Article

Inadequate DNA Damage Repair Promotes Mammary

Transdifferentiation, Leading to BRCA1 Breast
Cancer
Graphical Abstract Authors
Hua Wang, Dongxi Xiang, Ben Liu, ...,
Hans Clevers, Zhe Li, David M. Livingston

Correspondence
zli4@rics.bwh.harvard.edu (Z.L.),
david_livingston@dfci.harvard.
edu (D.M.L.)

In Brief
The tumor suppressor BRCA1 and certain
of its partners prevent the aberrant
transdifferentiation of mammary
epithelial cells to a mesenchymal state by
participating in interstrand crosslink DNA
repair.

Highlights
d Two BRCA1 partners, NUMB and HES1, participate in
crosslink DNA repair

d NUMB or HES1 loss or cisplatin triggers a luminal to basal/

mesenchymal transition

d BRCA1 loss leads to growing DNA damage in the mammary

epithelium and tumorigenesis

d BRCA1 tumorigenesis encompasses dynamic luminal/basal/

mesenchymal fate transitions

Wang et al., 2019, Cell 178, 135–151

June 27, 2019 ª 2019 Elsevier Inc.
https://doi.org/10.1016/j.cell.2019.06.002
Article

Inadequate DNA Damage Repair Promotes

Mammary Transdifferentiation, Leading
to BRCA1 Breast Cancer
Hua Wang,1,2,8 Dongxi Xiang,3,8 Ben Liu,1,2 Aina He,3 Helena J. Randle,1,2 Kelvin Xi Zhang,4 Anushka Dongre,5
Norman Sachs,6 Allison P. Clark,1,2 Luwei Tao,3 Qing Chen,3 Vladimir V. Botchkarev, Jr.,1,2 Ying Xie,3 Ning Dai,7
Hans Clevers,6 Zhe Li,3,* and David M. Livingston1,2,9,*
1Department of Cancer Biology, Dana-Farber Cancer Institute, Boston, MA 02215, USA
2Departments of Genetics and Medicine, Harvard Medical School, Boston, MA 02115, USA
3Division of Genetics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115, USA
4Informatics IT, Merck & Co., Boston, MA 02115, USA
5Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA
6Hubrecht Institute, Uppsalalaan 8, 3584 CT Utrecht, the Netherlands
7Department of Medicine, Robert Wood Johnson Medical School, Rutgers, New Brunswick, NJ 08901, USA
8These authors contributed equally
9Lead Contact

*Correspondence: zli4@rics.bwh.harvard.edu (Z.L.), david_livingston@dfci.harvard.edu (D.M.L.)

https://doi.org/10.1016/j.cell.2019.06.002

SUMMARY Mammary gland (MG) development is a unidirectional, hierar-

Loss of BRCA1 p220 function often results in basal-
like breast cancer (BLBC), but the underlying disease
mechanism is largely opaque. In mammary epithelial
cells (MECs), BRCA1 interacts with multiple proteins,
including NUMB and HES1, to form complexes that
participate in interstrand crosslink (ICL) DNA repair
and MEC differentiation control. Unrepaired ICL
damage results in aberrant transdifferentiation to
a mesenchymal state of cultured, human basal-
like MECs and to a basal/mesenchymal state in pri-
mary mouse luminal MECs. Loss of BRCA1,
NUMB, or HES1 or chemically induced ICL damage
in primary murine luminal MECs results in persistent
DNA damage that triggers luminal to basal/mesen-
chymal transdifferentiation. In vivo single-cell anal-
ysis revealed a time-dependent evolution from
normal luminal MECs to luminal progenitor-like tu-
mor cells with basal/mesenchymal transdifferentia-
tion during murine BRCA1 BLBC development.
Growing DNA damage accompanied this malignant
transformation.
INTRODUCTION
chical process wherein mammary stem cells (MaSCs) differen-
tiate into progenitors that further differentiate into mature
MECs (Visvader and Stingl, 2014). Dedifferentiation of mature
cells into a more primitive state rarely occurs in normal tissues.
However, when it does, it can trigger a neoplastic process (Fried-
mann-Morvinski and Verma, 2014; Van Keymeulen et al., 2015;
Visvader, 2011). Although BRCA1 can prevent transdifferentia-
tion of cultured, human MECs, whether this translates into BC
suppression is unclear (Wang et al., 2016).
BRCA1 p220 is necessary for maintaining a normal MEC dif-
ferentiation state, a function that likely contributes to its BC
suppression activity (Liu et al., 2008; Wang et al., 2016; Xu
et al., 1999). In humans, p220 depletion in basal-like MECs led
to disorderly differentiation (Wang et al., 2016), and aberrant
luminal progenitors (LPs) were detected in germline BRCA1-
mutated mammary tissue (Lim et al., 2009; Nakshatri et al.,
2015; Park et al., 2010; Proia et al., 2011).
Defective p220 function promotes aberrant differentiation of
otherwise normal, cultured, basal-like human MECs to a more
primitive, mesenchymal state that arises, at least in part, from
inadequate repair of DNA interstrand crosslinks (ICLs) (Wang
et al., 2016). Specifically, p220, and its bound partners, BRG1
and FANCD2, and DNp63, with which it also communicates,
suppress ICL accumulation and MEC transdifferentiation. This
study explores these events both in cultured MECs and during
BRCA1 mouse mammary tumor development.

BRCA1 mutations carry a 40%–80% lifetime risk of developing

breast cancer (BC). Inadequate maintenance of mammary
epithelial cell (MEC) genome integrity is a suspected driver of
this outcome (Chen et al., 2018; Huen et al., 2010; Silver and Liv-
ingston, 2012). While p220, the primary disease-suppressing
BRCA1 product, exhibits multiple functions, like DNA damage
repair, the detailed events that lead to BRCA1 BC are largely
unknown.
RESULTS
NUMB is a BRCA1-Interacting Protein
The BRCA1 C-terminal (BRCT) region is vital for the p220 DNA
repair function. It contains two adjacent BRCT repeat motifs
that operate as DNA damage signal receptors (Gerloff et al.,
2012; Wu et al., 2015). Currently, three BRCA1-associated

Cell 178, 135–151, June 27, 2019 ª 2019 Elsevier Inc. 135
Figure 1. NUMB Is a BRCA1 Partner
(A and B) Reciprocal interaction between BRCA1 and NUMB. 293T cell extracts transiently expressing HA-BRCA1 or myc-BRCA1 (A) or Flag-NUMB (long or short
isoform, B) were IP’d with anti-epitope antibody (Ab) and then immunoblotted (IB’d) with the indicated Abs.
(C and D) Endogenous BRCA1-NUMB interaction. MCF7 extracts were respectively IP’d with BRCA1 (C) or NUMB Ab (D), and the IPs were analyzed by IB.
(E and F) Effect of cisplatin or KU55933 on BRCA1-NUMB binding. Myc-tagged BRCA1-expressing (E) or naive 293T cells were or were not (UT) exposed to MMC
(100 ng/mL overnight) or KU55933 (10 mM overnight); extracts were IP’d with myc (E) or BRCA1 Ab (F) and analyzed by IB.
(G) In vitro BRCA1-BRCT/NUMB binding.
(H) NUMB mutations compromise NUMB/BRCA1 binding. Extracts of 293T cells transiently expressing FLAG-NUMB (long and short, WT or 2A) were IP’d with
FLAG Ab and the IPs analyzed by IB.
See also Figure S1.

proteins—CtIP, BACH1/BRIP1, and Abraxas—are known to
bind to them. All contain pSXXF/pSPTF sequences, where the
serine is phosphorylated by ATM/ATR following DNA damage,
thereby sustaining their BRCT binding function (Kim et al.,
2007; Manke et al., 2003; Wang et al., 2007; Yu and Chen,
2004; Yu et al., 2003). Conceivably, these motifs participate in
signaling events that sustain MEC differentiation following effec-
tive DNA repair.
Lacking evidence that any known BRCT-binding protein par-
ticipates in MEC differentiation control, we initiated a search
for additional p220 BRCT binding proteins. Specifically, we
screened database for heretofore undetected BRCA1-binding
polypeptides that contain SPTF sequences (Manke et al.,
2003; Yu et al., 2003) and encountered a stem cell biology-asso-
ciated protein, NUMB. Interestingly, NUMB is required for MEC
differentiation maintenance (Tosoni et al., 2015).
NUMB also contains an SPTF and an SPTXXF motif (Fig-
ure S1A). Immunoprecipitation (IP) of HA- or myc-tagged
BRCA1 in 293T cells showed that it coimmunoprecipitated
(coIP’d) with at least two endogenous human NUMB isoforms
(long [L] and short [S]; Figures 1A and 1B). Moreover, endoge-
nous BRCA1 p220 and NUMB coIP’d (Figures 1C and 1D), an
event that was stimulated by cell exposure to mitomycin C
(MMC) (Figures 1E and 1F). These results implied that BRCA1
and NUMB co-participate in DNA damage control.
To test whether the BRCA1 BRCT motifs contribute to NUMB
binding, glutathione S-transferase (GST)-tagged BRCA1 frag-
ments, collectively representing the entire BRCA1 sequence,
were assayed as candidate NUMB binding targets (Chen et al.,
1998). GST-BRCT fragment F6 (aa 1314–1863) exhibited the
strongest NUMB binding. Less impressive NUMB binding was
detected with GST-F5 (aa 1005–1313) (Figure 1G). A clinically

136 Cell 178, 135–151, June 27, 2019

 (legend on next page)

Cell 178, 135–151, June 27, 2019 137

relevant BRCA1 point mutation (M1775R) introduced into the
BRCT domain of HA-tagged full-length BRCA1 abolished
BRCA1/NUMB binding as it had done for Abraxas-, CtIP-, and
BACH1-BRCA1 binding (Kim et al., 2007; Manke et al., 2003;
Wang et al., 2007; Yu and Chen, 2004; Yu et al., 2003). By
contrast, HA-BRCA1 bearing a RING domain mutation (C61G)
bound NUMB normally (Figure S1B). Therefore, one or both F6
BRCT motif(s) bind(s) NUMB.
In response to DNA damage, the SPTF sequence(s) that bind
the BRCA1 BRCT motifs are phosphorylated by a suitable PIKK
kinase. Since this modification is essential for SPTF/BRCT in-
teractions (Manke et al., 2003; Yu et al., 2003), we asked if
BRCA1-NUMB binding is NUMB phosphorylation dependent.
Specifically, we IP’d HA-tagged NUMB, exposed the IP to an
exogenous phosphatase, and NUMB binding to BRCA1
decreased significantly (Figure S1C). ATM inhibitor addition
also disrupted BRCA1-NUMB binding (Figure 1E), and mutage-
nizing NUMB serines 361 and 634 to alanines led the resulting
double mutant (NUMB 2A) to exhibit reduced BRCA1 binding
(Figure 1H). Thus, endogenous NUMB appears to interact
directly and in a phosphorylation-dependent manner with one
or both BRCA1-BRCT motifs and is, therefore, an authentic
BRCA1 partner.
Nuclear NUMB Is a BRCA1 Partner Protein
NUMB was first identified in Drosophila as a membrane protein
that regulates asymmetric versus symmetric cell division and
NOTCH signaling (Guo et al., 1996; Uemura et al., 1989). At
least four NUMB isoforms exist in mammalian cells; the
longest controls cell proliferation, and the shortest affects dif-
ferentiation (Dho et al., 1999; Verdi et al., 1999). A mammary-
specific Numb knockout led to an epithelial to mesenchymal
transition (EMT), development of stem cell-like properties,
and tumorigenesis (Tosoni et al., 2015), much like the effects
of BRCA1 depletion. Since endogenous NUMB binds
BRCA1, we asked whether NUMB function is, at least in
part, nuclear, and if so, whether it and BRCA1 co-participate
in DNA damage control.
Specifically, human MECs were fractionated into different
subcellular fractions that were then assayed for NUMB (Xia
et al., 2006) (Figure S1D). Both long and short NUMB isoforms
were detected in the cytoplasmic (S100) and soluble nuclear
(S400) fractions (Figures S1E–S1H). Furthermore, the relative
abundance of NUMB in the latter was comparable to that in
the former. These findings were consistently observed in multi-
ple cell lines (Figures S1E–S1H), in keeping with others’ results
(Dhami et al., 2013). Moreover, the long isoform was enriched
in CD44low MECs, while the short form was overexpressed in
mesenchymal (U2OS) cells (Figure S1E). When exposed to
cisplatin, the cytoplasmic/nuclear distribution of NUMB in
U2OS and MCF7 cells did not change (Figures S1G and S1H).
These data suggest that NUMB is both nuclear and cytoplasmic.
While participating in certain types of DNA repair, BRCA1 con-
centrates in multiple, small, nuclear foci in S/G2 cells (Scully
et al., 1997) or single, larger BRCA1-containing foci in G1/G0
cells (Escribano-Dı́az et al., 2013; Lukas et al., 2011). In CD44low
MECs, NUMB often colocalized with BRCA1 and 53BP1 in these
single, large G0/G1 foci (Figures 2A–2D), which are also known
as ‘‘53BP1 bodies.’’ They carry DNA damaged during a prior
S/G2 period (Lukas et al., 2011). BRCA1/NUMB colocalization
was confirmed by confocal image analysis (Figure 2B and
Video S1). By contrast, frequent colocalization of BRCA1 and
NUMB in single, large foci was rare in S/G2 cells (Figures
2A–2F). Analogous results were obtained in MCF7 cells (Figures
S2A and S2B).
53BP1 sustains non-homologous end joining (NHEJ) and sup-
presses homologous recombination (HR)-driven double-strand
DNA break (DSB) repair in both G1 and S/G2 (Bunting et al.,
2010; Escribano-Dı́az et al., 2013; Orthwein et al., 2015). To
determine whether NUMB and/or BRCA1 loss results in an accu-
mulation of G1 DNA damage, we searched for 53BP1 foci in cy-
clin A-negative cells. When NUMB or BRCA1 depleted, these G1
cells overly accumulated large 53BP1 foci (three or more foci per
cell), suggesting the development of additional G1 DNA damage
(Figures 2E–2F, S2C, and S2D).
ATM/ATR signaling is essential for the formation of BRCA1 or
53BP1 foci after DNA damage. Therefore, we asked if reduced
ATM/ATR signaling abolishes NUMB focus formation. Cell expo-
sure to the ATM inhibitor, KU55933, suppressed single 53BP1
and NUMB focus formation (Figures 2G–2I). 53BP1 depletion
also abolished BRCA1/NUMB focal colocalization (Figures 2J
and 2K). BRCA1 depletion also abolished NUMB focus forma-
tion, implying its BRCA1/53BP1 co-dependence (Figures S2E
and S2F).
These observations fit with previous reports implying that
BRCA1 loss promotes 53BP1-dependent NHEJ repair (Bunting
et al., 2010). In addition, following the prior development of
DNA damage, significantly more cells arrested in G1/G0 after
BRCA1 or NUMB depletion, consistent with G1 checkpoint acti-
vation (Figure S2D). Thus, BRCA1/NUMB complexes respond to
spontaneously arising DNA damage, at least in part, during
G1/G0.

