individuals having a lower quantity of anti-B than anti-A [15]. In
agreement with other studies, the frequency of B-newborns with
haemolysis (39%) was higher compared to newborns without
haemolysis (21%) [5, 21].
In this study and our previous study [6] in combination, we
made three important observations: (i) a higher frequency of blood
group B was found in newborns with haemolysis compared with
newborns without haemolysis [6], (ii) comparing newborns with and
without haemolysis, the ratio of the maternal anti-B IgG2 levels was
12:1, while the ratio of anti-A IgG2 was 2:1 and (iii) a significant
association was found between the frequency of foetal secretor
allele and haemolysis. Since statistical significance was found only at
the allele level, it could be that the correlation actually reflects the
maternal secretor status and that this explains the effect on the
amount of ABO antibodies and IgG subclasses formed. A previous
study found that secretor status significantly affects the level of
anti-B [22]. Further studies should investigate the influence of the
secretor status of the mother to improve our understanding of the
risk of developing HDFN.
In conclusion, we observed a significant correlation between
newborns with haemolysis and the secretor allele. This study also
points out that anti-A and anti-B antibodies should be regarded as dis-
tinct entities due to both analytical and biological differences. In the
first trimester, prediction of A-newborns at risk of developing ABO-
HDFN was less accurate than of B-newborns. Predicting affected
A-newborns by the maternal IgG1 subclass determination achieved
an accuracy of 60% in the first trimester and 83% at birth. For
B-newborns, the maternal IgG1 subclass determination achieved an
accuracy of 93% in the first trimester and the maternal IgG2 subclass
determination achieved an accuracy of 91% at birth.
ACKNOWLEDGEMEN TS
We wish to thank our colleagues in the Serology Laboratory at the
Department of Clinical Immunology, Rigshospitalet. Special thanks to
Delphine Bonneau for her initial work in developing the flow
cytometric analysis. We also thank Bo Mølholm Hansen, Kristian
Vestergaard Jensen, Per Albertsen, Finn Ebbesen, Thomas Bergholt
and Steen Axel Hertel for including the participants.
G.R.K. designed, performed the research and wrote the first draft
of the manuscript; M.L.D. contributed to the design/editing of the
manuscript; A.T.H. contributed with essential work in the laboratory
and H.L., F.B.C. and M.H.D. supervised, reviewed and edited the
study/manuscript.
CONF LICT OF IN TE RE ST
All authors have declared no conflict of interest.
ORCID
Grethe Risum Krog https://orcid.org/0000-0002-9663-8476
Henriette Lorenzen https://orcid.org/0000-0001-6175-439X
Frederik Banch Clausen https://orcid.org/0000-0003-2487-5373
KROG ET AL.
RE FE RE NCE S
1. Kumpel BM, van de Winkel JG, Westerdaal NA, Hadley AG,
Dugoujon JM, Blancher A. Antigen topography is critical for interac-
tion of IgG2 anti-red-cell antibodies with Fc gamma receptors. Br J
Haematol. 1996;94:175–83.
2. de Haas M, Thurik FF, Koelewijn JM, van der Schoot CE. Haemolytic
disease of the fetus and newborn. Vox Sang. 2015;109:99–113.
3. Donneborg ML, Vandborg PK, Hansen BM, Rodrigo-Domingo M,
Ebbesen F. Double versus single intensive phototherapy with LEDs in
treatment of neonatal hyperbilirubinemia. J Perinatol. 2018;38:154–8.
4. Voak D, Bowley CC. A detailed serological study on the prediction
and diagnosis of ABO haemolytic disease of the newborn (ABO HD).
Vox Sang. 1969;17:321–48.
5. Bakkeheim E, Bergerud U, Schmidt-Melbye AC, Akkök ÇA, Liestøl K,
Fugelseth D, et al. Maternal IgG anti-A and anti-B titres predict outcome
in ABO-incompatibility in the neonate. Acta Paediatr. 2009;98:1896–901.
6. Krog GR, Donneborg ML, Hansen BM, Lorenzen H, Clausen FB,
Jensen KV, et al. Prediction of ABO hemolytic disease of the new-
born using pre- and perinatal quantification of maternal anti-A/anti-B
IgG titer. Pediatric Research. 2020. https://doi.org/10.1038/
s41390-020-01232-5
7. Voak D. The pathogenesis of ABO haemolytic disease of the
newborn. Vox Sang. 1969;17:481–513.
8. Brouwers HA, Overbeeke MA, van Ertbruggen I, Schaasberg W,
Alsbach GP, van der Heiden C, et al. What is the best predictor of
the severity of ABO-haemolytic disease of the newborn? Lancet.
1988;2:641–4.
9. Krog GR, Rieneck K, Clausen FB, Steffensen R, Dziegiel MH. Blood
group genotyping of blood donors: validation of a highly accurate
routine method. Transfusion. 2019;59:3264–74.
10. Nielsen LK, Green TH, Norderhaug L, Sandlie I, Dziegiel MH. Func-
tional in vitro studies of recombinant human immunoglobulin G and
immunoglobulin A anti-D. Transfusion. 2007;47:306–15.
11. Hult AK, Olsson ML. Many genetically defined ABO subgroups exhibit
characteristic flow cytometric patterns. Transfusion. 2010;50:308–23.
12. Shooshtari P, Fortuno ES 3rd, Blimkie D, Yu M, Gupta A,
Kollmann TR, et al. Correlation analysis of intracellular and secreted
cytokines via the generalized integrated mean fluorescence intensity.
Cytometry A. 2010;77:873–80.
13. Reverberi R. The statistical analysis of immunohaematological data.
Blood Transfus. 2008;6:37–45.
14. Breimer ME, Molne J, Norden G, Rydberg L, Thiel G, Svalander CT.
Blood group A and B antigen expression in human kidneys correlated
to A1/A2/B, Lewis, and secretor status. Transplantation. 2006;82:
479–85.
15. Anstee DJ, Klein HG, Mollison PL. Mollison’s blood transfusion in
clinical medicine. 11th ed. Malden, MA: Blackwell; 2005.
16. Bruhns P, Iannascoli B, England P, Mancardi DA, Fernandez N,
Jorieux S, et al. Specificity and affinity of human Fc gamma receptors
and their polymorphic variants for human IgG subclasses. Blood.
2009;113:3716–25.
17. Branch DR, Hellberg A, Bruggeman CW, Storry JR, Sakac D,
Blacquiere M, et al. ABO zygosity, but not secretor or fc receptor
status, is a significant risk factor for IVIG-associated hemolysis.
Blood. 2018;131:830–5.
18. Das S, Shastry S, Chakravarthy PK, Baliga PB. Clinical implication
of immunohaematological tests in ABO haemolytic disease of
newborn: revisiting an old disease. Transfus Med. 2021;31:30–5.
19. Matteocci A, De Rosa A, Buffone E, Pierelli L. Retrospective analysis
of HDFN due to ABO incompatibility in a single institution over
6 years. Transfus Med. 2019;29:197–201.
20. Malek A, Sager R, Kuhn P, Nicolaides KH, Schneider H. Evolution of
maternofetal transport of immunoglobulins during human pregnancy.
Am J Reprod Immunol. 1996;36:248–55.
ABO HAEMOLYTIC DISEASE OF THE NEWBORN 423

21. Kaplan M, Hammerman C, Vreman HJ, Wong RJ, Stevenson DK.

Hemolysis and hyperbilirubinemia in antiglobulin positive, direct ABO
blood group heterospecific neonates. J Pediatr. 2010;157:772–7.
22. Grundbacher FJ, Shreffler DC. Effects of secretor, blood, and serum
groups on isoantibody and immunoglobulin levels. Am J Hum Genet.
1970;22:194–202.
How to cite this article: Krog GR, Lorenzen H, Clausen FB,
Hansen AT, Donneborg ML, Dziegiel MH. ABO haemolytic
disease of the newborn: Improved prediction by novel
integration of causative and protective factors in newborn and
mother. Vox Sang. 2022;117:415–23.

SUPPORTING INFORMATION
Additional supporting information may be found online in the
Supporting Information section at the end of this article.
Received: 18 June 2021 Revised: 24 August 2021 Accepted: 29 August 2021

DOI: 10.1111/vox.13204

ORIGINAL ARTICLE

Molecular blood group screening in Omani blood donors

Arwa Z. Al-Riyami1 | Dina Al Hinai2 | Mohammed Al-Rawahi3 | Saif Al-Hosni1 |

4 3 3
Shoaib Al-Zadjali | Ali Al-Marhoobi | Murtadha Al-Khabori |
Hamad Al-Riyami5 | Gregory A. Denomme6

1
Department of Haematology, Sultan Qaboos
University Hospital, Muscat, Oman Abstract
2
College of Medicine and Health Sciences, Background and Objectives: Blood group genotyping has been used in different
Sultan Qaboos University, Muscat, Oman
3
populations. This study aims at evaluating the genotypes of common blood group
Department of Haematology, College of
Medicine and Health Sciences, Sultan Qaboos antigens in the Omani blood donors and to assess the concordance rate with
University, Muscat, Oman obtained phenotypes.
4
Sultan Qaboos Comprehensive Cancer
Material and Methods: Blood samples from 180 Omani donors were evaluated.
Centre, Muscat, Oman
5
Department of Genetics, College of Medicine Samples were typed by serological methods for the five blood group systems MNS,
and Health Sciences, Sultan Qaboos RH (RHD/RHCE), KEL, FY and JK. Samples were genotyped using RBC-FluoGene
University, Muscat, Oman
6
vERYfy eXtend kit (inno-train©). Predicted phenotypic variants for 70 red blood cell
Diagnostic Laboratories, Versiti Blood Center
of Wisconsin, Milwaukee, Wisconsin, USA antigens among the MNS, RH (RHD/RHCE), KEL, FY, JK, DO, LU, YT, DI, VEL, CO
and KN blood group systems were assessed.
Correspondence
Arwa Z. Al-Riyami, Department of Results: Simultaneous phenotype and genotype results were available in 130
Hematology, Sultan Qaboos University subjects. Concordance rate was >95% in all blood group systems with exception of
Hospital, P.B. Box; 38, Al Khod, Muscat
123, Oman. Fy(b+) (87%). Homozygous GATA-1 mutation leading to erythroid silencing
Email: arwa@squ.edu.om FY*02N.01 (resulting in the Fy(b-)ES phenotype) was detected in 81/112 (72%) of
genotyped samples. In addition, discrepant Fyb phenotype/genotype result was
Funding information
Sultan Qaboos University, Grant/Award obtained in 14/112 samples; 13 of which has a heterozygous GATA-1 mutation and
Number: IG/MED/HEAM/18/01
one sample with a wild GATA genotype. D and partial e c.733C>G variants
expressing the V+VS+ phenotype were found in 22/121 (18.2%) and 14/120
(11.7%) of the samples, respectively. Di(a-b+), Js(a-b+), Yt(a+b-) and Kn(a+b-) geno-
type frequencies were 99.4%, 95.8%, 91.9% and 97.7%, respectively.
Conclusion: In conclusion, we report a high frequency of FY*02N.01 allele due to
homozygous c.-67T>C GATA-1 single-nucleotide variation. This is the first study
reporting the detailed distribution of common and rare red cell genotypes in Omani
blood donors.

KEYWORDS
blood donor, Omani, phenotype, red cell genotyping

I N T R O D U CT I O N units for alloimmunized patients. Serological methods have some limi-

tations for which genotype-based testing provides a supplement. For
Blood banks utilize manual and automated methods for red blood cell some antigens, phenotyping cannot be used if the patient has a posi-
(RBC) phenotyping to screen blood donations for antigen-negative tive direct antiglobulin test or underlying autoantibodies, or there is a

424 © 2021 International Society of Blood Transfusion. wileyonlinelibrary.com/journal/vox Vox Sanguinis. 2022;117:424–430.
RED BLOOD CELL GENOTYPE AMONG OMANIS
lack of commercial antisera for some RBC antigens [1]. Red cell
genotyping is useful in these situations to select antigen-negative
units for patients requiring transfusion support [2]. Moreover, it is an
efficient method to identify RBC units with rare or uncommon antigen
phenotypes [3]. As a result, RBC genotyping techniques are used in
blood centres to complement traditional serological methods for pre-
transfusion testing, to provide the antigen-negative units for chroni-
cally transfused and multi-alloimmunized patients [4].
Many of the clinically significant antigens are encoded by alleles
defined by single-nucleotide variation (SNVs) predicting the RBC
phenotype [4]. Predicting the RBC phenotype from the genotype is
relatively easy for antigens encoded directly by blood group-specific
genes and can be determined by a wide variety of methods [5].
However, the results of molecular typing should be scrutinized in the
context of the serologic results when available [6]. Moreover, it is
essential to realize that phenotype–genotype discrepancies are the
hallmark that either result should be questioned [6]. Such methods
should be tested in different populations considering that each ethnic
population has polymorphisms that need to be accounted for in blood
genotyping arrays [7].
There are few publications on the blood group phenotype–
genotype concordances among the Arab population, namely, Saudi
and Kuwaiti Arabs [8, 9]. To date, there is no published RBC genotype
data for the Omani population. Utilizing genotyping techniques has a
significant implication considering the high frequencies of
haemoglobinopathies and the rate of alloimmunization in these in
Oman [10, 11]. This study aimed at assessing phenotype–genotype
correlation of RBC antigens among the Omani blood donors. A sec-
ondary aim was to assess the population frequency of rare blood
group genotypes that are not routinely tested by serology.
MATERIALS AND METHODS
Sampling
Within the context of searching for a suitable genotyping platform in
the Omani subjects, this study evaluated the RBC-FluoGene vERYfy
eXtend kit (inno-train© Diagnostik, Inc, Clinton, NY) in a representa-
tive sample of Omani blood donors.
Omani male and female blood donors were interviewed and con-
sented to be enrolled in this study. Exclusion criteria included
non-Omani donors and any donor with a history of recent transfusion
within 12 months period. Two ethylenediaminetetra-acetic acid (EDTA)
samples were collected from the donors. Ethical approval was obtained
from the ethics committee at the College of Medicine and Health
Sciences at the Sultan Qaboos University.
Serological methods
Samples were serologically phenotyped within 24 h of collection using
the automated ID-system gel cards for the following blood group
425
antigens; MNS (M, N, S, s), RhD, RhCE (C, E, c, e), KEL (K, k, Kpa, Kpb),
JK (Jka, Jkb), FY (FYa, FYb), LE (Lea, Leb) and LU (Lua, Lub). RBC
phenotyping for other blood group systems was performed as per the
manufacture instructions (DIaMed-ID Microtyping System, Bio Rad©,
Cressier, Switzerland), and as previously described [12].
The “DiaClon ABD-confirmation for donors” ID-cards (BioRad©,
Cressier Switzerland) were used to determine the ABO and D blood
groups. These detect DVI phenotype, and assign “Rh positive” status
to those react positive. Known positive and negative samples are
included for each test. A 5% RBC suspension is prepared by mixing
25 μl of donor’s packed cells with 0.5 ml of ID-Diluent 2 solution
(BioRad©). About 12.5 μl of the donor’s red cell suspension is then
added to the micro-tubes of the ID-card. The ID-card is then cen-
trifuged at 900 rpm for 10 min in the ID-Centrifuge, and results are
recorded visually.
As per the manufacturer’s instructions, a + to ++ reactions indi-
cate a possible weak or partial D. These weak positive reactions are
further verified using the “ID-DiaClon Anti-D” with the utilization of a
monoclonal anti-D formulated to characterize weak D’s and DVI. A
0.8% red cell suspension is made by mixing 1.0 ml of ID-Diluent 2 with
10 μl of packed red cells. A 50 μl of red cell suspension is added to the
appropriate micro-tube and mixed with 50 μl of “ID-DiaClon Anti-D”
for confirmation of weak D by indirect antiglobulin test. The ID-card
is incubated for 15 min at 37 C in the ID-incubator. The ID-card is
then centrifuged for 10-min in the ID-Centrifuge and the results are
then read and recorded. A positive reaction is defined by agglutinated
cells forming a red line on the surface of the gel or agglutinates
dispersed in the gel. RhD positive is defined by ++++ reaction,
while Rh weak D/DVI is defined by a reaction that ranges between +
and +++. Known weak D positive and negative samples are included
to validate the results. For the extended phenotype, Profile I, II and III
antigen cards were used.
Molecular methods
High-molecular-weight deoxyribonucleic acid (DNA) was extracted
from the EDTA-anticoagulated whole blood samples using the
QIAamp DNA blood mini kit (Qiagen, Inc., Valencia, CA). The concen-
tration of the DNA sample was adjusted to reach approximately
1 ng/μl. A DNA extraction was considered acceptable provided that
the yield is greater than 10 ng/μl and high purity (OD260/280 nm
ratio: 1.7–2.0). Extracted DNA was stored at 80 C until testing.
The DNA samples were tested in batches using the RBC-
FluoGene vERYfy eXtend kit (inno-train© Diagnostik, Inc). The kit
identifies 70 RBC antigens and phenotypic variant polymorphisms in
12 blood group systems. In the RH (RHD/RHCE) blood group
system; C, c, E, e were tested. Other blood group systems and anti-
gens tested were MNS (GYPA*01, GYPA*02, GYPB*03, GYPB*04), KEL
(KEL*01, KEL*02, KEL*03, KEL*04, KEL*06, KEL*07), JK (JK*01, JK*02),
FY (FY*01, FY*02, FY*01N.01/FY*01N.01, FY*02W.01/FY*02W.02),
DO (DO*01, DO*02, DO*02.-04, DO*01.-05), LU (LU*01, LU*02), YT
(YT*01, YT*02), DI (DI*01, DI*02), VEL (VEL*01/VEL*01W.01/
426 AL-RIYAMI ET AL.

VEL*01W.02), CO (CO*01.01, CO*02) and KN (KN*01, KN*02). More-
over, the kit screens for SNVs in RHD exons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
including RHDψ, RHD*DNB, RHD*DcatVII, RHD*DHMi, RHD*DAU,
RHD*697A, RHD*697C, RHD*weak D type 1, 1.1, 2, 3, 4.0, 4.1, 4.2/4.3,
5, 11, 14, 15, 17, RHD*DEL1, RHD*DEL8 (c.486+1A), along with RHCE
SNVs: C(RHCE*307T), Cw(RHCE*122G), c(RHCE*307C), E(RHCE*676C), e
(RHCE*676G), RHCE*733G, and RHCE*1006T.
Testing was performed as per the manufacturer’s instructions.
We have verified that the DNA concentration was adequate on all the
samples before the run. The methodology is based on sequence-
specific priming of an amplified defined DNA sequence polymerase
chain reaction (PCR). Detection of the PCR products is performed by
measuring fluorescence signals. Fluorescence detection is performed
as an endpoint method in the inno-train FluoVista fluorescence reader.
Analysis of fluorescence difference is performed using FluGene analy-
sis software. Results for all blood group systems were expressed in
accordance with the ISBT nomenclature of blood groups, alleles and
phenotypes [13]. Rare blood group donors are defined as those that
are negative for “high-incidence” antigens (<1:1000).
Genotype and phenotype results were compared and assessed of
any discordant results. A discrepancy was defined as either positive
genotype results with negative serology, or vice versa. The frequency
of the above phenotypes in the Omani population was compared with
those reported in Caucasians, African Americans and other racial
groups where information is available. Results were analysed for all
donors regardless of gender. The genotype results obtained in the DI,
DO, CO, KEL, YT, VEL and KN blood group systems were compared
with reported frequencies in other ethnic populations.
Statistical analysis
Frequencies of antigens and or alleles were estimated using direct
counting and presented as percentages. Frequencies of system-based
antigens and or alleles were also estimated using direct counting after
cross-tabulation. Concordance between the phenotypes and the
genotypes was assessed using unweighted Cohen’s Kappa (K) for two
evaluators. The concordance rate was calculated as the number of
phenotype–genotype results that are concordant over the total num-
ber of phenotype–genotype results that were assessed. All analyses
were performed using the R program [14].
RE SU LT S
A total of 180 Omani donors were invited to participate in this study.
A total of 175 donors had genotyping studies performed, of which
130 donors had extended phenotype test results available. A total of

TABLE 1 Frequency of antigens by genotype and phenotypes

Prediction by genotype Phenotype Concordance

System Antigen Pos (%) Pos (%) rate†
RHD D (n = 121) 93.28 90 100
RHCE C (n = 126) 71.15 71.67 98
E (n = 129) 29.65 24.44 98
c (n = 130) 77.46 75 99
e (n = 120) 93.13 95 96
KEL K (n = 124) 7.41 10 98
k (n = 131) 97.66 100 98
Kpa (n = 129) 0.58 1.67 98
Kpb (n = 132) 99.42 100 100
JK Jka (n = 127) 77.65 81.67 98
Jk (n = 125)
b
72.89 70 97
MNS M (n = 131) 91.37 92.22 100
N (n = 131) 43.10 44.44 98
S (n = 129) 67.25 69.44 99
s (n = 131) 80.46 81.11 98
LU Lua (n = 132) 2.30 3.89 97
Lub (n = 132) 100 100 100
FY Fya (n = 123) 10.3 11.67 99
Fy (n = 121)
b
21.21 16.67 87

Note: Concordance rate was calculated as follows = n compatible/[n compatible + discordant]*100. Concordance >95% was considered acceptable.
†
Excluding 81 genotype results (in 33 samples) that did not meet fluorescent threshold values, resulting into “questionable results” report and 43 genotype
results (in 39 samples) that were not reported due to failed internal control.
RED BLOOD CELL GENOTYPE AMONG OMANIS 427

T A B L E 2 Samples with discordant results between samples simultaneously tested for genotype by the inno-train© system and
phenotype (n = 21)

Number
Finding Antigen of cases Results Comment
Discrepancy between e 1 genotype: pos serology: neg Possible e-silencing variant
genotype and E 1 genotype: pos serology: neg Possible E-silencing variant
phenotype, b
Possible variants Jk 1 genotype: pos serology: neg Possible JKb-silencing variant
†
S 2 genotype: pos serology: neg Possible S-silencing variant
U+var (NY)
s‡ 2 genotype: pos serology: neg Possible s-silencing variant
b§
Fy 14 genotype: pos serology: neg Possible Fyb variant

Note: Samples are planned for sequencing studies.

†
s results; genotype: neg, serology: neg.
‡
S results; genotype: pos, serology: pos.
§
Further elaborated in Table 4.

3960 RBC phenotype data of 22 antigens, and 7000 genotype data of T A B L E 3 Variants within the RH (RHD/RHCE) blood group
systems (n = 36)
40 alleles were evaluated. The DNA concentration of the samples
ranged between 10 and 54 ng/μl. There were 81 genotype results in Variant Number
33 samples that did not meet the expected fluorescent threshold RhD variant (serology 1+) 6
values resulting in “questionable results.” There was a total of RHD*DV (serology 1+) 5
43 genotype results in 39 samples that flagged for failed internal con- RHD*DNB (serology 1+) 1
trol at individual wells. Repeat testing for the genotype resolution RHDψ (serology 1+) 1
could not be performed due to limited availability of reagents. In total,
Non-functional RHD (serology 0) 4
72 genotype results (1% of total) were not included in the analysis.
Likely a weak D (serology 1+) 5
Phenotype frequencies were obtained for all tested antigens †
V+VS+ (partial e) 14
and were compared with obtained genotypes. A >95% concordance
rate between the genotype and serological phenotype was obtained Note: Samples are planned for sequencing studies.
†
b Samples have E-e+ phenotype.
in all tested blood group antigens with the exception of Fy (concor-
dance rate of 87%, Table 1). Overall agreement between phenotype
T A B L E 4 Identified Duffy genotypes by the inno-train©
and genotype data was 95%. Moderate agreement was obtained system (n = 112).†
between the genotype and obtained phenotype for Fyb (K
Number
coefficient = 0.53).
Genotype Serology of cases
Discordances between genotype and obtained phenotype were
FY*02N.01/FY*02N.01 Fy(a-b-) 81
seen in 50 phenotype/genotype combinations in 36/130 (28%) sam-
FY*02/FY*02N.01 Fy(a-b+) 6
ples. There was a total of seven samples that were predicted to have
FY*01/FY*01N.01 (rare allele) Fy(a+b-) 4
underlying variants associated with e, E, Jkb, S and s phenotypes
(Table 2). Three samples had negative phenotype results by serology FY*01/FY*01 Fy(a+b-) 3

despite a positive genotype for e, E and Jkb, raising a suspicion of pos- FY*01/FY*02 Fy(a+b+) 3

