Reg. No.: ……………………………..

Name ……………………………… MSCCOM17

University of Kerala
Second Semester M.Sc. Degree Examination July 2018
COMPUTATIONAL BIOLOGY
BIN-C-423 Computational Genomics
Time: 3 Hrs. Max Marks: 60
Part - A
Answer any ten questions. Each carries three marks.
1. Define the terms 'Sense ' and 'Antisense' strands.
2. Differentiate between homologous, orthologous and paralogous gene.
3. Explain the term specificity and sensitivity with respect to sequence alignment.
4. Describe any two file formats used in multiple sequence alignment.
5. Define the following terms: (a) Sequence logos (b) Sequence chromatograms.
6. Explain the concept of gap penalty.
7. What are the three heuristic layers of BLAST algorithm?
8. Differentiate reading frame and open reading frame.
9. What is progressive alignment in MSA?
10. What do you understand by codon usage bias?
11. Give examples of any three protein sequence databases along with its full form.
12. Define Chargaff’s rule.
13. While running a blast search you got two hits with bit scores and e-values as follows;
Seq1: bit score= 431, e-value= 2e-156
Seq2: bit score=431, e-value= 4e-136

Which sequence would you consider as best hit? Why?

Part - B

Answer any six questions. Each carries five marks.

14. What are biological databases? Briefly describe a few important databases. Discuss the
importance biological databases in Bioinformatics.
15. Explain Needleman-Wunch algorithm for optimal global alignment of the nucleotide
sequence using the example of aligning ACTCG and ATCCGT with match score +1,
mismatch score 0 and gap penalty -1
16. Write the forward and reverse reading frames of the sequence
5' TTATGTTCAGGTACGATAGATAGAGATGCTGA 3'
17. Explain the working of BLAST algorithm.
18. Write short notes on (1) FASTA (2) GENBANK (3) EMBL (4) NEXUS file formats with
examples.
19. Explain tandem and inverted repeats with suitable examples.

20. Write down the alignment between ABCDEFI and ABEFGHI intuitively. Then draw the
dot plot.
21. Explain any one popular gene finding tool.
22. Discuss the application of multiple sequence alignment with examples.

23. Explain Smith- Waterman algorithm for optimal local alignment of the nucleotide
sequence by aligning with an example ATCTAT and TCCTA with alignment score , 2
for match, -1 for mismatch and -2 for gap penalty
Reg. No.: ……………………………..
Name ……………………………… MSCCOM17
University of Kerala
Second Semester M.Sc. Degree Examination July 2018
COMPUTATIONAL BIOLOGY
BIN-C-422 Fundamentals of Molecular Biology
Time: 3 Hrs. Max Marks: 60
Part - A
Answer any ten questions. Each carries three marks.
1. Differentiate between blunt end and staggered cut of restriction endonucleases.
2. Differentiate between monohybrid and dihybrid experiments.
3. Define Chargaff rule.
4. Define the term test cross. How it is significant in identifying the parent in a cross.
5. Mention any two application in rDNA technology
6. Differentiate adapter and linker DNA.
7. Difference between B and Z DNA.
8. Give a brief note on cDNA library
9. Define enthalpy, entropy and energy.
10. Differentiate between ionic bond and covalent bond.
11. Define point mutation and chromosomal mutation.
12. What are SNPS?
13. Mention the difference in the construction of plasmids and phagemids.
Part – B
Answer any six questions. Each carries five marks.

14. Discuss in detail about polymerase chain reaction.

15. What are the prerequisite for doing a cloning experiment
16. Comment on different transformation methods in gene cloning.
17. Discuss the structural features of DNA.
18. Discuss about gene mutation and its types.
19. Explain the secondary structure of tRNA.
20. Briefly explain some of the major DNA repair mechanisms.
21. Discuss briefly about Griffiths experiment.
22. In a crime, after investigation police suspect three people got involved in the incident
therefore they went for molecular analysis. The result is given below. Try to figure out
the criminal with your justification

23. Explain the steps involved in the process of transcription. How the primary transcript
produced by a eukaryotic cell is different from that produced by prokaryotic cell?
Reg. No.: ……………………………..
Name ……………………………… MSCCOM17
University of Kerala
Second Semester M.Sc. Degree Examination July 2018
COMPUTATIONAL BIOLOGY
BIN-E-425(i) Perl and Bio Perl
Time: 3 Hrs. Max Marks: 60
Part - A
Answer any ten questions. Each carries three marks.
1. Define three Data types in Perl.
2. Predict the output of the following Perl script.
#! /usr/bin/perl
@x=('A','L','L','T','H','E','B','E','S','T');
print "@x\n";
print "$#x\n";
print pop(@x);
3. How will you pass parameters to a subroutine? Illustrate with a simple Perl script.
4. Predict the output of the following Perl script.
#! /usr/bin/perl
$man ="I will be home in 5 minutes\n";
$woman ="I will be ready in 5 minutes\n";
print $x="men's ".$man."and women's ".$woman."are exactly same\n";
$a=($x=~tr/me/me/);
$b=($x=~s/me/me/g);
print "$a\n";
print "$b\n";
5. Write a Perl script to find the count of start codons in a DNA string.
6. Explain the three standard file handles in Perl.
7. Predict the output
use Bio::Seq;
$seq_obj = Bio::Seq->new(-seq => "ATGCAAATTTGGCC",-display_id =>
"ART001",
-desc => "artifical sequence",-alphabet => "dna" );
print $seq_obj->seq(), "\n\n";
print $seq_obj->length(), "\n\n";
print $seq_obj->display_id(), "\n\n";
8. Predict the error in the following Perl script, correct the code to get a proper output.
#! /usr/bin/perl
@q=("I","wont","be","impressed","by","technolgy","until","I","can",
"download","food");
for(i=0;i<5;i++)
{
 $x=pop(@q);
}
print @q;
print $x;
9. What is References and what is its importance while dealing with array and List.
10. List the difference between Bio::Seq and Bio:SeqIO in Bio Perl.
11. Differentiate warn and die.
12. Write a Perl regex script to validate your native landphone number.
13. Explain the use of bless in Perl.
14. Define grep with a Perl snippet.
15. Differentiate q, qq and qw with necessary example Perl scripts.
Part - B
Answer any six questions. Each carries five marks.
16. Write a Perl script to accept DNA sequence from user and find the nucleotide
frequency of the given input.
17. Explain in detail any five Special variables in Perl with necessary examples.
18. While executing the following program, it shows an error message. List out the errors
and correct the program
use Bio::Seq;
$seqio_obj = Bio::Seq>new(-file => "sequence.fasta", -format => "fasta"
);
$seq_obj = $seqio_obj->next_seq;
print $seq_obj->seq,"\n";
19. Write a program to retrieve a sequence from database using Bioperl.
20. Briefly explain how Exceptions are handled in Perl.
21. Write a Perl program to accept five numbers from standard input ,then sort and
print them.
22. Write note on Perl Subroutines.
23. Write a Perl program using subroutines to find the factorial of a given number.
24. Write note on any three Operators in Regular Expressions.
25. Write a html form to accept Name and DOB from user and also write a
Perl CGI counterpart that accepts them and print Name and Age on screen.
26. Write a Perl program to find the GC content and GC percentage in the given DNA
string.