Figure 2. NUMB-BRCA1 Colocalization

(A) Co-staining of NUMB and BRCA1 in WT CD44low MECs. Scale bar, 20 mm.
(B) Colocalization of BRCA1 and NUMB nuclear foci (arrows) in HME cells using confocal z stack microscopy. Scale bar, 20 mm. See also Video S1.
(C and D) Co-IF of NUMB/53BP1(C) or NUMB/Cyclin A (D) in WT CD44low MECs. Scale bar, 20 mm.
(E and F) Co-IF of 53BP1 and Cyclin A in CD44low MECs before and after NUMB depletion. >500 cells were analyzed in each experiment. See also Figures S2C
and S2D for statistics.
(G and H) Co-IF of NUMB and 53BP1 after mock treatment (DMSO, G) or KU55933 exposure (10 mM, 24 h, H). Scale bar, 10 mm.
(I) Effect of KU55933 on single-53BP1 body formation and NUMB/53BP1 colocalization.
(J) Co-IF of NUMB and BRCA1 in cells transfected with Siluc or Si53BP1. Scale bar, 10 mm.
(K) Effect of 53BP1 depletion on single-NUMB focus formation.
In (I) and (K), >200 cells were analyzed, and the data represent mean ± SD. Student’s t test was used to calculate statistical significance. **p < 0.01, ***p < 0.001
See also Figures S1 and S2 and Video S1.

138 Cell 178, 135–151, June 27, 2019

Figure 3. NUMB and MEC Differentiation
(A) Effects of overnight cisplatin exposure and NUMB depletion on CD44low MEC clonogenic survival.
(B) Western blot of NUMB in CD44low MECs before and after its short hairpin RNA (shRNA)-driven depletion.
(C) Cisplatin effect on clonogenic survival of MCF10A cells with NUMB siRNA depletion versus control upon expression of empty vector (EV), siRNA-resistant
NUMB-WT, or NUMB-2A.
(D) Western blot of NUMB in MCF10A cells after NUMB depletion or depletion and repletion with NUMB-WT or 2A.
(E) Western blot of NUMB and BRCA1 after transfecting CD44low MECs with the respective siRNAs.

(legend continued on next page)

Cell 178, 135–151, June 27, 2019 139

NUMB Sustains a DNA Damage-Associated
Differentiation Program in MECs
Failed ICL repair can promote aberrant basal-mesenchymal trans-
differentiation of cultured, basal-like human MECs (Wang et al.,
2016). In addition, at least three proteins—BRCA1 and its part-
ners, FANCD2 and BRG1—participate in ICL repair-driven MEC
differentiation control (Wang et al., 2016). Thus, we asked if
NUMB is also required for ICL repair and found that depletion of
NUMB in either CD44low or naive MCF10A MECs led to hypersen-
sitivity to the ICL-inducing agents, cisplatin, and MMC (Figures
3A–3D), much as has been detected in CD44low MECs after
BRCA1, BRG1, or FANCD2 depletion (Wang et al., 2016). To
determine if ICL agent sensitivity was NUMB depletion depen-
dent, we expressed small interfering RNA (siRNA)-resistant wild-
type (WT) NUMB or NUMB-2A mutant cDNAs in MCF10A cells
and found that WT NUMB, but not the mutant, rescued cisplatin
sensitivity (Figures 3C and 3D). This implied that NUMB phosphor-
ylation participates in sustaining ICL repair. Therefore, NUMB,
which was not formerly known to engage in DNA repair, much
less ICL repair, is necessary for ICL repair in these cells.
We also asked whether BRCA1 and NUMB cooperate in ICL
repair. When CD44low MECs were depleted of both NUMB and
BRCA1, they became more sensitive to cisplatin or MMC than af-
ter depleting NUMB or BRCA1 alone. This suggests that BRCA1
and NUMB cooperate in ICL repair (Figures 3E–3G). In addition,
NUMB depletion impaired nuclear focus formation by the key
ICL repair protein, FANCD2 (Figures S3A and S3B). Moreover,
NUMB depletion in MECs led to failed FANCD2 monoubiquitina-
tion following MMC exposure (Figures 3H, 3I, and S3C). Thus,
NUMB, like BRCA1 (Garcia-Higuera et al., 2001), promotes
FANCD2 recruitment to ICL-damaged sites by supporting its
monoubiquitination, a key event during ICL repair.
Since inadequate ICL repair threatened the normal differentia-
tion state of CD44low MECs, we asked if NUMB is required to
maintain a normal human MEC differentiation state, much like
its bound partner, BRCA1. We analyzed CD44low HME cells
(epithelial) and their BRCA1-depleted, aberrantly transdifferenti-
ated CD44high derivatives (Wang et al., 2016). The former ex-
pressed relatively high levels of E-Cadherin and DNp63 and a
low level of ZEB1, while CD44high cells revealed the opposite
phenotype, reflecting their respective epithelial and mesen-
chymal phenotypes (Figure 3J).
NUMB also underwent a dramatic isoform switch as CD44low
cells experienced BRCA1 depletion-driven EMT (Figure 3J).
CD44low HME cells expressed a relatively high level of the
NUMB long and a low level of the short isoform, while BRCA1-
depleted, aberrantly transdifferentiated CD44high cells revealed
the opposite pattern (Figure 3J). qPCR also revealed a significant
decrease of the long and an increase of short isoform-encoding
mRNA (Figure S3D). Using specific siRNAs, we selectively
depleted each NUMB isoform and validated that the two bands
represent the two above-noted isoform species (Figure S3E).
To test further whether a suitable NUMB isoform switch and
MEC differentiation maintenance are linked, we stably introduced
NUMB short cDNA (siRNA-resistant) or an empty vector into
CD44low MECs. Using a NUMB siRNA targeting its native 30 UTR,
the endogenous NUMB long isoform was efficiently depleted
while NUMB short cDNA expression was unaffected (Figure 3K).
Depleting endogenous NUMB long or overexpressing
NUMB short in otherwise unmanipulated cells led to only a
subtle MEC morphology effect, with most cells retaining their
epithelial state (Figure S3F). By contrast, the combination of
both triggered a clear change to mesenchymal morphology
(Figure S3F), a marked shift from CD44low to CD44high cells
(Figures S3G and S3H), and reduced expression of E-Cadherin
and overexpression of Vimentin (Figure 3K), similar to the re-
sults of a loss of BRCA1, BRG1, or FANCD2 expression.
NUMB long depletion followed by NUMB short overexpression
also led to a decrease in DNp63 expression (Figure 3K), which
is a driver of DNA damage-associated MEC dedifferentiation
(Wang et al., 2016). Interestingly, two human basal-like BC
cell lines also overexpressed the short isoform, unlike untrans-
formed MECs (Figure S3I), suggesting that a general isoform
switch might accompany MEC tumorigenesis. Thus, like
BRCA1 depletion, purposely altering the ambient ratio of
NUMB long/short isoform expression in human MECs, per-
turbed their differentiation state. Moreover, NUMB, like
BRCA1 and its partners, BRG1 and FANCD2, is necessary
for ICL repair, failure of which elicits an EMT.
HES1 Links BRCA1 and NUMB in ICL Repair
The finding of a NUMB contribution to ICL repair and MEC differ-
entiation maintenance prompted the question of whether
NOTCH signaling, a NUMB-influenced function (Flores et al.,
2014), underlies the latter. Of note, the NOTCH pathway tran-
scription factor (TF), HES1, normally interacts with certain Fan-
coni pathway core proteins and is required for proper ICL repair
(Tremblay et al., 2008). Moreover, HES1 depletion rendered
CD44low MECs hypersensitive to cisplatin and MMC exposure
(Figures 4A–4C).
Like NUMB depletion, HES1 depletion also impaired cisplatin/
ICL-driven FANCD2 focus formation in CD44low MECs (Fig-
ure S4A). By contrast, neither HES1 nor NUMB depletion altered
etoposide sensitivity (data not shown). In addition, HES1 deple-
tion led to defective MMC-driven FANCD2 monoubiquitination
(Figures 3H and 3I), similar to either BRCA1 or NUMB depletion.

(F and G) Clonogenic survival after depleting NUMB or BRCA1 or both in CD44low MECs exposed overnight to increasing concentrations of cisplatin (F) or
MMC (G).
(H and I) Effect of NUMB or HES1 depletion on monoubiquitination of FANCD2 after ICL damage in CD44low MECs (H) or in U2OS cells (I). Cells were transfected
with SiLuc or SiNUMB or SiHES1 for 48 h and exposed to MMC (100 ng/mL overnight). The lysates were IB’d with the indicated Abs.
(J) Western blotting for ZEB1, E-cadherin (E-CAD), DNp63, and long and short NUMB in undepleted, acutely depleted CD44low (DOX+) and chronically BRCA1-
depleted CD44high MECs.
(K) Western blotting for NUMB/E-CAD/VIMENTIN/DNp63 after depleting NUMB in CD44low MECs that overexpressed siRNA-resistant NUMB short.
The data (A, C, F, and G) represent mean ± SD. Two-way ANOVA analysis was used for statistical significance. N.S., not significant; *p < 0.05, **p < 0.01,
***p < 0.001, ****p < 0.0001.
See also Figure S3.

140 Cell 178, 135–151, June 27, 2019


HES1 expression was also lower in BRCA1-depleted CD44high
than in mock-treated CD44low MECs (Figures S4B and S4C).
These observations fit well with the finding that BRCA1-depleted
CD44high MECs also manifest a defect in ICL repair (Wang
et al., 2016).
To probe the context in which HES1 functions in ICL repair, we
asked if BRCA1, like other FANC proteins, interacts with HES1.
Indeed, BRCA1 coIP’d with endogenous HES1, FANCD2, and
NUMB (Figure 4D). NUMB-WT also coIP’d with HES1 and
FANCD2 (Figure 4E), and the ATM inhibitor KU55933 disrupted
BRCA1-NUMB (Figure 1E) and NUMB-HES1 binding (Figure 4F).
Importantly, mutations of NUMB phosphorylation sites (in the 2A
mutant) reduced NUMB binding to HES1 and to other DNA dam-
age repair proteins—i.e., BRCA1, FANCD2, and BARD1 (Fig-
ure 4E)—suggesting that NUMB phosphorylation contributes
to BRCA1-NUMB-HES1 complex integrity. Indeed, BRCA1
bound HES1 weakly after siNUMB expression (Figure 4G).
BRCA1/NUMB coIP was also perturbed when HES1 was
depleted (Figure 4G). These results imply that (1) BRCA1,
NUMB, and HES1 co-populate a common biochemical com-
Figure 4. HES1 Facilitates BRCA1/NUMB-
Dependent ICL Repair
(A and B) Effects of overnight cisplatin (A) or MMC
(B) exposure and HES1 depletion on CD44low MEC
clonogenic survival. Data represent mean ± SD;
two-way ANOVA analysis was used for statistical
analysis. ****p < 0.0001.
(C) IB of HES1 after transfecting the indicated
siRNAs into CD44low MECs.
(D) Interaction between myc-tagged BRCA1 and
HES1. Cell extracts from myc-BRCA1-expressing
293T cells were incubated with myc Ab versus
control IgG and analyzed by IB.
(E) Interaction between NUMB and BRCA1/HES1/
FANCD2/BARD1. A FLAG-tagged NUMB WT or 2A
mutant was expressed in 293T cells, and cell ly-
sates were IP’d with FLAG Ab and IB’d with the
indicated Abs.
(F) The effect of KU55933 (10 mM) or MMC
(100 ng/mL) on interaction between NUMB and
HES1.
(G) NUMB and HES1 are required for interaction
between BRCA1, CTIP, and FANCD2. 293T cells
were cotransfected with myc-BRCA1 and the
indicated SiRNAs. The corresponding cell extracts
were IP’d with myc Ab followed by IB.
See also Figure S4.
plex(es) that contribute(s) to ICL repair
and (2) the absence of any of them com-
promises BRCA1-NUMB-HES1 complex
formation.
BRCA1 also tethers both CtIP and
FANCD2 to damaged chromatin (Garcia-
Higuera et al., 2001; Yu et al., 2006), and
the latter proteins are both required for
crosslink lesion resolution (Murina et al.,
2014; Unno et al., 2014). Therefore, since
HES1-NUMB-BRCA1 complex formation
depends upon all three proteins being simultaneously available,
we asked if HES1 or NUMB is also required for the interaction of
FANCD2 and CtIP with BRCA1. Indeed, when either NUMB or
HES1 was depleted, BRCA1/CtIP/FANCD2 complex formation
and the capacity for ICL repair (Figures 3 and 4) also decreased.
Therefore, BRCA1/FANCD2/CtIP/NUMB/HES1 interactivity may
be necessary for proper ICL repair and, thus, for MEC differenti-
ation maintenance.
To assess HES1 participation in MEC differentiation mainte-
nance, we stably depleted it in CD44low MECs and succeeded
in isolating multiple, derivative CD44high clones. The latter ex-
hibited mesenchymal morphology while CD44low cells remained
largely epithelial. Western blotting also showed that HES1-
depleted CD44high cells exhibited high ZEB1 and Vimentin and
low E-Cadherin expression, consistent with EMT development
(Figures S4E and S4F). These HES1-depleted CD44high cells
also exhibited spontaneously arising DNA damage in the form
of anaphase bridges (Figure S4G). Therefore, similar to BRCA1,
FANCD2, BRG1, and NUMB, HES1 also sustains an ICL DNA
damage repair-associated differentiation program in MECs.
Cell 178, 135–151, June 27, 2019 141
Figure 5. BRCA1 Loss in Luminal MECs Promotes Development of Basal-like Mammary Tumors
(A) Schematic diagrams depicting Cre-mediated excision of either a floxed transcriptional Stop cassette (STOP) in the R26Y reporter, floxed exons 2–10 in the
Trp53L allele, and floxed exons 22–24 in the Brca1L allele, leading to YFP expression and disruption of Trp53 and Brca1.
(B) FACS analysis of MECs from virgin females with the indicated genotypes 3 days or 3 weeks after intraductal injection of Ad-K8-Cre. The YFP-marked/lineage
negative MECs were analyzed with CD24 and CD29 Abs.
(C) Statistical analysis of aberrant YFP+ MECs in the basal gate 3 weeks post injection (in B). ***p % 0.005.
(legend continued on next page)