sible silencing variants. Two samples had a positive S genotype and a FY*02/FY*02 Fy(a-b+) 1
negative phenotype by serology, suggesting the presence of an FY*02/FY*02N.01 ? novel alle Fy(a-b-) 13
S-silencing SNV (e.g., c.270+5t). Two samples had a positive FY*01/FY*02 ? novel allele Fy(a+b-) 1
s genotype and a negative phenotype by serology suggesting an
Note: Bolded rows represent discrepancies in the Fyb phenotype/
s-silencing SNV. There were 14 samples that had discrepancy genotype results. Samples are planned for sequencing studies.
†
results in the FY*02 allele with positive genotype and negative phe- Excluding 16 samples with questionable results and 2 samples with
notype (see below). The rest of discordances were in samples that discrepant results in the Duffy blood group system due to genotyping
error (negative genotype/positive phenotype results could not be
had positive phenotype for the detected antigens and negative
repeated due to the lack of needed reagents).
genotype suggesting a genotyping error requiring repeat of testing,
which could not be performed due to the limited reagents present
as part of the grant. phenotype reaction of 1+ by serology, with exception of four samples
RhD variants were confirmed in 22 samples, including RHD*DV, that had 0 reaction. The inno-train© system could not assign an RhD
RHD*DNB and RHD*ψ (Table 3). All these samples had an RhD status in these four samples raising the suspicion of a non-functional
428
RHD. There were 14 samples that had V+VS+ (c.733C>G) SNV and a
E-e+ phenotype indicating the presence of a possible partial e.
Table 4 displays the identified variants in the FY blood group sys-
tem (n = 112). Majority of the genotyped samples (81/112, 72%) had
a Fy(a-b-) phenotype determined by serology, and was consistent with
a homozygous GATA-1 SNV genotype (FY*02N.01). Heterozygous
GATA-1 SNV was also found in 10 samples. In 14 samples, the Fy(b-)
phenotype determined by serology did not match the blood type
inferred by genotype raising suspicion of a potential underlying novel
variant. In 13 individuals, the serological phenotype was Fy(a-b-) while
the inferred genotype was FY*02/FY*02N.01 with a heterozygous
GATA-1 SNV. In one individual, the serological phenotype was Fy(a+b-),
while the inferred genotype was FY*01/FY*02 with a wild type GATA-1.
Table S1 reports the extended phenotype frequencies by serol-
ogy in comparison to what has been reported in other populations.
We had one sample that had a phenotype of C-c-E-e-, confirmed by
genotyping studies. Tables S2 and S3 display genotypes and allele
combination of blood group systems that were obtained as a result
from the inno-train© system and were not attainable otherwise by
serological testing due to the unavailability of the phenotyping
reagents. We report one sample with KEL*06/KEL*06 genotype. In
addition, we report 3 null genotypes in our tested donors; namely,
Js(a-b-), Yt(a-b-) and Kn(a-b-).
DISCUSSION
To the best of our knowledge, this is the first study to evaluate RBC
genotypes in Omani population. An overall >95% concordance
between obtained genotype and serological phenotype was obtained
for all antigens with exception of Fyb. Many studies have reported
low rates of discordance between serology and genotype [15–17].
Previous large-scale donor genotyping has shown overall concordance
between molecular and serology testing of >95% for C, Jka, Jkb, M
and N antigens [18]. However, one of the major limitations of
targeted genotyping is that it can only identify genes encoding the
antigens, rather than the expression pattern of the allele [19]. False
positive results can result from silent or null alleles [20].
The discrepancies that were found may also be due to underlying
genetic variation that is not targeted by the RBC genotype array, par-
ticularly SNV arrays, and therefore resulted in incorrect RBC pheno-
type assignment. This was predicted in seven samples with underlying
variants in e, E, Jkb, S and s. Finally, non-concordance can be resulted
from serologic typing error that is liable for clerical or other
preanalytical errors that may be detected by genetic methods [19].
Our study reported several variants within the RH blood group
system, including RHD*DV, RHD*DNB and RHDψ. The RHDψ was fre-
quently observed in blacks, and was described in the Tunisian and
other Arab populations [21–23]. Rest of the variants were of cases in
which RHD could not be genotyped by the software, likely due to the
lack of a known exon pattern of the data. RHCE*ceVS variants with
RHCE*733G in exon 5 were reported at higher frequencies than what
has been reported in Kuwaitis (5.7%) [24]. It was interesting to see
AL-RIYAMI ET AL.
that most of these samples were serologically phenotyped as 1+,
including the sample with RHDψ. Variant D phenotypes can either
have reduced RhD quantities at the red cell surface (weak D) or lac-
king D-epitopes (partial D) [25]. Genotyping has the advantage of con-
firming weak serology results such as those generated by variant D
phenotypes, and sequencing studies will be required to confirm these
findings. Non-reportable results could be resolved by updating the
software with information on D variants present among Omanis;
hence, it is very important to further assess such variants utilizing
sequencing techniques.
Our results reveal that homozygous GATA-1 SNV resulting in a
Fy(a-b-) phenotype is common among Omanis, and reached a fre-
quency of 72%. This mutation is reported at higher frequencies com-
pared to Kuwaitis (15.2%) [24]. This frequency is also higher
compared to what has been described in donors of other Arabic
descents (2%) [23]. The Fy(a-b-) phenotype is common among the
African population [26], and found at a greater than 80% in African
Americans and more than 95% of West Africans [27]. In the homozy-
gous state, it leads to the lack of Fy antigens on RBC surface. As a
result, Africans with the Fy(a-b-) phenotype rarely make anti-Fyb anti-
bodies [28].
There were 13 samples that had phenotype–genotype discrep-
ancy with Fy(a-b-) phenotype, a negative FY*01 genotype, a positive
FY*02 genotype, and with a heterozygous GATA-1 SNV. This finding
suggests the presence of another SNV responsible for silencing Fyb
expression. Another possibility is a weak Fy(b+) phenotype that appeared
as Fy(a-b-). However, these findings need to be confirmed using DNA
sequencing methods. This is planned in collaboration with an external ref-
erence laboratory and results will be published in a separate manuscript.
Finally, we report the frequencies of antigens as obtained by
genotyping studies in the DI, DO, CO, KEL, YT and KN blood group
systems. The frequency of the DI*01 antigen is higher than what has
been described in the European or African ancestry, and is close to
what has been reported in the indigenous people of North and South
America [29]. When compared to what has been described in other
Arab populations and Iranians, where Js(a-b+) predominates [23], we
report higher frequency of the KEL*6, and one case of KEL*6/KEL*6
genotype. This allele is very rare within Caucasians (<0.01%) but pre-
sent in higher frequency within blacks [35]. Blood donors expressing
this allele has implication of risk of anti-Jsb alloimmunization, which
was previously described in our population [30]. We also report a
higher frequency of the YT*01/YT*01 genotype compared to what
has been described in other Arabian populations and Iranians, while
frequencies of the genotypes of the DO and CO blood group systems
was similar. These findings indicate the need of larger studies to
examine the frequencies of these genotypes in Omanis.
This is the first study that reports genotype frequencies among
Omani blood donors, including the weak D phenotypes and the
high rate of FY*02N.01 as a cause of the Fy(b-)ES phenotype.
Although the majority of Oman’s population is Arab, the country
exhibits a wealth of ethnic diversity and connections to nearby
countries such as India and Zanzibar that could explain some of the
observed results [12,31]. However, this study has few limitations.
RED BLOOD CELL GENOTYPE AMONG OMANIS
These questionable results were reported, indicating that the spe-
cific reaction of the patient DNA can be false negative when the
internal positive control is below the cut-off value. We cannot
exclude the possibility of false negative genotype due to an amplifi-
cation failure (allele dropout) since we observed one case of RHD*ψ
with a positive phenotype by serology. In addition, we cannot
exclude experimental error since we were unable to repeat the test.
Assays based on SNVs are limited in their ability to detect clinically sig-
nificant polymorphisms [19]. Hence, other possible causes include nucle-
otide polymorphism near the SNV of interest, such as in the primer
regions that are used to amplify around the SNV. Molecular techniques
such as allele-specific PCR and sequencing can complement genotyping
assays if the findings persisted [32,33].
In conclusion, the results of this study confirm that the inno-
train© genotyping system has >95% concordance with obtained
phenotypes by serology for all common blood group antigens with
exception of Fyb. We also report the first data on the Fy(b-)ES and
weak D variants among Omanis. Considering that the role of
genotyping is gaining interest, support of development of new tools
and technologies to facilitate antigen matching [34], and testing
these in different populations is recommended. Further next-
generation sequencing is planned for antigens with predictable
genotypic variants.
ACKNOWLEDGEMEN TS
We are grateful to the donors who agreed to perform the genotyping
studies on their samples. This project was supported by an internal
grant from the College of Medicine and Health Sciences at the Sultan
Qaboos University. The authors would like to acknowledge the inno-
train staff for technical support.
A.Z.R. is the project grant principal investigator who initiated the
research idea, summarized the phenotype and genotype findings, per-
formed literature review and wrote the manuscript. D.H. recruited the
donors and consented them. M.R. and S.H. performed genotype and
phenotype testing, respectively. S.Z. is the research grant co–co-
principal investigator who facilitated reagent ordering and grant man-
agement. A.M. and H.R. facilitated phenotype and genotype testing.
M.K. performed statistical analysis. All authors reviewed and accepted
the manuscript before submission.
CONF LICT OF IN TE RE ST
The authors declare that they have no conflicts of interest.
ORCID
Arwa Z. Al-Riyami https://orcid.org/0000-0001-8649-0650
Murtadha Al-Khabori https://orcid.org/0000-0002-2937-8838
Gregory A. Denomme https://orcid.org/0000-0001-8727-1679
RE FE R ENC E S
1. Westhoff C. The potential of blood group genotyping for transfusion
medicine practice. Immunohematology. 2008;24:190–5.
429
2. Hillyer CD, Shaz BH, Winkler AM, Reid M. Integrating molecular
technologies for red blood cell typing and compatibility testing into
blood centers and transfusion services. Transfus Med Rev. 2008;22:
117–32.
3. Fasano RM, Chou ST. Red blood cell antigen genotyping for sickle
cell disease, thalassemia, and other transfusion complications. Trans-
fus Med Rev. 2016;30:197–201.
4. Denomme GA. Molecular basis of blood group expression. Transfus
Apher Sci. 2011;44:53–63.
5. Reid M, Rios M, Powell V, Charles-Pierre D, Malavade V. DNA from
blood samples can be used to genotype patients who have recently
received a transfusion. Transfusion. 2000;40:48–53.
6. Sapatnekar S, Figueroa PI. How do we use molecular red blood cell
antigen typing to supplement pretransfusion testing? Transfusion.
2014;54:1452–8.
7. Olsson ML, Chester M. Polymorphism and recombination events at
the ABO locus: a major challenge for genomic ABO blood grouping
strategies. Transfus Med. 2001;11:295–313.
8. Alzahrani M, Jawdat D, Alaskar A, Cereb N, Hajeer A. ABO and Rh
blood group genotypes in a cohort of Saudi stem cell donors. Int J
Immunogenet. 2018;45:63–4.
9. El-Zawahri MM, Luqmani YA. Molecular genotyping and frequencies
of A 1, A 2, B, O 1 and O 2 alleles of the ABO blood group system in
a Kuwaiti population. Int J Hematol. 2008;87:303–9.
10. Al-Riyami AZ, Al-Muqbali A, Al-Sudiri S, Murthi, PS, Zacharia, M,
Al-Mahrooqi S, et al. Risks of red blood cell alloimmunization in
transfusion-dependent beta-thalassemia in Oman: a 25-year experi-
ence of a university tertiary care reference center and a literature
review. Transfusion. 2018;58:871–8.
11. Al-Riyami AZ, Al-Mahrooqi S, Al-Hinai S, Al-Hosni S, Al-Madhani A,
Daar S. Transfusion therapy and alloimmunization in Thalassemia
Intermedia: a 10 year experience at a tertiary care university hospital.
Transfus Apher Sci. 2014;51:42–6.
12. Al-Riyami AZ, Al-Marhoobi A, Al-Hosni S, Al Mahrooqi S, Schmidt M,
O’Brien S. Prevalence of red blood cell major blood group antigens
and phenotypes among Omani blood donors. Oman Med J. 2019;34:
496–503.
13. ISBT. Red cell immunogenetics and blood group terminology. ISBT.
[cited 2020 Mar 22]. https://www.isbtweb.org/working-parties/red-
cell-immunogenetics-and-blood-group-terminology/
14. R Core Team. R: a language and environment for statistical comput-
ing. Vienna: R Foundation for Statistical Computing; 2018.
15. Flegel WA, Gottschall JL, Denomme GA. Integration of red cell
genotyping into the blood supply chain: a population-based study.
Lancet Haematol. 2015;2:e282–8.
16. Haer-Wigman L, Ji Y, Lodén M, de Haas M, van der Schoot CE,
Veldhuisen B. Comprehensive genotyping for 18 blood group sys-
tems using a multiplex ligation-dependent probe amplification assay
shows a high degree of accuracy. Transfusion. 2013;53:2899–909.
17. Hopp K, Weber K, Bellissimo D, Johnson ST, Pietz B. High-
throughput red blood cell antigen genotyping using a nanofluidic
real-time polymerase chain reaction platform. Transfusion. 2010;50:
40–6.
18. Delaney M, Harris S, Haile A, Johnsen J, Teramura G, Nelson K. Red
blood cell antigen genotype analysis for 9087 Asian, Asian American,
and Native American blood donors. Transfusion. 2015;55:2369–75.
19. Jackups R. Impact of genotyping on selection of red blood cell
donors for transfusion. Hematol Oncol Clin. 2019;33:813–23.
20. Garratty G. Do we need to be more concerned about weak D anti-
gens? Transfusion. 2005;45:1547–51.
21. Singleton BK, Green CA, Avent ND, Martin PG, Smart E, Daka A,
et al. The presence of an RHD pseudogene containing a 37 base pair
duplication and a nonsense mutation in Africans with the Rh D-
negative blood group phenotype. Blood. 2000;95:12–8.
430
22. Moussa H, Tsochandaridis M, Chakroun T, Jridi S, Abdelneji B,
Hmida S, et al. Molecular background of D-negative phenotype in
the Tunisian population. Transfus Med. 2012;22:192–8.
23. Flesch BK, Scherer V, Just B, Opitz A, Ochmann O, Janson A, et al.
Molecular blood group screening in donors from Arabian countries
and Iran using high-throughput MALDI-TOF mass spectrometry and
PCR-SSP. Transfus Med Hemotherapy. 2020;47:396–408.
24. Ameen R, Al Shemmari S, Harris S, Teramura G, Delaney M. Classifi-
cation of major and minor blood group antigens in the Kuwaiti Arab
population. Transfus Apher Sci. 2020;59:102748.
25. Flegel W, Wagner F. Molecular genetics of RH. Vox Sang. 2000;78:109.
26. Höher G, Fiegenbaum M, Almeida S. Molecular basis of the Duffy
blood group system. Blood Transfus. 2018;16:93.
27. Tournamille C, Colin Y, Cartron JP, Le Van Kim C. Disruption of a
GATA motif in the Duffy gene promoter abolishes erythroid gene
expression in Duffy–negative individuals. Nat Genet. 1995;10:
224–8.
28. Iwamoto S, Li J, Omi T, Ikemoto S, Kajii E. Identification of a novel
exon and spliced form of Duffy mRNA that is the predominant tran-
script in both erythroid and postcapillary venule endothelium. Blood.
1996;87:378–85.
29. Cohn CS, Johnson ST, Katz LM. AABB technical manual. 20th ed.
Bethesda, Maryland: AABB; 2020.
30. Al Riyami AZ, Al Salmani M, Al Hashami S, Al Mahrooqi S, Al Hinai S,
Al Balushi H. Successful management of severe hemolytic disease of
the fetus due to anti-Jsb using intrauterine transfusions with serial
maternal blood donations: a case report and a review of the litera-
ture. Transfusion. 2014;54:238–43.
AL-RIYAMI ET AL.
31. Peterson JE. Oman’s diverse society: Northern Oman. Middle East J.
2004;58:32–51.
32. Jungbauer C. Routine use of DNA testing for red cell antigens in
blood centres. Transfus Apher Sci. 2011;45:61–8.
33. Jungbauer C, Hobel C, Schwartz D, Mayr W. High-throughput multi-
plex PCR genotyping for 35 red blood cell antigens in blood donors.
Vox Sang. 2012;102:234–42.
34. Zimring JC, Welniak L, Semple JW, Ness PM, Slichter SJ, Spitalnik SL,
et al. Current problems and future directions of transfusion-induced
alloimmunization: summary of an NHLBI working group. Transfusion.
2011;51:435–41.
35. Reid MEL-FC, Lomas-Francis C, & Olsson, ML. The blood group anti-
gen facts book. 3rd ed. Elsevier; 2012. https://www.sciencedirect.
com/book/9780124158498/the-blood-group-antigen-
factsbook#book-description
SUPPORTING INF ORMATION
Additional supporting information may be found in the online version
of the article at the publisher’s website.
How to cite this article: Al-Riyami AZ, Al Hinai D, Al-
Rawahi M, Al-Hosni S, Al-Zadjali S, Al-Marhoobi A, et al.
Molecular blood group screening in Omani blood donors. Vox
Sang. 2022;117:424–30.
Received: 24 June 2021 Revised: 7 September 2021 Accepted: 13 September 2021

DOI: 10.1111/vox.13209

ORIGINAL ARTICLE

Human neutrophil antigen 2 sequence-based typing: Joining

the hunt for the CD177 answer

Tom Browne | Elizabeth Wroe | Leigh Keen | Anthony Poles

Histocompatibility and Immunogenetics

Laboratory, NHS Blood and Transplant,
Bristol, UK
Correspondence
Tom Browne, Histocompatibility and
Immunogenetics Laboratory, NHS Blood and
Transplant, Bristol BS34 7QH, UK.
Email: tom.browne@nhsbt.nhs.uk
Funding information
None
Abstract
Background and Objectives: Isoantibodies to human neutrophil antigen 2 (CD177)
have been associated with several clinical conditions but to date the molecular basis
for altered or non-expression has not been determined. Reliance on phenotyping and
crossmatch to investigate these neutropenic clinical cases are inconvenient for the
patients and demanding of resources within the laboratory. Therefore, a molecular
approach has been introduced to address both issues.
Materials and Methods: A DNA panel of 100 randomly selected blood donors were
collected and supplemented with 18 DNA samples from blood donors previously
shown to be CD177 null. All DNA samples were sequence-based typed for all exons
and observed polymorphisms recorded. The DNA from two families previously inves-
tigated for neonatal alloimmune neutropenia due to CD177 isoantibodies were also
analysed.
Results: The incidence of CD177 null could be associated with a known exon 7 sin-
gle-nucleotide polymorphism in 16/21 known CD177 null samples, which is consis-
tent with previously published findings. Two additional mutations that may lead to
null expression were also identified, of which one may be novel. In both family inves-
tigations, this same mutation could also be observed in the maternal DNA sample.
Conclusion: Based on these observations, introduction of CD177 genotyping into
routine use would identify null expression in over 75% (16/21) of associated cases.
In turn, this could significantly reduce the need for supplementary testing and associ-
ated inconvenience to patients while permitting increased efficiency of laboratory
testing. An added benefit would potentially elucidate other clinically relevant muta-
tions and associated antigenic targets.

KEYWORDS
CD177, HNA-2, NAIN, null

I N T R O D U CT I O N haematopoietic stem cell graft failure [2–7]. Although many polymor-

First described in 1971 as NB1 [1], the human neutrophil antigen
2 (HNA-2/CD177) has been implicated in numerous clinical conditions
including autoimmune neutropenia (AIN), neonatal alloimmune
neutropenia (NAIN), transfusion-related acute lung injury and
phisms have been described in the CD177 gene there is no definitive
assignment of null or altered expression [4, 8–16], which is reflected
in the current nomenclature [17]. CD177 null frequency has been
reported >10% in French and Western Japanese populations, 3%–5%
European, Brazilian and North American populations [10, 18] and less

Vox Sanguinis. 2022;117:431–437. wileyonlinelibrary.com/journal/vox © 2022 International Society of Blood Transfusion. 431
432
than 0.05% in Thai/Chinese [19, 20]. The instance of CD177 null is
estimated to be 3.2% (95% confidence interval = 1.7%–4.7%) in the
English blood donor population (local data, unpublished).
Currently, there is no existing molecular approach in the labora-
tory [3, 4] for CD177 analysis and therefore CD177 expression is
determined by flow cytometry. Due to issues and constraints of this
approach, such as the short life-span of granulocytes to be suitable
for testing [21], CD177 phenotyping is not routinely performed unless
indicated in an investigation when an HNA-2 iso-antibody has been
identified or suspected. CD177 differential expression, where an indi-
vidual has both CD177+ and CD177
granulocytes, is also well docu-
mented but has been shown to be independent of copy number
variance [4, 16] or incorrect DNA splicing [4].
The need for a CD177 molecular typing strategy was identified
and a method has been evaluated to be introduced into the labora-
tory. This method will improve laboratory clinical investigations
involving suspected HNA-2 isoantibodies, enable a more rapid turn-
around in suspected AIN and NAIN investigation and reduce or
negate the need to request fresh granulocytes for phenotyping
and crossmatch studies. In turn, successful CD177 null identifica-
tion by genotyping would lessen the inconvenience on patients,
their families and clinicians to provide subsequent, time-sensitive
samples while permitting identification of potential antigenic
polymorphisms.
MATERIALS AND METHODS
Sample selection
A sample cohort of 100 random English blood donors with informed
consent were collected. In addition, further 18 English blood donor
samples, previously identified as CD177 null were obtained. Samples
were also obtained from two anonymised NAIN cases in which mater-
nal HNA-2 antibodies had been previously identified.
Granulocyte isolation and phenotyping
Granulocytes were isolated for phenotyping by flow cytometry from
the random donor cohort (n = 100). Red blood cells were lysed and
the remaining white blood cell population fixed with 1% formaldehyde
following local validated procedures within 24 h of venesection.
Phenotyping was performed using both human and monoclonal anti-
bodies specific for CD177 (local reference sera and 7D8, gift from
Dr. Stroncek [National Institutes of Health, Bethesda], respectively)
and CD16b (local reference sera and 3G8, International Blood Group
Reference Laboratory, respectively) as a control. Each donors’
granulocytes were incubated with sera or monoclonal antibody
(isotype control, CD16b and CD177) at 37 C followed by relevant
(human/murine) PE-conjugated IgG antibody at 4 C and analysed by
flow cytometry on a 96-well plate Cytoflex (Beckman Coulter) follow-
ing local protocols.
BROWNE ET AL.
DNA extraction
DNA was extracted from the 100-donor sample cohort using either
an automated (MagnaPure, Roche) or manual (Gentra Puregene,
Qiagen) method. Stored DNA was located for the additional
18 CD177 null and NAIN family samples.
DNA amplification
The CD177 gene was amplified by long-range PCR (Long-Range PCR
Kit, Qiagen) using primers (0.4 μM) described by Li et al. [16] (Table 1).
and 200 ng of genomic DNA. The PCR was performed on a Verity
96-well thermal cycler (ABI) following the recommended cycling
parameters for the PCR kit.
The CD177 DNA fragment (8728 bp) was cleaned with 1.8
AMPure XP (Bechman Coulter) and resuspended in 6 volume of
Milli-Q® water for sequencing.
DNA sequencing: Sequence-based typing
New forward and reverse sequencing primers covering all exons were
designed and sequencing was performed following existing, validated
in-house sequencing protocol (Table 1).
Cycle sequencing was performed on a CT1000 (BioRad) for all
exons (1–9). Sequencing was performed on a 3500xl genetic analyser
(ABI), with BigDye v1.1 (ABI) and 50 cm capillary.
Analysis
Flow cytometry data were analysed using CytExpert software
(v2.2.0.97, Beckman Coulter). Exon and flanking intronic sequencing
analysis for CD177 was performed using Mutation Surveyor® (v5.1.2,
SoftGenetics) and reference sequence NC_000019.10 (NCBI) and all
single-nucleotide polymorphisms (SNP) recorded.
Method validation
The CD177 sequencing method was validated by blind analysis of
three previously sequenced DNA samples kindly provided by the lab-
oratory for Immunogenetics (Red Cross Blood Transfusion Service
West, Bad Kreuznach, Germany).
RE SU LT S
The three supplied samples (49.411437, 2018F0022 and 2018F0023)
were sequenced for all CD177 exons and observed polymorphisms
reported back to the referring laboratory. In all three cases, the
observed mutations concurred with the referring laboratory results.
TABLE 1 HNA-2 PCR-SBT amplification and cycle sequencing primers
HNA-2 SEQUENCE-BASED TYPING

50 start (hg38) 30 stop (hg38)

Name Sequence Length Tm ( C) Chr19: Chr19 Direction Exon coverage
Amplification
Li_HNA_2_Fwd CTGAAAAAGCAGAAAGAGATTACCAGCCACAG 32 mer 66 43,353,676 43,353,707 Sense 5UTR–3UTR
Li_HNA_2_Rev GTCCAAGGCCATTAGGTTATGAGGTCAGA 29 mer 66 43,362,403 43,362,375 Anti-sense 5UTR–3UTR
Sequencing
CD177_SEQ_1F ATTTTGCAAGGCCCTCCCCT 20 mer 62 43,353,600 43,353,619 Sense 1, 2
CD177_SEQ_2R AGGCTGAGAGGCTGGAAAGGATTT 24 mer 62 43,354,128 43,354,109 Anti-sense 1, 2a
CD177_SEQ_3F GCCAGGACACGTTGATGCTC 20 mer 62 43,353,964 43,353,983 Sense 3a
CD177_SEQ_3R GAGGGACTCCGTAACAGCCC 20 mer 62 43,354,476 43,354,457 Anti-sense 2, 3
CD177_SEQ_4F TGATGGGAGCTGCAGAAGGC 20 mer 63 43,355,521 43,355,540 Sense 4, 5
CD177_SEQ_4R TCACCTCACTCCCCAAAGCC 20 mer 62 43,355,867 43,355,848 Anti-sense 4
CD177_SEQ_5F CGGCATGAGACCCAGAGGAG 20 mer 62 43,355,877 43,355,896 Sense 5
CD177_SEQ_5R TCCTGCTGGCTTTGGTGTGA 20 mer 62 43,356,201 43,356,182 Anti-sense 4, 5a
CD177_SEQ_6F GAAGCAGAGATGGGATGAGGATAAG 25 mer 61 43,359,966 43,359,990 Sense 6a
CD177_SEQ_6R TGCTTCACCCCCAGTTTTCAT 21 mer 60 43,360,582 43,360,562 Anti-sense 6
CD177_SEQ_7F TCAGGGCATTCACCCTCTGC 20 mer 62 43,361,026 43,361,045 Sense 7, 8a
CD177_SEQ_8F AGGGCCGTGGAGAAATGAGG 20 mer 62 43,361,340 43,361,359 Sense 8
CD177_SEQ_9F_v2 TTACAACTTGGCTGGGCTGT 20 mer 61 43,362,031 43,362,050 Sense 9a
CD177_SEQ_9R GAGGTCAGAGGGAGGTTGAGTGT 23 mer 63 43,362,383 43,362,361 Anti-sense 9a

Note: Amplification primers and sequencing primer panel for CD177 genotyping by PCR-SBT.
a
Proposed for routine HNA-2 genotyping.
433
434 BROWNE ET AL.

F I G U R E 1 Mutation Surveyor (v5.1.2, Softgenetics) electropherogram traces, the reference sequence on top and the sample sequence given
below, indicating the identified non-sense polymorphisms that would lead to premature termination of the protein. (a) c.1021 polymorphism and
(b) c.1254 polymorphism

Phenotyping of the 100 random English blood donor samples
identified three to be CD177 null. All of 100 samples and the addition
of the previously defined 18 CD177 null samples were sequenced and
all observed nucleotide polymorphisms were recorded (Table 1).
Sequencing of 16/21 phenotypically CD177 null samples were shown
to be homozygote (TT) at position c.787 in exon 7 which has been
reported to cause a premature ‘stop’ codon (p.Lys263Ter) and lead to
CD177 non-expression [4, 10, 16] although none had the associated
c.995delG [10] or described c.1291 [9] polymorphisms. The causative
mutation/polymorphism for the remaining 5/21 samples could not be
HNA-2 SEQUENCE-BASED TYPING 435

TABLE 2 HNA-2 mutations in English blood donors (n = 118, 21 = CD177 null)

Prevalence
Position Position (homozygote/
Region (hg38) Chr19 Variation SNV AA SO term (cDNA) heterozygote)
Exon 1 43,353,721 rs45441892 g>C A3P Missense c.7 66/118 (22/44)
Exon 2 43,353,892 rs45553433 A>T H31L Missense c.92 16/118 (1/15)
43,353,914 rs45571738 g>A L38L Synonymous c.114 31/118 (5/26)
43,353,930 rs752085844 C>g P44A Missense c.130 1/118 (0/1)a
Exon 3 43,354,354 rs755945780 T>A V114D Missense c.341 1/118 (0/1)a
Exon 5 43,356,040 rs12981714 T>g V184G Missense c.551 108/118 (100/8)
43,356,099 rs12980412 g>A D204N Missense c.610 108/118 (100/8)
43,356,103 rs12981771 T>g M205R Missense c.614 108/118 (100/8)
Exon 6 43,360,396 rs10425835 C>A L251I Missense c.751 47/118 (19/28)
Exon 7 43,361,164 rs200660811 g>C G261A Missense c.782 40/118 (16/24)
43,361,168 rs587670082 A>C T262T Synonymous c.786 40/118 (16/24)
43,361,169 rs201821720 A>T K263X Stop c.787 40/118 (16/24)
43,361,172 rs200145410 g>A G264S Missense c.790 40/118 (16/24)
43,361,181 rs12978146 A>g T267A Missense c.799 40/118 (16/24)
Exon 8 43,361,519 rs201040394 C>T R341X Stop c.1021 1/118 (0/1)a
43,361,540 rs17856829 g>A A348T Missense c.1042 48/118 (11/37)
Exon 9 43,362,260 rs188387562 g>A W418X Stop c.1254 1/118 (0/1)b
43,362,297 rs78718189 g>A G431R Missense c.1291 19/118 (2/17)

Note: SNV and AA changes observed in 118 donors sequenced across exons 1–9 for CD177.
Abbreviations: AA, associated amino acid; SNV, single-nucleotide polymorphisms.
a
To be confirmed in a second or homozygous sample.
b
Reported in Thai study by Siriphanthong et al. [8].

elucidated from the exon and adjacent intronic sequences. Additional
premature ‘stop’ codon at CD177 positions c.1021C>T (Arg341Ter,
rs201040394) and c.1254 g>A (Trp418Ter, rs188387562) were also
observed as heterozygote SNP in the sample cohort (Figure 1 and
Table 2).
The parents and affected child of both NAIN families in which
CD177 isoantibodies had been identified were also genotyped for all
exons. In both cases, sequencing of the maternal sample identified a
homozygous (TT) mutation at position c.787 in exon 7, whereas both
paternal and infant samples were heterozygous (AT) at position c.787.
DISCUSSION
A recent multi-centre study [4] identified homozygous
(TT) polymorphism at position c.787 to correlate with CD177 null
expression in 43/54 samples (0.796) which is consistent with these
observations of this study (16/21, 0.762).
The polymorphism at position c.1254 has been previously
reported as a low-frequency polymorphism in a large Asian study [8]
where only one homozygous individual was identified. In this case,
CD177 expression was not significantly affected (CD177+ 85%, Fig-
ure 2). The second polymorphism observed at position c.1021 is
potentially novel and on this occasion was associated with a reduced
CD177 expression (CD177+ 30%, Figure 2) although further examples
would be required to confirm this finding. To assess the effects of
these polymorphisms on CD177 expression, further analysis of
CD177 mRNA and the cell transfection are required.
The method was developed to align as much as possible with the
existing sequence-based typing method currently in routine use for
HNA-1, -3, -4 and -5 genotyping to integrate with the current HNA
genotyping strategy.
Although it is not currently possible to assign definitive CD177
expression from the genotyping and no allelic system has been
described, the introduction of a genotyping method for CD177 will
improve the laboratory service, specifically in the investigation of clin-
ical referrals where a CD177 antibody is indicated. From the two
NAIN cases retrospectively genotyped, a causative correlation was
identified which may have negated the need for fresh paternal
granulocytes for confirmation. In turn, this would have meant less
inconvenience to the patient, family and clinician to provide the addi-
tional samples and permitted a more rapid conclusion to the investiga-
tion. From this and the recent multi-centre study [4], this would be
reflective of over three quarters of CD177 related cases where addi-
tional phenotyping or crossmatch would no longer be necessary. This
would not only benefit the patient as mentioned but significantly
reduce the burden on the laboratory in arranging and performing this
phenotyping and crossmatching assays.
436 BROWNE ET AL.