142 Cell 178, 135–151, June 27, 2019

 To investigate the hypothesis that a CD44low to CD44high MEC
transition represents a step during mammary tumorigenesis, we
compared the soft agar colony formation ability of CD44low and
CD44high cells that arose after BRCA1 depletion. CD44high cells
formed agar colonies much more efficiently (>100-fold) than
CD44low cells (Figures S4H and S4I). This is consistent with
DNA damage-associated transdifferentiation that appears after
BRCA1 depletion, representing a step toward BC development.
Loss of BRCA1 Function in Luminal MECs Promotes
Basal-like Mammary Tumorigenesis
To understand how BRCA1 loss affects luminal MEC fate and
promotes BC development, we established a mouse BRCA1
BC model. It involved the intraductal injection of a Cre-express-
ing adenovirus under Krt8 promoter control (Ad-K8-Cre), leading
to floxed Brca1 and/or Trp53 knockout and simultaneous activa-
tion of a conditional YFP-expressing Cre-reporter (Rosa26-
LSL-YFP [R26Y]) in luminal MECs (Tao et al., 2014, 2017) (Fig-
ure 5A). Of note, Cre-mediated excision of floxed exons 22–24
of mouse Brca1 (McCarthy et al., 2007), resulted in disruption
of the NUMB/CtIP/Abraxas/BACH1-interacting BRCA1 BRCT
domains.
Speculating that a BRCA1-dependent MEC differentiation
program affects normal MG biology and that its loss will impair
luminal MEC fate—e.g., during the early stage of BRCA1 BC
development—we studied YFP-marked MEC fate soon after
Ad-K8-Cre injection (Figure 5B). This vector restricts Cre expres-
sion to luminal MECs (Tao et al., 2017); thus, YFP+ MECs were
detected solely in the LinCD24hiCD29lo luminal fluorescence-
activated cell sorting (FACS) gate 3 days after injection, in
Trp53L/L;Brca1L/L;R26Y (PBY) females, as well as in R26Y (WT)
and Trp53L/L;R26Y (PY) controls (Figure 5B). Three weeks after
injection, we began to detect YFP+ MECs in the basal MEC
gate in injected PBY females, but not in injected R26Y and PY
controls (Figures 5B and 5C). Thus, induced BRCA1 loss in
luminal MECs likely led to a luminal-to-basal cell fate change
soon thereafter.
We also detected more YFP+ MECs in injected PBY mice than
in controls (Figure 5B). Quantitation of YFP+ MECs in females
2 weeks post injection confirmed the presence of more prolifer-
ating p53/BRCA1-deficient MECs compared to p53-deficient or
WT MECs (Figure S5A). These data imply that (1) BRCA1 main-
tains a luminal MEC fate in vivo and (2) a corresponding loss of
a luminal and the emergence of a basal-like cell fate accompa-
nied BRCA1 loss. The latter correlated with enhanced BRCA1/
p53-deficient MEC proliferation.
All Ad-K8-cre-injected PBY female mice eventually developed
mammary tumors (first palpated 8–12 months post injection; Fig-
ures 5D and S5B). Immunofluorescence (IF) staining showed that
the resulting tumor cells expressed basal markers (e.g., K5, K14)
(Figures 5E and S5C). By gene set enrichment analysis (GSEA)
(Subramanian et al., 2005), we compared their microarray
(D) Kaplan-Meier tumor-free plot for PBY female mice (n = 8) injected with Ad-K8-Cre.
(E) IF staining showing expression of YFP (luminal origin), K5 (basal marker), and K8 (luminal marker) in a representative mammary tumor developed in mice in (D).
(F) GSEA for comparisons of microarray data from tumors in (D) to gene sets representing different human BC subtypes.
(G) GSEA plots showing significant enrichment of MaSC and EMT-related gene sets in tumors in (D) relative to WT Krt8+ luminal MECs.
See also Figure S5.
expression profiles to expression signatures of human and
murine BC subtypes (Pfefferle et al., 2013). The mouse Brca1-
deleted tumors most closely resembled the human basal-like
breast cancer (BLBC) subtype and murine MycEx, p53null-Basa-
lEx, and C3TagEx subtypes, each a model of BLBC (Pfefferle
et al., 2013) (Figures 5F and S5D).
Employing an intraductal injection approach, p53 loss, alone in
Krt8+ luminal MECs resulted in Claudin-low mammary tumors,
possibly due to an acquisition of secondary mutations (e.g.,
9qA1 [Yap1] or 6qA2 [Met] amplification; Tao et al., 2017). How-
ever, genes from such regions in p53/BRCA1-deficient tumors
lacked signs of amplification-driven overexpression (Figure S5E).
Thus, co-induced loss of BRCA1 and p53 drove luminal MECs to
develop BLBC and not Claudin-low cancer. Others argue that
human Claudin-low BC is not a prevalent BRCA1 disease (Mada-
ras et al., 2016). Lastly, analysis of gene sets that reflect MaSC
(Lim et al., 2010) and EMT (Gotzmann et al., 2006) programs (Fig-
ure 5G) suggests that these BRCA1-deficient tumor cells, being
derived from luminal MECs originally, acquired aberrant basal
and mesenchymal (b&m) gene expression programs after
BRCA1 loss.
Loss of BRCA1 Function Elicits a Luminal to Basal/
Mesenchymal Change
Our mouse model revealed the emergence of premalignant
basal-like MECs and mammary cancer from luminal MECs
following induced BRCA1 loss. To determine if these p53/
BRCA1-deficient MECs had acquired an abnormal in vivo differ-
entiation state, we FACS-purified YFP+ MECs from the corre-
sponding mice one month after Ad-K8-Cre injection. These cells
then underwent RNA sequencing (RNA-seq). Several mesen-
chymal/EMT genes (e.g., Vim, Zeb1, Zeb2) were upregulated
(unlike in the case of p53-deficient or WT MECs) (Figure 6A).
Furthermore, GSEA revealed that multiple, mesenchymal/EMT-
related gene sets were enriched, again only in the BRCA1/
p53-deficient MECs (Figures 6B and S5F), accompanied by
enrichment of a mammary LP gene set (Lim et al., 2010) (Fig-
ure 6B). The latter may reflect the LP origin of BRCA1 BLBC
(Lim et al., 2009; Molyneux et al., 2010; Proia et al., 2011).
To further assess the aberrant differentiation state of p53/
BRCA1-deficient MECs, we purified YFP+ MECs by FACS
7 days after Ad-K8-Cre injection and cultured them as organo-
ids. Although their organoid-forming efficiency was similar to
that of p53-deficient and WT luminal MECs, the doubly deficient
cells were larger when cultivated in the presence (rather than the
absence) of B27, which includes progesterone (Figures S5G–
S5I). When cultivated in B27-free medium, only the doubly (and
the p53-deficient) MECs still formed organoids. Moreover, the
organoid-forming efficiency and size of the doubly deficient
MECs were greater than those of p53-deficient and WT MECs
(Figures S5H and S5I). B27-independent growth of BRCA1-defi-
cient MECs was observed previously (Lim et al., 2009; Sau et al.,
Cell 178, 135–151, June 27, 2019 143
Figure 6. Loss of BRCA1 Function Elicits a Luminal to Basal/Mesenchymal Fate Change and Accumulation of DNA Damage
(A) Expression (relative to that of WT cells, normalized = 1, from bulk RNA-seq) of select EMT-related genes in YFP+ cells sorted from MGs of PBY or PY or R26Y-
only females 1 month after Ad-K8-Cre injection.
(B) GSEA plots showing enrichment of EMT and LP-related gene sets in Trp53/Brca1 null MECs compared to WT or Trp53 null MECs based on RNA-seq data
as in (A).
(C) qRT-PCR data revealing an upregulation of selected b&m genes in Trp53/Brca1 null organoid cells compared to those obtained from PY or R26Y-only control
females following Ad-K8-Cre injection. Data represent mean ± SEM.
(D) IF staining confirming upregulation of Keratin 14 (K14) and Vimentin (VIM) expression in Trp53/Brca1 null (bottom) versus Trp53 null (top) organoid cells as in
(C). Scale bar, 100 mm.

(legend continued on next page)

144 Cell 178, 135–151, June 27, 2019

2016). The differentiation status of MECs in organoids, when
characterized by qRT-PCR analysis, also revealed an upregula-
tion of expression of b&m genes only in p53/BRCA1-deficient
cells (Figures 6C and 6D).
We also detected 53BP1+ cells in these p53/BRCA1-deficient
organoids, a sign of ongoing DNA damage. Furthermore, 53BP1
foci were more abundant in cells that manifest aberrant differen-
tiation (i.e., exhibited robust K14 expression) (Figure S5J). Thus,
aberrant differentiation of p53/BRCA1-deficient MECs was
accompanied by DNA damage, as in BRCA1-depleted human
MECs (Wang et al., 2016).
Single-Cell Expression Analysis during the Evolution of
BRCA1-Deficient Tumors
To assess the fate change of p53/BRCA1-deficient luminal
MECs in vivo, we performed single-cell (sc)RNA-seq analysis
(10X Genomics) on YFP+ MECs FACS-purified from injected
MGs and from mammary tumors that arose in Ad-K8-Cre-in-
jected PBY females. We used the Seurat tool (Butler et al.,
2018) to analyze the top 50 enriched genes in each cell cluster
(Data S1).
Two weeks after Ad-K8-Cre injection, we found that YFP-
marked MECs included five luminal MEC clusters. The largest
four were composed of hormone receptor (HR)+ luminal cells
that expressed Prlr, Pgr, and an estrogen receptor co-factor
gene, Cited1 (Figure 6E). There was also a cluster that expressed
Csn3 and Wfdc18 (Figure 6E and Data S1), likely reflecting HR
MECs with an LP/alveolar luminal phenotype (Giraddi et al.,
2018). There was also a small cluster of MECs that expressed
b&m genes (e.g., Acta2, Krt5, Krt14, Sparc, Postn, Igfbp7,
Serpinh1, Sfn) and myoepithelial differentiation genes (e.g.,
Myl9, Mylk, and Tpm2) (B cluster; Figure 6E and Data S1). The
presence of this cluster is consistent with that of a sizeable num-
ber of YFP+ MECs in the basal FACS gate at this early post-Ad-
K8-Cre injection stage (Figures 5B and 5C).
5 months post injection, the YFP-marked MECs now included
a large LP cluster (HR, high expression of Csn3 and Wfdc18)
and a much smaller HL cluster (again expressing Prlr and Cited 1;
Figure 6F). There was also a distinct EMT cluster expressing
mesenchymal genes (e.g., Sparc, Postn, Aebp1, Figure 6F and
Data S1). Cells in this cluster may be related to those in the
basal-like cluster observed at 2 weeks (Figure 6E; cluster B)
that subsequently underwent EMT and expressed mesenchymal
genes (e.g., Sparc, Postn) and retained expression of the myoe-
pithelial gene, Tpm (Figures 6E and 6F).
In addition, multiple highly enriched RNAs in the 5-month LP
cluster were the same as those in the LP cluster 2 weeks post in-
jection, possibly reflecting a common LP origin (Figures 6E and
6F and Data S1). However, unlike MECs analyzed at 2 weeks,
many cells in the LP cluster at 5 months had begun to express
Sox4 (Figure 6F), a known EMT inducer (Tiwari et al., 2013),
and several b&m genes initially found to be highly expressed in
the Basal-like cluster at 2 weeks (e.g., Sfn, Igfbp7, Serpinh1;
compare Figure 6E cluster B and Figure 6F cluster LP). Overall,
these and bulk RNA-seq data from the YFP+ premalignant
MECs suggest that (1) HR LPs are the main MEC population de-
tected following the loss of BRCA1 and p53 and that (2) YFP+,
p53/BRCA1-deficient LPs, and basal-like cells continued to un-
dergo b&m transdifferentiation over time.
In the two tumors analyzed, we observed 1–2 cluster(s) of tu-
mor epithelial cells, as well as a cluster of mesenchymal cells
(possibly reflecting stromal cells, though some of these cells
may be tumor epithelial cells undergoing more complete mesen-
chymal transdifferentiation) (Figures 6G and 6H). The tumor
epithelial cell clusters (Figures 6G and 6H and Data S1) largely
reflect their LP origin, given that they expressed LP/alveolar
luminal genes (e.g., Sox9, Csn3, Wfdc18, Lcn2, Mfge8, Phlda1,
Tm4sf1, Fxyd3). Furthermore, many cells in these clusters also
expressed mesenchymal (e.g., Sparc, Postn, Bgn, Mgp, Igfbp7,
Serpinh1, Aebp1) and EMT inducer genes such as Sox4, sug-
gesting that they might be undergoing an EMT.
Using another t-distributed stochastic neighbor embedding
(t-SNE) plotting approach (10X Genomics), we observed that tu-
mor epithelial and mesenchymal cell clusters self-organized in a
manner that reflected transdifferentiation from a luminal (purple-
lettered genes) toward a mesenchymal fate (red- and green-
lettered genes) (Figure S6A). These included clusters that
manifested signs of an LP origin (purple lettering), as reflected
by their expression of LP/alveolar luminal genes (e.g., Sox9,
Elf5, Kit, Csn3, Wfdc18). Yet other clusters seemed to be gradu-
ally losing expression of the pan-luminal gene Krt8, the EMT in-
hibitor/LP gene Elf5 (Chakrabarti et al., 2012), and the epithelial
gene Cdh1 while gaining expression of the basal gene (Krt14)
and eventually certain EMT-associated TF-encoding (e.g.,
Zeb1, Twist1, Snai1, Sox4) and mesenchymal genes (e.g.,
Cdh2, Vim, Sparc, Postn, Aebp1). At the top of Figure S6A, in
both tumors, an LP-like tumor cell cluster is on the left side, an
EMT-like tumor cell cluster is in the middle/middle right, and a
mesenchymal cell cluster is on the right.
Compared to cells in the mesenchymal clusters, which might
be stromal cells, cells in the EMT clusters are tumor cells that
manifest signs of an epithelial origin, as they expressed the
above-noted LP/alveolar luminal genes (e.g., Csn3, Wfdc18,
Sox9; Figure S6A). In tumor 1, cells in the EMT cluster also ex-
pressed Krt8 (Figure S6A, left).
Interestingly, cells in the B/M (basal/mesenchymal) and EMT
clusters expressed several genes, defined above, that appear
to reflect cell fate dynamics over time (e.g., basal: Sfn;

(E–H) Analysis of scRNA-seq data based on Seurat (top: t-SNE plots; bottom: heatmaps of select cell clusters). Data obtained 2 weeks after Ad-K8-Cre injection in
PBY females were based on sorted YFP+ MECs (E), data for 5-month chasing was based on sorted YFP+ MECs and CD45+ leukocytes (F), and data for tumors
were based on tissues (cells unfractionated) from two different mammary tumors (G and H). Heatmaps for the top 50 enriched genes in each cell cluster are shown
(epithelial and mesenchymal clusters only). HL, hormone receptor-positive luminal cell cluster; LP, luminal progenitor-like cell cluster; B, basal-like cell cluster;
EMT, epithelial-to-mesenchymal transition cell cluster; M, mesenchymal cell cluster. See also Data S1 for the top 50 enriched genes
(I) Representative IF staining of 53BP1(green arrowheads) in MGs or tumors from PBY female mice at different time points after Ad-K8-Cre injection. Scale bar,
50 mm. See also Figure S6D for quantification.
See also Figures S5 and S6 and Data S1.