F I G U R E 2 The flow cytometry data of CD177 expression for samples with identified heterozygous non-sense polymorphism; (a) c.1254
polymorphism W418W/X, (b) c.1021 polymorphism R341R/X. Forward scatter and side scatter were used to set the gate for CD177+
population. The left histogram for each sample shows the granulocyte population with isotype control. The right histograms show the gated
population which has been incubated with CD177 antibody to show the CD177+ populations (a) 85%, (b) 30%

The ability to identify polymorphism in the CD177 gene would
also provide the ability to elucidate potential antigenic ‘targets’ in
other CD177 suspected clinical cases and contribute towards the col-
lective endeavour to establish the extent of clinically relevant poly-
morphism in the CD177 gene. This method will be validated and
implemented into the routine laboratory testing stratagem.
AC KNOW LEDG EME NT S
T.B. performed the laboratory testing, analysis and drafted the paper.
E.W. reanalysed and reviewed the sequencing. E.W., L.K. and
A.P. provided critical review of the content and provided feedback for
the final revised version. Thanks to Dr. BK. Flesch (Laboratory for
Immunogenetics, German Red Cross Blood Service West, Bad
HNA-2 SEQUENCE-BASED TYPING 437

Kreuznach, Germany) for supplying DNA for the method validation 10. Bayat B. Molecular basis of human neutrophil antigen 2 (HNA-2)
and reviewing the associated results, Rachel Jackson for identifying expression. ISBT Sci Ser. 2019;15:77–81.
11. Wu Z, Liang R, Ohnesorg T, Cho V, Lam W, Abhayaratna WP, et al.
the clinical cases analysed, the NHSBT Southmead blood donor centre
Heterogeneity of human neutrophil CD177 expression results
(Bristol) and NHSBT regional blood testing department, (Bristol) for from CD177P1 Pseudogene conversion. PLoS Genet. 2016;12:
collecting and providing the samples, all Blood donors past and e1006067.
present. 12. Bayat B, Bein G, Sachs UJ. A sequence-specific polymerase chain
reaction method for HNA-2 genotyping: homozygous c.843A>T
mutation predicts the absence of CD177. Transfusion. 2016;56:
CONF LICT OF IN TE RE ST 2127–32.
The authors have no conflicts of interest. 13. Moritz E, Chiba AK, Kimura EY, Albuquerque D, Guir~ao FP,
Yamamoto M, et al. Molecular studies reveal that A134T, G156A and
G1333A SNPs in the CD177 gene are associated with atypical
ORCID
expression of human neutrophil antigen-2. Vox Sang. 2010;98:
Tom Browne https://orcid.org/0000-0002-0825-6233 160–6.
14. Caruccio L, Walkovich K, Bettinotti M, Schuller R, Stroncek D.
RE FE R ENC E S CD177 polymorphisms correlation between high-frequency single
nucleotide polymorphisms and neutrophil surface. Transfusion.
1. Lalezari P, Murphy GB, Allen FH Jr. NB1, a new neutrophil-specific
2004;44:7–82.
antigen involved in the pathogenesis of neonatal neutropenia. J Clin
15. Wolff J, Brendel C, Fink L, Bohle RM, Kissel K, Bux J. Lack of NB1
Invest. 1971;50:1108–15.
GP (CD177/HNA-2a) gene transcription in NB1 GP- neutrophils
2. Traum A, Hofmann C, Haas S, Schmidt S, Bein G, Sachs UJ, et al.
from NB1 GP-expressing individuals and association of low expres-
Characterization of CD177-reactive iso- and auto-antibodies. Trans-
sion with NB1 gene polymorphisms. Blood. 2003;102:731–3.
fusion. 2021;61:1916–1922.
16. Li Y, Mair DC, Schuller RM, Li L, Wu J. Genetic mechanism of human
3. Browne T, Dearman RJ, Poles A. Human neutrophil antigens: nature,
neutrophil antigen 2 deficiency and expression variations. PLoS
clinical significance and detection. Int J Immunogenet. 2021;48:
Genet. 2015;11:e1005255.
145–56.
17. Flesch BK, Curtis BR, de Haas M, Lucas G, Sachs UJ. Update on the
4. Flesch BK, Reil A, Nogués N, Canals C, Bugert P, Schulze TJ, et al.
nomenclature of human neutrophil antigens and alleles. Transfusion.
Multicenter study on differential human neutrophil antigen 2 expres-
2016;56:1477–9.
sion and underlying molecular mechanisms. Transfus Med Hemother.
18. Bux J. Human neutrophil alloantigens. Vox Sang. 2008;94:277–85.
2020;47:385–95.
19. Gong J, Rao M, Jia Z, Ma N, Sun L, Xiaonan Yu X, et al. Screening for
5. Flesch BK, Reil A. Molecular genetics of the human neutrophil anti-
the human neutrophil antigen-2 deficiency by a multiplex one-tube
gens. Transfus Med Hemother. 2018;45:300–9.
polymerase chain reaction assay. ISBT Sci Ser. 2020;15:286–91.
6. Wada T, Miyamoto S, Okamoto H, Matsuda Y, Toma T, Imai K, et al.
20. Nathalang O, Siriphanthong K, Petvises S, Jeumjanya N. Flow-
Prolonged neutropenia due to antihuman neutrophil antigen
cytometric analysis of HNA-2 expression and phenotypes among
2 (CD177) antibody after bone marrow transplantation. Pediatr
Thai blood donors. Ann Lab Med. 2018;38:362–6.
Blood Cancer. 2017;64:e26388.
21. Schonbacher M, Mayr WR, Schulze TJ, Leitner G, Schmidt C,
7. Lucas G, Culliford S, Bendukidze N, Dahlstrom J, Grandage V,
Hofbauer G, et al. Time from venipuncture to cell isolation: impact
Carpenter B, et al. Late onset cytopenias following haematopoietic
on granulocyte-reactive antibody testing. Clin Biochem. 2019;63:
stem cell transplant associated with viral infection and cell specific
72–8.
antibodies. Transpl Immunol. 2017;41:32–6.
8. Siriphanthong K, Petvises S, Thanongsaksrikul J, Intharanut K,
Nathalang O. A novel nonsense mutation found in the CD177 gene
of Thai individuals with the HNA-2 null phenotype. Transfus Med.
2020;30:30–6. How to cite this article: Browne T, Wroe E, Keen L, Poles A.
9. Wu J, Li Y, Schuller RM, Li L, Litmeyer A-S, Bein G, et al. The non- Human neutrophil antigen 2 sequence-based typing: Joining
conservative CD177 single-nucleotide polymorphism c.1291G>A is a
the hunt for the CD177 answer. Vox Sang. 2022;117:431–7.
genetic determinant for human neutrophil antigen-2 atypical/low
expression and deficiency. Transfusion. 2019;59:1836–42.
Received: 14 July 2021 Revised: 9 August 2021 Accepted: 9 August 2021

DOI: 10.1111/vox.13198

SHORT REPORT

Babesia microti in a Canadian blood donor and lookback

in a red blood cell recipient

Steven J. Drews1,2 | Paul Van Caeseele3 | Jared Bullard3 | L. Robbin Lindsay4 |

Teresa Gaziano5 | Michelle P. Zeller6,7 | Debra Lane8 | Momar Ndao9 |
Vanessa G. Allen10,11 | Andrea K. Boggild12,13 | Sheila F. O’Brien14 |
Daniel Marko15,16 | Charles Musuka15,16 | Muhamad Almiski15,16 | Mark Bigham17
1
Microbiology, Donation Policy and Studies, Canadian Blood Services, Edmonton, Alberta, Canada
2
Laboratory Medicine and Pathology, University of Alberta, Edmonton, Alberta, Canada
3
Cadham Provincial Laboratory, Winnipeg, Manitoba, Canada
4
Zoonotic Diseases and Special Pathogens Section, National Microbiology Laboratory, Winnipeg, Manitoba, Canada
5
Medical Laboratory and Stem Cell Services, Canadian Blood Services, Brampton, Ontario, Canada
6
Medical Laboratory and Stem Cell Services, Canadian Blood Services, Ancaster, Ontario, Canada
7
McMaster Centre for Transfusion Research, McMaster University, Hamilton, Ontario, Canada
8
Medical Laboratory and Stem Cell Services, Canadian Blood Services, Winnipeg, Manitoba, Canada
9
National Reference Centre for Parasitology, Research Institute of the McGill University Health Centre, Montreal, Quebec, Canada
10
Public Health Ontario, Toronto, Ontario, Canada
11
Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario, Canada
12
Tropical Disease Unit, Division of Infectious Diseases, University Health Network, Toronto, Ontario, Canada
13
Department of Medicine, University of Toronto, Toronto, Ontario, Canada
14
Epidemiology and Surveillance, Donation Policy and Studies, Canadian Blood Services, Ottawa, Ontario, Canada
15
Department of Pathology, University of Manitoba, Winnipeg, Manitoba, Canada
16
Shared Health, Winnipeg, Manitoba, Canada
17
Medical Laboratory and Stem Cell Services, Canadian Blood Services, Vancouver, British Columbia, Canada

Correspondence
Steven J. Drews, Canadian Blood Services, Abstract
8249 114 St. NW, Edmonton, AB T6G 2R8,
Background and Objectives: We describe the third documented case of
Canada.
Email: steven.drews@blood.ca autochthonous human babesiosis in Canada and the second in a Canadian blood
donor.
Funding information
None Materials and Methods: Multiple laboratory investigations were carried out on the
donor and the immunocompromised recipient of an associated, potentially infectious
red blood cell product.
Results: The donor had not travelled except for outdoor exposure in
south-eastern Manitoba, followed by illness and hospital admission. The donor
had a notable parasitaemia, positive for Babesia microti using whole blood
nucleic acid testing (NAT). The recipient was negative for B. microti by both
serology and NAT.
Conclusion: There was no evidence of transfusion-transmitted babesiosis.

438 © 2021 International Society of Blood Transfusion. wileyonlinelibrary.com/journal/vox Vox Sanguinis. 2022;117:438–441.
BABESIA LOOKBACK CANADA 439

KEYWORDS
Babesia, haemovigilance, protozoal infections, transfusion-transmitted infections

I N T R O D U CT I O N
Babesia species are intra-erythrocytic protozoan parasites with Babesia
microti and Babesia duncani being the two main species in North America.
Although these parasites are primarily transmitted by bites from Ixodes spe-
cies ticks, transmission via solid organ transplantation or blood transfusion
has been reported. Infected donors can be asymptomatic and infectious
for weeks to months. In recipients, Babesia infection may present with an
influenza-like illness weeks to months after transfusion followed by typical
manifestations of the disease. Severe disease can include anaemia, organ
dysfunction and death. Risk factors for severe outcomes include extremes
of age, asplenia, or immunosuppression, and individuals with such condi-
tions may have high parasite burdens that can be detected by examination
of blood smears. B. microti is endemic in the north-eastern and midwestern
United States near the Canadian border [1]. In the United States, over
200 cases of transfusion-transmitted babesiosis (TTB) have been reported
since 1980, with a trend of increasing reported incidence, prompting imple-
mentation in 2019 of universal, year-round testing in designated states
with high reported incidence of babesiosis [1].
Canadian donors are currently indefinitely deferred for known babe-
siosis, but donor testing is not performed for Babesia species (B. microti,
B. duncani, B. divergens and B. venatorum). In 1998, the only documented
case of transfusion-transmitted babesiosis was described in Canada. The
donor infection was thought to have been acquired during travel to Cape
Cod, Massachusetts, the United States [2]. In 2013, the first documented
case of locally acquired tick-borne babesiosis was described in Manitoba,
Canada [3]. In the same year, a serological survey of 13,993 donors from
across Canada, failed to identify a Babesia seropositive donor [4]. Five
years later in 2018, 50,752 blood donations from across Canada were
screened for Babesia species (B. microti, B. duncani, B. divergens and
B. venatorum) using a nucleic acid test (NAT) and an additional 14,758
NAT-negative donations were screened for B. microti antibody [5]. The
2018 survey yielded a single NAT-positive blood donor from Manitoba,
while four other Canadian blood donors demonstrated serological
evidence of prior Babesia species infection.
This manuscript describes a retrospective investigation (formally
called a lookback investigation by blood operators) involving a B. microti
NAT-positive Canadian blood donor from Manitoba, with likely autoch-
thonous Babesia infection and a recipient of red blood cells (RBCs) that
had been collected during the donor’s potential infectious period.
M A T E R I A L S A N D M ET H O D S
A lookback investigation was initiated by Canadian Blood Services
staff [6], following post-donation notification to the blood operator by

F I G U R E 1 Time course for the investigation of a Babesia microti–infected blood donor and a recipient of red blood cells (RBCs).
Key timings for investigation of the infected donor are in the top half of the figure. Key timings for the investigation of the immunocompromised
RBC recipient are in the bottom half of the figure. No transfusion transmission of B. microti via donor RBCs was identified in this investigation
440
Pleomorphic
Ring
F I G U R E 2 Microscopic investigation of donor blood for parasites. This image is of a thin blood smear (oil, 1000, Giemsa stain). Babesia
trophozoites and merozoites were identified morphologically. Trophozoites were ring-shaped, pleomorphic and vacuolated. Merozoites were
occasionally identified displayed in tetrads
the donor (Figure 1). During the donor’s hospitalization, whole
blood specimens were initially analysed by the hospital pathology
staff. During the lookback process, details of the donor’s clinical and
travel history were obtained, and additional microscopy was under-
taken on donor whole blood specimens by public health at the
Cadham Provincial Laboratory (Winnipeg, Manitoba, Canada). Donor
whole blood specimens were also tested by NAT for B. microti,
B. divergens and B. duncani (National Microbiology Laboratory [NML],
Winnipeg, Canada) [7, 8] (Figure 1).
Anti-B. microti immunofluorescence assay serology testing on
serum from the RBC recipient was performed by the National Reference
Centre for Parasitology (Montreal, Quebec, Canada) [9]. NML performed
NAT for Babesia on a recipient whole blood specimen.
RESULTS
In mid-August 2019, Canadian Blood Services was contacted post-
donation by a 75-year-old male donor from Manitoba who reported
being recently diagnosed and treated for babesiosis. The donor had
camped in south-eastern Manitoba (early June 2019) and suspected at
least one tick bite before donating whole blood in late June 2019
(Figure 1). There was no recent travel history to a reported Babesia-
endemic region outside of Canada. The donor reported becoming very
ill less than 1 week after donation and was hospitalized in early August
2019. Blood parasites were noted in whole blood specimens collected
during hospitalization, and further microscopic examination identified
‘malaria-like’ parasites (Figure 2). Both hospital and public health
DREWS ET AL.
Tetrads
laboratories estimated a parasitaemia ranging from 0.2% to 1%. Whole
blood NAT testing was subsequently positive for B. microti (Figure 1).
Three components were produced from the original donation: one fresh
product, RBCs, and two subsequently frozen products, cryosupernatant
plasma (CSP) and cryoprecipitate (CRYO). The CSP was transfused the sec-
ond week of July 2019, while the CRYO was transfused the third week of
July 2019. No lookback was undertaken on frozen products [10].
A lookback determined that the associated leukoreduced RBC
unit was transfused after 27 days of storage in the fourth week of July
2019, to a 74-year-old male recipient with relapsed, diffuse large B
cell lymphoma status post-RCEPP (rituximab, cyclophosphamide,
etoposide, prednisone and procarbazine) (Figure 1). Babesia microti
serologic testing on a recipient serum specimen collected in late
September 2019 was non-reactive (immunofluorescence assay titre
< 1/64). NAT testing for B. microti, B. divergens and B. duncani on a
whole blood specimen collected in late October 2019 was negative.
There was no clinical evidence of transfusion-transmitted babesiosis
in the recipient (Figure 1).
DI SCU SSION
Even in low babesiosis prevalent settings such as Canada, blood opera-
tors must remain vigilant for transfusion-transmitted babesiosis. In the
absence of a complete blood donor travel history, Babesia may be
mistaken for malaria, if diagnosis relies on microscopy and Babesia-
specific NAT is not undertaken [11]. Cross-reactivity on Plasmo-
dium genus-specific 18S assays may also cloud the microbiological
BABESIA LOOKBACK CANADA
picture in such scenarios [11]. In the case described herein, babesio-
sis was diagnosed during a hospital admission based on a history of
outdoor activities (and possible tick exposure) in a region with prior,
reported autochthonous transmission, along with corroborative laboratory
evidence. The impetus for the subsequent blood product lookback investi-
gation was a donor-reported history of recent babesiosis infection shortly
after a whole blood donation. Of note, Manitoba is also one of few prov-
inces in Canada (including Quebec) where babesiosis is a specifically desig-
nated reportable infection to public health. The lookback investigation
was a multi-team process that involved the blood operator, hospital clinical
and laboratory staff, and reference laboratory experts from two provincial
laboratories and the national public health laboratory.
The recipient of the RBCs was immunocompromised and hence at
higher risk of more serious transfusion-transmitted babesiosis. RBC
concentrate is the most likely blood product associated with transfusion-
transmitted Babesia infection. Longer RBC storage times may not
prevent parasite transmission as transfusion-transmitted babesiosis impli-
cating RBC units 42 days old have been identified [12, 13]. Thus, in this
case, the RBC recipient remained clinically well without signs of babesio-
sis and was non-reactive for Babesia spp. using NAT and serology
months after RBC transfusion. Given the immunocompromised nature of
the recipient and the possibility of a blunted or negative serologic
response, the final specimen collected from the recipient was tested
using NAT. During this investigation, the CSP and CRYO units were not
investigated as Babesia is rapidly killed by freezing [10]. We do note that
Babesia survives freezing in glycerolized red cells, which have been impli-
cation in transfusion cases [14].
This is the third documented case of autochthonous babesiosis in
Canada and the second in a Canadian blood donor. Of note, all cases thus
far spent time in forested areas in the very southernmost areas of
Manitoba, close to the US border. Although there was no evidence of
transfusion-transmitted babesiosis in the immunocompromised RBC
recipient, we are using this information and results from a 2018 Canadian
blood donor surveillance study to undertake a risk-based decision-making
(RBDM) assessment. On completion of the RBDM, Canadian Blood Ser-
vices will determine if further Babesia-related blood safety measures,
especially in a region of potential Babesia emergence, are warranted.
ACKNOWLEDGEMEN TS
S.J.D. led the investigation from the blood operator perspective, analysed
the data and wrote the first draft of the manuscript; P.V.C., J.B. and
L.R.L. coordinated specimen testing on the donor, reviewed the labora-
tory data and reviewed and edited the manuscript; T.G. and
M.P.Z. assisted with the recipient investigations, helped coordinate fur-
ther testing on the recipient and reviewed and edited the manuscript;
D.L. worked with D.M., C.M. and M.A. to initially investigate the donor,
undertake and interpret laboratory testing and also reviewed and edited
the manuscript; M.N., V.G.A. and A.K.B coordinated the recipient work-
up and also reviewed and edited the manuscript; S.F.O. provided epide-
miological context for the findings and also reviewed and edited the
manuscript and M.B. assisted on both the donor and recipient investiga-
tions and reviewed and edited the first and following drafts of the
manuscript.
441
CONFLIC T OF INT ER E ST
Steven J. Drews has acted as a content expert on respiratory viruses
for Johnson and Johnson (Janssen). He also acted as a content expert
to Roche on Arboviruses. All other authors have no other conflicts of
interest.
ORCID
Steven J. Drews https://orcid.org/0000-0003-2519-1109
Sheila F. O’Brien https://orcid.org/0000-0002-5332-2789
RE FE RE NCE S
1. Krause PJ. Human babesiosis. Int J Parasitol. 2019;49:165–74.
2. Kain KC, Jassoum SB, Fong IW, Hannach B. Transfusion-transmitted
babesiosis in Ontario: first reported case in Canada. CMAJ. 2001;
164:1721–3.
3. Bullard JM, Ahsanuddin AN, Perry AM, Lindsay LR, Iranpour M,
Dibernardo A, et al. The first case of locally acquired tick-borne Babe-
sia microti infection in Canada. Can J Infect Dis Med Microbiol.
2014;25:e87–9.
4. O’Brien SF, Delage G, Scalia V, Lindsay R, Bernier F, Dubuc S, et al.
Seroprevalence of Babesia microti infection in Canadian blood
donors. Transfusion. 2016;56:237–43.
5. Tonnetti L, O’Brien SF, Gregoire Y, Proctor MC, Drews SJ, Delage G,
et al. Prevalence of Babesia in Canadian blood donors: June-October
2018. Transfusion. 2019;59:3171–6.
6. Chargé S. In: Clarke G, editor. Vein to vein: a summary of the blood
system in Canada. Ottawa, ON, Canada: Canadian Blood Services;
2019. https://professionaleducation.blood.ca/en/vein-vein-summary-
blood-system-canada. Accessed 13 Jul 2021.
7. Nakajima R, Tsuji M, Oda K, Zamoto-Niikura A, Wei Q, Kawabuchi-
Kurata T, et al. Babesia microti-group parasites compared phylogenet-
ically by complete sequencing of the CCTeta gene in 36 isolates.
J Vet Med Sci. 2009;71:55–68.
8. Persing DH, Mathiesen D, Marshall WF, Telford SR, Spielman A,
Thomford JW, et al. Detection of Babesia microti by polymerase
chain reaction. J Clin Microbiol. 1992;30:2097–103.
9. Ndao M. Diagnosis of parasitic diseases: old and new approaches.
Interdiscip Perspect Infect Dis. 2009;2009:1–15.
10. Leiby DA. Transfusion-transmitted Babesia spp.: bull’s-eye on Babesia
microti. Clin Microbiol Rev. 2011;24:14–28.
11. Warren T, Lau R, Ralevski F, Rau N, Boggild AK. Fever in a visitor to
Canada: a case of mistaken identity. J Clin Microbiol. 2015;
53:1783–5.
12. AABB: AABB Emerging Pathogens Fact Sheets: Babesia species. https://
www.aabb.org/docs/default-source/default-document-library/regulatory/
eid/215s.pdf?sfvrsn=565a52c9_2 (2013). Accessed 13 Jul 2021.
13. Stramer SL, Dodd RL. Transfusion-transmitted diseases. In:
Hoffman R, Benz EJ Jr, Silberstein LE, Heslop HE, Weitz JI,
Anastasi J, et al., editors. Hematology: basic principles and practice.
6th ed. Philadelphia, PA: Elsevier; 2018. p. 1803–21.
14. Herwaldt BL, Linden JV, Bosserman E, Young C, Olkowska D,
Wilson M. Transfusion-associated babesiosis in the United States: a
description of cases. Ann Intern Med. 2011;155:509–19.
How to cite this article: Drews SJ, Van Caeseele P, Bullard J,
Lindsay LR, Gaziano T, Zeller MP, et al. Babesia microti in a
Canadian blood donor and lookback in a red blood cell
recipient. Vox Sang. 2022;117:438–41.
Received: 16 April 2021 Revised: 11 June 2021
DOI: 10.1111/vox.13207
SHORT REPORT
Sequence variants in the proximal promoter and +5.8-kb site
of ABO in Koreans with weak B phenotypes
HongBi Yu1 | Tae Yeul Kim2 | Sue Jin Moon1 |
Hwa Jong Yoo2 | Jeong Hoon Kim1 | Duck Cho1,2
1
Department of Health Sciences and
Technology, Samsung Advanced Institute for
Health Sciences and Technology,
Sungkyunkwan University, Seoul, South Korea
2
Department of Laboratory Medicine and
Genetics, Samsung Medical Centre,
Sungkyunkwan University School of Medicine,
Seoul, South Korea
3
Department of Laboratory Medicine,
Dankook University Hospital, Cheonan,
South Korea
Correspondence
Duck Cho, Department of Laboratory
Medicine and Genetics, Samsung Medical
Centre, Sungkyunkwan University School of
Medicine, 81, Irwon-ro, Gangnam-gu, Seoul
06351, South Korea.
Email: duck.cho@skku.edu
I N T R O D U CT I O N
Weak ABO subgroups are rare but one of the major causes of
ABO discrepancies. The majority of ABO subgroups are caused by
variants in the coding exons and flanking introns of ABO, that is,
missense, nonsense, frameshift and splice site variants [1, 2].
However, some weak ABO subgroups result from variants in the
HongBi Yu and Tae Yeul Kim contributed equally to this work.
442 © 2021 International Society of Blood Transfusion.
Accepted: 6 September 2021
Yoo Na Chung3 |
Abstract
Background and Objectives: Several studies on Chinese and Japanese
populations have revealed that a substantial proportion of weak B subgroups
are caused by variants in the major regulatory regions of ABO, the proximal
promoter, CCAAT-binding factor/NF-Y binding site and +5.8-kb site. We per-
formed molecular analyses of these regions in Koreans with weak B
phenotypes.
Materials and Methods: This study included 16 samples with weak B phenotypes
(4 B3, 1 Bw, 5 A1B3 and 6 A1Bw) harbouring no subgroup-causing variants in ABO
exons 6 and 7. These samples were subjected to sequencing analysis of exons 1–5
and the major regulatory regions of ABO.
Results: Of the 16 samples, 14 were found to carry a sequence variant either in the
proximal promoter (g.4991_5008del [n = 3]) or the +5.8-kb site (g.10893G>A
[n = 4] and g.10925C>T [n = 7]). The remaining two samples were found to contain
no subgroup-causing variants.
Conclusion: Our study demonstrates that sequence variants in the proximal pro-
moter and +5.8-kb site account for a substantial proportion of weak B sub-
groups in Koreans, suggesting that molecular analysis of these regions is
essential for the accurate determination of ABO genotypes in Koreans with
weak B phenotypes.
KEYWORDS
+5.8-kb site, ABO, Korean, proximal promoter, weak B subgroup
ABO regulatory regions, including the proximal promoter, +5.8-kb
site and CCAAT-binding factor (CBF)/NF-Y binding site [1, 3–13].
These subgroups are often misclassified as having common ABO
genotypes such as ABO*B.01/O.01.01 because ABO genotyping in
many blood banks examines only the coding exons and flanking
introns of the ABO gene. In our previous study, the sequencing
analysis of all exons and flanking introns of ABO revealed no
subgroup-causing variants in 11 of 12 Korean blood donors with
B3 phenotype [14], suggesting that a substantial proportion of
wileyonlinelibrary.com/journal/vox Vox Sanguinis. 2022;117:442–446.
MOLECULAR BASIS OF WEAK B PHENOTYPES IN KOREANS 443

weak B subgroups in the Korean population may be caused by var-
iants in the ABO regulatory regions. Hence, in the present study,
we analysed the major regulatory regions of ABO in Koreans with
weak B phenotypes.
MATERIALS AND METHODS
This study included 16 Korean patients with weak B phenotypes
carrying no subgroup-causing variants in exons 6 and 7 of ABO.
Factors associated with down-regulation of ABO antigen expres-
sion, including pregnancy and haematological malignancies,
were absent in all patients. Genomic DNA was extracted from
whole blood using the Wizard Genomic DNA Purification Kit
(Promega, Madison, WI). The Institutional Review Board of
Samsung Medical Centre approved this study (IRB no. SMC
2020-08-077).
ABO forward typing was carried out using the tube method
with anti-A, anti-B (Shinyang Diagnostics, Siheung, Korea), anti-
A,B, anti-A1 (Ortho Clinical Diagnostics, Raritan, NJ) and anti-H
(Lorne Laboratories, Reading, UK) reagents. ABO reverse typing
was conducted using the tube method with A1 and B cells (Ortho
Clinical Diagnostics). Samples showing a weak B phenotype in rou-
tine serology were subjected to polymerase chain reaction (PCR)
amplification and sequencing of ABO exons 6 and 7 as previously
described by our group [15]. If no subgroup-causing variant was
found in ABO exons 6 and 7, PCR amplification and sequencing of
ABO exons 1–5, including the proximal promoter were performed
according to the previously described methods [16, 17]. Next, the
CBF/NF-Y binding site was amplified and sequenced using the
primer pair described by Olsson et al. [2]. In addition, to identify
two types of deletions involving the +5.8-kb site of ABO intron 1,
a 5.8-kb deletion (g.10157_15927del) and a 3.0-kb deletion
(g.9130_12158del), PCR amplification was performed using the
following primer pairs described by Sano et al. [4]: ABO+4419S
and ABO+11078AS for the 5.8-kb deletion and ABO+3043S and
ABO+11078AS for the 3.0-kb deletion. To identify sequence vari-
ants in the +5.8-kb site, the PCR products were sequenced using
the primer ABO+5743S described by Takahashi et al. [6]. As the
ABOInt1*06 haplotype of the 5.8-kb site is linked to B alleles [18],
allele-specific PCR and sequencing targeting the ABOInt1*06 hap-
lotype were carried out to confirm whether sequence variants
identified in the +5.8-kb site are located on the B allele. We used
the primer pair ABO+5733A_F and ABO+7196R to distinguish
between the B and O alleles and the primer pair ABO+4419S and
ABO+6152C_R to distinguish between the B and A alleles. The
primer sequences used in this study are presented in Table S1.
RE SU LT S
The serological and molecular results of 16 samples with weak B
phenotypes are summarized in Table 1. Of the 16 samples with
weak B phenotypes, 14 (87.5%) were found to carry a heterozy-
gous variant either in the proximal promoter (NG_006669.2:
g.4991_5008del [n = 3, 18.8%]) or the +5.8-kb site
(NG_006669.2:g.10893G>A [n = 4, 25.0%] and NG_006669.2:
g.10925C>T [n = 7, 43.8%]) (Figure 1). Of note, the g.10893G>A
variant has not been reported previously in individuals with weak
B phenotypes. Allele-specific PCR and sequencing targeting
ABOInt1*06 detected g.10893G>A and g.10925C>T (Figure 1a)
as well as single nucleotide polymorphisms present on
ABOInt1*06, indicating that g.10893G>A and g.10925C>T are
located on the B allele. The remaining two samples were found to
carry no subgroup-causing variants in the coding exons, proximal
promoter, CBF/NF-Y binding site and +5.8-kb site of ABO.