Cell 178, 135–151, June 27, 2019 145

mesenchymal: Sparc, Postn, Aebp1) (Figures 6E–6H and S6A).
These clusters may be clinically relevant, since, from public
database sources, we found that among human BLBC cases,
those with higher expression levels of any of these four genes
experienced a worse clinical outcome (Figure S6B).
Loss of BRCA1 Function Causes the Accumulation of
DNA Damage
To determine whether the kinetics of cell fate change correlate
with an accumulation of DNA damage in BRCA1/p53-deleted
MECs, we stained MGs from Ad-K8-Cre-injected PBY females
for DNA damage markers. A small number of 53BP1+ cells could
already be detected 1 month after injection (Figure 6I). Fewer still
were detected in p53-depleted MGs, and none were found in WT
MGs (Figures S6C and S6D).
5 months after BRCA1/p53 deletion, the abundance of
53BP1+ cells had increased significantly in PBY MGs (Figures
6I and S6D). Subsequently, in the resulting tumors, most tumor
epithelial cells exhibited nuclear 53BP1 staining (Figures 6I and
S6E, green arrowheads), whereas the non-epithelial cells (Fig-
ure S6E, white arrowheads) in these tumors did not. There was
an analogous pattern of g-H2AX accumulation in p53/BRCA1-
deficient MECs and tumor cells (Figure S6F).
Collectively, these data imply that normal differentiation
maintenance by BRCA1 in luminal MECs is a major suppressor
of BLBC development. By contrast, loss of BRCA1 (in a p53-
deficient background) in primary luminal MECs resulted in
the emergence of aberrantly differentiated, progesterone-
independent, hyperproliferating, b&m-like cells. BRCA1 defi-
ciency-linked aberrant MEC differentiation gave way to BLBC
development, and both were accompanied by abundant DNA
damage that likely arose, at least in part, from a defect in
BRCA1 function.
Inadequate DNA Repair Promotes Aberrant
Transdifferentiation in Primary Luminal MECs
To further test if failed BRCA1 DNA repair function results in
aberrant, ex vivo MEC transdifferentiation, we exposed Trp53/
organoids derived from sorted YFP+ luminal MECs of Ad-K8-
Cre-injected PY mice to cisplatin (0.2 mM, 1 week). After drug
withdrawal, the cells were maintained in organoid culture for
14 days. By comparison with mock-treated cells, the cisplatin-
treated cells experienced a dramatic increase in basal-like orga-
noids with upregulated K5 expression (Figures 7A and S7A).
When compared with mock-treated cells, 53BP1 staining re-
flected persistent cisplatin DNA damage in these cells (Figures
7A and S7B).
We also assayed for b&m marker gene expression and de-
tected increased expression of most of these genes in the
cisplatin-treated organoids. Expression had risen to a level com-
parable to that detected in drug-free BRCA1/p53-deficient orga-
noid cells (Figure 7B), suggesting that cisplatin treatment had, at
least in part, phenocopied BRCA1 loss in p53-deficient luminal
MECs. The same was true in human MECs (Wang et al., 2016).
To determine whether this cell fate change resulted from DNA
damage in general or more specifically from ICL DNA damage,
we exposed p53-deficient luminal organoids to etoposide and
then subjected the cells to the same analyses. Unlike cisplatin,
146 Cell 178, 135–151, June 27, 2019
etoposide exposure, which induces topoisomerase II-linked
DSB as opposed to ICL (Baldwin and Osheroff, 2005), led to a
significant increase in mRNA expression of basal (Trp63 and
Krt5), but not mesenchymal markers (Vim and Zeb1) (Figures
7B, S7A, and S7B), in keeping with our previous observations
(Wang et al., 2016). Taken together, these data indicate that
ongoing DSB-like DNA damage triggers a luminal to basal cell
fate change in primary MECs and that ICL DNA damage induced
by cisplatin or a loss of BRCA1 function phenocopy one another,
leading to the acquisition by these transdifferentiated basal cells
of a mesenchymal fate.
Next, we asked if certain subunits of BRCA1-containing multi-
protein complexes participate in DNA damage-associated dif-
ferentiation maintenance in primary mouse luminal MECs. We
disrupted NUMB expression in p53-deficient luminal organoid
cells, using CRISPR/Cas9 (Figure S7D). As a positive control,
we similarly disrupted BRCA1 in another aliquot of the same or-
ganoid cells and confirmed the absence of BRCA1 nuclear foci in
proliferating organoid MECs (Figure S7C). As negative controls,
we targeted either the mouse Rosa26 locus (leading to DSB in a
neutral genomic region) or an unrelated plant gene (which is not
expected to induce DNA breaks in mouse cells). Similar to
BRCA1-loss, NUMB loss resulted in larger organoids by com-
parison with controls (Figures 7C and S7E); qRT-PCR analysis
revealed upregulation of both b&m gene expression in NUMB-
deficient organoid cells, like what occurred in BRCA1-deficient
cells (Figure 7D).
In addition, loss of either NUMB or BRCA1 led to an accumu-
lation of DNA damage in aberrantly differentiated MECs, as
measured by comet assay (Figures 7E, 7F, and S7F). More spe-
cifically, their DNA damage levels were significantly higher than
those of MECs exposed to a Rosa26 gRNA, which should only
have elicited a low level of DSB (Figure S7F). Thus, the DNA dam-
age associated with loss of either NUMB or BRCA1 was not due
to irrelevant CRISPR editing.
Lastly, since HES1 links BRCA1 and NUMB to ICL DNA repair,
we also tested if loss of HES1 in luminal MECs phenocopies the
outcome of either BRCA1-loss or NUMB-loss. HES1 expression
was disrupted in p53-deficient luminal organoid cells by
CRISPR/Cas9 (Figure S7G). Similar to BRCA1 or NUMB loss,
HES1 loss also resulted in larger organoids (Figures S7H and
S7I) and an upregulation of b&m gene expression (Figure S7J).
Therefore, both NUMB and HES1 recapitulated the role of
BRCA1 in suppressing a luminal to b&m transition of primary
mouse luminal MECs. Importantly, in human BCs, both NUMB
and HES1 are expressed at significantly lower levels in BLBC
than other subtypes (except the luminal B subtype; Figure S7K),
consistent with these two genes playing supporting roles as ICL-
repair proteins during the suppression of BLBC development.
DISCUSSION
BRCA1 prevents in vivo DNA damage from promoting transdif-
ferentiation of normal luminal MECs to basal-like cells that
manifest a mesenchymal phenotype. Aberrant luminal MEC dif-
ferentiation likely contributes to BRCA1 BLBC development (Lim
et al., 2009; Molyneux et al., 2010; Proia et al., 2011). Others have
detected heterogeneity in the results of primary MEC analysis

performed on cells of BRCA1+/+ and tumor-free BRCA1 mutation
carriers (Nakshatri et al., 2015). Therefore, we undertook a pro-
spective, comparative analysis of primary MECs from BRCA1-
mutated and relevant control mice to determine if aberrant
MEC differentiation accompanies BRCA1 loss in tumor-free
mammary tissue.
Evidence of such a process was detected. Its central out-
comes mimicked the aberrant DNA damage-associated trans-
differentiative phenotypes induced in human MECs by BRCA1
p220 depletion or depletion of certain p220-associated proteins
(Wang et al., 2016). Where tested, these DNA damage-associ-
ated outcomes developed rapidly after in vivo BRCA1 luminal
cell depletion and persisted during BRCA1 mouse mammary
tumorigenesis. Therefore, they may be signs of molecular mis-
Figure 7. Inadequate ICL Repair Pro-
motes Luminal to Basal/Mesenchymal
Transdifferentiation
(A) IF staining for K5 and 53BP1 in organoids (as in
Figures 6C and 6D) with or without cisplatin or
etoposide treatment. Scale bar, 100 mm. Quanti-
tation of K5+ and 53BP1+ organoids is shown in
Figures S7A and S7B.
(B) The effect of cisplatin or etoposide treatment on
b&m gene expression in Trp53 null luminal orga-
noid cells by qRT-PCR analysis. Data represent
mean ± SEM.
(C) Size assessment of Trp53 null luminal organo-
ids following CRISPR/Cas9-mediated editing of
Brca1, Numb, or Rosa26 (control). Data represent
mean ± SEM. **p % 0.01.
(D) The effect of CRISPR/Cas9-mediated editing of
Brca1 or Numb on b&m gene expression in Trp53
null luminal organoid cells compared to that of
Rosa26 editing (control).
(E and F) Quantitation of the incidence of cells
with comet tails (E) and relative comet tail length
(F) (following the indicated CRISPR/Cas9-medi-
ated gene editing). Data represent mean ± SD;
***p % 0.005, ****p % 0.001.
(G) A proposed model of the ICL-dependent dif-
ferentiation program in MECs.
See also Figure S7.
steps that lead to BRCA1-associated
BC. This process operates in humans
and in mice and is summarized in
Figure 7G.
Aberrant LPs exist both in human
BRCA1 mutation carriers and in mouse
models (Lim et al., 2009; Molyneux et al.,
2010; Proia et al., 2011). However, the
mechanism by which a BRCA1 functional
defect results in aberrant luminal MEC dif-
ferentiation followed by BLBC has been
unclear.
Four generic questions were posed
during this study. First, does an inte-
grated, BRCA1-containing, ICL repair-
promoting process contribute to MEC
differentiation control? If so, are any of
its participants newly detected, and how do they operate?
Does such a process sustain normal MEC differentiation (1) in
multiple mammalian species, (2) both in vitro and in vivo, and
(3) by executing the same steps in both instances? Lastly, is its
failure material to BRCA1 BC development?
The participants in this process are, at a minimum, BRCA1 and
four BRCA1-associated proteins—two established partners,
BRG1 and FANCD2, a formerly suspected one, HES1 (Buckley
et al., 2013), and a new one, NUMB. Yet others may exist.
Some contribute to DSB repair (Houghtaling et al., 2005; Scully
et al., 1997), and all contribute to ICL repair (Kim and D’Andrea,
2012; Tremblay et al., 2008; Wang et al., 2016). Depletion of any
member of this group not only compromised ICL repair, but
also led to the mesenchymal transdifferentiation of cultured,
Cell 178, 135–151, June 27, 2019 147
basal-like human and primary mouse luminal MECs analyzed
during mouse BRCA1 mammary tumorigenesis.
All of these associated proteins not only contribute to ICL
repair, they likely do so in an organized, possibly even integrated
manner. In particular, much of the BRCA1 binding to the above-
noted partner proteins depended upon it also binding to each
subunit individually. Leaving one out triggered a defect in multi-
partner binding to BRCA1. BRCA1/multisubunit complex forma-
tion is, therefore, subunit interdependent, as if intact complex
formation represents a well-organized and cooperative process.
Each subunit that was tested also appeared to be necessary for
the maintenance of normal, cultured basal-like human MEC
differentiation and proper ICL repair. Since ICL damage alone
triggered aberrant MEC transdifferentation, we suspect that sub-
unit-interdependent BRCA1 complex formation and ICL repair
contribute to efficient MEC differentiation maintenance.
The studies reported here also revealed that the nature of the
breakdown in MEC differentiation differed when cells were
exposed to ICL- versus DSB-inducing compounds. Defective
DSB repair led to a luminal-to-basal change, while ICL damage
contributed to a luminal-to-b&m change. Therefore, the quality
of DNA damage affected the nature of its biological outcome.
Better still, the mammary cancers that emerged from BRCA1-
deficient luminal MECs were preceded by both advancing DNA
damage and aberrant luminal transdifferentiation. These findings
imply that BRCA1 elimination-dependent premalignant DNA
damage and its associated luminal-to-b&m phenotypic changes
represent vital contributions to BRCA1 mammary tumorigenesis.
NUMB and HES1, both BRCA1 partners, contribute to ICL
repair-driven MEC differentiation and communicate with one
another (Flores et al., 2014; Buckley et al., 2013). HES1 also posi-
tively influences Fanconi core complex ICL repair function
(Tremblay et al., 2008). Therefore, a reasonable speculation is
that they co-participate in BRCA1 BC suppression.
In both p53/BRCA1-deficient tumors that were analyzed,
scRNA-seq data showed that most tumor cells expressed LP/al-
veolar luminal markers, consistent with them having an LP origin
(Lim et al., 2009; Molyneux et al., 2010; Proia et al., 2011). Impor-
tantly, a subset of tumor cells (e.g., the B/M and EMT clusters in
tumor 1, the EMT cluster in tumor 2; Figure S6A) expressed both
LP/alveolar luminal markers and basal and/or mesenchymal
genes. The premalignant single-cell data and that derived
from both tumors reflect the operation of an overarching luminal
to mesenchymal transdifferentiation process. It involved an
enlarging LP population and/or a rare basal-like population that
then underwent mesenchymal transdifferentiation (Figures
S7L–S7N).
The subsequent development of BRCA1-deficient mammary
tumor cells can be explained by at least three models (Figures
S7L–S7N). In one, LP cells represent the origin of each primary
tumor (Figure S7L), and basal-like, EMT, and mesenchymal tu-
mor cells are all derived from them. In another model, the cells
in the Basal-like cluster originated from the earlier growth of a
once relatively rare Ad-K8-Cre-targeted basal cell species that
subsequently underwent EMT; alternatively, LP cells underwent
aberrant expansion, gradually acquired b&m features, and
became EMT cells. In both cases, the EMT cells may manifest
multipotent cancer stem cell activity (Figure S7M). In the third
148 Cell 178, 135–151, June 27, 2019
model, the tumor may be polyclonal, with cells in the LP and
Basal-like clusters progressing independently and then jointly
forming a tumor (Figure S7N).
This notwithstanding, both LPs and basal-like cells revealed
increasing mesenchymal gene expression that correlated with
and possibly even depended upon an accumulation of endoge-
nous ICL or ICL-like DNA damage. Taken together, these find-
ings suggest that linked defects in BRCA1-driven multiprotein
complex formation, repair of ICL or ICL-like DNA damage, and
MEC transdifferentiation suppression conspire to promote
BRCA1 tumorigenesis. Our results also provide the first longitu-
dinal mechanism-related picture of certain key events that give
rise to BRCA1 mammary cancer.
STAR+METHODS
Detailed methods are provided in the online version of this paper
and include the following:
d KEY RESOURCES TABLE
d LEAD CONTACT AND MATERIALS AVAILABILITY
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
B Cell lines and Culture conditions
B Mouse models
d METHOD DETAILS
B Immunoblotting and Immunoprecipitation
B GST –BRCA1 Fragment Binding experiments
B Mammary gland cell preparation and flow cytometry
B Mammary organoid culture and manipulation
B Immunofluorescence staining
B Confocal microscope analysis
B Soft Agar Assay
B Clonogenic and Cell Growth Assays
B CRISPR/Cas9 lentiviral vectors
B Plasmid Construction
B siRNA and shRNA
B Comet Assay
B Anaphase bridges
B Microarray expression profiling and analysis
B RNA isolation and Bulk RNA sequencing
B Single-cell RNA sequencing (scRNaseq)
B scRNaseq data preprocessing
B Quantitative RT–PCR
B Statistics
d DATA AND CODE AVAILABILITY
SUPPLEMENTAL INFORMATION
Supplemental Information can be found online at https://doi.org/10.1016/j.
cell.2019.06.002.
ACKNOWLEDGMENTS
We thank all members of the Li and Livingston groups for their many helpful
suggestions. We are also grateful to Dr. Joan Brugge and her group and to
Drs. Myles Brown, Kornelia Polyak, and Robert Weinberg for valuable input
along the way. We also thank Dr. Steve McCarroll’s lab for access to their
10X Genomics and deep-well PCR machines. This work was supported by
grants from the National Cancer Institute (NCI) (2PO1CA80111-16; D.M.L.),
(5R01CA136512-05; D.M.L.) and from the Susan B. Komen Foundation for
the Cure, the Breast Cancer Research Foundation, the Murray Winsten Foun-
dation, the BRCA Foundation, and the Gray Family Foundation (D.M.L.). This
work was also supported by a Seed Grant (SG-0062-10; Z.L.) and a Cancer
Program Pilot Grant (DP-0137-13-00; Z.L.) from the Harvard Stem Cell Insti-
tute, by Breakthrough Awards from the Department of Defense (W81XWH-
15-1-0100 and W81XWH-18-1-0037; Z.L.), and by NCI/NIH grants R21
CA205825 (Z.L.) and R01 CA222560 (Z.L.).
AUTHOR CONTRIBUTIONS
H.W., Z.L., and D.M.L. conceived the project. H.W. and H.J.R. performed most
cultured cell studies, and D.X. performed most in vivo studies and organoid ex-
periments with help from A.H., L.T., and Y.X.; D.X. performed the scRNA-seq
and bioinformatic analysis with help from K.X.Z. and Q.C.; and B.L. and N.D.
helped construct and analyze plasmids. A.P.C. and V.V.B. performed soft
agar assays and confocal microscope analysis. A.D. contributed to the EMT
analysis. N.S. and H.C. generously provided an unpublished protocol that
made primary mammary organoid cultures possible before its publication
and advised us on its optimal use. Z.L. and D.M.L. supervised all experiments.
H.W., D.X., Z.L. and D.M.L. wrote the manuscript. All authors read and were
invited to comment on the manuscript.
DECLARATION OF INTERESTS
D.M.L. is a consultant to Constellation Pharma and the Novartis Institute for
Biomedical Research and a scientific advisor to NextechInvest; he sits on
external advisory boards of the Johns Hopkins (Kimmel), MIT, and Rutgers
Cancer Centers. K.X.Z. is an employee of Merck. None of the other authors
have any conflicts of interest to declare.
Received: June 18, 2018
Revised: March 4, 2019
Accepted: May 31, 2019
Published: June 27, 2019
REFERENCES
Baldwin, E.L., and Osheroff, N. (2005). Etoposide, topoisomerase II and can-
cer. Curr. Med. Chem. Anticancer Agents 5, 363–372.
Bu, P., Chen, K.Y., Chen, J.H., Wang, L., Walters, J., Shin, Y.J., Goerger, J.P.,
Sun, J., Witherspoon, M., Rakhilin, N., et al. (2013). A microRNA miR-34a-
regulated bimodal switch targets Notch in colon cancer stem cells. Cell
Stem Cell 12, 602–615.
Buckley, N.E., Nic An tSaoir, C.B., Blayney, J.K., Oram, L.C., Crawford, N.T.,
D’Costa, Z.C., Quinn, J.E., Kennedy, R.D., Harkin, D.P., and Mullan, P.B.
(2013). BRCA1 is a key regulator of breast differentiation through activation
of Notch signalling with implications for anti-endocrine treatment of breast
cancers. Nucleic Acids Res. 41, 8601–8614.
Bunting, S.F., Callén, E., Wong, N., Chen, H.T., Polato, F., Gunn, A., Bothmer,
A., Feldhahn, N., Fernandez-Capetillo, O., Cao, L., et al. (2010). 53BP1 inhibits
homologous recombination in Brca1-deficient cells by blocking resection of
DNA breaks. Cell 141, 243–254.
Butler, A., Hoffman, P., Smibert, P., Papalexi, E., and Satija, R. (2018). Inte-
grating single-cell transcriptomic data across different conditions, technolo-
gies, and species. Nat. Biotechnol. 36, 411–420.
Chakrabarti, R., Hwang, J., Andres Blanco, M., Wei, Y., Lukac isin, M.,
Romano, R.A., Smalley, K., Liu, S., Yang, Q., Ibrahim, T., et al. (2012). Elf5 in-
hibits the epithelial-mesenchymal transition in mammary gland development
and breast cancer metastasis by transcriptionally repressing Snail2. Nat.
Cell Biol. 14, 1212–1222.
Chen, J., Silver, D.P., Walpita, D., Cantor, S.B., Gazdar, A.F., Tomlinson, G.,
Couch, F.J., Weber, B.L., Ashley, T., Livingston, D.M., and Scully, R. (1998).
Stable interaction between the products of the BRCA1 and BRCA2 tumor sup-
pressor genes in mitotic and meiotic cells. Mol. Cell 2, 317–328.
Chen, C.C., Feng, W., Lim, P.X., Kass, E.M., and Jasin, M. (2018). Homology-
Directed Repair and the Role of BRCA1, BRCA2, and Related Proteins in
Genome Integrity and Cancer. Annu. Rev. Cancer Biol. 2, 313–336.
Dhami, G.K., Liu, H., Galka, M., Voss, C., Wei, R., Muranko, K., Kaneko, T.,
Cregan, S.P., Li, L., and Li, S.S. (2013). Dynamic methylation of Numb by
Set8 regulates its binding to p53 and apoptosis. Mol. Cell 50, 565–576.
Dho, S.E., French, M.B., Woods, S.A., and McGlade, C.J. (1999). Character-
ization of four mammalian numb protein isoforms. Identification of cytoplasmic
and membrane-associated variants of the phosphotyrosine binding domain.
J. Biol. Chem. 274, 33097–33104.
Drost, J., Karthaus, W.R., Gao, D., Driehuis, E., Sawyers, C.L., Chen, Y., and
Clevers, H. (2016). Organoid culture systems for prostate epithelial and cancer
tissue. Nat. Protoc. 11, 347–358.
Duarte, A.A., Gogola, E., Sachs, N., Barazas, M., Annunziato, S., de Ruiter,
J.R., Velds, A., Blatter, S., Houthuijzen, J.M., van de Ven, M., et al. (2018).
BRCA-deficient mouse mammary tumor organoids to study cancer-drug
resistance. Nat. Methods 15, 134–140.
Escribano-Dı́az, C., Orthwein, A., Fradet-Turcotte, A., Xing, M., Young, J.T.,
, J., Cook, M.A., Rosebrock, A.P., Munro, M., Canny, M.D., et al.
Tkác
(2013). A cell cycle-dependent regulatory circuit composed of 53BP1-RIF1
and BRCA1-CtIP controls DNA repair pathway choice. Mol. Cell 49, 872–883.
Flores, A.N., McDermott, N., Meunier, A., and Marignol, L. (2014). NUMB inhi-
bition of NOTCH signalling as a therapeutic target in prostate cancer. Nat. Rev.
Urol. 11, 499–507.
Follenzi, A., Ailles, L.E., Bakovic, S., Geuna, M., and Naldini, L. (2000). Gene
transfer by lentiviral vectors is limited by nuclear translocation and rescued
by HIV-1 pol sequences. Nat. Genet. 25, 217–222.
Friedmann-Morvinski, D., and Verma, I.M. (2014). Dedifferentiation and re-
programming: origins of cancer stem cells. EMBO Rep. 15, 244–253.
Garcia-Higuera, I., Taniguchi, T., Ganesan, S., Meyn, M.S., Timmers, C.,
Hejna, J., Grompe, M., and D’Andrea, A.D. (2001). Interaction of the Fanconi
anemia proteins and BRCA1 in a common pathway. Mol. Cell 7, 249–262.
Gerloff, D.L., Woods, N.T., Farago, A.A., and Monteiro, A.N. (2012). BRCT do-
mains: A little more than kin, and less than kind. FEBS Lett. 586, 2711–2716.
Giraddi, R.R., Chung, C.Y., Heinz, R.E., Balcioglu, O., Novotny, M., Trejo, C.L.,
Dravis, C., Hagos, B.M., Mehrabad, E.M., Rodewald, L.W., et al. (2018). Sin-
gle-Cell Transcriptomes Distinguish Stem Cell State Changes and Lineage
Specification Programs in Early Mammary Gland Development. Cell Rep. 24,
1653–1666.
Gotzmann, J., Fischer, A.N., Zojer, M., Mikula, M., Proell, V., Huber, H., Jech-
linger, M., Waerner, T., Weith, A., Beug, H., and Mikulits, W. (2006). A crucial
function of PDGF in TGF-beta-mediated cancer progression of hepatocytes.
Oncogene 25, 3170–3185.
Guo, M., Jan, L.Y., and Jan, Y.N. (1996). Control of daughter cell fates during
asymmetric division: interaction of Numb and Notch. Neuron 17, 27–41.
Houghtaling, S., Newell, A., Akkari, Y., Taniguchi, T., Olson, S., and Grompe,
M. (2005). Fancd2 functions in a double strand break repair pathway that is
distinct from non-homologous end joining. Hum. Mol. Genet. 14, 3027–3033.
Huen, M.S., Sy, S.M., and Chen, J. (2010). BRCA1 and its toolbox for the main-
tenance of genome integrity. Nat. Rev. Mol. Cell Biol. 11, 138–148.
Jardé, T., Lloyd-Lewis, B., Thomas, M., Kendrick, H., Melchor, L., Bougaret,
L., Watson, P.D., Ewan, K., Smalley, M.J., and Dale, T.C. (2016). Wnt and Neu-
regulin1/ErbB signalling extends 3D culture of hormone responsive mammary
organoids. Nat. Commun. 7, 13207.
Jiang, X., Xing, H., Kim, T.M., Jung, Y., Huang, W., Yang, H.W., Song, S., Park,
P.J., Carroll, R.S., and Johnson, M.D. (2012). Numb regulates glioma stem cell
fate and growth by altering epidermal growth factor receptor and Skp1-Cullin-
F-box ubiquitin ligase activity. Stem Cells 30, 1313–1326.
Kim, H., and D’Andrea, A.D. (2012). Regulation of DNA cross-link repair by the
Fanconi anemia/BRCA pathway. Genes Dev. 26, 1393–1408.
Kim, H., Huang, J., and Chen, J. (2007). CCDC98 is a BRCA1-BRCT domain-
binding protein involved in the DNA damage response. Nat. Struct. Mol. Biol.
14, 710–715.
Cell 178, 135–151, June 27, 2019 149
Lim, E., Vaillant, F., Wu, D., Forrest, N.C., Pal, B., Hart, A.H., Asselin-Labat,
M.L., Gyorki, D.E., Ward, T., Partanen, A., et al.; kConFab (2009). Aberrant
luminal progenitors as the candidate target population for basal tumor devel-
opment in BRCA1 mutation carriers. Nat. Med. 15, 907–913.
Lim, E., Wu, D., Pal, B., Bouras, T., Asselin-Labat, M.L., Vaillant, F., Yagita, H.,
Lindeman, G.J., Smyth, G.K., and Visvader, J.E. (2010). Transcriptome ana-
lyses of mouse and human mammary cell subpopulations reveal multiple
conserved genes and pathways. Breast Cancer Res. 12, R21.
Liu, S., Ginestier, C., Charafe-Jauffret, E., Foco, H., Kleer, C.G., Merajver, S.D.,
Dontu, G., and Wicha, M.S. (2008). BRCA1 regulates human mammary stem/
progenitor cell fate. Proc. Natl. Acad. Sci. USA 105, 1680–1685.
Lukas, C., Savic, V., Bekker-Jensen, S., Doil, C., Neumann, B., Pedersen,
R.S., Grøfte, M., Chan, K.L., Hickson, I.D., Bartek, J., and Lukas, J. (2011).
53BP1 nuclear bodies form around DNA lesions generated by mitotic
transmission of chromosomes under replication stress. Nat. Cell Biol. 13,
243–253.
Madaras, L., Balint, N., Gyorffy, B., Tokes, A.M., Barshack, I., Yosepovich, A.,
Friedman, E., Paluch-Shimon, S., Zippel, D., Baghy, K., et al. (2016). BRCA
Mutation-Related and Claudin-Low Breast Cancer: Blood Relatives or Step-
sisters. Pathobiology 83, 1–12.
Manke, I.A., Lowery, D.M., Nguyen, A., and Yaffe, M.B. (2003). BRCT repeats
as phosphopeptide-binding modules involved in protein targeting. Science
302, 636–639.
McCarthy, A., Savage, K., Gabriel, A., Naceur, C., Reis-Filho, J.S., and Ash-
worth, A. (2007). A mouse model of basal-like breast carcinoma with meta-
plastic elements. J. Pathol. 211, 389–398.
Molyneux, G., Geyer, F.C., Magnay, F.A., McCarthy, A., Kendrick, H., Natrajan,
R., Mackay, A., Grigoriadis, A., Tutt, A., Ashworth, A., et al. (2010). BRCA1
basal-like breast cancers originate from luminal epithelial progenitors and
not from basal stem cells. Cell Stem Cell 7, 403–417.
Murina, O., von Aesch, C., Karakus, U., Ferretti, L.P., Bolck, H.A., Hänggi, K.,
and Sartori, A.A. (2014). FANCD2 and CtIP cooperate to repair DNA interstrand
crosslinks. Cell Rep. 7, 1030–1038.
Nakatani, Y., and Ogryzko, V. (2003). Immunoaffinity purification of mamma-
lian protein complexes. Methods Enzymol. 370, 430–444.
Nakshatri, H., Anjanappa, M., and Bhat-Nakshatri, P. (2015). Ethnicity-Depen-
dent and -Independent Heterogeneity in Healthy Normal Breast Hierarchy Im-
pacts Tumor Characterization. Sci. Rep. 5, 13526.
Orthwein, A., Noordermeer, S.M., Wilson, M.D., Landry, S., Enchev, R.I.,
Sherker, A., Munro, M., Pinder, J., Salsman, J., Dellaire, G., et al. (2015). A
mechanism for the suppression of homologous recombination in G1 cells. Na-
ture 528, 422–426.
Park, S.Y., Lee, H.E., Li, H., Shipitsin, M., Gelman, R., and Polyak, K. (2010).
Heterogeneity for stem cell-related markers according to tumor subtype and
histologic stage in breast cancer. Clin. Cancer Res. 16, 876–887.
Pfefferle, A.D., Herschkowitz, J.I., Usary, J., Harrell, J.C., Spike, B.T., Adams,
J.R., Torres-Arzayus, M.I., Brown, M., Egan, S.E., Wahl, G.M., et al. (2013).
Transcriptomic classification of genetically engineered mouse models of
breast cancer identifies human subtype counterparts. Genome Biol. 14, R125.
Proia, T.A., Keller, P.J., Gupta, P.B., Klebba, I., Jones, A.D., Sedic, M., Gil-
more, H., Tung, N., Naber, S.P., Schnitt, S., et al. (2011). Genetic predisposi-
tion directs breast cancer phenotype by dictating progenitor cell fate. Cell
Stem Cell 8, 149–163.
Sachs, N., de Ligt, J., Kopper, O., Gogola, E., Bounova, G., Weeber, F.,
Balgobind, A.V., Wind, K., Gracanin, A., Begthel, H., et al. (2018). A Living
Biobank of Breast Cancer Organoids Captures Disease Heterogeneity. Cell
172, 373–386.
Sau, A., Lau, R., Cabrita, M.A., Nolan, E., Crooks, P.A., Visvader, J.E., and
Pratt, M.A. (2016). Persistent Activation of NF-kB in BRCA1-Deficient Mam-
mary Progenitors Drives Aberrant Proliferation and Accumulation of DNA Dam-
age. Cell Stem Cell 19, 52–65.
150 Cell 178, 135–151, June 27, 2019
Schwank, G., Andersson-Rolf, A., Koo, B.K., Sasaki, N., and Clevers, H.
(2013). Generation of BAC transgenic epithelial organoids. PLoS ONE 8,
e76871.
Scully, R., Chen, J., Ochs, R.L., Keegan, K., Hoekstra, M., Feunteun, J.,
and Livingston, D.M. (1997). Dynamic changes of BRCA1 subnuclear loca-
tion and phosphorylation state are initiated by DNA damage. Cell 90,
425–435.
Shalem, O., Sanjana, N.E., Hartenian, E., Shi, X., Scott, D.A., Mikkelson, T.,
Heckl, D., Ebert, B.L., Root, D.E., Doench, J.G., and Zhang, F. (2014).
Genome-scale CRISPR-Cas9 knockout screening in human cells. Science
343, 84–87.
Silver, D.P., and Livingston, D.M. (2012). Mechanisms of BRCA1 tumor sup-
pression. Cancer Discov. 2, 679–684.
Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert, B.L., Gil-
lette, M.A., Paulovich, A., Pomeroy, S.L., Golub, T.R., Lander, E.S., and Me-
sirov, J.P. (2005). Gene set enrichment analysis: a knowledge-based approach
for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA
102, 15545–15550.
Tao, L., van Bragt, M.P., Laudadio, E., and Li, Z. (2014). Lineage tracing of
mammary epithelial cells using cell-type-specific cre-expressing adenovi-
ruses. Stem Cell Reports 2, 770–779.
Tao, L., Xiang, D., Xie, Y., Bronson, R.T., and Li, Z. (2017). Induced p53 loss in
mouse luminal cells causes clonal expansion and development of mammary
tumours. Nat. Commun. 8, 14431.
Tiwari, N., Tiwari, V.K., Waldmeier, L., Balwierz, P.J., Arnold, P., Pachkov, M.,
Meyer-Schaller, N., Schübeler, D., van Nimwegen, E., and Christofori, G.
(2013). Sox4 is a master regulator of epithelial-mesenchymal transition by con-
trolling Ezh2 expression and epigenetic reprogramming. Cancer Cell 23,
768–783.
Tosoni, D., Zecchini, S., Coazzoli, M., Colaluca, I., Mazzarol, G., Rubio, A.,
Caccia, M., Villa, E., Zilian, O., Di Fiore, P.P., and Pece, S. (2015). The
Numb/p53 circuitry couples replicative self-renewal and tumor suppression
in mammary epithelial cells. J. Cell Biol. 211, 845–862.
Tremblay, C.S., Huang, F.F., Habi, O., Huard, C.C., Godin, C., Lévesque, G.,
and Carreau, M. (2008). HES1 is a novel interactor of the Fanconi anemia
core complex. Blood 112, 2062–2070.
Uemura, T., Shepherd, S., Ackerman, L., Jan, L.Y., and Jan, Y.N. (1989). numb,
a gene required in determination of cell fate during sensory organ formation in
Drosophila embryos. Cell 58, 349–360.
Unno, J., Itaya, A., Taoka, M., Sato, K., Tomida, J., Sakai, W., Sugasawa, K.,
Ishiai, M., Ikura, T., Isobe, T., et al. (2014). FANCD2 binds CtIP and regulates
DNA-end resection during DNA interstrand crosslink repair. Cell Rep. 7,
1039–1047.
Van Keymeulen, A., Lee, M.Y., Ousset, M., Brohée, S., Rorive, S., Giraddi,
R.R., Wuidart, A., Bouvencourt, G., Dubois, C., Salmon, I., et al. (2015). Reac-
tivation of multipotency by oncogenic PIK3CA induces breast tumour hetero-
geneity. Nature 525, 119–123.
Verdi, J.M., Bashirullah, A., Goldhawk, D.E., Kubu, C.J., Jamali, M., Meakin,
S.O., and Lipshitz, H.D. (1999). Distinct human NUMB isoforms regulate differ-
entiation vs. proliferation in the neuronal lineage. Proc. Natl. Acad. Sci. USA 96,
10472–10476.
Visvader, J.E. (2011). Cells of origin in cancer. Nature 469, 314–322.
Visvader, J.E., and Stingl, J. (2014). Mammary stem cells and the differentia-
tion hierarchy: current status and perspectives. Genes Dev. 28, 1143–1158.
Wang, B., Matsuoka, S., Ballif, B.A., Zhang, D., Smogorzewska, A., Gygi, S.P.,
and Elledge, S.J. (2007). Abraxas and RAP80 form a BRCA1 protein complex
required for the DNA damage response. Science 316, 1194–1198.
Wang, H., Bierie, B., Li, A.G., Pathania, S., Toomire, K., Dimitrov, S.D., Liu, B.,
Gelman, R., Giobbie-Hurder, A., Feunteun, J., et al. (2016). BRCA1/FANCD2/
BRG1-Driven DNA Repair Stabilizes the Differentiation State of Human Mam-
mary Epithelial Cells. Mol. Cell 63, 277–292.
Wu, Q., Jubb, H., and Blundell, T.L. (2015). Phosphopeptide interactions with
BRCA1 BRCT domains: More than just a motif. Prog. Biophys. Mol. Biol. 117,
143–148.
Xia, B., Sheng, Q., Nakanishi, K., Ohashi, A., Wu, J., Christ, N., Liu, X., Jasin,
M., Couch, F.J., and Livingston, D.M. (2006). Control of BRCA2 cellular and
clinical functions by a nuclear partner, PALB2. Mol. Cell 22, 719–729.
Xu, X., Wagner, K.U., Larson, D., Weaver, Z., Li, C., Ried, T., Hennighausen, L.,
Wynshaw-Boris, A., and Deng, C.X. (1999). Conditional mutation of Brca1 in
mammary epithelial cells results in blunted ductal morphogenesis and tumour
formation. Nat. Genet. 22, 37–43.
Yu, X., and Chen, J. (2004). DNA damage-induced cell cycle
checkpoint control requires CtIP, a phosphorylation-dependent
binding partner of BRCA1 C-terminal domains. Mol. Cell. Biol. 24,
9478–9486.
Yu, X., Chini, C.C., He, M., Mer, G., and Chen, J. (2003). The BRCT domain is a
phospho-protein binding domain. Science 302, 639–642.
Yu, X., Fu, S., Lai, M., Baer, R., and Chen, J. (2006). BRCA1 ubiquiti-
nates its phosphorylation-dependent binding partner CtIP. Genes Dev.
20, 1721–1726.
Yu, M., Smolen, G.A., Zhang, J., Wittner, B., Schott, B.J., Brachtel, E., Ram-
aswamy, S., Maheswaran, S., and Haber, D.A. (2009). A developmentally regu-
lated inducer of EMT, LBX1, contributes to breast cancer progression. Genes
Dev. 23, 1737–1742.
Cell 178, 135–151, June 27, 2019 151
STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
BRCA1 (D9) Santa Cruz Cat#SC-6954; RRID: AB_626761
BRCA1 Millipore Cat#07-434; RRID: AB_2275035
NUMB Cell Signaling Cat#2761; RRID: AB_2267391
NUMB Novus Biologicals Cat#NB500-178; RRID: AB_922130
NUMB Bethyl labs Cat#A301-715A; RRID: AB_1211245
NUMB Bethyl labs Cat#A301-714A; RRID: AB_1211242
53BP1 Fisher Scientific Cat#BDB612522; RRID: AB_2206766
53BP1 Santa Cruz Cat#SC-22760; RRID: AB_2256326
Cyclin A Fisher Scientific Cat#BDB611268; RRID: AB_398796
HA Covance Cat#MMS-101P; RRID: AB_2314672
Flag Sigma Aldrich Cat#F1804(M2); RRID: AB_262044
Myc Millipore Cat#05-419; RRID: AB_309725
Keratin 5 (K5) Covance Cat#PRB-160P: RRID: AB_291581
Keratin 14 (K14) Covance Cat#PRB155P; RRID: AB_292096
Keratin 14 (K14) Covance Cat#SIG-3476; RRID: AB_107180
Keratin 8 (K8) Covance Cat#MMS-162P; RRID: AB-291334
GFP Abcam Cat#ab290; RRID: AB_303395
GFP Abcam Cat#ab6673; RRID: AB_305643
b-Actin Sigma Aldrich Cat#A5441; RRID: AB_476744
Zeb1 Santa Cruz Cat#SC-25388; RRID: AB_2217979
E-cadherin BD-Transductions Cat#610182; RRID: AB_397581
Vimentin (VIM) Santa Cruz Cat#SC-5565; RRID: AB_793999
HES1 Cell Signaling Cat#D6P2U; RRID: AB_2728766
HES1 Santa Cruz Cat#SC-166410; RRID: AB_2117960
DNp63 Santa Cruz Cat#SC-8431; RRID: AB_628091
FANCD2 (polyclonal antibody, IF) Novus Cat#NB100-182; RRID: AB_10002867
FANCD2 Bethyl labs Cat#A302-174A; RRID: AB_1659803
FANCD2 (monoclonal antibody, WB) Santa Cruz Cat#sc20022; RRID: AB_2278211
CtIP Bethyl labs Cat#A300-488A; RRID: AB_2175262
BRG1 Bethyl labs Cat#A300-813A; RRID: AB_2191850
Tubulin Sigma Aldrich Cat#T5168: RRID: AB_477579
Histone 3 Cell Signaling Cat#D1H2; RRID: AB_10544537
PALB2 Bethyl labs Cat#A301-246A; RRID: AB_890607
BRG1 Santa Cruz Cat#SC-17796; RRID: AB_626726
BRCA1 (anti-mouse) homemade NA
CD24-FITC BD Cat#555427; RRID: AB_395821
CD44-PE BD Cat#555479; RRID: AB_395871
CD24-PE eBiosciences Cat#12-0242-83: RRID: AB_465603
CD29-APC eBiosciences Cat#12-0291-82; RRID: AB_763478
biotinylated CD31 eBiosciences Cat#13-0311-85; RRID: AB_466421
biotinylated CD45 eBiosciences Cat#17-0495-82: RRID: AB_2016694
biotinylated TER119 eBiosciences Cat#13-5921-85: RRID: AB_466798
(Continued on next page)