TABLE 1 Serological and molecular results of 16 samples with weak B phenotypes

Forward typing Reverse typing Regulatory region

a
No. of samples Phenotype Anti-A Anti-B Anti-A,B Anti-H A1 cell B cell Genotype Proximal promoter +5.8-kb site
3 A1B3 4+ 3+mf 4+ 01+ 0 0 ABO*A1.02/B.01 g.4991_5008del WT
3 A1Bw 4+ 2+ 4+ 1+2+ 0 0 ABO*A1.02/B.01 WT g.10925C>T
1 A1B3 4+ 3+mf NT NT 0 0 ABO*A1.02/B.01 WT g.10925C>T
1 A1Bw 4+ 2+ 4+ 2+ 0 0 ABO*A1.01/B.01 WT g.10925C>T
1 B3 0 3+mf NT NT 4+ 0 ABO*B.01/O.01.01 WT g.10925C>T
1 Bw 0 2+ NT NT 3+ 0 ABO*B.01/O.01.02 WT g.10925C>T
1 A1Bw 4+ 1+ 4+ 2+ 0 0 ABO*A1.02/B.01 WT g.10893G>A
1 B3 0 3+mf 2+ 3+ 4+ 0 ABO*B.01/O.01.01 WT g.10893G>A
2 B3 0 3+mf 3+mf 2+ 4+ 0 ABO*B.01/O.01.02 WT g.10893G>A
1 A1B3 4+ 3+mf 4+ 1+ 0 0 ABO*A1.02/B.01 WT WT
1 A1Bw 4+ 2+ 4+ 2+ 0 0 ABO*A1.02/B.01 WT WT

Abbreviations: mf, mixed-field agglutination; NT, not tested; WT, wild type.
a
ABO genotypes were determined based on the results of sequencing analysis of the entire coding regions of ABO.
444 YU ET AL.

F I G U R E 1 Three subgroup-causing variants detected in the proximal promoter and +5.8-kb site of ABO. (a) PCR products of the major
regulatory regions of ABO and sequence variants detected by sequencing analysis of the products. In our cohort, g.4991_5008del in the proximal
promoter and g.10893G>A and g.10925C>T in the +5.8-kb site was detected. Allele-specific PCR and sequencing demonstrated that
g.10893G>A and g.10925C>T is located on the ABOInt1*06 haplotype linked to B alleles. (b) Locations of subgroup-causing variants detected in
the +5.8-kb site. Subgroup-causing variants and nearby common single nucleotide polymorphisms are shown in red and blue text, respectively.
The motifs for transcription factors GATA, RUNX1 and C/EBPα are indicated by overbars. CBF, CCAAT-binding factor

DISCUSSION
The proximal promoter, located between 150 and 2 relative to the
translation start site (TSS), has been shown to play a critical role in the
regulation of ABO transcriptional activity [19]. Since Cai et al. reported
an 18-bp deletion (g.4991_5008del) in the ABO proximal promoter in
Chinese individuals with B3 and A1B3 phenotypes [1], three single nucle-
otide variants have been reported in this region (g.4958G>T [9] and
g.4949C>G [6] in Japanese individuals with B3 phenotype and
g.4954G>A in a Ukrainian individual with B3 phenotype [12]). In this
study, 3 of 16 Korean individuals with weak B phenotypes were
identified to harbour the g.4991_5008del variant, all of whom had the
A1B3 phenotype. This finding is consistent with the aforementioned
studies showing that sequence variants in the ABO proximal promoter,
including g.4991_5008del, cause the B3 or A1B3 phenotype [1, 6, 9, 12].
Sano et al. identified an erythroid cell-specific regulatory region
between +5653 and +6154 relative to the TSS, named the +5.8-kb
site [4]. The erythroid cell-specific regulatory activity of the +5.8-kb
site was found to be dependent on the binding of the haematopoietic
transcription factors GATA and runt-related transcription factor 1
(RUNX1), and variants in the binding motifs of these factors were
shown to reduce the transcriptional activity of the +5.8-kb site [4, 7].
MOLECULAR BASIS OF WEAK B PHENOTYPES IN KOREANS 445

TABLE 2 Variants in the proximal promoter and +5.8-kb site of ABO identified in individuals with weak B phenotypes to date

Variant

Regulatory region NG_006669.2 (LRG_792) Nomenclature in the original report Phenotype Population Reference
a
Proximal promoter g.4991_5008del 35_ 18del B3, A1B3 Chinese, Japanese, Korean [1, 6], this study
g.4958G>T 68G>Ta B3 Japanese [9]
a
g.4954G>A c. 72G>A B3 Ukrainian [12]
g.4949C>G c. 77C>Ga B3 Japanese [6]
+5.8-kb site g.9130_12158del +4105_+7136delb Bm Japanese [8]
g.10157_15927del +5137_+10914delb Bm, A1Bm Japanese [4, 8]
g.10893G>A g.10893G>A B3, A1Bw Korean This study
g.10911T>G +5890T> Gb Bm, Bel, A1Bel Japanese, Chinese [5, 11]
g.10925C>T +5904C> Tb B3, Bw, A1B3, A1Bw Chinese, Korean [11], this study
g.10926A>C +5847A>Cc B3 Unknown [13]
g.10928A>G +5849A>G c
B3, A1B3 Unknown [13]
g.10935C>T c.28+5885C>Ta B3 Chinese [10]
a
The reference sequence was not provided in the original report.
b
The position is relative to the translation start site of the reference sequence NT_035014.4.
c
The position is relative to the translation start site of the reference sequence KC841429.

To date, seven variants in the +5.8-kb site have been reported to
cause weak B phenotypes, most of which have been identified in Chi-
nese and Japanese individuals [4, 5, 8, 10, 11, 13]. In the Japanese
population, Bm is the most common B subgroup, the main mechanism
of which is the 5.8-kb deletion (g.10157_15927del) [4, 8, 19]. In con-
trast, in the Chinese and Korean populations, B3 is the most common
B subgroup [10, 14], and the 5.8-kb deletion has not been reported. In
this study, which included 16 Koreans with weak B phenotypes, the
most frequent variant was g.10925C>T located in the RUNX1 motif of
the +5.8-kb site (Figure 1b). This variant has been reported in Chinese
individuals with B3 and Bw phenotypes and demonstrated to reduce the
transcriptional activity of the +5.8-kb site [11]. The g.10893G>A vari-
ant, first discovered in this study, is located adjacent to the binding
motif of the transcription factor CCAAT/enhancer-binding protein α
(C/EBPα) (Figure 1b). C/EBPα regulates the transition from straight-
chain i to branched-chain I during erythroid differentiation [20]; how-
ever, its effect on ABO transcriptional regulation in erythroid cells
remains unknown. Thus, further functional studies are necessary to con-
firm whether the g.10893G>A variant adjacent to the C/EBPα motif
affects the transcriptional activity of the +5.8-kb site. This variant is
listed in dbSNP as rs1588646575 and has a very low allele frequency
(AF) in population databases: gnomAD v3.1.1, AF = 0.00001314 in the
total population and AF = 0 in the East Asian population; KRGDB,
AF = 0.00029395 in the Korean population. Table 2 presents a list of
all variants in the proximal promoter and +5.8-kb site of ABO identified
in individuals with weak B phenotypes to date.
The CBF/NF-Y binding site, located approximately 3800 bp
upstream of the TSS, has been suggested as an erythroid cell-specific
regulatory region [19] and variants in this region have been observed
in individuals with weak B phenotypes [3]. However, it remains uncer-
tain whether the CBF/NF-Y binding site is indeed involved in tran-
scriptional regulation in erythroid cells. In the present study,
sequencing analysis of the CBF/NF-Y binding site identified no vari-
ants in any of the 16 Koreans with weak B phenotypes. Furthermore,
we found no subgroup-causing variants in two Koreans with weak B
phenotypes (A1B3 and A1Bw). In these cases, microchimerism that is
below the detection limit of Sanger sequencing or variants in ABO reg-
ulatory regions uncovered by our sequencing analysis could be the
culprit of the weak B phenotypes. Deep sequencing of the complete
ABO gene may be helpful in identifying the culprit.
In conclusion, we identified three sequence variants of the
ABO regulatory regions in Koreans with weak B phenotypes:
g.4991_5008del in the proximal promoter, g.10893G>A and
g.10925C>T in the +5.8-kb site. Our study demonstrates that
sequence variants in the proximal promoter and +5.8-kb site
account for a substantial proportion of weak B subgroups in
Koreans, suggesting that molecular analysis of these regions is
crucial for the accurate determination of ABO genotypes in
Koreans with weak B phenotypes, particularly B3 and Bw .
AC KNOW LEDG EME NT S
D.C. and J.H.K. designed the study, supervised the data analyses and
reviewed and edited the manuscript. H.Y., S.J.M., H.J.Y. participated in
experiments. T.Y.K. and Y.N.C. analysed the data. H.Y. and
T.Y.K. wrote the initial draft of the manuscript. All authors read and
approved the final manuscript.
CONFLIC T OF INT ER E ST
The authors have no conflict of interest.
ORCID
HongBi Yu https://orcid.org/0000-0002-2401-5958
Tae Yeul Kim https://orcid.org/0000-0002-6405-5305
Duck Cho https://orcid.org/0000-0001-6861-3282
446
RE FE R ENC E S
1. Cai X, Jin S, Liu X, Fan L, Lu Q, Wang J, et al. Molecular genetic anal-
ysis of ABO blood group variations reveals 29 novel ABO subgroup
alleles. Transfusion. 2013;53:2910–6.
2. Olsson ML, Irshaid NM, Hosseini-Maaf B, Hellberg Å, Moulds MK,
Sareneva H, et al. Genomic analysis of clinical samples with serologic
ABO blood grouping discrepancies: identification of 15 novel A and
B subgroup alleles. Blood. 2001;98:1585–93.
3. Seltsam A, Wagner FF, Grüger D, Gupta CD, Bade-Doeding C,
Blasczyk R. Weak blood group B phenotypes may be caused by vari-
ations in the CCAAT-binding factor/NF-Y enhancer region of the
ABO gene. Transfusion. 2007;47:2330–5.
4. Sano R, Nakajima T, Takahashi K, Kubo R, Kominato Y, Tsukada J,
et al. Expression of ABO blood-group genes is dependent upon an
erythroid cell-specific regulatory element that is deleted in persons
with the Bm phenotype. Blood. 2012;119:5301–10.
5. Nakajima T, Sano R, Takahashi Y, Kubo R, Takahashi K, Kominato Y,
et al. Mutation of the GATA site in the erythroid cell-specific regula-
tory element of the ABO gene in a Bm subgroup individual. Transfu-
sion. 2013;53:2917–27.
6. Takahashi Y, Isa K, Sano R, Nakajima T, Kubo R, Takahashi K, et al.
Presence of nucleotide substitutions in transcriptional regulatory ele-
ments such as the erythroid cell-specific enhancer-like element and
the ABO promoter in individuals with phenotypes A3 and B3, respec-
tively. Vox Sang. 2014;107:171–80.
7. Takahashi Y, Isa K, Sano R, Nakajima T, Kubo R, Takahashi K, et al.
Deletion of the RUNX1 binding site in the erythroid cell-specific reg-
ulatory element of the ABO gene in two individuals with the Am phe-
notype. Vox Sang. 2014;106:167–75.
8. Sano R, Kuboya E, Nakajima T, Takahashi Y, Takahashi K, Kubo R,
et al. A 3.0-kb deletion including an erythroid cell-specific regulatory
element in intron 1 of the ABO blood group gene in an individual
with the Bm phenotype. Vox Sang. 2015;108:310–3.
9. Isa K, Yamamuro Y, Ogasawara K, Yabe R, Ogiyama Y, Ito S, et al.
Presence of nucleotide substitutions in the ABO promoter in individ-
uals with phenotypes A3 and B3. Vox Sang. 2016;110:285–7.
10. Tao C, Xiao J, Hu Y, Huang C, Sun J, Li M, et al. A novel B allele with
c.28 + 5885C>T substitution in the erythroid cell-specific regulatory
element identified in an individual with phenotype B3. Transfusion.
2017;57:1318–9.
11. Ying Y, Hong X, Xu X, Ma K, He J, Zhu F. A novel mutation +5904
C>T of RUNX1 site in the erythroid cell-specific regulatory element
decreases the ABO antigen expression in Chinese population. Vox
Sang. 2018;113:594–600.
YU ET AL.
12. Hellberg A, Hult AK, Moser I, Tomaz B, Rodrigues M, Olsson ML. A
novel single-nucleotide substitution in the proximal ABO promoter
gives rise to the B3 phenotype. Transfusion. 2019;59:E1–3.
13. Hult AK, Hellberg A, Hosseini-Maaf B, Pisacka M, Hustinx H, Lejon-
Crottet S, et al. Disrupted RUNX1 motifs in the ABO gene explain
samples with A3 and B3 phenotypes [abstract 3A-S04-03]. Vox Sang.
2020;115(Suppl s1):15.
14. Lee SG, Cho D, Jeon MJ, Song J, Shin M, Shin J-H, et al. Analysis of
complete exons and flanking introns of ABO gene in Korean B3
blood donors. Korean J Blood Transfus. 2006;17:97–105.
15. Cho D, Kim SH, Jeon MJ, Choi KL, Kee SJ, Shin MG, et al. The sero-
logical and genetic basis of the cis-AB blood group in Korea. Vox
Sang. 2004;87:41–3.
16. Danzer M, Polin H, Stabentheiner S, Hartmann CC, Lennartz K,
Gabriel C. Comprehensive polymorphism analysis of ABO using
allele-specific separation by bead technology and subsequent
sequencing. Vox Sang. 2010;98:451–4.
17. Wu PC, Lin YH, Tsai LF, Chen MH, Chen PL, Pai SC. ABO genotyping
with next-generation sequencing to resolve heterogeneity in donors
with serology discrepancies. Transfusion. 2018;58:2232–42.
18. Nakajima T, Sano R, Takahashi Y, Watanabe K, Kubo R,
Kobayashi M, et al. ABO alleles are linked with haplotypes of an ery-
throid cell-specific regulatory element in intron 1 with a few excep-
tions attributable to genetic recombination. Vox Sang. 2016;110:
90–2.
19. Kominato Y, Sano R, Takahashi Y, Hayakawa A, Ogasawara K.
Human ABO gene transcriptional regulation. Transfusion. 2020;60:
860–9.
20. Twu YC, Chen CP, Hsieh CY, Tzeng CH, Sun CF, Wang SH, et al. I
branching formation in erythroid differentiation is regulated by tran-
scription factor C/EBPα. Blood. 2007;110:4526–34.
SUPPORTING INF ORMATION
Additional supporting information may be found in the online version
of the article at the publisher’s website.
How to cite this article: Yu HB, Kim TY, Moon SJ, Chung YN,
Yoo HJ, Kim JH, et al. Sequence variants in the proximal
promoter and +5.8-kb site of ABO in Koreans with weak B
phenotypes. Vox Sang. 2022;117:442–6.
Received: 20 July 2021 Accepted: 21 July 2021
DOI: 10.1111/vox.13192
INTERNATIONAL FORUM
International Forum on Gender Identification and Blood
Collection: Summary
Suchitra Pandey | Jed B. Gorlin | Mary Townsend | Nancy Van Buren
Jennifer N. S. Leung | Cheuk-kwong Lee | Katja van den Hurk |
Natalia Casamitjana | Roser Valles | Eva Alonso | Yvette Marie Miller |
Pascale Richard | Geneviève Woimant | Pierre Tiberghien | Eugene Zhiburt |
Terrie Butler-Foster | Mindy Goldman | Lise Sofie H. Nissen-Meyer |
Aurora Espinosa | Hany Kamel | Marj Bravo | Luiz Amorim Filho |
Margarida Pecego | Marc Germain | Isabelle Rabusseau | Eilat Shinar |
Hana Raz | Nabajyoti Choudhury | Nidhi Bhatnagar | Kelsi Hurt |
Melissa Lopez | Rita A. Reik | Yongmei Nie
Nancy Dunbar
I N T R O D U CT I O N
Transgender is an umbrella term for individuals whose gender identity
(includes genders outside of the male/female binary) differs from their
sex assigned at birth. Although the majority of transgender people will
identify as either male or female, for some, gender identity is a blend
of male and female elements and others do not identify with either
gender, commonly described as non-binary [1]. Table 1 provides a
description of commonly used transgender-related terminology [2, 3].
In the past decade, there has been a growing societal awareness
of the wide spectrum of gender identity and being transgender.
Increased mainstream visibility and political discourse have furthered
transgender rights worldwide. In 2019, the World Health Organization
removed ‘gender identity disorder’ from the chapter on mental
illnesses in the International Classification of Diseases so that transgen-
der people were no longer labelled as mentally ill and were recognized
as expressing human variation [4]. Globally, multiple countries now
legally recognize non-binary or third gender classifications and allow a
third gender option (such as gender X) on government identification
like passports [5]. In the United States, 20 states currently allow resi-
dents to mark M, F or X on their driver’s licence [6]. Many countries
also permit citizens to change their gender on identification but
requirements to do so vary. In Europe and Central Asia, transgender
people can change their gender in 41 of 54 countries, although
Vox Sanguinis. 2022;117:447–456. wileyonlinelibrary.com/journal/vox
|
| Yang Hung | Lethola Pheello |
31 countries still require a mental health diagnosis and 13 require
gender-affirming surgery, which is controversial [7]. Today, gender
identity and requests for gender affirmative medical interventions
(GAMI) such as surgery and/or hormone treatment are more diverse,
including a number of transgender individuals who have decided against
GAMI [8]. A recent survey of transgender people in Germany showed
that 3.4% did not report prior or planned GAMI. In general, non-binary
individuals request treatment less often, especially genital surgery [8, 9].
Currently, there is very limited data regarding the number of
transgender people in different countries. A US report from 2016 esti-
mated 0.6% of adults, about 1.4 million, identify as transgender in the
United States [10]. In addition, a large US survey of transgender adults
showed that 33% identified as transgender women, 29% as transgen-
der men, 35% as non-binary and 3% as cross-dressers. For the non-
binary respondents, 80% were assigned as female at birth and 20% male
[1]. In India, the Supreme Court recognized ‘transgender’ as a third gen-
der in 2014, and it is estimated that 4.8 million Indian adults (0.04% of
the total population) identify as transgender [11]. In the United Kingdom,
approximately 200,000–500,000 identify as transgender [12].
Unfortunately, there are still numerous hardships that are faced
by transgender people, more so in some regions than others, but there
is evidence of growing support. A survey of over 17,000 adults in
23 countries showed majorities in all 23 countries supporting impor-
tant transgender rights [13]. Spain, Sweden, Argentina, Canada,
© 2021 International Society of Blood Transfusion 447
448
TABLE 1 Summary of transgender-related terminology
Definitions
Sex Assigned at birth as male, female or intersex
usually based on the appearance of external
anatomy.
Gender identity A person’s internal sense of identifying as male,
female, some combination of male and female
or neither male nor female. Unlike gender
expression (see below), gender identity is not
visible to others.
Gender External manifestations of gender, expressed
expression through a person’s name, pronouns, clothing,
haircut, behaviour, voice and/or body
characteristics.
Cisgender People whose current gender identity matches the
sex they were assigned at birth
Transgender An umbrella term for individuals whose gender
identity differs from the sex they were
assigned a birth. It includes people who have
medically transitioned to align their internal
knowledge of their gender with their physical
presentation, but it also includes those who
have not or will not medically transition as well
as non-binary people who do not exclusively
identify as male or female.
Transgender A person who was assigned female at birth but
male whose gender identity is male (with or without
gender affirmative medical interventions).
Transgender A person who was assigned male at birth but
female whose gender identity is female. Biological
male identifying as female (with or without
gender affirmative medical interventions).
Non-binary People who experience their gender identity
and/or gender expression as falling outside the
categories of male and female. They may
identify with a gender other than male or
female, as more than one gender or as no
gender. These individuals may refer to
themselves as non-binary, genderqueer,
gender fluid, other-gendered, agendered, third
gendered and many other terms.
Gender non- A term used to describe some people whose
conforming gender expression is different from
conventional expectations of masculinity and
femininity. Not all gender non-conforming
people identify as transgender or are all
transgender people gender non-conforming.
The term is not a synonym for transgender and
should only be used if someone self-identifies
as gender non-conforming.
Germany and Great Britain had the highest levels of support. Surveys
have also shown increased awareness and acceptance, especially in
the younger generations [13, 14].
For blood collection organizations (BCOs), there are unique chal-
lenges relating to transgender blood donors that must be considered,
and recently, there has been more focus on transgender donor issues,
especially as BCOs experience an increase in donors identifying as
transgender [15, 16]. One of the major system challenges at this time
is the binary gender limitations of most blood establishment computer
PANDEY ET AL.
systems (BECS). The majority of BECS used by BCOs worldwide only
has a male and female gender option [17]. The results of a 2017 amer-
ican association of blood banks (AABB) survey of the United States
and Canadian BCOs showed that only 3% had additional gender
options for donors in their BECS [16]. Some BECS vendors are now
evaluating the addition of more gender options. For example, an inter-
national users’ group for ePROGESA® (MAK Systems), a commonly
used BECS worldwide, is discussing strategies for moving away from a
binary gender approach.
Another challenge related to transgender donors is the determina-
tion of sex/gender at registration. For some centres, the sex/gender for
the donor’s record will be taken from identification but this may not
reflect the donor’s gender identity. Other centres will accept the donor’s
self-declared gender while others document the donor’s sex at birth or
perform an individual assessment [17]. Ultimately, the sex/gender docu-
mented in the donor’s record will determine what donor screening
questions will be asked if a gender-specific electronic questionnaire is
being used. In the United States, a 2015 food and drug administration
(FDA) guidance stated that ‘in the context of the donor questionnaire,
FDA recommends that male or female gender be taken to be self-identi-
fied’ and the majority of the US blood centres now allow blood donors
to self-report their gender for the record [16, 18, 19]. There is little
guidance, however, on screening donors who identify as non-binary.
Interestingly, a 2019 survey of 39 US BCOs showed that 21% had added
non-binary gender identification to their procedures and 31% planned to
do so in the future [18]. In addition, 33% reported that they were aware
of a non-binary individual presenting to donate at their centre [18].
Finally, when a BCO is made aware of a donor being transgender
how should gender-specific donor screening criteria be handled?
Gender-specific questions about pregnancy history to assess for
transfusion-related acute lung injury (TRALI) risk and high-risk sexual
activity are asked by many BCOs. One gender-specific question for
male donors asks about sexual activity with other men (MSM) due to
higher rates of human immunodeficiency virus (HIV) infection with
MSM [19, 20]. Although studies show that transgender women also
have a high HIV infection rate, using this data to guide transgender
blood donor eligibility is not ideal since many of the HIV-infected par-
ticipants in these studies would not have qualified for blood donation
(e.g., history of accepting money for sex or drug use) [17, 21, 22].
Nevertheless, given this risk data in transgender women, the most
conservative approach would be to ask transgender women about
sexual activity with men. When it comes to individuals who identify
as non-binary, however, there is little data on HIV risk in this group to
help guide eligibility decisions. Several strategies to handle gender-
specific questions in transgender donors have been shared [17,
18, 23]. One important potential strategy that is gaining traction is the
use of a gender-neutral questionnaire for all donors regardless of gender
identity [24]. Some countries, most recently the United Kingdom on
14 June 2021, have implemented a questionnaire that asks the same
high-risk questions to all donors [25, 26].
Haemoglobin (Hgb) criteria and blood volume calculations are also
typically gender-specific in order to protect donor health. Due to
physiologic differences in normal Hgb levels between males and
females, the minimum Hgb acceptance criteria is usually lower for
INTERNATIONAL FORUM ON GENDER IDENTIFICATION AND BLOOD COLLECTION: SUMMARY 449

females than males. In addition, apheresis collection platforms require
the entry of a male or female gender in order to calculate an estimated
blood volume (EBV) since different calculations are used for males
and females. EBV is slightly lower in females than in males of the same
weight and height. For transgender donors, including non-binary
donors, blood centres must decide what Hgb criteria and EBV calcula-
tions are most appropriate to use. Of note, hormone treatment in
transgender donors can impact both Hgb and EBV [17].
In order to gain a global perspective on gender identification and
blood donation, we invited international BCOs to share their approach
to blood donors whose gender identity differs from their sex assigned
at birth. Questions included how donor gender is ascertained if a
donor’s recorded gender can be changed, how eligibility criteria are
assessed in transgender donors and how non-binary donors are man-
aged. Background information about each country’s policies on
requests for gender changes was also captured. A total of 24 sites
were invited to participate in the forum and 18 responses rep-
resenting 14 countries were received.
S U M M A R Y OF R E S P O N S E S
East, Asia and Australia were all represented. Excluding the US sites,
most were national blood services covering or representing policies
for their entire nation, with the exception of a few hospital-based
blood services (e.g., Russia, Norway and India) that lack a national ser-
vice. In the United States, four centres were surveyed, while many
truly provide service on a national scope, they functionally act as
regional centres as no one organization is granted exclusive responsi-
bility for any specific geography. Collection volumes range from 5000
(a hospital-based centre in India) to almost five million at some US
centres.
Question 2 In your country, can someone change their gender on
government-issued identification such as a driver’s licence
or national identity card (e.g., birth sex is female, but gen-
der can be changed to male)? If yes, what is required to
change one’s gender on government-issued identification?
For example, is gender reassignment treatment (surgery or
hormones) required, or can gender be changed without
treatment? Is it possible to change one’s gender to non-
binary (neither male nor female) on government-issued
identification?