e1 Cell 178, 135–151.e1–e8, June 27, 2019

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
Bacterial and Virus Strains
Max efficiency DH5a competent cells Life Technologies Cat#18258012
Adenovirus K8-Cre (Ad-K8-Cre) University of Iowa NA
Chemicals, Peptides, and Recombinant Proteins
B27 Thermo Fisher Cat#17504044
A83-01 Tocris Bioscience Cat#2939
EGF PeproTech Cat#AF-100-15
Nrg1 R&D Cat#396-HB
Y-27632 (ROCK inhibitor) Sigma Aldrich Cat#Y0503
Cisplatin Sigma Aldrich Cat#P4394-100mg
Etoposide Sigma Aldrich Cat#E1383-100mg
Noggin PeproTech Cat#120-10C
R-spondin1 Peprotech Cat#120-38
TrypLE Thermo Fisher 12604-013
Critical Commercial Assays
CometAssay kit TREVIGEN Cat#4250-050-K
QuickChange II Site-Directed Mutagenesis Kit Agilent Cat#200523
Deposited Data
Gene expression data GEO database GSE114787, GSE126761,
GSE130453
Experimental Models: Cell Lines
HMEC Yu et al., 2009 NA
MCF10A ATCC Cat#CRL-10317
MCF7 ATCC Cat#HTB-22
293T ATCC Cat#CRL-3216
U2OS ATCC Cat#HTB-96
MDA-MB231 ATCC Cat#HTB-26
Experimental Models: Organisms/Strains
B6.129P2-Trp53tm1Brn/J (Trp53L) The Jackson Laboratory Stock No#008462
Brca1tm1Aash/J (Brca1L) The Jackson Laboratory Stock No#017835
B6.129X1-Gt(ROSA)26Sortm1(EYFP)Cos/J (R26Y) The Jackson Laboratory Stock No#006148
Oligonucleotides
gNumb-1: CGTGGCCGAGGTACTTAACT This paper NA
gNumb-2: GATGAAGAAGGAGTCCGCAC This paper NA
gBrca1-1: GGCGTCGATCATCCAGAGCG This paper NA
gBrca1-2: GCTACCGGAACCGTGTCAGA This paper NA
gHes1-1: GTCCGGTGTCGTGTTGACAC This paper NA
gHes1-2: GAGGCCGTCTTTGGTTTGTC This paper NA
gPlant: GGTTCGTACGTACACTGTTC This paper NA
gROSA26: GACTCCAGTCTTTCTAGAAGA This paper NA
siBRCA1:50 UAUAAGACCUCUGGCAUGAAUUU30 This paper NA
Si53BP1: GAGAGCAGAUGAUCCUUUA This paper NA
siHES1: 50 GAGAAAAGACGAAGAGCAAUU30 This paper NA
siNUMB(both):50 CAGACUUUGUCUCCUGAUUUU30 This paper NA
siNumb (long isoform, exon 9, PRR region): Dharmacon NA
50 UAGCAAUGCCUGUGCGUGAUU30
siNumb (short isoform specific): GAAAGCUACUGGAAAGAAAUU Dharmacon NA
(Continued on next page)

Cell 178, 135–151.e1–e8, June 27, 2019 e2

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
shNUMB-A: CCGGGCATCACCTTTCCAAGGGAATCTCGAGATTCCC Sigma-Aldrich Cat#TRCN0000007227
TTGGAAAGGTGATGCTTTTT
shNUMB-B: CCGGGCAGCTTTCAATGGTGTAGATCTCGAGATCT Sigma-Aldrich Cat#TRCN0000007225
ACACCATTGAAAGCTGCTTTTT
shHES1: CCGGTGACTGACCATGCACTATATTCTCGAGAATATAGT Sigma-Aldrich Cat#TRCN0000229656
GCATGGTCAGTCATTTTTG
Gapdh: forward: 50 -GGTGAAGGTCGGTGTGAACG-30 ; reverse: This paper NA
50 -CTCGCTCCTGGAAGATGGTG-30
Trp53: forward: 50 - GCGTAAACGCTTCGAGATGTT 30 ; reverse: This paper NA
50 - TTTTTATGGCGGGAAGTAGACTG 30
Brca1: forward: 50 -CTGCCGTCCAAATTCAAGAAGT-30 ; reverse: This paper NA
50 -CTTGTGCTTCCCTGTAGGCT-30
Krt5: forward:50 -TGGCGATGACCTTCGAAACA-30 ; reverse: This paper NA
50 -GGTTGGCACACTGCTTCTTG-30
Krt14: forward: 50 -CGGACCAAGTTTGAGACGGA-30 ; reverse: This paper NA
50 -GCCACCTCCTCGTGGTTC-30
Trp63 (DNp63): forward:50 -GGAAAACAATGCCCAGACTC-30 ; This paper NA
reverse: 50 -GTGGAATACGTCCAGGTGGC-30
Vim: forward:50 -CGGCTGCGAGAGAAATTGC 30 ; reverse: This paper NA
50 - CCACTTTCCGTTCAAGGTCAAG 30
Zeb1: forward:50 -GCTGGCAAGACAACGTGAAAG-30 ; reverse: This paper NA
50 - GCCTCAGGATAAATGACGGC 30
Tcf4: forward:50 -TGAGGGGGAAAATGAGGTGC-30 ; reverse: This paper NA
50 -GAGGCGAAAACATCGCACTG-30
Hes1: forward:50 -AGGCGGACATTCTGGAAATG-30 ; reverse: This paper NA
50 - CGGTACTTCCCCAGCACACTT 30
hNumb (total)-forward:50 -CCCCAGACAGGAACTTTGATAG-30 This paper NA
reverse:50 -GCTCTAAACAGGCTGCAAAAG-30
hNumb (long, Exon9) This paper NA
forward: 50 -CTCTAGCACCCGTAGCAATG-30
reverse: 50 -GGCTGCAATTTCCTTGTTAGC-30
hNumb (short, at junction of exon 8+exon10) This paper NA
forward: 50 -CTTCCAAGGGACCGAGTG-30
reverse: 50 -AGGGAGTACGTCTATGACCG-30
S361A forward: This paper NA
50 -CAGTGGTGGCACCACAAGCTCCTACCTTCCAAG-30 reverse:
50 -CTTGGAAGGTAGGAGCTTGTGGTGCCACCACTG-30
S634A forward: This paper NA
50 -CAGCGTACTAATCCCGCCCCTACCAACCCTTTC-30 reverse:
50 -GAAAGGGTTGGTAGG GGCGGGATTAGTACGCTG-30
Recombinant DNA
lentiCRISPR-v2 Addgene Cat#52961
PHAGE-CMV-dsRed-UBC-GFP-NUMB Bu et al., 2013 NA
Numb4-GFP Jiang et al., 2012 NA
POZ-FH-N Nakatani and Ogryzko, 2003 NA
Software and Algorithms
ImageJ NIH NA
Other
glutathione-Sepharose beads GE healthcare Cat#17075601
RNeasy Micro Kit QIAGEN Cat# 74004
Chromium Single Cell 30 Library and Gel Bead Kit v2, 4 rxns 10x Genomics Cat# 120267
Chromium Single Cell A Chip Kit, 16 rxns 10x Genomics Cat# 1000009
Chromium i7 Multiplex Kit, 96 rxns 10x Genomics Cat# 120262

e3 Cell 178, 135–151.e1–e8, June 27, 2019

LEAD CONTACT AND MATERIALS AVAILABILITY

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, David M.
Livingston (david_livingston@dfci.harvard.edu).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Cell lines and Culture conditions

293T, MCF7, MDA-MB231and U2OS cells were grown in 10% FBS DMEM medium at 37 C in a 10% CO2-containing atmosphere.
Telomerase-immortalized human mammary epithelial cells (MECs) including CD44low and CD44high MECs and MCF10A cells were
maintained in MEGM medium (Lonza). The source of cell lines is listed in the key resource tables. All cells were cultivated in a humid-
ified incubator. All cell lines and primary cells are from female origin.