Question 1 Respondent demographic information
Responses to the survey were received from 18 respondents
from across the globe. These included a predominant number from
North America and Europe, but South America, Africa, the Middle
As shown in Table 2, in many of the surveyed countries, it is pos-
sible to formally submit a gender change to the governing body with
or without GAMI, but in many cases, this is restricted to the two gen-
ders: male or female, and a non-binary or a third gender choice is
often not available. For example, in Brazil, South Africa and Norway, it

TABLE 2 Ability for citizens to change their gender on government identification in the countries participating in this forum

Gender change GAMI (medical or NB gender is an

Country on ID allowable surgical) required option on ID
China No N/A N/A
Australia Yes Yes/No (requirements vary between Yes (gender ‘X’ option
state and federal jurisdictions) allowed on some ID)
South Africa Yes Yes No
Hong Kong Yes Yes No
Netherlands Yes No No (few cases were
allowed by court)
Spain Yes Yes No
United States Yes Yes/No (requirements vary on Yes (some states have an
federal and state level) NB option on
government-issued
identification)
France Yes No No
Russia Yes Yes No
Canada Yes No (some provinces require a note Yes (passport and some
from provider or sworn statement) provinces’ ID has
gender X option)
Norway Yes No No
Brazil Yes No No
Israel Yes No No
India Yes (only one time) Yes Noa

Abbreviations: GAMI, gender affirmative medical interventions; ID, identification; NB, non-binary.
a
Although a gender of ‘non-binary’ is not an option on government identification, there are three gender options: male, female and transgender.
450
is possible to petition to change gender of record but not to no gen-
der. Australia, Canada and the United States reported that there is a
non-binary (gender X) option on some government identification
although it may only be an option in some states or provinces. This
can be a considerable challenge for blood collection agencies that
cover multiple states/provinces.
Question 3 How does your blood centre determine the
sex/gender of a potential donor?
Eight respondents, including BCOs in the United States, Australia,
South Africa, Brazil, Canada and India, reported that a blood donor’s
gender of record can be self-reported and another eight respondents,
including all European centres surveyed, reported that a blood donor’s
gender is determined by the sex/gender documented on the identifi-
cation presented by the donor. Two BCOs reported that a donor’s sex
at birth was recorded. Two respondents also specifically noted that if
needed, blood centre staff made an individual assessment to help
determine a potential donor’s gender for the record, taking into
account multiple factors. Refer to Table 3 for a summary of responses
to this question.
Question 4 Does your blood centre allow a donor to change their
gender? If yes, describe what is required for a blood donor
to change their gender. For example, can gender be chan-
ged only if the donor provides changed gender on gov-
ernment identification or is getting treatment to
change gender? Can a donor change their gender simply
by self-reporting their new gender without treatment or
changed gender on identification?
The majority of respondents (n = 14) reported allowing a donor
to change their gender as summarized in Table 3. Seven respondents
reported that a blood donor can change their previously recorded
gender if their gender had been changed on government-issued iden-
tification, while five sites (Australia, Brazil and three US sites) allowed
a blood donor to change their recorded gender based on self-report
alone without either a gender change on identification or evidence of
GAMI. For two respondents (in Canada and Norway), a transgender
donor may change their recorded gender only after gender affirmation
surgery. China, India and one site in the United States did not allow a
donor to change their gender and the respondents from China and
India indicated on the survey that transgender donors are not permit-
ted to donate. In India, regulations on blood donations require deferral
of individuals who have changed their gender, but it was noted that
this criteria is being further reviewed at the request of the Indian
Supreme Court.
Question 5 Can a blood donor identify as non-binary at your
blood centre? To your knowledge, has an individual who
identifies as non-binary ever presented to your blood cen-
tre to donate blood?
PANDEY ET AL.
All respondents with the exception of one site in the United
States reported that it was not possible for the donor to identify as
non-binary in the donor’s record (refer to Table 3). The one US site
indicated on the survey that they have four gender options for blood
donors: female, male, transgender and other; and non-binary donors
can select the ‘other’ gender option for the donor record. Two sites
(Australia and Brazil) specifically noted that although a donor may
identify as non-binary due to the limitations of their computer system,
the donor had to select male or female in order to donate. India indi-
cated that a non-binary donor must be deferred per current regula-
tions. Respondents from Australia, Netherlands, Canada and the
United States stated that they were aware of non-binary donors who
had presented to donate. However, the majority of respondents
admitted that they were not aware of a non-binary donor presenting
to donate at their centre. Nevertheless, one centre acknowledged that
given the large region they served in their country most likely a non-
binary donor had presented but it was just not known.
Question 6 Is your blood centre’s computer system currently able
to accommodate gender(s) other than male or female?
Please specify what computer system your centre uses.
Only one of the 18 respondents had a computer system able to
accommodate gender(s) other than male or female by providing a
‘transgender’ and ‘other’ option (refer to Table 3). Not all centres
specified which computer system they used, but ePROGESA® (MAK
Systems) accounted for the majority of the responses.
Question 7 Does your blood centre ask different donor history
questions for high-risk behaviour based on gender (some
questions are different for males and females)? Can you
provide us with specific questions that are based on
gender?
The majority of respondents currently ask questions about high-
risk behaviour that are specific for male or female gender as shown in
Table 4. However, six respondents reported that the same questions
are asked of all donors regardless of gender (South Africa, Brazil,
Spain, Russia, India and China). In Brazil, the Supreme Court decided
in June 2020 that blood banks could not ask different questions for
male and female prospective donors (except pregnancy-related ques-
tions). Specifically, it is now forbidden to ask male donors if they have
had sex with another man in the past 12 months. Instead, the same
questions about sexual behaviour are asked of males and females,
such as the number of sexual partners in the last months, sex with a
new partner and sex for money. South Africa responded that the
deferral of men who have sex with men was removed in 2016.
There were a variety of responses about how blood centres
would manage questions if they were made aware of a donor being
transgender or non-binary. India accords basic rights to a third gender
individual, but a donor identifying as transgender is deferred from
blood donation by regulations of the country although this is currently
INTERNATIONAL FORUM ON GENDER IDENTIFICATION AND BLOOD COLLECTION: SUMMARY 451

T A B L E 3 Summary of how respondents determine donor gender, if a donor’s gender can be changed, information about NB donors and if the
facility’s computer system allows additional gender options

Gender determination Donor can Aware of a NB Computer system

for donor record Donor gender identify as NB donor presenting allows genders
Respondent (at registration) change allowed (in donor record) to donate other than M or F
China Sex at birth NOa NO No responseb NO
Australia Self-report YES (by self-report) NO YES NO
South Africa Self-report N/A (no known requests) NO NO NO
b
Hong Kong Government ID YES (if changed on ID) NO No response NO
Netherlands Government ID YES (if changed on ID) NO YES NO
Spain Government ID YES (if changed on ID) NO No responseb,c NO
US 1 Self-report YES (by self-report) YES YES YESd
US 2 Self-report YES (by self-report) NO NO NO
US 3 ID, self-report of sex if NOe NO NO NO
not on IDe
US 4 Self-report YES (by self-report) NO NO NO
b
France Government ID YES (if changed on ID) NO No response NO
Russia Government ID YES (if changed on ID) NO No responseb NO
f f
Canada 1 Sex at birth YES NO YES NO
Canada 2 Self-report/staff YES (if changed on ID) NO NO NO
assessmentg
Norway Government ID/staff YESh NO NO NO
assessmenth
Brazil Self-report YES (by self-report) NO NO NO
Israel Government ID YES (if changed on ID) NO NO NO
India Self-report NOa NO NO NO

Abbreviations: F, female; ID, identification; M, male; MSM, male sex with male activity; NB, non-binary; TG, transgender; TRALI, transfusion-related acute
lung injury.
a
TG and NB donors are deferred.
b
No response was provided to the question ‘To your knowledge, has an individual who identifies as non-binary ever presented to your blood centre to
donate blood?’
c
Centre has received suggestions from donors requesting a non-binary gender option.
d
Four gender options available for donor record in computer system: male, female, transgender and other.
e
If a donor is known to be TG male, TG female or non-binary, their gender/sex is entered as (or if needed changed to) male in the donor record in order to
ask questions on MSM.
f
Donor registered based on sex at birth. TG and NB donors who have not had lower genital affirming surgery are registered as their sex at birth. Gender
affirmation surgery is required to change gender.
g
Self-reported gender can now be assigned in system. When a donor identifies as transgender, a telephone meeting is conducted by the medical director
or delegate (nurse) and an individual assessment is made to determine sex/gender of a potential donor (focus on MSM and TRALI risk). An NB donor must
accept an M or F gender identification to donate.
h
If the gender observed differs from the gender on ID, the donor will be asked about birth sex. After gender affirmation surgery, the donor can be assessed
using new gender. Donors who have changed gender without treatment will be assessed based on the information provided.

under review. China also currently defers all transgender and non-
binary individuals from blood donation.
Question 8 How does your blood centre assess pregnancy history
for TRALI risk? How do you manage this if you are made
aware of a donor being transgender? If a donor identifies
as non-binary, how do you assess pregnancy history?
do not assess pregnancy history for TRALI risk but instead prevent
the collection or production of TRALI risk components for transfusion
from all-female donors. In some countries, this also applies to all
donors self-identified as transgender, including non-binary. The
respondent from Norway indicated that all first-time apheresis donors
are tested for human leukocyte antigen (HLA) antibodies, regardless
of gender or pregnancy history.

The majority of respondents to the survey assess pregnancy his- Question 9 Does your blood centre have different Hgb or
tory for TRALI risk (refer to Table 4) either by obtaining pregnancy haematocrit criteria for male and female donors? What are
history from female donors or from all donors. Some BCOs, however, the criteria for use for males and females? If different
 452

TABLE 4 Assessment of high-risk behaviour and TRALI risk, including when a facility is made aware of a donor being TG or NB

Gender-specific questions for high-risk behaviour Assessing pregnancy for TRALI risk

Respondent M F TG/NB M F TG/NB

China N/A: Same questions regardless of gender N/A: deferred Questionnaire assesses for pregnancy N/A: deferred
Australia MSM in past 3 months In past 3 months sex with a TG: based on self-reported N/A: no pregnancy history for TRALI risk TRALI risk TG: TRALI risk
man who had MSM gender. NB: based on components not made from donors registered as F components not made
sex at birth. TG/NB from TG donors; NB:
answer supplemental based on sex at birth
risk questiona
South Africa N/A: Same questions for all donors regardless of genderb N/A Asked pregnancy history N/A: unaware of TG/NB
donors
Hong Kong MSM in past 12 months In past 12 months sex with a TG: staff assess with M and N/A: no pregnancy history for TRALI risk. TRALI alert for TG: TRALI alert for TG
man who had MSM F questions all F donors donors
Netherlands MSM in the past 4 In past 4 months sex with a TG: based on registered N/A: for donors registered as F, a code designates TG: if TG male, ‘potentially
months man who had MSM gender (on ID). NB: use ‘potentially HLA positive’ in the system and prevents HLA positive’ code
gender on ID plasma components. used
Spain N/A: same questions for all donors regardless of gender N/A Asked pregnancy question TG: plasma not used for
and plasma from F transfusion; NB:
donors not used for assessed as an F if F
transfusion gender on ID.
US 1 MSM in past 3 months In past 3 months sex with a Donors who register as TG N/A Asked pregnancy history Donors who register as TG
man who had MSM or other, asked M and F or other, asked
questions pregnancy question
US 2 MSM in past 3 months In past 3 months sex with a TG: based on self-reported N/A Asked pregnancy history TG/NB: if registered as F
man who had MSM gender identity; NB: (self-report), pregnancy
based on gender of question asked
choice
US 3 MSM in past 3 months In past 3 months sex with a TG/NB: assess with the M All donors asked pregnancy question
man who had MSM question
US 4 MSM in past 12 months In past 12 months sex with a TG/NB: no response N/A Asked pregnancy history TG/NB: if sex at birth is F,
and MSM ever man who had MSM assessed for TRALI
France MSM in past 4 months In past 4 months sex with a TG/NB: based on gender N/A Asked pregnancy history TG/NB: assessed based on
man who had MSM on ID gender on ID
Russia N/A: same questions for all donors regardless of gender N/A: no pregnancy history for TRALI risk
Canada 1 MSM in past 3 months In past 3 months sex with a TG/NB: based on sex at N/A: no pregnancy history for TRALI risk TRALI risk TG/NB: TRALI risk
man who had MSM birth if no lower genital components not made from donors registered as F components not madec
gender-affirming
surgery
(Continues)
PANDEY ET AL.
TABLE 4 (Continued)

Gender-specific questions for high-risk behaviour Assessing pregnancy for TRALI risk

Respondent M F TG/NB M F TG/NB

Canada 2 MSM in past 3 months In past 3 months sex with a TG: physician/nurse assess N/A Asked pregnancy history TG/NB: For known TG
man who had MSM to determine gender to male and NB donors, if
use; NB: must accept M donor still has uterus,
or F gender and this registered as F to
determines question assess for pregnancy
asked history
Norway MSM ever and when was In the past 6 months sex TG/NB: based on sex at N/A: all new donors tested for HLA antibodies (F donors also tested for HLA antibodies)
last contact with a man who had birth
MSM
Brazil N/A: same questions for all donors regardless of genderd All donors asked pregnancy question
e
Israel N/A: no direct questions about risk behaviour TG: TG females are N/A Asked pregnancy history No response for TG/NB
referred to information
about MSM
India N/A: same questions regardless of gender N/A: deferred Self-declarationf N/A: deferred

Abbreviations: F, female; ID, identification; M, male; MSM, male sex with male activity; NB, non-binary; TG, transgender; TRALI, transfusion-related acute lung injury.
a
For TG or NB donors, a supplemental question is asked about sexual contact with a male, transgender or gender-diverse partner within the previous 3 months.
b
No MSM deferral since 2016.
c
For donors who identify as TG or NB, a code is added to computer system so that donation is processed the same way as a donor registered as F (plasma-rich components for transfusion are not made).
d
Same questions are asked of all donors about sexual behaviour, including number of recent partners, sex with a new partner, sex for money and so forth. Supreme Court decision in June 2020 requires that
different questions cannot be asked of M and F donors regarding high-risk behaviours.
e
Donor materials include information about high-risk sexual behaviour and requests that potential donors who have had high-risk sexual activity in the past 12 months (e.g., MSM or payment for sex) defer
themselves from donation.
f
Pregnancy history is recorded as per self-declaration and signed statement from all donors.
INTERNATIONAL FORUM ON GENDER IDENTIFICATION AND BLOOD COLLECTION: SUMMARY
453
 454

T A B L E 5 Assessment of eligibility criteria to protect donor health (minimum haemoglobin [Hgb] requirement and apheresis blood volume), including when a facility is made aware of a donor
being TG or NB

Apheresis blood volume determination for TG and NB

Minimum haemoglobin/haematocrit criteria (whole blood) donors

Respondent M F TG NB TG NB
China 12 g/dl 11 g/dl N/A: TG and NB donors are deferred N/A: TG and NB donors are deferred
Australia 13 g/dl 12 g/dl Based on self-reported gender identity Based on birth sex and if Use F blood volume criteria
on hormone treatmenta
South Africa 13 g/Lb 12 g/dlb N/A: No formal policy (NB not an option on ID) N/A: unaware of donors identifying as TG/NB, no policy
Hong Kong 13 g/dl 11.5 g/dl Based on gender documented on ID N/A: gender not used in blood volume assessment only
weight
Netherlands 13.54 g/dlc 12.57 g/dlc Based on gender documented on ID Based on gender documented on ID
Spain 13.5 g/dl 12.5 g/dl Based on gender documented on ID Based on gender documented on ID
US 1 13 g/dl 12.5 g/dl Use M criteria (If registered as TG or Other) Use F blood volume criteria (If registered as TG or Other)
US 2 13 g/dl 12.5 g/dl Based on self-reported gender identity Based on gender of choice Based on self-reported gender or gender of choice
US 3 13 g/dl 12.5 g/dl Use M criteria Use F blood volume criteria
US 4 13 g/dl 12.5 g/dl Based on birth sex Based on birth sex
France 13 g/dl 12 g/dl Based on gender documented on ID Based on gender documented on ID
Russia 13 g/dl 12 g/dl Based on gender documented on ID (passport) Based on gender documented on ID (passport)
Canada 1 13.5 g/dl 12.5 g/dl Based on gender at registration (refer to Table 3) Based on gender at registration (refer to Table 3)
Canada 2 13 g/dl 12.5 g/dld Based on gender at registration (refer to Table 3) Based on gender at registration (refer to Table 3)
Norway 13.5 g/dl 12.5 g/dl Based on birth sex Based on birth sex
Brazil 13 g/dl 12.5 g/dl Use M criteria Use F blood volume criteria
Israel 13 g/dl 12 g/dl Based on gender documented on ID N/A: unaware of apheresis donors identifying as TG/NB,
no policy
India 12.5 g/dl 12.5 g/dl N/A: TG and NB donors are deferred N/A: TG and NB donors are deferred

Abbreviations: F, female; ID, identification; M, male; NB, non-binary; TG, transgender.

a
If NB donor is not on hormone treatment, their Hgb will be assessed based of registered sex (sex at birth). If NB donor is on hormone treatment, Hgb assessed will be like a TG donor.
b
In process of implementing at the time of survey completion.
c
Hgb criteria provided was in mmol/L (8.4 mmol/L for males and 7.8 mmol/L for females), which has been converted to g/dl.
d
Revised to 12.0 g/dl during coronavirus disease of 2019 (COVID-19) public health emergency.
PANDEY ET AL.
INTERNATIONAL FORUM ON GENDER IDENTIFICATION AND BLOOD COLLECTION: SUMMARY
criteria are used for males and females, which criteria would
you use if you are made aware of a donor being transgender?
What Hgb/haematocrit criteria would you use for a donor
who identifies as non-binary?
The majority of respondents confirmed that criteria for either
haematocrit or Hgb were gender-specific, with females required to
meet a lower level, with the exception of India, which sets the lower
limit at 12.5 for both genders (refer to Table 5). In the United States
and Canada, levels for females are ≥12.5 and for males ≥13.0. In
South Africa, the limits were ≥12.0 for females and ≥13.0 for males.
In countries and states where non-binary is not allowed, no option for
donation is given. The lower Hgb limit in Hong Kong is a bit lower, at
11.5 for females and 13.0 for males, but it was noted very few
females were eligible even at the lower cut-off.
For transgender and non-binary donors, there was a range of strat-
egies used to determine what criteria to use. Some reported that the
gender on the donor’s identification determined the Hgb threshold,
while others used the donor’s self-reported gender or the donor’s sex at
birth. Three respondents used the higher male Hgb cut-off for transgen-
der and non-binary donors. Refer to Table 5 for a summary.
Question 10 For apheresis procedures, how does your blood cen-
tre determine blood volume if you are made aware of a
donor being transgender? How do you determine blood vol-
ume if a donor identifies as non-binary?
There were multiple approaches reported by respondents regard-
ing EBV calculation for apheresis. However, the three most common
were setting apheresis EBV for both transgender and non-binary at
conservative female blood volumes, using the gender specified on the
government-issued ID to determine EBV for apheresis or using
the donor’s sex at birth. For a number of respondents, this question
was not applicable because gender was not used in EBV calculation,
transgender donors were deferred or there was no policy since the
centre was unaware of an apheresis transgender donor. Table 5 pro-
vides additional details on how each respondent determines EBV for
apheresis procedures in transgender and non-binary donors.
Question 11 (optional). Please provide any additional comments
relating to the management of gender non-conforming
blood donors that were not captured with the survey
questions.
A number of respondents commented on the inability to accept
non-binary donors based on the restriction of their BECS systems.
Very few BECS systems currently allow for the registration of donors
as transgender or non-binary, though this may change in the future.
Respondents also commented on the use of government-approved
donor questionnaires and the potential for the development of
gender-neutral questionnaires. One respondent shared that commu-
nity engagement and cultural competency training have helped to
improve the donor experience for transgender and non-binary donors.
455
CONC LU SION
BCOs throughout the world are increasingly requested to allow blood
donation by donors who do not identify with their sex assigned at
birth. This international survey identified significant variation in
approaches to determine the sex/gender of a potential donor, includ-
ing the process for allowing a donor to change gender and policies to
address transgender donors, including those who identify as non-
binary. Notably, this survey also showed countries that face an imped-
iment for inclusivity of transgender donors due to regulations in their
country, which require them to defer transgender donors.
One major obstacle reported by almost all the respondents in this
forum is the limitation of their BECS, which allows only a male and
female option to register donors. BECS vendors are evaluating the addi-
tion of more gender options, and there is an opportunity to learn how
other industries have modified their intake process. Manufacturers of
apheresis collection platforms should also consider adjustments to their
programme for EBV calculations to account for transgender donors. The
most conservative approach would be to allow the ‘female collection
parameter’ to be selected to estimate blood volume to reduce the risk of
reactions and improve donation safety.
Another opportunity involves the modification of the donor his-
tory questionnaire. Alternative approaches for assessing donors will
be required to reformat questions in a gender-neutral manner, partic-
ularly for HIV risk and pregnancy history. In this forum, six respon-
dents were utilizing gender-neutral questions for high-risk behaviour.
Studies validating the use of a gender-neutral questionnaire and indi-
vidual risk assessment will help to promote more widespread adop-
tion. In addition, for transgender donors, assessment by alternative
approaches is currently also hampered by the lack of data on HIV risk
in various transgender and non-binary communities. Nonetheless, a
modified approach would likely enhance the donor experience and
support gender non-discrimination.
As we continue to move forward, it is important to engage with
the lesbian, gay, bisexual, transgender, and queer or questioning com-
munity to develop and optimize policies and procedures related to
transgender blood donors. A recent report from Canadian Blood Ser-
vices stressed the importance of community engagement and
described their experience in working with the transgender commu-
nity to make improvements to the donor screening process and ensure
that donors are treated with respect and dignity [17]. Cultural compe-
tence and sensitivity training for staff are also important factors in pro-
viding a positive donor experience [17].
Ultimately, this forum demonstrates that there is an increased
awareness regarding transgender donors with progress being made by
BCOs in many countries to work towards providing a safe and inclu-
sive environment. More changes and improvements are on the hori-
zon in this rapidly evolving area, and BCOs should continue to share
their best practices, strategies and experiences.
ORCID
Cheuk-kwong Lee https://orcid.org/0000-0002-3939-564X
Pierre Tiberghien https://orcid.org/0000-0002-9310-8322
456
Terrie Butler-Foster https://orcid.org/0000-0003-2166-6031
Mindy Goldman https://orcid.org/0000-0001-9904-9952
RE FE R ENC E S
1. James SE, Herman JL, Rankin S, Keisling M, Mottet L, Anafi M. The
report of the 2015 U.S. transgender survey. Washington DC:
National Center for Transgender Equality [cited 2021 Jun 11]. Avail-
able from: https://www.ustranssurvey.org/reports
2. GLAAD medial reference guide, glossary of terms - Transgender
[cited 2021 Jun 16]. Available from: https://www.glaad.org/reference/
transgender
3. HRC’s brief guide to getting transgender coverage right [cited 2021
Jun 16]. Available from: https://www.hrc.org/resources/reporting-
about-transgender-people-read-this
4. Slagstad K. The political nature of sex - transgender in the history of
medicine. N Engl J Med. 2021;384:1070–4.
5. Gender X Passports. Enei. 2020. [cited 2021 Jun 11]. Available from:
https://www.enei.org.uk/resources/news/gender-x-passports/
6. Movement Advancement Project: Equality maps: Identity document
laws and policies. https://www.lgbtmap.org/equality-maps/identity_
document_laws. Accessed 17 Jun 2021.
7. Trans Right Europe & Central Asia Index 2020. TGEU. 2020 [cited
2021 Jun 11]. Available from: https://tgeu.org/trans-rights-europe-
central-asia-index-maps-2020/
8. Nieder TO, Eyssel J, Köhler A. Being trans without medical transition:
exploring characteristics of trans individuals from Germany not seek-
ing gender-affirmative medical interventions. Arch Sex Behav. 2020;
49:2661–72.
9. Koehler A, Eyssel J, Nieder TO. Genders and individual treatment pro-
gress in (non-)binary trans individuals. J Sex Med. 2017;15:102–13.
10. Flores AR, Herman JL, Gates GJ, Brown TNT. How many adults iden-
tify as transgender in the United States?. The Williams Institute.
2016 [cited 2021 Jun 11]. Available from: https://williamsinstitute.
law.ucla.edu/wp-content/uploads/How-Many-Adults-Identify-as-
Transgender-in-the-United-States.pdf
11. Pandya AK, Redcay A. Access to health services: barriers faced by
the transgender population in India. J Gay Lesbian Ment Health.
2021;25:132–54.
12. Government Equalities Office: Trans People in the UK. https://
assets.publishing.service.gov.uk/government/uploads/system/
uploads/attachment_data/file/721642/GEO-LGBT-factsheet.pdf
13. Flores AR, Brown TNT, Pak A. Public support for transgender rights:
a twenty-three country survey. The Williams Institute. 2016 [cited
2021 Jun 11]. Available from: https://williamsinstitute.law.ucla.edu/
wp-content/uploads/Public-Opinion-Trans-23-Countries-Dec-
2016.pdf
14. Parker K, Graf N, Igielnik R. Generation Z looks a lot like millennials
on key social and political issues. Pew Research Center. 2019 [cited
2021 Jun 11]. Available from: https://www.pewresearch.org/social-
trends/2019/01/17/generation-z-looks-a-lot-like-millennials-on-
key-social-and-political-issues/
15. Butler-Foster T, Chin-Yee I, Huang M, Jackson KT. Toward understanding
culutrally sensitive care for transgender blood donors: a scoping review of
health care provider knowledge. Transgender Health. 2020;5:104–15.
16. Miller Y. Transgender donors everything you wanted to know but
were afraid to ask! [Internet]. Boston (MA): AABB; 2018. [cited 2021
Jun 11]. Available from: www.aabb.org/development/elearning/
Pages/301.aspx
17. Goldman M, Butler-Foster T, Lapierre D, O’Brien S, Devor A. Trans
people and blood donation. Transfusion. 2020;60:1084–92.
18. Pandey S. Gender identification challenges and blood donation: edu-
cation, regulation, and experience [Internet]. San Antonio (TX) AABB;
2019. [cited 11 Jun 2021]. Available from: https://education.aabb.
org/aabb/sessions/2747/view
PANDEY ET AL.
19. FDA Guidance Document. Revised recommendations for reducing
the risk of human immunodeficiency virus transmission by blood and
Blood products. 2015 [cited 11 Jun 2021]. Available from: https://
www.fda.gov/regulatory-information/search-fda-guidance-documents/
revised-recommendations-reducing-risk-human-immunodeficiency-
virus-transmission-blood-and-blood
20. Blood Donor History Questionnaires. AABB. [cited 11 Jun 2021].
Available from: https://www.aabb.org/news-resources/resources/
donor-history-questionnaires/blood-donor-history-questionnaires
21. Becasen JS, Denard CL, Mullins MM, Higa DH, Sipe TA. Estimating
the prevalence of HIV and sexual behaviors among US transgender
population: a systematic review and meta-analysis, 2006-2017.
Am J Public Health. 2019;29:e1-8.
22. Habarta N, Wang G, Mulatu MS, Larish N. HIV testing by transgender
status at CDC-funded cites in the United States, Puerto Rico, and US
Virgin Islands, 2009-2011. Am J Public Health. 2015;105:1917–25.
23. Karp JK, Hall N. I am Cait, and I am a transgender blood donor.
Transfusion. 2017;57:705–8.
24. Woo JS, Pach D, Perez-Alvarez I, Tran MH. Transcending gender:
recognizing the impact of gender identity on blood collection.
Transfusion. 2019;59:2481–2.
25. Blanco S, Carrizo LH, Moyano RW, Mangeaud A, Gallego SV. Gender-
neutral donor deferral policies: experience in Argentina implementing
individual risk-assessment policies. Vox Sang. 2020;115:548–54.
26. UK to Introduce Individualized Risk Assessment in June. AABB. 2021
[cited 14 Jun 2021]. Available from: https://www.aabb.org/news-
resources/news/article/2021/05/11/uk-to-introduce-individualized-
risk-assessment-in-june
Guest Editors
Suchitra Pandey
Stanford University, Palo Alto, CA, USA
Email: spandey1@stanford.edu
Jed B. Gorlin
Innovative Blood Resources (a division of New York Blood Centre
Enterprises), St Paul, MN, USA
Email: jed@mbc.org
Mary Townsend
Vitalant Inc., Vitalant, Scottsdale, AZ, USA
Email: mtownsend@vitalant.org
Nancy Van Buren
Innovative Blood Resources (a division of New York Blood Centre
Enterprises), St. Paul, MN, USA
Email: Nancy.VanBuren@innovativeblood.org
International Forum Editor
Nancy Dunbar
Dartmouth-Hitchcock Medical Centre, Lebanon, NH, USA
Email: nancy.m.dunbar@hitchcock.org
How to cite this article: Pandey S, Gorlin JB, Townsend M,
Van Buren N, Leung JNS, Lee C-k, et al. International Forum
on Gender Identification and Blood Collection: Summary. Vox
Sang. 2022;117:447–56.
Received: 20 July 2021 Accepted: 21 July 2021

DOI: 10.1111/vox.13193

INTERNATIONAL FORUM

International Forum on Gender Identification and Blood

Collection: Responses

Suchitra Pandey | Jed B. Gorlin | Mary Townsend | Nancy Van Buren |

Jennifer N. S. Leung | Cheuk-kwong Lee | Katja van den Hurk |
Natalia Casamitjana | Roser Valles | Eva Alonso | Yvette Marie Miller |
Pascale Richard | Geneviève Woimant | Pierre Tiberghien | Eugene Zhiburt |
Terrie Butler-Foster | Mindy Goldman | Lise Sofie H. Nissen-Meyer |
Aurora Espinosa | Hany Kamel | Marj Bravo | Luiz Amorim Filho |
Margarida Pecego | Marc Germain | Isabelle Rabusseau | Eilat Shinar |
Hana Raz | Nabajyoti Choudhury | Nidhi Bhatnagar | Kelsi Hurt |
Melissa Lopez | Rita A. Reik | Yongmei Nie | Yang Hung | Lethola Pheello |
Nancy Dunbar

HONG KONG Question 3

Jennifer N. S. Leung & Cheuk-kwong Lee The frontline staff determines the sex/gender of a potential donor by
referring to the gender on government-issued identification.

Question 1
Question 4
Type of institution:
Regional blood services/blood centre (responsible for recruiting Yes, please refer to Q3.
donors, screening and selecting blood donors, blood collection, testing
and processing blood units, transporting, receiving and storage of
blood units, pre-transfusion testing and issuing blood for clinical trans- Question 5
fusion at a regional level).
Institution demographics: No.
Around 215,000 whole blood collection and 10,000 apheresis
collections for platelets and plasma per year.
Question 6

Question 2 No. The computer system at our centre is Symphony from Haemonetics.

Yes, gender reassignment treatment (surgery or hormones) is required

before applying the change of gender on government-issued identifi- Question 7
cation. It is not possible to change one’s gender to non-binary (neither
male nor female) on government-issued identification. Yes.

Vox Sanguinis. 2022;117:E21–E43. wileyonlinelibrary.com/journal/vox © 2021 International Society of Blood Transfusion E21
E22 PANDEY ET AL.

Questions for 1. Are you pregnant? T H E NE T H E R L A N D S

female donors 2. Have you given birth/had an abortion in the
last 12 months?
3. Are you still breastfeeding?
4. Have you ever received treatment for infertility?
5. Have you ever had sexual contact with a
bisexual man (one who has had oral or anal
sex with another man) in the past 12 months?
Question for male 6. Have you ever had oral or anal sex with a
donors man in the past 12 months?
The frontline staff should assess the transgender donors for all
questions.
Katja van den Hurk
Question 1
Type of institution:
National blood establishment (responsible for any aspect of the
collection, testing, processing, storage, release and/or distribution of
human blood or blood components).
Institution demographics:
In 2018, 412,682 whole blood donations and 311,320 plasma-
pheresis donations [1]. Platelet concentrates are mainly produced by
pooling platelets from whole blood donations.