Mouse models
Trp53L (B6.129P2-Trp53tm1Brn/J, Stock No: 008462), Brca1L (STOCK Brca1tm1Aash/J, Stock No: 017835), R26Y (B6.129X1-Gt(ROSA)
26Sortm1(EYFP)Cos/J, Stock No: 006148) mice were obtained from The Jackson Laboratory. To target luminal MECs in Trp53L/L;R26Y,
Trp53L/L;Brca1L/L;R26Y, or R26Y-only adult female mice (2-3 months of age), animals were anaesthetized; and Ad-K8-Cre adeno-
virus [diluted in injection medium (DMEM supplemented with 0.1% Bromophenol blue and 0.01 M CaCl2)] was introduced into ducts
of the #4 inguinal mammary gland (MG) via intraductal injection (Tao et al., 2014). Female mice were then monitored weekly for any
sign of mammary tumor development. Once tumors were detected via palpation or visual inspection, animals were monitored 2–3
times per week for subsequent tumor growth. All animal experiments were approved by the Institutional Animal Care and Use Com-
mittee (IACUC) of the Brigham and Women’s Hospital.

METHOD DETAILS

Immunoblotting and Immunoprecipitation

Immunoblotting was carried out using standard methods. In brief, cells were lysed for 2 h on ice in NETN-250 lysis buffer
(150mM NaCl, 20mM Tris-HCl pH 7.5, 0.5mM EDTA, 0.5% NP40 and 10% Glycerol) with proteinase inhibitors (Roche), and the lysate
was cleared of residual cells by centrifugation. 20-30 mg of extract were electrophoresed in each lane of a 4%–12% Bis-Tris gel
(Invitrogen) using MOPS buffer. Electrophoresed proteins were transferred to nitrocellulose membranes at 350 mA for 3 h at 4 C.
Membranes were blocked in 3% non-fat milk in PBS + 0.2% Tween 20 (PBST) and incubated overnight at 4 C in primary antibody
diluted in blocking solution. After a brief wash with PBST, the membranes were incubated with Horseradish peroxidase (HRP)-con-
jugated secondary antibodies (GE) for 2 h at room temperature. The membranes were developed by ECL chemiluminescence
(Thermo fisher). Primary antibodies are listed in the key resource table.
To generate different subcellular fractions, cells were lysed for 5 min on ice in NETN-100 lysis buffer (100mM NaCl) and centrifuged
at 8,000rpm for 5 min. The resulting pellets were suspended in the NETN 400 (400 mM NaCl) for 1 h on ice and centrifuged at 13,200
for 10 min. The insoluble chromatin pellet was then suspended in 0.2N HCL for 15 min on ice and neutralized with an identical volume
of 1M Tris-HCl (pH = 8) and labeled p400. After clearance by centrifugation, the resulting fractions (S100/S400/P400) were subjected
to immunoblotting assays.
Immunoprecipitation was performed with NETN 250-based (250mM NaCl) soluble extracts, unless otherwise specified. To probe
the BRCA1 and NUMB interaction, 293T cells were transiently transfected with HA-BRCA1 or myc-BRCA1 or Flag-NUMB plasmids
using Lipofectamine 2000 (Invitrogen). 72 h after transfection, cells were collected and lysed with NETN 250. Cellular extracts were
then incubated with the indicated antibodies and protein A-coupled Sepharose beads (GE) at 4 C overnight with continuous rocking.
The resulting immunobeads were washed 4 times in NETN 100 buffer and suspended in SDS-Laemmli sample buffer (BIO-RAD) and
analyzed by immunoblotting as described above.
To analyze endogenous BRCA1/NUMB interactions, 239T or MCF7 cell extracts were incubated with BRCA1 antibody (D9) or
NUMB antibody (Bethyl lab) and the resulting complex were analyzed by immunoblotting.
To analyze the subunit interdependence of the BRCA1/HES1/NUMB/FANCD2/CTIP complex formation, 293T cells were trans-
fected with both myc-BRCA1 and the indicated siRNA species. Transfected cells were collected after 72 h, extracted, and the ex-
tracts incubated with myc antibody (9E10) at 4 C overnight. myc-BRCA1 associated protein complexes were then analyzed by
immunoblotting.
The antibodies used in these experiments were listed in the key resource tables.

GST –BRCA1 Fragment Binding experiments

GST-BRCA1 fragments (#1-#6) have been described (Chen et al., 1998; Scully et al., 1997). These GST-BRCA1 fusion proteins
were synthesized in E.Coli and purified on glutathione-Sepharose beads (GE healthcare 17075601). Cell extract from 293T cells

Cell 178, 135–151.e1–e8, June 27, 2019 e4

was incubated with bead-bound GST fusion proteins or GST beads only. The bound complexes were then analyzed by SDS gel elec-
trophoresis and immunoblotting, as described above. Coomassie blue staining that revealed the relative abundance of each GST
fusion protein is indicated above each arrow.

Mammary gland cell preparation and flow cytometry

Inguinal MGs injected with Ad-K8-Cre were dissected, minced, and incubated for 1–1.5 h in digestion medium (DMEM/F12 with 2%
Penicillin/ Streptomycin, 0.1 mg ml1 Gentamicin, 0.6% Nystatin, 2 mg ml1 Collagenase A, 0.096 mg ml1 Hyaluronidase) at 37  C
with continuous shaking. After digestion, the cells/tissues were treated sequentially with 0.25% trypsin/EDTA (37  C, 2 min),
5 mg ml1 dispase with DNaseI (0.1 mg ml1, Sigma, St Louis, MO; 37  C, 5 min), and cold red blood cell (RBC) lysis buffer (on
ice, 2–3 min). Between each treatment step, cells/tissues were washed with 1 3 PBS containing 5% FCS. After treatment with
RBC lysis buffer, cells/tissues were filtered through a 40 mm cell strainer and washed with 1 3 PBS/5% FCS, to obtain a single-
cell suspension (Tao et al., 2017). The resulting MECs are depleted with the CD45, CD31 and TER119 lineage markers and only
YFP positive cells were used for analysis of CD24 and CD29. Flow cytometric (FACS) analysis and cell sorting were performed
with a FACSAria sorter (BD Biosciences). Antibodies used in FACS analysis and cell sorting were purchased from eBiosciences
(San Diego, CA) and included, CD24-PE (clone M1/69, 12-0242-83; 1:250), CD29-APC (clone eBioHMb1-1, 12-0291-82; 1:250),
and biotinylated lineage (Lin) markers: CD31 (clone 390, 13-0311-85; 1:100), CD45 (clone 30-F11, 17-0495-82; 1:100) and
TER119 (clone Ter-119, 13-5921-85; 1:100).

Mammary organoid culture and manipulation

The long-term organoid culture system used in this study was developed with minor optimization based on the original formulation
from (Drost et al., 2016) and adapted from (Jardé et al., 2016), and (Sachs et al., 2018), and (Duarte et al., 2018). Sorted YFP+ MECs
were embedded in 15-20 mL Matrigel (Corning, 356231) in a 48-well plate, allowed to solidify for 5-10 min, and then overlaid with
DMEM/F12 advance media, supplemented with HEPES (1:100, GIBCOTM, 15630-080), GlutaMAX (1:100, GIBCOTM, 35050-061),
B27 (1:50, Thermo Fisher, 17504044), 100 ng/mL A83-01 (Tocris Bioscience, 2939), 50 ng/mL EGF (PeproTech, AF-100-15),
100 ng/mL Noggin (PeproTech, 120-10C), 500 ng/mL commercial R-spondin1 (Peprotech, 120-38) or conditioned R-spondin1 me-
dium from RSPO cells (Cultrex, 3700-100-01), 100 ng/mL Nrg1 (R&D, 396-HB), 10 mM Y-27632 (ROCK inhibitor, Sigma Aldrich,
Y0503) which is only necessary when organoids are first prepared, thawed, or when organoids are dissociated to single cells. The
organoid culture medium including the supplementaries described above will be referred to as ‘‘full medium’’ for the subsequent
work. The procedure for organoid transfection was developed with modifications mainly based on the protocol described by
(Schwank et al., 2013). Briefly, following one day of culture in full medium, as described above, organoids were infected with lentivirus
for 2-3 days before selection was initiated in full medium containing puromycin (1 mg/mL) for one week. Stably infected and edited
organoid cells were expanded in full medium.
For drug treatment of organoids, cisplatin (final concentration = 0.2 mM, Sigma) and etoposide (final concentration = 0.1 mM, Sigma)
were added to relevant full organoid culture medium for 7 days. Drug-treated organoids were then digested for single cell suspen-
sions by TrypLE (Thermo Fisher Scientific, 12604-013) for 15 min in the cell culture incubator. Single organoid cells were re-plated in
a 48-well plate and cultured in full organoid medium without cisplatin or etoposide treatment for another 14 days. At this point, orga-
noids were digested and collected for RNA extraction, or single organoid cells were cultured in an 8-well chamber slide for at least
24 h followed by co-immunofluorescent staining for K5, 53BP1 and DAPI. In all these experiments, 250 ml of full organoid culture
medium was added per well, and these organoids were maintained in a 37  C humidified atmosphere under 5% CO2.

Immunofluorescence staining
Prior to embedding organoids in paraffin, organoids suspended in Matrigel were entirely embedded in Specimen Processing
HistoGel (Thermo Fisher, HG-4000-012), followed by fixation in 4% paraformaldehyde (PFA, Fisher Scientific, Hampton, NH) for
2 h and then overnight in 70% ethanol at room temperature. Immunofluorescent (IF) staining was performed on sections from
MGs, mammary tumors and organoids. The IF staining was performed as described (Tao et al., 2017). Primary antibodies used
included: anti-GFP (ab290, 1:500 or ab6673, 1:200, Abcam, Cambridge, UK), anti-Keratin 14 (K14) (PRB-155P, 1:400 or SIG-
3476, 1:200, Covance, Dedham, MA), anti-Keratin 5 (K5) (PRB-160P, 1:500, Covance), anti-Keratin 8 (K8) (MMS-162P, 1:200, Cova-
nce), anti-53BP-1 (BD 612522, 1:1000). For IF staining, the secondary antibodies used were: goat anti-mouse IgG conjugated with
AF488 (A11029, 1:250) or with AF647 (A31571, 1:250), donkey anti-goat IgG conjugated with AF488 (Ab150129, 1:250), chicken anti-
goat IgG conjugated with AF647 (A21469, 1:250), goat anti-rabbit IgG conjugated with AF488 (A11008, 1:250) or with AF594 (A11037,
1:250), and goat anti-chicken IgG conjugated with AF594 (A11042, 1:250) or with AF488 (A11039, 1:250) (all from Molecular Probes,
Eugene, OR). Slides were counterstained with DAPI (1 mg/mL).
To stain mouse BRCA1 in the CRISPR/Cas9-affected organoids, organoids stably edited with gPlant/gRosa26/gBrca1/gNumb/ or
gHes1 were first collected and resuspended as single cells and then seeded onto coverslips with overnight incubation. Cells were
then fixed with 4% paraformaldehyde for 15 min, washed with PBS 3 times and permeablized with cold 0.5% Triton X-100 for
5 min. Cells were incubated with primary antibodies for 3 h and then with secondary antibodies for 1 h, both at room
temperature. After washing with PBST (PBS containing 0.5% Tween 20), cells were then mounted with medium containing
4’,6-diamidino-2-phenylindole (DAPI, Vector lab H1500) and sealed with clear nail polish.

e5 Cell 178, 135–151.e1–e8, June 27, 2019

Confocal microscope analysis
Confocal images were captured as z stacks (0.265mm thickness) using a Nikon Ti inverted microscope equipped with a CSU-X1 spin-
ning disk head (Yokogawa), 100x oil objective (NA1.4; Nikon), and an iXon DU-897 EM-CCD camera (Andor). Confocal images were
captured using Andor iQ2 software. HME cells for confocal imaging were cultured asynchronously on 1.5mm cover glasses at 37 C/
5% CO2, fixed with 4% paraformaldehyde and permeabilized with PBS+0.5% Triton X-100. Cells were stained with mouse mono-
clonal a-BRCA1 antibody at 1:500 dilution in 1% BSA/PBS (sc-6954, Santa Cruz Biotechnology) and rabbit polyclonal a-NUMB anti-
body at 1:50 dilution in 1% BSA/PBS (A301-715A, Bethyl Laboratories) Secondary antibodies were FITC AffiniPure goat anti-rabbit
(1:200 in PBS; Jackson ImmunoResearch Laboratories, 111-095-003) and Rhodamine Red-X AffiniPure goat anti-mouse (1:400 in
PBS; Jackson ImmunoReseach Laboratories, 115-295-146). Image analysis was performed using the Fiji processing software pack-
age of ImageJ.

Soft Agar Assay

Bottom layers were prepared in six well dishes with 0.6% noble agar (Difco 214220) in DMEM. HMECs were plated in a top layer
composed of 0.3% agar in MEGM at a density of 12,500 cells per well. Each well was fed weekly with 1ml of MEGM. After three
weeks, the media was aspirated and plates were fixed in a solution of 5% methanol and 5% acetic acid for 20-30 min, then stained
overnight with 0.005% crystal violet in 10% ethanol. Crystal violet solution was aspirated prior to imaging and counting colonies.
Counts represent the average of three wells.

Clonogenic and Cell Growth Assays

To measure cell growth, Cells were transfected with siLuc/siBRCA1/siNumb/ or siHes1 for 48 h. 300 cells/well were seeded in six-
well plastic plates and treated with indicated drugs and cultivated for 10 days. Cells were fixed and visualized with crystal violet.
To rescue NUMB depletion-associated ICL drug sensitivity, siRNA-resistant NUMB cDNA (WT or 2A) or empty vector was stably
introduced into MCF10A cells by retrovirus infection followed by puromycin-based selection. The stable MCF10A-vector and
MCF10A-NUMB (WT or 2A, both siRNA-resistant) -transduced cells were then transfected with siNUMB to deplete endogenous
NUMB proteins and plated in 96 well plates (1,000 cells/well). These cells were exposed overnight to increasing concentrations of
cisplatin. We measured the relative growth of NUMB-WT or NUMB-2A expressing MCF10A after siNUMB depletion by CellTiter-
Glo Luminescent Cell Viability Assay (Promega) following the manufacture instructions.

CRISPR/Cas9 lentiviral vectors

The lentiCRISPR-v2 plasmid was from Addgene (No. 52961, a gift from Dr, Feng Zhang). Two individual guide RNAs (gRNAs) target-
ing Numb or Brca1 or Hes1 were designed based on http://crispr.mit.edu (with a high quality score of above 90). LentiGuide vectors
constructed with gRNAs targeting the mouse Rosa26 region of mouse (gRosa26) and targeting a plant region (gPlant) were kind gifts
from Prof. Richard Mass [Division of Genetics, Brigham and Women’s Hospital (BWH)]. Sequences for all of these gRNAs are listed in
the key resource table. Cloning of gRNAs in lentiCRISPR-v2 plasmid was performed as described (Shalem et al., 2014). All vectors
were validated by Sanger sequencing. We produced concentrated lentiviral stocks, pseudotyped with the VSV-G envelope protein,
by transient transfection of their corresponding plasmids into 293T cells as previously described (Follenzi et al., 2000).