Question 8
Question 2
Our blood centre does not assess pregnancy history for transfusion-
related acute lung injury (TRALI) risk but would apply the TRALI alert Yes, this is possible: ‘In December 2013, the Dutch Parliament over-
to all blood collections from female donors and donors being whelmingly approved a bill allowing transgender people to legally
transgender. change their gender on birth certificates and other official documents
without undergoing sterilization and sex reassignment surgery. The
law took effect in 2014’ [2].
Question 9 An expert statement is required, and the person should be aged
16 years or older.
Officially this is not possible, but there are very few examples of
Gender Hb criteria (g/dl)
individuals who had their sex changed to ‘X’ (cannot be determined)
Female 11.5–16.5
in court.
Male 13.0–18.0

Question 3
The frontline staff would apply appropriate criteria according to
the gender on government-issued identification. Based on ID information.

Question 10 Question 4

For apheresis procedures, the blood centre determines the blood Yes, this is possible based on their changed ID.
volume according to the donor’s body weight instead of the gender.

Jennifer N. S. Leung Question 5

Hong Kong Red Cross Blood Transfusion Service, Hong Kong
SAR, China No.
Email: lnsz01@ha.org.hk Yes, this has happened once.

Cheuk-kwong Lee
Hong Kong Red Cross Blood Transfusion Service, Hong Kong Question 6
SAR, China
Email: ckleea@ha.org.hk No, eProgesa (MAK Systems, Paris, France) is used.
INTERNATIONAL FORUM ON GENDER IDENTIFICATION AND BLOOD COLLECTION: RESPONSES
Question 7
Yes, the following questions are gender-specific:
Women: Have you ever been pregnant? (Y/N) Are you currently
pregnant? (Y/N).
Men: ‘In the last 4 months, have you had sex with a man?’
Women: In the last 4 months, have you had sexual contact with a
man who has had sex with another man? (Y/N).
The registered gender (as stated in ID) determines the applied
policy.
Not applicable, non-binary cannot be registered in our system. If
a non-binary donor presents, gender on their ID is used to determine
what high-risk gender-specific question to ask.
Question 8
In these cases, ‘potentially anti-human leukocyte antigen (HLA) posi-
tive’ is registered in the system, which prevents the donor from being
selected to donate plasma for transfusion.
There is a code that designates ‘potentially anti-HLA positive’ for
female donors. For transgender donors, when changing from female
to male, a test code records the result ‘potentially anti-HLA positive’.
This code prevents this donor from being selected for conversion to
Q or W donation type. Because of the risk of the presence of HLA
antibodies, (former) women are not allowed to donate Q or W plasma
as a measure to prevent TRALI.
Question 9
Men with Hb levels below 8.4 mmol/L and women with Hb levels below
7.8 mmol/L are deemed ineligible to donate. Men can donate every
56 days (5 times a year) and women every 122 days (3 times a year).
The registered gender (as stated in ID) determines the applied
policy. This is considered safe because trans women can donate with
lower Hb levels, but less frequently and trans men can donate more
often, but this requires higher Hb levels. In addition, ferritin levels are
monitored in all whole blood donors [3].
Not applicable, non-binary cannot be registered in our system.
Question 10
The registered gender (as stated in ID) determines the applied policy,
non-binary cannot be registered in our system.
Question 11
The following ‘frequently asked question’ is posted on Sanquin’s website:
Can I register as a donor as a transgender person after my gender
change?
E23
Yes, that is possible. During your examination, the donor physi-
cian will discuss with you how to become a donor. You can, of
course, also discuss any questions about this by telephone in
advance.
For the implementation of its policy, Sanquin uses the gender stated
in your passport/ID. This also determines whether you fill in the questions
for men or women during your donor screening. It makes no difference
whether or not you underwent surgery as a result of the gender
change [4].
RE FE RE NCE S
1. Sanquin Year Report 2018, Cited 2021 Feb 18. Available from
https://www.sanquin.nl/over-sanquin/facts-en-figures
2. Wikipedia ‘LGBT rights in the Netherlands’, Cited 2021 Feb 18.
Available from https://en.wikipedia.org/wiki/LGBT_rights_in_the_
Netherlands#
3. Sweegers MG, Zalpuri S, Quee FA, Huis In’t Veld EMJ, Prinsze FJ,
Hoogendijk EO, et al. Ferritin measurement IN donors-
effectiveness of iron monitoring to diminish iron deficiency and
low haemoglobin in whole blood donors (FIND’EM): study proto-
col for a stepped wedge cluster randomised trial. Trials. 2020;
21:823.
4. Sanquin online donor information, Cited 2021 Feb 18. Available from
https://www.sanquin.nl/veelgestelde-vragen/antwoord/medisch/
geslachtsverandering/
Katja van den Hurk
Sanquin, Amsterdam, The Netherlands
Email: k.vandenhurk@sanquin.nl
SPAIN
Natalia Casamitjana, Roser Valles & Eva Alonso
Question 1
Type of institution:
Banc de Sang i Teixits is the regional blood services/blood centre
of Catalunya (Spain). Catalunya has 7.5 million inhabitants. In 2020,
we collected 240,000 whole blood, 1,300 apheresis platelets and
19,000 plasma.
Question 2
In Spain, it is allowed to change the gender on government-issued
identification. In order to do it, a medical report is needed to prove
that gender dysphoria has been diagnosed and that the person has
been medically treated for at least 2 years. Surgery is not
mandatory.
At this moment, it is not possible to change gender to non-binary
on government-issued identification. However, a draft of a new law
to regulate these issues is being discussed in Spain.
E24
Question 3
In our blood centre, we determine the gender of a potential donor
with the national identity card.
Question 4
In our blood centre, we allow donors to change their gender. The
donor has to provide her/his national identity card to demonstrate
that they have changed their gender legally.
Question 5
In our blood centre, a donor cannot identify as non-binary since the
law does not contemplate this option. However, we have received
some suggestions from donors asking for this option.
Question 6
Our computer system is not currently able to accommodate gender(s)
other than male or female. We are using eProgesa.
Question 7
We do not ask different donor history questions for high-risk behav-
iour based on gender.
Question 8
We assess pregnancy history for TRALI risk with a specific question
about pregnancy for women in the donor questionnaire. Furthermore,
our blood bank has the policy of only using plasma from men not
transfused for transfusion purposes.
If a donor states that he is transgender, then his plasma will not
be used for transfusion.
Donors cannot identify as non-binary in our country. Although
they identify as non-binary, if they have an identity document that
identifies them as women, they are asked about pregnancy and their
plasma is not used for transfusion purposes.
Question 9
We have different haemoglobin criteria for male and female blood donors:
For females, haemoglobin must be ≥12.5 g/dl, and for males, ≥13.5 g/dl.
For a transgender donor, we take into consideration the gender
that appears in the national identity card.
For a donor who identifies as non-binary, we would do
the same.
PANDEY ET AL.
Question 10
For apheresis procedures, we determine blood volume according to
gender, weight and height.
If a donor identifies as transgender, we are not taking this issue into
consideration and determine volume according to the gender that
appears in the national identity card. We do not have a special policy yet.
Donors cannot identify as non-binary in our country. We deter-
mine blood volume according to the gender that appears in the
national identity document, weight and height.
Natalia Casamitjana
Banc de Sang i Teixits de Catalunya, Barcelona, Spain
Email: ncasamitjana@bst.cat
Roser Valles
Banc de Sang i Teixits de Catalunya, Barcelona, Spain
Email: rvalles@bst.cat
Eva Alonso
Banc de Sang i Teixits de Catalunya, Barcelona, Spain
Email: ealonso@bst.cat
U N I T E D S T A T E S—I N N O V A T I V E BL O O D
RE SO UR CE S
Jed Gorlin & Nancy Van Buren
Question 1
Type of institution:
Regional blood services/blood centre (responsible for recruiting
donors, screening and selecting blood donors, blood collection, testing
and processing blood units, transporting, receiving and storage of
blood units, pre-transfusion testing and issuing blood for clinical trans-
fusion at a regional level).
Institution demographics:
RBC: 160,000; apheresis platelet products: 26,000.
Question 2
Yes, but varies state by state. Minnesota allows legal change of gen-
der, including non-binary options. It is my understanding that the peti-
tioner simply states their preference.
Question 3
Since spring of 2019, our blood centre has offered four options for gen-
der choice: male, female, trans or other. This was done after meeting with
INTERNATIONAL FORUM ON GENDER IDENTIFICATION AND BLOOD COLLECTION: RESPONSES
stakeholder groups. Some trans individuals will choose the gender of their
new assignment and others will choose trans. Non-binary individuals
appreciated the fourth option. In truth, whether you choose trans or
other, it currently leads to the same outcome, specifically asking the
United States Food and Drug Administration (FDA) required questions
for both genders and applying the highest minimum standard, such as
higher male haemoglobin eligibility but smaller total blood volume calcula-
tion. When a non-binary questionnaire is approved, we can adjust accord-
ingly, but until then we are forced by FDA to ask questions that may not
conform to the donor’s self-identified gender.
Question 4
Yes, if a donor changes a gender, we will ask all questions. A signifi-
cant number of gender changes historically were simply inaccurate
coding of donors, especially prior to donor self-completed computer-
ized forms, so this is also clarified.
Question 5
Yes, a non-binary donor can select the ‘other’ category on the gender
question of our donor history questionnaire (DHQ).
Question 6
Yes, the advent of our change in spring of 2019 was the implementa-
tion of El Dorado Donor, the replacement for Safetrace, as the previ-
ous system only allowed the use of male/female gender choice.
Question 7
Yes, so this makes no sense, but our interpretation of FDA require-
ments without submitting our own DHQ is to ask both sets of ques-
tions, even if they do not really make sense for an individual who
identifies as non-binary.
Male donors: In the past 3 months, have you had sexual contact
with another male?
Female donors: In the past 3 months, have you had sexual contact
with a male who had sexual contact with another male in the past
3 months?
Female donors: Have you ever been pregnant or are you
pregnant now?
How do you manage gender-based questions if a donor identifies
as non-binary? (see above—all male and female questions asked).
Question 8
Both sets of questions are asked of donors identifying as ‘trans’ or ‘other’
assessing the pregnancy history of all donors in these categories.
E25
We treat trans and other plasma as female, so transfusable
plasma and platelets are collected only if never pregnant or negative
for HLA antibodies.
Question 9
Per FDA, male minimum haemoglobin is 13 g/dl and female is
12.5 g/dl. We require those answering ‘trans’ or ‘other’ to have mini-
mum haemoglobin of 13 g/dl.
Question 10
For both, we would use the female algorithm, which gives a smaller
total blood volume as it is not possible to individually assess whether
the donor is using hormones, how long they have been treated and
where they are on the likely transition toward newly identified
gender-associated blood volume.
Question 11
We applaud the efforts of AABB’s (formerly American Association of
Blood Banks) uniform donor history committee in working with the
FDA to establish a non-gender-specific donor history questionnaire as
while our offering multiple options have been well received by such
self-identifying donors (almost 200 in the first year!), the questions
that do not align with their self-identified gender choice continue to
cause consternation for these donors.
Jed Gorlin
Innovative Blood Resources, St. Paul, MN, USA
Email: jed@mbc.org
Nancy Van Buren
Innovative Blood Resources, St. Paul, MN, USA
Email: Nancy.VanBuren@innovativeblood.org
U N I T E D S T A T E S—A M E R I C A N R E D CR O S S
Yvette Marie Miller
Question 1
Type of institution:
National blood services/blood centre (responsible for recruiting
donors, screening and selecting blood donors, blood collection, testing
and processing blood units, transporting, receiving and storage of
blood units, pre-transfusion testing and issuing blood for clinical trans-
fusion at a national level).
Institution demographics:
E26
An approximate number of whole blood and apheresis collections
made/year for red blood cells (RBCs), platelets and plasma (as applica-
ble). I used FY19 data, as it was the last normal collection year: RBC
5,282,313; platelets 994,649 and plasma 32,648.
Question 2
Yes.
The requirements vary widely by state. Some states do not
require any verification and some states require certification, proof of
surgery or court order.
Yes, some states have a non-binary option for government-issued
identification.
Question 3
The gender is self-reported by the donor.
Question 4
Yes, gender is self-reported by the donor.
The collection staff asks the donor to state their gender and they
document the gender as provided by the donor. The donor does not
have to provide proof of gender change.
Question 5
No. All donors must provide a gender, female or male, to be eligible to
donate.
To your knowledge, has an individual who identifies as non-binary
ever presented to your blood centre to donate blood? This is
unknown.
Question 6
No, the blood establishment computer systems (BECS) cannot accom-
modate gender identification other than female or male.
Question 7
Yes. We ask the gender-specific questions currently on the AABB
DHQ. Question for males: In the past 3 months, have you had sexual
contact with another male. Question for females: In the past 3 months,
have you had sexual contact with a male who had sexual contact with
another male in the past 3 months.
The high-risk gender-specific question asked would be based on
the gender the donor self-reports, and for an nonbinary donor, it
would be based on whatever gender (M or F) the donor chooses.
PANDEY ET AL.
Question 8
TRALI risk is assessed based on the donor’s self-reported gender.
We still manage the donor based on the self-reported gender.
All donors must provide a gender choice.
Question 9
We use the standard FDA haemoglobin criteria for females (12.5 g/dl)
and male donors (13 g/dl).
If different criteria are used for males and females, which
criteria would you use if you are made aware of a donor being trans-
gender? Haemoglobin criteria used are based on self-reported
gender.
What haemoglobin/haematocrit criteria would you use for a
donor who identifies as non-binary? All donors must provide a gender
choice in order to donate.
Question 10
We use the self-reported gender.
All donors must provide a gender choice.
Yvette Marie Miller
American Red Cross, Charlotte, NC, USA
Email: yvette.miller@redcross.org
FR A N C E
Pascale Richard, Geneviève Woimant & Pierre Tiberghien
Question 1
Type of institution:
National blood establishment (responsible for any aspect of the
collection, testing, processing, storage, release and/or distribution of
human blood or blood components).
Institution demographics:
From 2020 records, whole blood collections: 2,421,932; platelet
apheresis: 96,217 (mostly platelet/plasmapheresis) and plasmaphere-
sis: 301.283.
Question 2
Yes.
In France, it is possible to change one’s gender on all civil status
certificates and government-issued identification documents. Since
2016, a transition treatment (surgery or hormones) is not mandatory.
To change the gender on government-issued identification, one needs
INTERNATIONAL FORUM ON GENDER IDENTIFICATION AND BLOOD COLLECTION: RESPONSES
to introduce a demand to a judge and to produce testimonies (from
family, friends and colleagues), or medical certificates to confirm that
current social gender corresponds to the gender you advocate for.
Is it possible to change one’s gender to non-binary (neither male
nor female) on government-issued identification?
The civil registration authorities only recognize the male or female
genders.
Question 3
Upon registration, donors are required to present a government-
issued identification document. All identification items in the blood
donor registration have to be identical to the official ones.
Question 4
Refer to the answer to Q3: yes, the identification at the blood centre has
to match with the one on the government-issued identification document.
Question 5
To your knowledge, has an individual who identifies as non-binary
ever presented to your blood centre to donate blood?
Not to our knowledge, however, as such an occurrence would
not be registered specifically, we may not be aware.
A donor who would identify as non-binary upon arrival at the
blood centre would have to be registered as male or female, based on
the gender indicated on the government-issued identification
document.
Question 6
No, refer to the answer to Q5.
Question 7
Yes, our health check questionnaire has questions based on gender
that differ between men and women:
*For men: Have you had sexual intercourse with another man in
the last 4 months?
If they answered yes to the previous question:
For whole blood donation and apheresis: 4 months deferral after
the last sexual intercourse considered.
In the case of plasma donation by apheresis to prepare quarantine
safe plasma or plasma for fractionation: 4 months deferral if multi-
partnership.
*For women: Have you had, to your knowledge, sexual inter-
course with a man who, to your knowledge, has had sexual inter-
course with another man in the last 4 months?
If they answered yes to the previous question:
Four months deferral after the last sexual intercourse considered.
E27
If Yes:
If gender-based questions are asked, how do you manage these
questions if you are made aware of a donor being transgender?
Questions are managed in reference to the gender reported on the
government-issued identification document on the day of donation.
How do you manage gender-based questions if a donor identifies
as non-binary?
A donor who would identify as non-binary would be managed
according to the gender indicated on the donor government-issued
identification document.
Question 8
Women with a full-term pregnancy history are allowed to donate
plasma for therapeutic use or apheresis platelets only after being tested
negative for anti-HLA (class I and II) Ab. The whole blood–derived
pooled (n = 5) platelet concentrates have to contain not more than
buffy coats from women with prior pregnancy not tested for anti-HLA
Ab (all whole blood donations from donors with anti-HLA Ab do not
contribute to whole blood–derived pooled platelet concentrates).
We do not manage the risk if we are not aware of a donor being
transgender; the question relative to pregnancy is asked to women
only. As mentioned previously, donors who identify as non-binary are
screened based on the gender indicated on the government-issued
identification document.
Question 9
For whole blood donation, male donors are allowed to donate if their
haemoglobin is ≥130 g/L; the threshold is 120 g/L for female donors.
The selection criteria for transgender will be the one that corresponds
to their gender on the day of donation.
As per gender indicated on the government-issued identification
document (refer to answers to Q5 and Q6).
Question 10
The blood volume is determined differently depending on the aphere-
sis separator (e.g., Nadler Allen for Fresenius). For whole blood dona-
tion, the Gilcher rule is used, with no gender difference for donors
measuring more than 145 cm and weighing more than 57 kg, or for a
height less <144 cm and a weight >50 kg. Between these ranges, the
calculated volume differs according to gender. As mentioned previ-
ously, blood volume determination is made based on the gender indi-
cated on the donor government-issued identity document.
Question 11
In France, the maximum annual number of donations is different for
men and women. The criteria that will apply to transgender will
E28 PANDEY ET AL.

depend on their gender indicated on their government-issued identifi- Question 3

cation document at the time of donation.
According to the corresponding column in the passport.
Pascale Richard
Etablissement Français du Sang, La Plaine St-Denis, France
Email: pascale.richard@efs.sante.fr Question 4

Geneviève Woimant Yes.

Etablissement Français du Sang, La Plaine St-Denis, France Gender can be changed only if the donor provides changed gen-
Email: genevieve.woimant@efs.sante.fr der on government identification (passport).

Pierre Tiberghien
Etablissement Français du Sang, La Plaine St-Denis, France Question 5
Email: pierre.tiberghien@efs.sante.fr
To my knowledge, in Russia, we do not have an individual who iden-
tifies as non-binary ever presented to any blood centre to donate
RUSSIA blood.

Eugene Zhiburt
Question 6

Question 1 No.

Type of institution:
Other: Hospital blood services with post-graduate institution Question 7
(a hospital unit performing the functions of blood transfusions and
teaching of transfusion people). No.
Institution demographics: We have one additional question for women: are you currently
650 beds; 40,000 inpatients per year; 17,000 surgeries; 5000 hip pregnant, have you been pregnant in the last year and are you cur-
and knee replacements; 250 stem cell transplantations; 2000 alloge- rently breastfeeding your baby?
neic RBCs transfusions; 700 platelets and 300 plasma.

Question 8
Question 2
We ask women about pregnancy only to determine the need for a
Yes. temporary deferral (not for TRALI risk).
A medical certificate of gender reassignment (Form N 087/u, est. by
MoH Order N850n-2017) is required to amend the civil status record.
The certificate is issued by medical organizations that carry out
medical activities on the basis of a licence that provides for the per- Question 9
formance of work (services) in psychiatry.
To establish sexual reorientation in the medical organization, a Different haemoglobin criteria are used for males (≥130 g/L) and
permanent medical commission is formed, which includes a psychia- females (≥120 g/L). For all donors, we use criteria according to their
trist, a sexologist and a medical psychologist. current passports.
A referral to establish sexual reorientation is issued by a psychia- We do not have non-binary persons.
trist based on the results of medical supervision of a citizen in the
event of a diagnosis of transsexualism (International Classification of
Diseases, Tenth Revision (ICD-10)). Question 10
The certificate is valid for 1 year from the date of its issue.
It is impossible to change one’s gender to non-binary (neither For all donors, we use criteria according to their current
male nor female) on government-issued identification. passports.
INTERNATIONAL FORUM ON GENDER IDENTIFICATION AND BLOOD COLLECTION: RESPONSES
Question 11
Very, very rare cases in our practice.
Eugene Zhiburt
Pirogov National Medical Surgical Centre, Moscow, Russia
Email: ezhiburt@yandex.ru
C A NA D A — C A N A D I A N B L O O D S E R V I C E S
Terrie Butler-Foster & Mindy Goldman
Question 1
Type of institution:
Canadian Blood Services is a national blood establishment responsi-
ble for recruitment, testing and distribution of blood products in all
Canadian provinces except for Quebec (covered by Hema-Quebec).
Institution demographics:
We collect approximately 804,000 donations annually (735,000
whole blood donations, 33,000 plateletpheresis donations and 37,000
plasmapheresis donations).
Question 2
Gender can be changed on all federal and provincial government-
issued identification in Canada, and there is no requirement for
gender-affirming medical interventions [1]. Many trans and non-
binary people choose not to undergo or have access barriers to
receiving gender-affirming medical interventions; their self-
identified gender is still valid and recognized in Canada on their
identification.
Federally issued identification such as passports include gender (M,
F or X) as self-reported by the applicant, and gender can be changed at
any time. Gender (M or F) can also be changed, on provincially issued
identification without gender-affirming medical interventions. Some
provinces require a note from a medical treatment provider in order to
make this change. Many provinces have non-binary (X) gender options
for their identification, and some provinces also allow individuals to
decline to have gender printed on identification documents. The process
for changing gender on provincial identification for people who were
born in other provinces varies with some requiring gender to be chan-
ged on documentation in a person’s home country or province first.
Question 3
At Canadian Blood Services, we understand sex and gender as
described in the definitions mentioned earlier. Gender is the intrinsic
experience of being male/female/both/neither or anywhere along the
E29
gender spectrum and sex is based on anatomic external characteris-
tics, usually assigned at birth based on external genitalia.
Transgender and non-binary donors are self-identified based on
responses to the donor health questionnaire (medication use in last
3 days, consulted a doctor for a health problem or had surgery or in
the last 6 months) or through self-disclosure during screening, such
as a change in name at registration. We do not have a question to
specifically ask if a donor is transgender or non-binary cur-
rently [2,3].
Question 4
The donor’s gender is changed in our BECS if they have had genital
gender-affirming surgery. Registering the donor and processing of
blood products at Canadian Blood Services are usually based on the
donors’ sex. Transgender and non-binary donors who have not had
lower genital gender-affirming surgery are registered and their dona-
tions are managed based on the sex assigned to them at birth [4].
Question 5
We have many donors who identify as non-binary; however, our
BECS and eProgesa, currently only allows male/female options to reg-
ister donors.
Question 6
Our BECS, eProgesa, currently only allows male and female options to
register donors. We are part of an international eProgesa users’ group
that is attempting to come up with strategies to move away from a
binary approach.
Question 7
Donors identified as female are asked, ‘In the last 3 months, have you
had sex with a man who, in the last 12 months, had sex with another
man?’ Donors identified as male are asked, ‘In the last 3 months, have
you had sex with a man?’
Self-identified transgender and non-binary donors are asked the
high-risk questions based on the sex assigned to the donor’s birth if
they have not undergone lower genital gender-affirming surgery, as
explained previously.
Question 8
We added a code to our BECS for all donors identified as transgender
or non-binary to guide component production and reduce TRALI risk.
Whole blood donations of people with this code are processed in the
E30
same way as a donation from a donor-designated female in our BECS.
We do not ask female whole blood donors about the history of preg-
nancy; rather, all donations from female donors are treated as having
a possible higher risk of TRALI, with plasma sent for fractionation
rather than transfusion, and not used to suspend a buffy coat
platelet pool.
Question 9
Donors designated as a female in our system can donate whole
blood once every 84 days provided their haemoglobin level is above
125 g/L. Donors designated as male in our system can donate once every
56 days provided their haemoglobin level is above 135 g/L. Haemoglobin/
haematocrit requirements and donation intervals are the same for male-
and female-designated apheresis plasma and platelet donors.
Transgender and non-binary donors designated as a female in our
system use the haemoglobin criteria for female donors, and those des-
ignated as male use the criteria for male donors, mainly for operational
simplicity.
Question 10
Transgender and non-binary donors designated as a female in our sys-
tem use the blood volume criteria for female donors and those desig-
nated as male use the blood volume criteria for male donors.
Question 11
Community engagement and cultural competency training have hel-
ped us to improve the donor experience for transgender and non-
binary donors. Correct pronoun and name use throughout the clinic is
an important step in providing a culturally safe donation experience.
Understanding the difference between sex assigned at birth and gen-
der allows our staff to understand and apply our criteria. While these
processes have helped us to welcome transgender and non-binary
donors into our clinic and assess their eligibility to donate in a consis-
tent and streamlined way, there is still room for improvement for
screening donors in a culturally competent way [4,5]. A major limita-
tion is the binary nature of our computer system.
Some transgender and non-binary donors have criticized the
focus of the criteria on anatomical sex because it overemphasizes the
importance of medical gender affirmation. LGBTQ (lesbian, gay, bisex-
ual, transgender, queer or questioning) groups have called for gender-
neutral short-term behavioural-based screening questions to address
the concerns about transgender and non-binary donor screening as
well as to allow more inclusive donation for gay, bisexual and other
men who have sex with men (MSM). Investigation into the feasibility
of this is currently underway. Assessment of risk associated with alter-
native approaches is hampered by the lack of data on human immuno-
deficiency virus (HIV) risk in various transgender communities in
PANDEY ET AL.
Canada. Any changes in criteria must be approved by our regulator,
Health Canada.
RE FE RE NCE S
1. Transgender rights in Canada. https://en.wikipedia.org/w/index.
php?title=Transgender_rights_in_Canada&amp;oldid=1007692160.
Accessed 26 Feb 2021.
2. Goldman M, Butler-Foster T, Lapierre D, O’Brien SF, Devor A. Trans
people and blood donation. Transfusion. 2020;60:1084–92.
3. Trans individuals: eligibility criteria for trans individuals [Internet]. Ottawa:
Canadian Blood Services. 2019. Available from: https://www.blood.ca/
en/blood/am-i-eligible/trans-individuals. Accessed 26 Feb 2021.
4. Butler-Foster T, Chin-Yee I, Huang M, Jackson KT. Toward under-
standing culturally sensitive care for transgender blood donors: a
scoping review of health care provider knowledge. Transgender
Health. 2020;5:104–15.
5. Grace D, Gaspar M, Lessard D, Klassen B, Brennan DJ, Adam BD,
et al. Gay and bisexual men’s views on reforming blood donation pol-
icy in Canada: a qualitative study. BMC Public Health. 2019;19:1–4.
Terrie Butler-Foster
Canadian Blood Services, London, Ontario, Canada
Email: terrie.foster@blood.ca
Mindy Goldman
Canadian Blood Services, London, Ontario, Canada
Email: mindy.goldman@blood.ca
NO RW AY
Lise Sofie H. Nissen-Meyer & Aurora Espinosa
Question 1
Type of institution:
Oslo Blood Centre is a hospital-based blood service located as part
of Oslo University Hospital. We perform blood collections from
donors in the Oslo region and provide transfusion services mostly at a
hospital level, sometimes at a regional or national level.
Institution demographics:
Oslo Blood Centre yearly performs approximately 31,000 whole
blood collections from which RBCs, platelets and plasma are pro-
duced. In addition, 1500 thrombapheresis and 300 plasmapheresis
procedures are performed.
Question 2
According to new legislation from 2016, a person can change juridical
gender based on the persons’ own subjective gender experience,
without diagnosis, treatment or sterilization.
It is not possible to change one’s gender to non-binary. The law
recognizes only male and female gender identification.
INTERNATIONAL FORUM ON GENDER IDENTIFICATION AND BLOOD COLLECTION: RESPONSES
Question 3
In the blood bank information system (BBIS), the gender of the
potential donor is decided by the personal identification number.
The potential blood donors need to have a Norwegian personal
identification number, as this is required for becoming a blood
donor. The Norwegian personal identification number informs about
the gender by a single digit (pairs for women and odds for men). If
the ‘apparent’ gender differs from the gender shown in the personal
identification number, the potential donor will be asked to state
their biological gender.
Question 4
At our blood centre, donors may continue to donate after gender
change. They are deferred from blood donation for 1 year following
final surgery, after which, we treat them according to their new gen-
der/biological sex. Donors, who have changed gender without under-
going surgical/hormonal treatment, will be assessed in accordance
with the medical information they supply.
Question 5
If an individual who identifies as non-binary has presented to our blood
centre to donate blood, the person must have agreed to use biological
sex for registration into the BBIS. If not, the person has been deferred.
A case agreed at this level is not likely to be further reported.
Question 6
The BBIS that we use is ProSang by CSAM Health (former Databyrån).
To our knowledge, the current version of ProSang (v. 7.1) is not able
to accommodate other choices for gender than male/female.
Our blood centre occasionally gets requests to become a blood
donor from individuals who have changed their gender or previous
donors who want to resume donations following gender change. Some
donors have changed their gender and at the same time changed their
personal identification number, while others have kept their identifica-
tion number unchanged. We have to get assistance from the CSAM
Health to change the gender of the donors. In some cases, the solution
was to manually create a duplicate of the donors’ profile, by copying
the data from the original profile to the new one, in which the gender
was different from the original profile. We do not know whether the
newer versions of ProSang will accommodate these cases.
Question 7
The Norwegian donor questionnaire contains the following gender-
related questions, different for males and females:
E31
(For women:) Have you in the last 6 months had sexual contact
(intercourse, oral/anal sex) with a man whom you know has had sex-
ual contact with another man?
(For men:) Have you ever had sexual contact with another man
(oral/anal sex)? If yes, when was the last sexual contact?
Donors are assessed according to their biological sex, and the
questions above cover well most aspects of risk behaviour and lead to
adequate deferrals with regard to donor eligibility.
If a donor identifies as non-binary, it would be necessary to
inform that our systems do not allow non-binary donors for the time
being and explain carefully why. Thus to be able to donate blood, the
donor has to answer these questions in accordance with their biologi-
cal sex and accept to be assessed accordingly.
Question 8
At our blood centre, all new donors are screened for alloanti-
bodies, and all apheresis donors are investigated with regard to
HLA antibodies, regardless of gender. Women are in addition
investigated for human neutrophil antigen (HNA) antibodies,
therefore, we would need to ask the question of whether a man
who previously was a woman, has ever given birth.
Question 9
According to Norwegian blood donor legislation, haemoglobin criteria
are lower for female donors compared to males (12.5 and 13.5 g/dl,
respectively).
Transgender donors are considered in accordance with their
biological sex.
For a donor who identifies as non-binary, it seems reasonable to
use the criteria corresponding to the current biological sex of the
donor. The purpose of the haemoglobin criteria is to maintain the
donors’ physical health.
Question 10
The purpose of blood volume determination for apheresis procedures
is to perform the procedure with minimal physical risk for the donors.
As for haemoglobin criteria, it seems reasonable to use the parameters
corresponding to the current biological sex of the donor, for a donor
who identifies as non-binary.
Question 11
Blood donation is voluntary and cannot be considered an individual
human right. It is, therefore, important to inform the transgender,
potential blood donors about the medical reasons and special con-
siderations we need to make for their assessment as blood donors.
E32 PANDEY ET AL.

When they understand that our main purpose is to ensure a safe
blood supply, most people accept the current shortcomings of the
system. However, there are many unsolved questions, and new poli-
cies for the assessment of potential blood donors with additional
gender statements are needed in Norway.
Lise Sofie H. Nissen-Meyer
Oslo University Hospital, Oslo, Norway
Email: lise.sofie.haug.nissen-meyer@ous-hf.no
Aurora Espinosa
Oslo University Hospital, Oslo, Norway
Email: aurora.espinosa@ous-hf.no
▪ Sex
▪ Enter a donor's sex
▪ Sex from ID is acceptable
▪ Ask donor to state their sex when Sex is not present on ID.
▪ Do not enter donor’s sex based on appearances or name, etc to and
so forth
▪ If donor is a female to male transgender donor, enter/change sex
designation to MALE.
▪ If donor is a male to female transgender donor, enter/retain/change
sex designation as MALE.
▪ If donor is non-binary or gender neutral, enter/change sex
designation to MALE.
If a donor is known to be transgender male, transgender female
or non-binary, their gender/sex is entered as (or if needed, changed
to) male in the donor’s record. Assigning the gender as male in the
computer system is the most conservative selection since it ensures
the donor is asked about MSM risk.

U N I T E D S TA T E S —V I T A L A N T Question 4

Mary Townsend, Hany Kamel & Marj Bravo No.

Question 5
Question 1
Not currently.
Type of institution: To your knowledge, has an individual who identifies as non-binary
National blood services/blood centre (responsible for recruiting ever presented to your blood centre to donate blood? Not that we
donors, screening and selecting blood donors, blood collection, testing know of, but we are a large system in many areas, so we likely have
and processing blood units, transporting, receiving and storage of encountered such individuals.
blood units, pre-transfusion testing and issuing blood for clinical trans-
fusion at a national level).
Institution demographics: Question 6
An approximate number of whole blood and apheresis collections
made/year for RBCs, platelets and plasma (as applicable); 1,066,971 in No.
2019 and 1,052,553 in 2020.

Question 7
Question 2
Yes.
This determination is made state-by-state; on the federal level, indi-
viduals are able to change the gender on their passport; see the link.
Male donors 7N. In the past 3 months, have □ Yes □ No
https://travel.state.gov/content/travel/en/passports/need- you had sexual contact with
passport/change-of-sex-marker.html another male?

Varies by state: https://transequality.org/sites/default/files/ Female donors 5Y. In the past 3 months, have you □ Yes □ No
had sexual contact with a male
images/Drivers%20License%20Grades%20May%202020.pdf who had sexual contact with
Again this is state-by-state, with eight states currently allowing another male in the past 3 months?
for a non-binary government-issued ID.

Question 3
Donor sex is obtained from the donor’s ID or by verbally asking the
donor their sex when sex is not present on their ID.
If Yes:
If gender-based questions are asked, how do you manage these
questions if you are made aware of a donor being transgender? All
transgender donors are asked the male questions for risk behaviour
as well as the question about prior pregnancies.
INTERNATIONAL FORUM ON GENDER IDENTIFICATION AND BLOOD COLLECTION: RESPONSES E33

How do you manage gender-based questions if a donor identifies Marj Bravo

as non-binary? All non-binary donors are asked the male questions Vitalant, Inc., Scottsdale, AZ, USA
and the question about prior pregnancies. Email: mbravo@vitalant.org

Question 8
BRAZIL
All donors, regardless of gender, are asked about previous pregnan-
cies, and if any pregnancy is reported, the donor is tested for anti- Luiz Amorim Filho & Margarida Pecego
bodies to HLA.
Question 1
All donors 9G. In the past 6 weeks, have you been □ Yes □ No
pregnant, or are you pregnant now? Type of institution:
OH. Have you ever been pregnant? □ Yes □ No Regional blood services/blood centre.
9U. How many pregnancies have you had? Institution demographics:
9O. Have you been pregnant since □ Yes □ No Whole blood collection/year: 80,000; Apheresis platelets/year:
your last automated donation?
800; Apheresis plasma: 600/year; Apheresis red blood cell concen-
trate/year: 800/year.

Question 2
Question 9
Yes. According to a Brazilian Supreme Court’s decision, from August
Males ≥ 13.0; Females ≥ 12.5. 2018, any citizen can change their gender on any government-issued
identification. They just need to make an administrative request. Gen-
5U. 1st
Hgb g/dl 2nd Hgb g/dl der reassignment either by surgery or by hormones is not necessary;
(acceptable Female: ≥ 12.5, Male ≥ 13.0)
(≥ 13.3 for 2RBC)
the gender can be changed without treatment.
Recheck reason, if applicable So far, it is not possible to change the gender to non-binary on
government-issued identification.

If different criteria are used for males and females, which criteria Question 3
would you use if you are made aware of a donor being transgender?
We require the more conservative ≥13.0. Self-declaration, the same procedure we use for ethnicity identification.
What haemoglobin/haematocrit criteria would you use for a
donor who identifies as non-binary? ≥13.0. Question 4

Question 10 Yes. Donors with previous attendance to Hemorio can ask us to

change their gender and/or their name if they prefer to be called by
Known transgender and non-binary donors are entered as females to their ‘social name’.
collect the most conservative volume of components. If they have new government identification, with different gender
and/or different name, they just have to show this document.
Question 11 If they do not have a new document, we ask them to fulfil and
sign a formal and very simplified request, which we keep in their
Most of our issues with transgender and non-binary donors rest in the records. It is not necessary to provide a document; a donor can
inability of our current BECS to handle genders outside traditional change their gender simply by self-reporting their new gender without
male and female. In addition, gender is entered into other devices treatment or changing the gender on identification.
such as apheresis devices; these devices also do NOT allow for gen-
ders other than male or female.
Question 5
Mary Townsend
Vitalant, Inc., Scottsdale, AZ, USA They can identify themselves as non-binary, but our software is not
Email: mtownsend@vitalant.org able to register this information. If someone asks to be identified as
non-binary, we explain why we are still not able to do so, and we ask
Hany Kamel him to choose between the binary options: male/female.
Vitalant, Inc., Scottsdale, AZ, USA To our knowledge, we did not have any individual who identified
Email: hkamel@vitalant.org as non-binary, so far.
E34
Question 6
Currently, our computer system is not able to accommodate genders
other than male/female.
Our computer system is called ‘Hemote’; it was a local develop-
ment, from 1995. Since then, the software has incorporated a lot of
new functionalities. Today, it became commercial software.
So far, we only have the binary choice, regarding gender—but
this new functionality is under development, and it should be
implemented by the end of this year 2021. We are still discussing,
which (if any) non-binary categories we will include among the
options.
Question 7
On 8 June 2020, Brazilian Supreme Court decided that blood banks
could not ask different questions for male and female prospective
donors (except for pregnancy-related questions). For example, we
used to ask male donors if they have had sex with another man in the
past 12 months—this question is now forbidden, as it is officially con-
sidered discriminatory and homophobic.
We ask the same questions about sexual behaviour, for males and
females: number of sexual partners in the last months, sex with a new
partner, sex for money and so forth.
Nothing changes in the pre-donation interview if we are aware
that a donor is transgender or if he/she identifies him/herself as non-
binary.
Question 8
There are specific questions about pregnancy history (pregnancy: yes
or no; if yes, how many). We used to ask those questions only for
female donor candidates.
Nowadays, we are asking every donor about pregnancy history,
regardless of their gender.
Question 9
Yes, we use the same criteria recommended by AABB standards:
13 g/dl for males and 12.5 g/dl for females.
When we are aware of a donor being transgender, we adopt the
male criteria: 13.0 g/dl, as a precautionary measure to protect donor
health. For non-binary donors, we use the same criteria.
Question 10
We use the usual parameters for blood volume estimates in females,
either for transgender and non-binary donors.
PANDEY ET AL.
Question 11
Two points that we are still discussing:
• deferral criteria to be applied (if any) to transgender donors who
take very high doses of testosterone. For the donors, who take
high oestrogen doses, we have already defined that it does repre-
sent a risk for transfusion recipients.
• donors on high testosterone doses who present high haemoglobin
levels and need phlebotomy. Should this blood be used for transfusion?
Can they become regular donors? We are still debating this point.
The fact that we no longer use different questions for male and
female donors and that MSM is not a reason for deferral per se brought
an unexpected problem: the public perception was that there were no
more restrictions based on exposure to risky sexual situations. Then,
some donors—MSM or not—came and they were deferred—for exam-
ple, for having several sexual partners in the past 3 months.
Those deferred donors were very unhappy, and one of them tried
to call the police, alleging discrimination. Most blood centres in Brazil
have addressed this issue through advertising campaigns, but the situ-
ation is still not well understood by public opinion.
Luiz Amorim Filho
HEMORIO, Rio de Janeiro, Brazil
Email: luizamorimfilho@gmail.com
Margarida Pecego
HEMORIO, Rio de Janeiro, Brazil
Email: margarida.pecego@hemorio.rj.gov.br
 A - Q U EB
C A N A D A —H EM  EC
Marc Germain & Isabelle Rabusseau
Question 1
Type of institution:
National blood establishment.
Institution demographics:
2019–2020, RBCs derived from whole blood: 218,000; RBCs
derived from multiple apheresis products: 2265; platelets: 40,000;
fractionated plasma: 83,000; plasma derived from multiple apheresis
products: 20,100.
Question 2
The change of gender must be done first in the Registry of Civil Sta-
tus. Following this, other identity documents can be modified
(e.g., provincial health insurance card). It is not necessary to have had
an operation or a hormone treatment. However, it is necessary to pro-
vide a sworn statement attesting comprehension of the request.
INTERNATIONAL FORUM ON GENDER IDENTIFICATION AND BLOOD COLLECTION: RESPONSES
http://legisquebec.gouv.qc.ca/fr/ShowDoc/cr/CCQ,%20r.%
204%20/
Currently, it is not possible to change one’s gender to non-binary
(neither male nor female) on government-issued identification. How-
ever, it should become possible in the near future, based on a recent
court ruling to this effect.
https://www.canlii.org/en/qc/qccs/doc/2021/2021qccs191/
2021qccs191.html?fbclid=IwAR2P_epaiG0sOvJ7T5VNbUz_
aQEDYQ-yn8Z3XU0B5KwrMS2uXNRUHGZh6LE
Question 3
A telephone meeting is conducted by the medical director or his delegate
(nurse) and an individual assessment is made to determine the sex/gender
of a potential donor. We focus primarily on MSM and TRALI risks.
The assessment is done when a donor identifies as transgender,
either when showing up in the donation clinic or when calling the cen-
tre to inquire about his or her eligibility. Donors are then informed
that someone in the medical department will soon contact them to
assess their eligibility.
Determining gender for donor records is done on a case-by-case
basis, but usually, we request a valid ID with the reassigned name and
gender. (This policy was just recently adjusted so that we can now
assign the self-reported gender in our information system; there is still
the need to have a valid ID with the right name and surname.)
Question 4
The sex change must be completed on identity documents. It is not
necessary to have had surgery or to have taken a hormone. We assess
MSM and TRALI risks.
Question 5
If an individual who identified as non-binary ever presented to the
blood centre to donate blood, the donor was refused.
Question 6
This is not possible with eProgesa currently able to accommodate
gender(s) other than male or female.
Question 7
Female: In the last 3 months, have you had sex with a man who, in the
last 12 months, had sex with a man?
Male: In the last 3 months, have you had sex with a man?
E35
The donor must be assessed by the medical director or his dele-
gate (nurse) who determines the gender to be used based on the
donor’s situation.
The donor identifies as non-binary will be prohibited from donating.
Question 8
TRALI risk: If the donor had a previous pregnancy, including abortion
or miscarriage, the TRALI risk must be retained. If the donor still has
their uterus, TRALI risk is possible: the gender will have to be ‘Female’
even if the IDs have been changed to ‘Male’.
Non-binary donor: Will be evaluated in the same way as trans-
gender donors but will not be eligible to donate if they do not accept
gender identification for blood donation purposes.
We do not ask systematically our donors about their sex at birth;
pregnancy history is only taken from donors who declare to be female.
Self-declared male TG and NB donors are questioned about pregnancy
history. For known male TG donors who still have their uterus, the gen-
der assigned in the donor information system is female and the donor
is questioned about prior pregnancies at each donation. (This policy has
been modified more recently, based on the fact that the vast majority
of male TG donors have no prior pregnancies; these donors are cur-
rently assigned female gender in the IT system. A definitive procedure
for these situations has yet to be defined, however.)
Question 9
FEMALE: minimum 12.5 g/dl (minimum reduced to 12.0 during the
COVID-19 pandemic).
MALE: minimum 13.0 g/dl.
The criterion used will be the gender on the donor’s file.
The donor who identifies as non-binary will be prohibited from
donating.
Question 10
The total blood volume used will be the gender on file for the donor.
If the donor is non-binary, he will be prohibited from donating.
Question 11
We are currently re-evaluating how we assess the eligibility of these
donors in order to make the process simpler while still ensuring safety.
Furthermore, we will monitor the United Kingdom’s implementation
of the non-gender-specific questionnaire in the summer of 2021.
Marc Germain
Héma-Québec, Québec, Canada
Email: marc.germain@hema-quebec.qc.ca
E36 PANDEY ET AL.

Isabelle Rabusseau Question 5

Héma-Québec, Québec, Canada
Email: isabelle.rabusseau@hema-quebec.qc.ca A blood donor cannot identify as non-binary at our blood centre.
To our knowledge, no donor identified themselves so far as non-
binary.
ISRAEL

Eilat Shinar & Hana Raz Question 6

No.
Question 1 The computer system we use is PROGESA by MAK. It is not pos-
sible to enter a gender other than male or female.
Type of institution:
National blood establishment (responsible for any aspect of the
collection, testing, processing, storage, release and/or distribution of Question 7
human blood or blood components).
Institution demographics: The donor health questionnaire does not include direct ques-
An approximate number of whole blood and apheresis collections tions, but rather contains mentioning of high-risk behaviour
made per year for RBCs, platelets and plasma (as applicable)-data for among MSM and in cases of paid sex. People who are involved
2020. Whole blood: 269,158 units; plateletpheresis: 480; plasmaphe- in such activities are requested to defer themselves for blood
resis (including COVID-19 convalescent plasma (CCP)): 9821. donation.
The mentioning are sexual relations between males in the past
12 months and payment (giving or receiving) for sexual relations in
Question 2 the past 12 months.
If we become aware of a male who changed his gender to female,
Yes. It is possible to change one’s gender on government-issued we refer him to the relevant mentioning to rule out sexual relations
identification. with another man in the last 12 months.
A person wishing to change their gender has to come in front of a
board that includes:
Question 8
• clinical psychologist
• psychiatrist The questionnaire includes a question about pregnancy history. As of
• endocrinologist today, it is addressed to females only.
• gynaecologist/urologist—in case of surgery

It is possible to change the gender with or without surgery or hor- Question 9

mone treatment.
No. It is not possible to change one’s gender to non-binary on The haemoglobin criteria are different for males and females: males
government-issued identification. 13–18 g% and females 12–16 g%. In case of a gender change,
we refer to the current gender and receive donors by the matching
criteria.
Question 3

We determine the gender according to the government-issued Question 10

identification.
As of today, we are not aware of any transgender apheresis
donors.
Question 4

Yes. Eilat Shinar

A person can change their gender if he/she provides a Magen David Adom Blood Services, Ramat Gan, Israel
government-issued identification that shows the new gender. Email: eilats@mda.org.il
INTERNATIONAL FORUM ON GENDER IDENTIFICATION AND BLOOD COLLECTION: RESPONSES
Hana Raz
Magen David Adom Blood Services, Ramat Gan, Israel
Email: hanar@mda.org.il
INDIA
Nabajyoti Choudhury
Question 1
Type of institution:
Hospital-based blood services.
Institution demographics:
Health City Hospital - Annual blood/apheresis collection is about
4500 units. All units are being separated into components.
B J Medical College - Annual blood/apheresis collection is about
44,000 units. All units are being separated into components.
Question 2
Yes, in India, a person can change his/her gender on a government-
issued identification document like Aadhaar Card (national/citizen
identity card), but it is allowed only once in a lifetime. This can be
done online by own self. If it needs to be changed again, the resi-
dent is required to visit the regional office of the Unique Identifica-
tion Authority of India (UIDAI) and submit health records from a
registered medical practitioner along with other necessary docu-
ments [1].
A medical record of surgery is required for change of gender on
the government identification number.
During enrolment for Aadhaar, there are only three options for
gender: (i) male, (ii) female and (iii) transgender.
Question 3
On the basis of signed self-declaration on the DHQ, which is followed by
pre-donation counselling by a trained and qualified blood donor counsellor.
Ministry of Health and Family Welfare (MoH), Government of India has
rolled out uniform DHQ across the country.
Question 4
The criteria for prospective blood donor selection and deferral in India
are provided by the Drugs and Cosmetic Act 1940 (and rules thereun-
der), MoH, Government of India. As per regulations in India, transgen-
der and non-binary persons are not allowed to donate blood/
components. Therefore, if any blood donor changes his/her gender
preceding periods of donations, this person will be deferred from
donation for life [2].
E37
Question 5
The Government of India accords basic rights to third gender (trans-
gender and/or non-binary) individual. However, the Drugs and Cos-
metics Act and amended rules prohibit blood/component donations
from this category of individuals. It is on the basis of presumptions of
prevailing high-risk behaviours among third-gender individuals. There-
fore, we would have no knowledge about non-binary individuals com-
ing forward to donate blood/components [2].
Recently, the Supreme Court of India has asked the government
to respond to a plea challenging blood donation guidelines, which ban
transgender persons, members of the gay community and sex workers
from donating blood [3].
Question 6
No.
Question 7
In India, the Ministry of Health and National Blood Transfusion
Council (NBTC) has designed and implemented a questionnaire for
screening blood donors, which is being ratified by the country’s reg-
ulations. This questionnaire is being used across the country. There
is a set of questions pertaining to high-risk behaviour, which are
applicable to both genders. The questionnaire is being enclosed
with questions pertaining to high-risk behaviour are being
highlighted [4].
If the donor identifies himself as transgender, he/she is deferred
for life by the regulations of the country.
Question 8
Pregnancy history is recorded purely as per self-declaration and
signed statement of the donor. This history is being used to segregate
plasma units to prevent TRALI. Transgender are deferred from dona-
tion as per regulations. All third-gender persons are deferred from
blood/component donations [4].
Question 9
As per Indian regulations for blood donor selection, haemoglobin
criteria is more than or equal to 12.5 g% for both male and female
donors. There is no difference in the criteria for males and females [4].
Question 10
As per Indian regulations, transgender and non-binary donors are
deferred from blood/component donation [4].
E38 PANDEY ET AL.

Question 11 Actuals-Current year: 01 January 2020 to 31 December 2020

Autologous Allogeneic Directed Therapeutic HH TT Total %

No comments as they are not allowed to donate blood/components. 2 units RBC 51,014 35 51,049 5,44%

Granulocytes 34 34 0,00%

Plasma 10,484 2 10,486 1,12%

aphersis
RE FE R ENC E S Platelet 48,361 146 48,507 5,17%
aphersis
1. Government of India, Ministry of Electronics & IT, Unique Identifica-
tion Authority of India (Enrollment & Update Division): Office Mem- Platelets and 29,437 65 29,502 3,14%
concurren
orandum [cited 2019 Apr 1]. https://www.uidai.gov.in//images/ plasma
resource/Name_Gender_DOB_Update_27042019.pdf. Accessed 14
RBC with 4,641 3 4,644 0,49%
Jul 2021. plasma
2. Drugs and Cosmetics Act, 1940, Drugs and Cosmetics Rules, 1945, RBC with 280 3 283 0.03%
Ministry of Health and Family Welfare, Department of Health and plasma

Family Welfare, Government of India. GSR. 166(E). Gazette Notifica- RBC with 839 8 847 0,09%
tion. [cited 2020 Mar 11]. https://cdsco.gov.in/opencms/opencms/ plasma
and plasma
system/modules/CDSCO.WEB/elements/download_file_division.jsp?
Single unit 2,695 2 2.698 0,29%
num_id=NTc2MQ. Accessed 14 Jul 2021.
recovery
3. Mahapatra D. The Times of India, TNN [cited 2021 Mar 5]. https://
Stem cells 13 13 0.00%
timesofindia.indiatimes.com/india/sc-asks-centre-why-transgenders-
Whole blood 362 750,423 1,215 14,697 6,329 17,674 790,700 84,23%
banned-from-blood-donation/articleshow/81344613.cms. Accessed
14 Jul 2021. Total 362 898,175 1,526 14,697 6,329 17,674 938,763 100,00%

4. Guidelines for Blood Donor Selection and Blood Donor Referrals, Page % 0,04% 95,68% 0,16% 1,57% 0,67% 1,88% 100,00%

6, Letter issued by National Blood Transfusion Council, National AIDS

Control Organization, Ministry of Health & Family Welfare, Govern-
ment of India [cited 2017 Oct 11]. http://naco.gov.in/sites/default/
files/Letter%20reg.%20%20guidelines%20for%20blood%20donor%
20selection%20%26%20referral%20-2017.pdf. Accessed 14 Jul 2021.
Question 2
Nabajyoti Choudhury
Health City Hospital, Guwahati, India • To update the gender on a Florida ID, the applicant must submit the
Email: contact@drnchoudhury.com court order for a name change and/or a signed original statement on
office letterhead from the attending physician stating that the appli-
Nidhi Bhatnagar cant is undergoing appropriate clinical treatment for gender transi-
B J Medical College, Ahmedabad, India tion. In Florida, it is not possible to change gender to non-binary [1].
Email: bhatnagarnidhi@ymail.com

Question 3
U N I T E D S TA T E S —O N E B L O O D
• OneBlood follows FDA guidelines, prior to each blood donation
Kelsi Hurt, Melissa Lopez & Rita A. Reik the donor must provide proof of identity. OneBlood accepts the
gender the donor identifies as male or female [2].

Question 1
Question 4
Type of institution:
Regional blood services/blood centre (responsible for recruiting • OneBlood’s Regulated Software Application (RSA) donor user man-
donors, screening and selecting blood donors, blood collection, testing ual states that the donor can change their gender based on how
and processing blood units, transporting, receiving and storage of they identify. The donor self-reports their identity, and we do not
blood units, pre-transfusion testing and issuing blood for clinical trans- require any documentation [3].
fusion at a regional level).
Institution demographics:
An approximate number of whole blood and apheresis collections Question 5
made/year for RBCs, platelets and plasma (as applicable)—Please see
the table for the calendar year 2020 data. • At this time, no situation such as this has been encountered.
INTERNATIONAL FORUM ON GENDER IDENTIFICATION AND BLOOD COLLECTION: RESPONSES E39

Question 6 2. U.S. Food and Drug Administration: Code of Federal Regulations

(CFR) Title 21, part 630.10. https://www.accessdata.fda.gov/
scripts/cdrh/cfdocs/cfcfr/cfrsearch.cfm?fr=630.10. Accessed 26
• No, at the time we do not have this accommodation.
Jul 2021.
3. RSA. Blood establishment computer software, user’s manual. Miramar,
FL: Arc-One Solutions; 2020.
Question 7 4. AABB. Standards for blood banks and transfusion services. 32nd ed.
Bethesda, MD: AABB; 2020.

Yes, please see questions below based on the regulations of FDA [2]:
Female donors: Have you ever been pregnant or are you pregnant now? Kelsi Hurt
Female donors: In the past 12 months, have you had sexual con- OneBlood, St Petersburg, FL, USA
tact with a male who had sexual contact with another male in the past Email: kelsi.hurt@oneblood.org
12 months?
Male donors: In the past 12 months, have you had sexual contact Melissa Lopez
with another male? OneBlood, St Petersburg, FL, USA
Male donors: From 1977 to the present, have you ever had sexual Email: melissa.lopez@oneblood.org
contact with another male, even once?
Currently, in the process of implementing FDA guidance and Rita A. Reik
revising questions to ‘In the past 3 months’ instead of ‘in the past OneBlood, St Petersburg, FL, USA
12 months’ for males and females. Email: rita.reik@oneblood.org
For transgender donors, we accept the gender self-reported by
the donor (which may differ from the donor’s gender at birth). High-
risk questions asked are based on the gender they self-report. CHINA

Yongmei Nie
Question 8

We assess this by questioning the donor about the pregnancy history.
If the donor is transgender, the donor is asked based on their assigned
gender at birth. Previous pregnancies are associated with antibodies
that can cause TRALI, therefore, non-binary donors will be questioned
based on their biological sex [2, 4].
Question 9
Question 1
Type of institution:
National blood services/blood centre (responsible for recruiting
donors, screening and selecting blood donors, blood collection, testing
and processing blood units, transporting, receiving and storage of
blood units, pre-transfusion testing and issuing blood for clinical trans-
fusion at a national level).

The Food and Drug Administration has set the minimum standards for • Institution demographics:Approximate number of whole blood and
donor safety levels of haemoglobin. Our company adheres to this apheresis collections made/year for RBCs, platelets and plasma
standard, based on the donor’s biological gender. There is minimum (as applicable). Whole blood 440,000 units (200 ml/unit), 88,000
haemoglobin of 12.5 g/dl for females and 13.0 for males [2]. units APlt (2.5*1011/unit).

Question 10 Question 2

If transgender or non-binary, this volume is calculated in the same No.

manner as assessing the pregnancy history [2, 4].
Question 3

Question 11 The sex of birth certification will be the person’s sex in life.

RE FE R ENC E S Question 4
1. Florida Statues: Section 68.07. http://www.leg.state.fl.us/statutes/
index.cfm?App_mode=Display_Statute&URL=0000-0099/0068/ No.
Sections/0068.07.html. Accessed 26 Jul 2021.
E40 PANDEY ET AL.

Question 5 SOUTH AFRICA

No. Pheello Lethola

No.

Question 6 Question 1

No. Type of institution:

If Yes: National blood service.
Which genders (other than male or female) are included in your Institution demographics:
blood centre computer system and can be selected by potential Approximate number of whole blood and apheresis collections
donors? made per year for RBCs, platelets and plasma (as applicable)—
946,904 units per annum.
Question 7
Question 2
Yes, The same questions for males and females: Do you have any
high-risk sex behaviours? Yes. The South African law states, ‘any person whose sexual
If Yes: characteristics have been altered by surgical or through medical treatment
If gender-based questions are asked, how do you manage resulting in gender reassignment may apply to the Director-General of
these questions if you are made aware of a donor being the National Department of Home Affairs…’ (Section 1 of Act 49) to
transgender? change their gender marker and or names. According to the law, gender
How do you manage gender-based questions if a donor identifies reassignment needs to involve some medical intervention; however, med-
as non-binary? ical intervention is not limited to surgery. The legislation defines gender
reassignment as ‘the process, which is undertaken for the purpose of
reassigning a person’s sex by changing physiological or other sexual char-
Question 8 acteristics, and includes any part of such a process’. Two letters are
required from medical professionals to confirm such medical intervention.
By questionnaires about pregnancy and production history to assess The South African law does not currently have a non-binary
TRALI risk. marker or self-determination.
A donor being transgender or non-binary is not accepted.

Question 3
Question 9
The sex/gender of a potential donor is based on the gender/sex as
Yes. Hb criteria for blood donors is 110 g/L for females and 120 g/L expressed by the donor on the self-exclusion questionnaire. In cases
for males. where the donor has not specified sex/gender on the self-exclusion
No criteria for transgender donors. questionnaire, the blood centre staff records the gender according to
No criteria for non-binary donors. their observation of the donor. In cases where the blood centre staff
cannot determine the donor’s gender, it is recorded as unknown.

Question 10
Question 4
A transgender or non-binary donor is not accepted.
To date, the blood centre has not received any donor requests for a
change of existing gender records. Our systems currently use the
Question 11 (optional) binary gender marker of male and female.

ID card or driver’s licence will be the only valid certification before

blood donation. Question 5

Yongmei Nie No. Our systems are not currently set up to accommodate non-binary
Guangzhou Blood Centre, Guangzhou, P.R. China gender identification. We have not had any donors presenting to
Email: nie.yongmei@yahoo.com donate and identifying as non-binary.
INTERNATIONAL FORUM ON GENDER IDENTIFICATION AND BLOOD COLLECTION: RESPONSES E41

Question 6 Question 10

If Yes: Currently, we have not had any donor who identifies as either trans-
Which genders (other than male or female) are included in your gender or non-binary.
blood centre computer system and can be selected by potential
donors?
No. Our blood centre’s computer system does not accommodate Question 11 (optional)
gender(s) other than male and female. We currently use the Meditech
computer system. Pheello Lethola
South African National Blood Service, Johannesburg, South Africa
Email: pheello.lethola@sanbs.org.za
Question 7

If Yes: AUSTRALIA
If gender-based questions are asked, how do you manage these
questions if you are made aware of a donor being transgender? Hung Yang
How do you manage gender-based questions if a donor identifies
as non-binary?
No. Our blood centre does not currently ask different donor his- Question 1
tory questions for high-risk behaviour based on gender. The questions
asked for high-risk behaviour are identical for male and female donors. Type of institution:
This is in line with the removal of deferral of men who have sex with Select what best describes your institution:
men (MSM), which was introduced at our blood centre in 2016. National blood establishment (responsible for any aspect of the
collection, testing, processing, storage, release and/or distribution of
human blood or blood components).
Question 8 Institution demographics:
Lifeblood collects around 1.5 million blood donations annually to
Our blood centre self-exclusion questionnaire has a section titled serve a national population of roughly 25 million people.
‘female donors’. Questions related to pregnancy history for TRALI risk
are included in this section.
We have not had any donors that identify as transgender or Question 2
non-binary.
• Yes:
Question 9  In Australia, a transgender person can change their gen-
der on government-issued identification. The requirements
Yes. Our blood centre has different haemoglobin and haematocrit for such changes vary between state and federal jurisdic-
criteria for male and female donors. Historically, the haemoglobin tions, some of which require gender reassignment
criteria for whole blood donation was 12.5 g/dl for male and female surgery.
donors. This has been changed for whole blood and apheresis plate-  In Australia, it has been possible since 2003 to change a per-
let donations to 13.0 g/dl for male donors and 12.0 g/dl for female son’s gender to non-binary on some government-issued identifi-
donors. We are in the process of rolling-out the change to all our cation. This is denoted by a third gender option (‘X’) for people
donation sites. In addition, the haemoglobin criteria for source who identify as neither male or female—including non-binary
plasma donation is 12.0 g/dl for female donors and 12.5 g/dl for and intersex individuals.
male donors.
We have not formally determined the criteria we would apply if Question 3
we were made aware of a donor being transgender. At the donor’s
consent, we potentially could use haemoglobin/haematocrit criteria • A donor’s current gender (i.e., gender identity) is determined by
corresponding to their biological sex. However, we have not yet asking the donor.
decided on how we could manage these cases in the future. • A donor’s sex assigned at birth is determined through their medi-
Currently, the South African legislation does not recognize non- cal history—specifically, from any history of gender transition
binary markers. However, this is an area that the blood centre needs associated with hormonal or surgical treatment for the purpose
to review further to determine the most reasonable approach. of gender affirmation.
E42
Question 4
• Yes:
 Because Lifeblood allows donors to self-report their gender, an
Australian blood donor can change their gender simply by self-
reporting their new gender without treatment or changed the
gender on identification, as long as they can satisfy Lifeblood’s
donor identification requirements.
 Because many forms of donor ID accepted by Lifeblood do not
include gender, it is possible for a donor to change their regis-
tered gender without their gender being changed on
government-issued identification.
 Lifeblood does not require a transgender donor to be on any
form of gender-affirming treatment in order to change their reg-
istered sex/gender.
Question 5
• A blood donor can identify as gender non-binary at Lifeblood,
but we are currently limited in our capacity to recognize their
non-binary gender because our blood management system
(MAK/PROGESA) only provides two donor sex/gender
options.
• As of March 2021, we are only aware of three gender non-binary
blood donors who have actually presented to Lifeblood to donate
blood:
1. The first was an existing female-registered donor who was born
intersex, assigned female sex at birth and raised as female, is on
no sex hormones and no longer identifies as either female
or male.
2. The second was a new donor who was assigned male sex at
birth and is on female sex hormones but identifies as neither
female nor male.
3. The third was a new donor who was assigned female sex at
birth and is on male sex hormones but identifies as neither
female nor male.
• In addition, we have received a number of enquiries from gender
non-binary individuals on our website.
• Lifeblood advises gender non-binary blood donors that we can use
their preferred pronouns, but our system currently requires us to
register a donor as either male or female. Therefore, our standard
workaround for gender non-binary blood donors is to register them
in accordance with their sex assigned at birth, then to modify our
donor management protocols to accommodate any sex hormone
treatment and/or sexual-activity-related risk for transfusion-
transmitted infections (TTIs).
Question 6
• No—currently Lifeblood’s National Blood Management System
(NBMS) can accept only male or female in the donor sex/gender
field.
• NBMS is based on MAK/PROGESA.
PANDEY ET AL.
Question 7
• Lifeblood’s high-risk behaviour questions are the same for male-
registered and female-registered donors with one exception. The
exception is that sexual contact with a man who has sex with men
(MSM) is captured by a different question based on the donor’s-
registered sex/gender:
 Male-registered donors are asked about male-to-male sex
within the previous 3 months:
In the last 3 months, have you had male-to-male sex (i.e., oral or
anal sex) with or without a condom?
 Female-registered donors are asked about sex, within the previ-
ous 3 months, with a man who has ever had male-to-male sex:
In the last 3 months, have you had sex (with or without a con-
dom) with a man who you think may have had oral or anal sex
with another man?
• If a donor is identified as transgender—whether trans male or trans
female—Lifeblood applies an additional supplementary question for
transgender- and gender-diverse donors, which asks about sexual con-
tact with a male, transgender- or gender-diverse partner within the pre-
vious 3 months. In addition, the donor is automatically asked the gender-
based MSM partner question applicable to their registered gender.
• If a donor identifies as gender non-binary, the donor is registered
in accordance with their sex assigned at birth and is asked the applica-
ble gender-based MSM partner question. In addition, Lifeblood applies
an additional supplementary question for transgender- and gender-
diverse donors, which asks about sexual contact with a male,
transgender- or gender-diverse partner within the previous 3 months.
Question 8
• Lifeblood does not assess pregnancy history for TRALI risk—only
for the purpose of triggering red cell antibody screening.
• Instead, Lifeblood covers TRALI risk on the basis of the donor’s-
registered sex/gender. This means that any female-registered
donor is automatically restricted from donating plasma-rich blood
components like apheresis platelets and fresh frozen plasma (FFP).
• For a trans male donor, this means that TRALI risk is not covered
automatically on the basis of the donor’s-registered sex/gender. This
is covered manually by excluding all transgender donors—that is, both
trans male and trans female donors—from TRALI risk components.
• For a gender non-binary donor, TRALI risk is covered on the basis
of the donor’s-registered sex/gender because a donor who was
assigned female sex at birth (AFAB) will be automatically excluded
from TRALI-risk components.
Question 9
• Yes—Lifeblood applies an upper limit of 165 g/L for cis female
donors and 185 g/L for cis male donors. Our lower limits for whole
blood donation are 120 and 130 g/L, respectively, and for aphere-
sis donation are 115 and 125 g/L, respectively.
INTERNATIONAL FORUM ON GENDER IDENTIFICATION AND BLOOD COLLECTION: RESPONSES
• For transgender donors, Lifeblood applies the applicable gender-
based reference range according to the donor’s gender identity and
registered donor sex/gender. Hence, trans male donors are assessed
like cis male donors and trans female donors are assessed like cis
female donors. This is on the basis of published data on the use of
sex hormones in a variety of conditions showing a trend toward
haemoglobin levels rising or falling in accordance with sex hormone
treatment. Lifeblood has over 150 known transgender donors, and
so far all have reported being on sex hormone treatment.
• For gender non-binary donors (who are registered in accordance
with their sex assigned at birth), Lifeblood assesses Hb on the basis
of sex hormone treatment. If a non-binary donor is not on sex hor-
mone treatment, their Hb will be assessed in accordance with their
registered donor sex/gender. If the donor is on sex hormone treat-
ment, their Hb will be assessed like a transgender donor—that is,
assuming the same change in Hb level as for transgender donors.
Question 10
• Lifeblood applies the female predictive formula for estimating total
blood volume for both trans male and trans female blood donors.
The basis for this protocol is that Lifeblood was unable to find ade-
quate published data on the effect of sex hormone treatment on
total blood volume, and the safest assumption was to apply the
lower estimate for all trans donors.
• For gender non-binary donors, Lifeblood applies the female predic-
tive formula irrespective of registered sex/gender or sex hormone
treatment. The rationale was to maintain the simplest possible pro-
tocol considering the very small number of non-binary donors
known to be donating in Australia.
E43
Question 11 (optional)
• Lifeblood’s additional supplementary question for transgender-
and gender-diverse donors captures sexual contact with a male,
transgender- or gender-diverse partner within the previous
3 months. Most commonly, this will affect trans female donors
after sex with a male partner—a group with known HIV risk
according to published data.
• In other cases, however, the supportive evidence is comparatively
weak—for example, with respect to gender non-binary donors.
Feedback from the community has identified a number of opportu-
nities for improvement in the future, and our policies are currently
under review based on the available evidence.
Hung Yang
Australian Red Cross Lifeblood, Sydney, New South Wales,
Australia
Email: hyang@redcrossblood.org.au
ORCID
Cheuk-kwong Lee https://orcid.org/0000-0002-3939-564X
Pierre Tiberghien https://orcid.org/0000-0002-9310-8322
Terrie Butler-Foster https://orcid.org/0000-0003-2166-6031
Mindy Goldman https://orcid.org/0000-0001-9904-9952
How to cite this article: Pandey S, Gorlin JB, Townsend M,
Van Buren N, Leung JNS, Lee C-k, et al. International Forum
on Gender Identification and Blood Collection: Responses.
Vox Sang. 2022;117:E21–43.
Received: 28 April 2021 Revised: 8 June 2021 Accepted: 17 June 2021

DOI: 10.1111/vox.13178

LETTER TO THE EDITOR

ABO blood type analysis of the donors of convalescent plasma

after COVID-19 infection in Chelyabinsk region, Russia

The distribution of ABO blood type in COVID-19 patients was
studied in a number of countries among various ethnic groups.
Increased percentage of the A and decreased percentage of the O
blood type were observed in COVID-19-infected individuals [1].
However, in some cohorts in India, Iran and Lebanon, these corre-
lations were not found [2–5]. We determined the association of
COVID-19 infection rate with ABO blood type in the sample of
Russian population, which previously was not studied. During the
period between 1 August 2020 and 1 February 2021, we analysed
193 donors of COVID-19 convalescent plasma donors (CPD) in
Chelyabinsk Region, located in the South Ural Mountains of
Russia and inhabited mostly by Russians (83.8%), Tatars (5.4%)
and Bashkirs (4.8%).
Diagnosis according to anamnesis data was confirmed by SARS-
CoV-2 RNA test through PCR from the nasopharyngeal swabs and
the disease severity in patients were analysed retrospectively.
Seventy-four people had a mild form of the disease (acute respiratory
infections, pharyngitis, bronchitis, asymptomatic forms, contact), and
119 people had moderate form (bilateral pneumonia of moderate
severity). All subjects were free of concomitant severe illnesses and
had positive SARS-Cov-2-IgG. Two thousand, one hundred and two
healthy blood donors from Chelyabinsk Region from the same ethnos
served as controls. The ABO blood group was determined by standard
serological methods using monoclonal antibodies.
Control group is represented mostly by individuals with blood type O,
35.0%, type A, 29.9%, type B, 23.6% and AB, 11.0%. Similar distribution
was found in CPD with mild symptoms. (Table 1). In contrast, the ABO
group distribution of the CPD with a history of moderate symptoms was
different. In this group, blood type A was more predominant (41.2%) than
type O (25.2%). It should be noted, that fewer individuals with
anti-A isoagglutinins (O and B blood type) were observed in the
moderate symptoms group compared to the mild symptoms. This
observation indicates that the presence of anti-A isoagglutinins
may protect from COVID-19 infection, so that people with O and
B groups can be better protected from infection and prone to less
severe development of the disease. In conclusion, we found that
group A population of the Chelyabinsk region in Russia seems to
have a higher risk of suffering from severe forms of COVID-19, like
it has been reported in other regions of the world.
CONFLIC T OF INT ER E ST
The authors declare no conflicts of interest.
FUNDING INF ORMATI ON
NIHRO1 NS112381; Chelyabinsk Region20-44-740004; RFBR
Anatoly A. Krokhin1
Mikhail N. Rusakov2
Svetlana V. Belyaeva2
Alexander Galkin3
Tatiana A. Suslova2
1
Blood Transfusion Station, Chief Physician, Chelyabinsk Oblast Ministry
of Health, Chelyabinsk, Russia
2
Department of Microbiology, Immunology and General Biology, Faculty
of Biology, Chelyabinsk State University, Chelyabinsk, Russia
3
Neonatology Division, Department of Pediatrics, Columbia University,
New York, New York, USA

TABLE 1 The frequency of ABO antigens in CPD for COVID-19

ABO CPD with moderate form CPD with mild form Control group p-valuea OR [95%CI]a
Number 119 74 2102
O 30 (25.21%) 23 (31.08%) 745 (35.44%) 0.023 0.6 [0.4–0.9]
A 49 (41.18%) 21 (28.38%) 628 (29.88%) 0.009 1.6 [1.1–2.4]
B 25 (21.01%) 22 (29.73%) 497 (23.64%)
AB 15 (12.61%) 8 (10.81%) 232 (11.04%)
anti-A 55 (46.21%) 45 (60.81%) 1242 (59.09%) 0.006 0.6 [0.4–0.9]
anti-B 79 (66.38%) 44 (59.46%) 1373 (65.32%)

Note: The chi-square (χ2) test was used to assess the differences in the size of distribution for blood type within study groups (p < 0.05).
Abbreviation: CPD, convalescent plasma donors.
a
COVID-19 CPD moderate severity versus control group.

Vox Sanguinis. 2022;117:457–458. wileyonlinelibrary.com/journal/vox © 2021 International Society of Blood Transfusion. 457
458 LETTER TO THE EDITOR

Correspondence COVID-19 working group. Vox Sang. 2021; https://doi.org/10.

Tatiana A. Suslova, Department of Microbiology, Immunology and
General Biology, Faculty of Biology, Chelyabinsk State University,
Chelyabinsk, Russia.
Email: tatiana.suslova.hla@gmail.com
ORCID
Tatiana A. Suslova https://orcid.org/0000-0002-7028-6839
RE FE R ENC E S
1. Goel R, Bloch EM, Pirenne F, Al-Riyami AZ, Crowe E, Dau L, et al.
ABO blood group and COVID-19: a review on behalf of the ISBT
1111/vox.13076
2. Levi JE, Telles PR, Scrivani H, Campana G. Lack of association
between ABO blood groups and susceptibility to SARS-CoV-2 infec-
tion. Vox Sang. 2021;116:251–2.
3. Padhi S, Suvankar S, Dash D, Panda VK, Pati A, Panigrahi J, et al.
ABO blood group system is associated with COVID-19 mortality: an
epidemiological investigation in the Indian population. Transfus Clin
Biol. 2020;27:253–8.
4. Abdollahi A, Mahmoudi-Aliabadi M, Mehrtash V, Jafarzadeh B,
Salehi M. The novel coronavirus SARS-CoV-2 vulnerability associa-
tion with ABO/Rh blood types. Iran J Pathol. 2020;15:156–60.
5. Khalil A, Feghali R, Hassoun M. The Lebanese COVID-19 cohort; a
challenge for the ABO blood group system. Front Med. 2020;7:1–7.
Received: 16 June 2021 Accepted: 13 July 2021

DOI: 10.1111/vox.13186

LETTER TO THE EDITOR

Appropriately specifying the quality of plasma for fractionation

I thank Siekmann et al. [1] for their copious references to my work in undoubtedly enhanced the safety of mainstream transfused compo-
their paper and would suggest some additional considerations. The nents [5]. Efforts to shift plasma procurement to the apheresis route
authors come from a major plasma fractionation company; this being the will allow this conundrum to be resolved and enhance the safety and
case, their focus should be on the effect of the levels of the variables quality of plasma for fractionation.
measured in the plasma on the safety and quality of the plasma deriva-
tives harvested from the plasma. It is doubtful as to whether the mea- CONFLIC T OF INT ER E ST
surements performed meticulously by the authors reflect entities that The authors declare no conflicts of interest.
affect any of these derivatives. The proteins that are most sensitive to
plasma quality as assessed by the authors include concentrates of Factor FUNDING INF ORMATI ON
VIII and IX, both of which have been mostly superseded by other, non- None.
plasma-derived, therapies. Their work indicating a level of platelet activa-
tion and contact activation in some plasma types might have a bearing Albert Farrugia
on the problems involving the incursion of activated Factor XI (FXIa) in
some immunoglobulin products and its association with thrombogenicity School of Surgery, Faculty of Medicine and Medical Sciences, The
[2]; however, studies by the relevant company indicated that changes in University of Western Australia, Crawley, Perth, Australia
the manufacturing conditions were implicated, rather than issues of
plasma quality [3]. Hence, my proposal, cited by the authors, is that such Correspondence
variables should be restricted to arrangements between the supplier of Albert Farrugia, School of Surgery, Faculty of Medicine and Medical
plasma and the manufacturer of its products, within the context of an Sciences, The University of Western Australia, 35 Stirling Highway,
overarching quality system [4]. Embedding such variables within manda- Crawley WA 6009, Perth, Australia.
tory standards, which are difficult to retract once their relevance has Email: albert.farrugia@uwa.edu.au
abated, risks having such standards posing limitations to the access of
adequately collected and processed plasma. This situation has ensued ORCID
with the rigorous requirements for the separation, freezing and storage Albert Farrugia https://orcid.org/0000-0003-0804-7463
of plasma for fractionation embedded in the European regulatory
requirements, which are geared primarily to considerations of coagula- RE FE RE NCE S
tion Factor VIII. As previously outlined, these requirements have a mini- 1. Siekmann J, Weber A, Bauer C, Turecek PL. Biochemical and cellular
markers differentiate recovered, in-line filtered plasma, and plasma
mal relevance to the purification of immunoglobulin, the main driver for
obtained by apheresis methods. Vox Sang. 2021. https://doi.org/10.
plasma procurement globally. It would be more appropriate to specify 1111/vox.13118
plasma quality to variables ensuring overall safety and quality related to 2. Funk MB, Gross N, Gross S, Hunfeld A, Lohmann A, Guenay S, et al.
the products to be harvested, and this is better achieved by agreements Thromboembolic events associated with immunoglobulin treatment.
Vox Sang. 2013;105:54–64.
between specific, individual fractionators and plasma collectors.
3. European Medicines Agency: Overall summary of the scientific evalu-
Rather than problems ensuing from different plasmapheresis
ation of Octagam and associated names. (2011). https://ec.europa.
technologies, the plasma industry faces the pivotal issue that plasma eu/health/documents/community-register/2011/20110530104748/
recovered from whole blood donations has to be specified in such a anx_104748_en.pdf. Accessed 21 Jul 2019.
way that its eventual use, whether as a raw material for fractionation 4. Farrugia A. Plasma for fractionation: safety and quality issues.
Haemophilia. 2004;10:334–40.
or an unmodified product for clinical transfusion, is not impeded.
5. Bianchi M, Vaglio S, Pupella S, Marano G, Facco G, Liumbruno GM,
Hence, the use of leucocyte depletion, as the authors point out, et al. Leucoreduction of blood components: an effective way to
has not affected the safety of plasma for fractionation but has increase blood safety? Blood Transfus. 2016;14:214–27.

Vox Sanguinis. 2022;117:459. wileyonlinelibrary.com/journal/vox © 2021 International Society of Blood Transfusion. 459
Received: 9 July 2021 Accepted: 13 July 2021
DOI: 10.1111/vox.13185
LETTER TO THE EDITOR
Reply to Farrugia: Appropriately specifying the quality
of plasma for fractionation
We are grateful to Albert Farrugia for sharing his additional
considerations with regards to our work and would like to take the
opportunity to address these [1].
He asks – aside from the well-described and efficient, but sparse,
characteristics defined so far for plasma fractionation – the fundamen-
tal question, whether other biochemical characteristics could contribute
to a better understanding of this valuable raw material for life-saving
therapies? We would like to clarify this.
There is no doubt that immunoglobulins (IgG) are one of the
main drivers for plasma procurement globally [2] as emphasized by
Farrugia. However, plasma fractionation is a complex procedure by
which a variety of therapeutic proteins are separated. This com-
prises not only albumin and the coagulation factors VIII and IX but
also a substantial number of therapeutically important and life-
saving coagulation proteins, such as fibrinogen, factor VII or
protein C, to give just a few examples. Of course, alternative non-
factor therapies have become available as substitutes for plasma-
derived coagulation factor VIII, but it is only conditionally true that
classical plasma-derived preparations are completely or mostly
superseded [3]. Currently, an increasing amount of plasma is needed
by the pharmaceutical industry to meet the global demand and
patients’ needs for all plasma-derived therapies [4]. For example, in
India, one of the most populous countries in the world, the need for
plasma has strongly increased during the last few years [5], and this
is for all fractions, not just IgG.
Farrugia explained in his letter that detailed process and
product-relevant plasma criteria for a fractionation company should
be directly defined between a fractionation company and a plasma
supplier. This is common practice in the plasma industry. For such
a complex starting material, it would never make sense to include
all possible criteria in a general specification as these strongly
depend also on the processes and the combination of different
products within those processes that come from the same starting
material. However, the collection of plasma to manufacture thera-
peutic products has substantially changed from how it has typically
been performed in the past. Besides the use of plasma recovered
from whole blood, source plasma – where plasma is separated from
blood through plasmapheresis – is now being increasingly used [6].
This is because new cost-effective plasmapheresis systems have
This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any
medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.
© 2021 Baxalta Innovations GmbH. Vox Sanguinis published by John Wiley & Sons Ltd on behalf of International Society of Blood Transfusion.
460 wileyonlinelibrary.com/journal/vox
become available, and the fractionation industry is investing more
in developing the infrastructure to meet the growing patients’
need. In addition, plasma for fractionation is prepared using mul-
ticomponent collection systems with different equipment design
compared to established plasmapheresis systems. With the advent
of the coronavirus disease 2019 pandemic, plasma supply has
become even more critical and more challenging [7]. Therefore, we
propose consideration that is given to defining universal plasma-
quality parameters, which can be used for characterization of all
these new ‘plasma flavours’ in the future [8]. These concepts are
even more necessary when plasma is fractionated according to the
‘product for plasma’ methodology or in the plasma tender
business.
Our investigation to define plasma-quality parameters was
triggered by the fact that each, even slightly different, method of
obtaining plasma might be influenced by the interactions of the
plasma proteins with soluble and cellular components of whole
blood and the potent anticoagulantly acting endothelium during
collection processes. Different methods of plasma preparation
could, therefore, be expected to result in different activation levels
of major plasma protein systems, including contact activation,
coagulation and complement system. Rather than proposing the
introduction of mandatory standards and restrictions for plasma
quality with regard to these activation levels, the data presented in
our work – which do not claim completeness – are intended to
provide a baseline evaluation in order to increase our knowledge
on this irreplaceable, unique raw material.
As plasma derivatives usually undergo multi-step, effective
purification procedures, the probable impact of differences in the
starting material obtained with plasma preparation technologies used
today is reduced to a minimum. In addition, established quality con-
trol testing contributes to maintaining standardized safety and effi-
cacy of plasma derivatives. Nevertheless, introducing new
technologies for plasma preparation might call for a more in-depth
analysis of the resulting plasma for fractionation. In this context,
the data provided by our study will be supportive and could be
used as a starting point for further efforts in this direction without
any intent to limit plasma availability, be it recovered or source
plasma.
Vox Sanguinis. 2022;117:460–461.
LETTER TO THE EDITOR 461

CONF LICT OF IN TE RE ST RE FE RE NCE S

All authors are employees of Baxalta Innovations GmbH or Baxter 1. Siekmann J, Weber A, Bauer C, Turecek PL. Biochemical and cellular
AG, respectively. markers differentiate recovered, in-line filtered plasma, and plasma
obtained by apheresis methods. Vox Sang. 2021. https://doi.org/10.
1111/vox.13118
FUND ING INFORMATION 2. Farrugia A, Bansal M, Marjanovic I. Estimation of the latent thera-
None. peutic demand for immunoglobulin therapies in autoimmune neurop-
athies in the United States. Vox Sang. 2021. https://doi.org/10.
Jürgen Siekmann1 1111/vox.13134
Alfred Weber1 3. Kevane B, O’Connell N. The current and future role of plasma-
Christoph Bauer2 derived clotting factor concentrate in the treatment of hemophilia A.
Transfus Apher Sci. 2018;57:502–6.
Peter L. Turecek1
4. Burnouf T, Faber J-C, Radosevic M, Goubran H, Seghatchian J.
Plasma fractionation in countries with limited infrastructure and
1
Baxalta Innovations GmbH, part of Takeda, Vienna, Austria low / medium income: how to move forward? Transfus Apher Sci.
2
Baxter AG, part of Takeda, Vienna, Austria 2020;59:102715.
5. Ajmani RS. Indian plasma fractionation industry: challenges and
opportunities. Ann Blood. 2018;3:30.
Correspondence
6. Burgstaler EA. Blood component collection by apheresis. J Clin
Peter L. Turecek, Baxalta Innovations GmbH, part of Takeda,
Apher. 2006;21:142–51.
DC-Tower, Donau-City-Straße 7, A-1220 Vienna, Austria. 7. Hartmann J, Klein HG. Supply and demand for plasma-derived
Email: peter.turecek@takeda.com medicinal products - a critical reassessment amid the COVID-19
pandemic. Transfusion. 2020;60:2748–52.
8. Mérrien S. Specific requirements for plasma for fractionation. IPFA:
ORCID
Proceedings of 4th Asia workshop on plasma quality and supply. (publi-
Alfred Weber https://orcid.org/0000-0002-0423-3851 shed in 2019. https://ipfa.nl/events/ipfa-4th-asia-workshop-on-plasma-
Peter L. Turecek https://orcid.org/0000-0002-6161-1556 quality-and-supply/). Accessed 24 Jun 2021.
DOI: 10.1111/vox.13140

DIARY OF EVENTS

See also http://www.isbtweb.org/congresses/

10.2.2022 The European Hematology Association (EHA) and the European Society for Blood and Marrow Transplantation (EBMT) -
4th edition of the jointly organized European CAR T-cell Meeting.
15-16.3.2022 The IPFA/EBA Symposium on Plasma Collection and Supply will take place fully physical in Amsterdam,
the Netherlands on March 15 - 16, 2022.
23.3.2022 Eye Drops from Human Origin - First EDHO Workshop on Current Standards and Future Developments organized
by the ISBT Working Party Cellular Therapies.

462 © 2021 International Society of Blood Transfusion. wileyonlinelibrary.com/journal/vox Vox Sanguinis. 2022;117:462.