Plasmid Construction
The NUMB long isoform was amplified from the PHAGE-CMV-dsRed-UBC-GFP-NUMB plasmid provided by Pengcheng Bu
(Bu et al., 2013) and the NUMB short isoform was amplified from the Numb4-GFP plasmid provided by Dr. Hongyan Xing
(Jiang et al., 2012). The amplified PCR products were then cloned into a vector with 3XHA or 3xFlag or an HA/Flag double tag.
The NUMB S361A /S634A mutant was generated with the quickchange II site-directed mutagenesis Kit (Agilent 200523) followed
by the manual instruction with following primers. All plasmids were sequenced to confirm the mutations.

siRNA and shRNA

All siRNAs were synthesized at Dharmacon Inc, and the sequences are listed in the key resource table. CD44low MECs were plated at
50% confluence, and the siRNAs were transfected with RNA MAX(Invitrogen) following the Manual’s instructions.
To test the effect of siRNA transfection on BRCA1/NUMB/53BP1/Cyclin A staining, cells were transfected with the indicated
siRNAs for 48 h, plated on coverslips, and allowed to incubate overnight. Cells were then fixed with 4% PFA, permeabilized with
0.5% Triton, and then incubated with antibodies at room temperature.
To test the effect of overexpression of short NUMB on differentiation, CD44low MECs stably infected with empty vector or short
NUMB cDNA retrovirus were then transfected with SiLuc (Luc: luciferase) or SiNUMB. SiNUMB targeting its 30 UTR depleted both
endogenous short and long NUMB isoforms but had no effect on short NUMB cDNA.
ShRNAs were delivered by lentivirus infection. Briefly, the shRNA and packaging plasmids (VSV-G and D8.9) were cotransfected
into 293T cells using Lipfectomine 2000. Viral particles were collected at 48 and 72 h after transfection. The supernatants were used
for infection after filtration through 0.45 mM syringe filters. Infected cells were selected with puromycin (2 mg/mL) and maintained in

Cell 178, 135–151.e1–e8, June 27, 2019 e6

puromycin-containing MEGM. To produce retroviruses expressing HA/Flag-tagged NUMB, viral vectors were cotransfected with
pMD-MLV and pMD-G using Lipfectomine 2000 in 293T cells. Supernatants were collected 48 or 72 h after transfection and centri-
fuged to concentrate virus for infection.

Comet Assay
Alkaline comet assays were performed on mouse MECs engineered with CRISPR/Cas9 (gPlant/gRosa26/gNumb/ or gBrca1) using
the CometAssay kit (Trevigen, 4250-050-K) according to the manufacturer’s instructions. 100-300 cells were analyzed in each
experiment.

Anaphase bridges
Proliferating CD44high cells following HES1 depletion were plated at 60% confluence overnight, fixed with 4% paraformaldehyde for
15 min, and stained with 4’,6-diamidino-2-phenylindole (DAPI; Vector Labs) prior to microscopy.

Microarray expression profiling and analysis

Total RNAs from YFP+ MECs sorted from R26Y females 2 weeks after intraductal induction of Ad-K8-Cre or from Trp53/Brca1 null
mammary tumors were prepared using an RNeasy kit (QIAGEN, Valencia, CA). The microarray experiment was performed in Dana-
Faber Cancer Institute Core facility as described in (Tao et al., 2017). All arrays were normalized and processed in GenePattern
(https://www.broadinstitute.org/cancer/software/genepattern/). Gene Set Enrichment Analysis (GSEA) was performed using the Mo-
lecular Signatures Database v5.2 (http://software.broadinstitute.org/gsea/msigdb) and the standalone GSEA program (http://
software.broadinstitute.org/gsea/login.jsp). Gene sets for mouse or human intrinsic breast cancer subtypes were extracted from
a recent study (Pfefferle et al., 2013) by using upregulated genes (SAM fold change > 1) for each subtype, with SAM q-value of 0.
A Multiple Experiment Viewer (MeV) program (http://www.tm4.org/) was used to visualize the expression data.

RNA isolation and Bulk RNA sequencing

Single-cell suspensions of mammary glands (MGs, from Trp53L/L;Brca1L/L;R26Y or Trp53L/L;R26Y or R26Y female mice 1 month post
Ad-K8-Cre injection were obtained as described in the ‘‘Mammary gland cell preparation and flow cytometry’’ procedure. Cell preps
were stained with DAPI and DAPI-YFP+ cells were sorted in a FACS Aria II (BD Biosciences). Total RNA was extracted using the
RNeasy Micro Kit (QIAGEN, Cat# 74004). Libraries were prepared by the Dana-Farber Cancer Institute (DFCI) Molecular Biology
Cores, using the Low Input mRNA Library (Clontech SMARTer) v4, following the vendor’s protocol. Library quality was checked using
High Sensitivity D1000 reagents in an Agilent Tape Station. Libraries were pooled and sequenced in an Illumina NextSeq500 (Single-
End 75bp reads per sample). A Visualization Pipeline for RNaseq (Viper) analysis tool, developed by the Center for Functional Cancer
Epigenetics (CFCE) at DFCI, was used to generate standard outputs.

Single-cell RNA sequencing (scRNaseq)

Single-cell suspensions were generated as described in the ‘‘Mammary gland cell preparation and flow cytometry’’ procedure. YFP+
premalignant MECs or mammary tumor cells from Trp53L/L;Brca1L/L;R26Y mice post Ad-K8-Cre injection (at the indicated time
points) were sorted by FACS into Dulbecco’s PBS + 0.04% BSA and retained on ice. Barcoded scRNaseq libraries were generated
according to the manufacturer’s instructions, using a 10 3 Chromium Single Cell 30 v2 reagent kit (10 3 Genomics, Pleasanton, CA,
USA). Basically, cell suspensions were loaded onto a Chromium Single-Cell Chip along with the reverse transcription (RT) master mix
and single cell 30 gel beads, aiming for maximum of 10,000 cells per channel. Following the generation of single-cell gel bead-in-emul-
sions (GEMs), reverse transcription was performed using a C1000 Touch Thermal Cycler with a Deep Well Reaction Module (Bio-Rad
Laboratories, Hercules, CA, USA). Amplified cDNA was purified using SPRIselect beads (Beckman Coulter, Lane Cove, NSW,
Australia) and sheared to approximately 200 bp with a Covaris S2 instrument (Covaris, Woburn, MA, USA) following the manufac-
turer’s recommended parameters. Sequencing libraries were generated with unique sample indices (SI) for each sample. Libraries
were sequenced on an Illumina HiSeq-RAPID High Output Mode at cycles of 26x98 bps.

scRNaseq data preprocessing

Following sequencing, demultiplexing of cellular barcodes, mapping of reads to the mouse genome (build mm10), and production of
matrices of gene counts were performed by the MIT Genome Technology Core or BWH Single Cell Genomics Core. We next pro-
cessed the unique molecular identifier (UMI) count matrix using the Seurat R package (v3.0) (Butler et al., 2018). Cells that have either
a unique gene count over 2,500 or less than 200, and genes detected in less than three cells, were filtered out. Seurat methodology
uses principle component analysis (PCA) to visualize and explore these datasets and further summarize PCA with tSNE dimension-
ality using the default settings of the RunTSNE function. Cell clusters in the resulting two-dimensional representation were annotated
to known biological cell types using FindAllMarkers for all clusters. For tumor single cell data, tSNE two-dimensional plots were also
generated by the Loupe Cell Browser (10X Genomics) by using .cloupe files generated from the expression matrices derived from the
Cell Ranger pipeline (10X Genomics).

e7 Cell 178, 135–151.e1–e8, June 27, 2019

Quantitative RT–PCR
Organoids were dissociated with TrypLE and pelleted by centrifugation for 5 min at 1000 rpm, followed by RNA extraction with either
TRIzol (Thermo Fisher Scientific, 15596026) or the Allprep DNA/RNA mini/micro kits (QIAGEN) according to the manufacturer’s pro-
tocols. cDNA was generated with an iScript cDNA synthesis kit (Bio-RAD, 170-8891). Quantitative RT–PCR was performed using
FastStart SYBR Green Master (Roche, 04913850001, IN).

Statistics
Student’s t test (two-tailed) and Two-way ANOVA methods were used to calculate P values. Data were reported as Mean ± SEM or
Mean ± SD. Statistical methods were not used to pre-determine mouse sample sizes. No randomization or blinding was used in the
in vivo studies.

DATA AND CODE AVAILABILITY

The accession numbers for gene expression reported in this paper are GEO: GSE114787, GEO: GSE126761 and GEO: GSE130453.

Cell 178, 135–151.e1–e8, June 27, 2019 e8

Supplemental Figures

Figure S1. NUMB Is a BRCA1-Interacting Nuclear Protein, Related to Figures 1 and 2

(A) Sequence analysis of NUMB from different species emphasizing (in red type) two, putative BRCT-binding motifs SPTF and SPTXXF. Analogous motifs are also
depicted in three, other BRCA1 BRCT motif- binding proteins.
(B) A mutation in a BRCT motif (e.g., M1775R) reduced the interaction between BRCA1 and NUMB. 293T cells were transiently transfected with HA-BRCA1
(WT/M1775R/C61G), and cell extracts were immunoprecipitated with HA antibody and analyzed by immunobloting.
(C) Phosphatase exposure reduced the interaction between NUMB and BRCA1. Cell extracts from HA-NUMB (Long isoform)-expressing 293T cells were IP’d
with HA antibody and, where indicated, the IPs we exposed or not to phosphatase and subjected to immunobloting analysis.
(D-F) western blotting for NUMB and BRCA1 in cytoplasmic (S100), soluble nuclear (S400), and insoluble nuclear fractions (P400). U2OS or CD44low MECs or
MCF10A cells were fractioned at the different indicated salt concentrations in the experimental scheme (D) and analyzed by immunoblotting (E-F).
(G-H) western blotting for NUMB and BRCA1 of different cellular fractions from U2OS or MCF7 cells before and after cisplatin treatment.
Figure S2. NUMB Forms Distinct DNA Damage Foci, Related to Figure 2
(A-B) Immunofluorescent (IF) staining of BRCA1 and NUMB (A) or 53BP1 and NUMB (B) in MCF7 cells. Scale bar = 20 mm.
(C) Quantitation of 53BP1 foci in Cyclin A negative (G1/G0) CD44low MECs before and after NUMB or BRCA1 depletion.
(D) Quantitation of Cyclin A positive (S/G2 cells) and Cyclin A negative (G1/G0) cells before and after NUMB or BRCA1 depletion in CD44low MECs. Data in C and D
represent Mean ± S.D., and a Student’s t test was used to calculate statistical significance. N.S = Not Significant; *p < 0.05; ****p < 0.0001.
(E-F) Co-staining of 53BP1 and NUMB after transfection of siluc (E) or siBRCA1 (F) in CD44low MECs. Scale bar = 10 mm.
Figure S3. NUMB Sustains Differentiation and ICL Repair in MECs, Related to Figure 3
(A) Representative image of FANCD2 staining of SiLuc- or SiNUMB- transfected CD44low MECs after cisplatin treatment (1 mM, overnight).
(B) Quantitation of FANCD2 positive cells (i.e., that contain > 10 FANCD2 foci/cell) in SiLuc- or SiNUMB- transfected CD44low MECs after cisplatin treatment
(1 mM, overnight). More than 280 cells were analyzed, and the data represent Mean ± SD. A student’ t test was again used to calculate statistical significance.
****p < 0.0001.
(C) Effect of NUMB depletion on monoubiquitinaiton of FANCD2 after MMC treatment in MCF7 cells.
(D) qPCR analysis of relative expression of total NUMB, long NUMB isoform or short NUMB isoform mRNAs in CD44low MECs or BRCA1-depleted
CD44high MECs.
(E) Immunoblotting for NUMB after CD44low MECs were transfected with SiNUMB targeting both the long and short isoforms, the long isoform only, or the short
isoform only.
(legend continued on next page)
(F) Phase-contrast images from CD44low MECs stably infected with empty vector or short NUMB cDNA retrovirus after siluc or siNumb transfection. siNUMB
targeted the NUMB 30 UTR depleting both endogenous Short and Long NUMB. In contrast, it had no effect on the exogenously expressed short NUMB cDNA.
(G) CD24 and CD44 profiles of CD44low MECs stably infected with empty vector or an siRNA-resistant Short NUMB-encoding retrovirus after SilLuc or SiNUMB
transfection.
(H) Quantitation of CD44high cells derived from CD44low MECs expressing empty vector or NUMB-Short after SiLuc or SiNUMB transfection. Data represent
Mean ± S.D., and a Student’s t test was used to calculate statistical significance. **p < 0.01.
(I) Immunoblotting for NUMB/BRCA1/E-cadherin in basal breast cancer cells, MDA-MB231 and SUM149PT, and CD44low WT MECs. SUM149PT is a line derived
from a germline BRCA1 mutant patient.
Figure S4. Loss of HES1 Promotes Aberrant Differentiation and ICL Damage, Related to Figure 4
(A) Quantitation of FANCD2 positive cells (that contain > 10 foci/nucleus) in siLuc or siHes1- transfected CD44low MECs after cisplatin treatment (1 mM, over-
night). The data represent Mean ± SD. A Student’s t test was used to calculate statistical significance. ****p < 0.0001.
(B) Quantitation of HES1 mRNA expression in CD44low and BRCA-depleted CD44high cells, each labeled by its clone number. The figure depicts HES1 mRNA
expression in each of several BRCA1-depleted CD44high clones and dox-treated and untreated CD44low cells. Doxycycline (Dox) induction was performed to elicit
synthesis of a BRCA1 hairpin.
(C) Immunoblotting for HES1 in CD44low and BRCA-depleted CD44high cells. Doxycycline induction was performed to elicit synthesis of a BRCA1 hairpin.
(D) CD24 and CD44 profile of cells transfected with sh-control or shHES1 (clone-1).
(E) Phase-contrast images of FACS-sorted CD44low and CD44high cells after stable HES1 depletion.
(F) Immunoblotting for EMT markers in HES1-depleted CD44high and CD44low MECs (clone-1).
(G) Representative images of anaphase bridges in HES1-depleted CD44high cells. Scale bar = 10 mm.
(H) Representative images of soft agar assay results obtained with CD44low or BRCA1-depleted CD44high MECs.
(I) Statistical analysis of the effects on soft agar formation in clonal CD44low or CD44high cells. The data represent Mean ± SD. A Student’s t test was used to
calculate statistical significance. ***p < 0.001.
Figure S5. Induced Loss of BRCA1 and p53 Promotes Luminal Cell Origination of Basal-like Mammary Tumor Development, Related to
Figures 5 and 6
(A) Quantitation of percentages of YFP-marked MECs found in mammary glands (MGs) from virgin females with the indicated genotypes 2 weeks after intraductal
injection of Ad-K8-Cre. The data represent Mean ± SEM, and statistics were calculated using a Student’s t test: ***p % 0.005.
(B) Representative images showing H&E-stained sections of mouse cancers that developed in the cohort in Figure 5D. Scale bar = 50 mm.
(C) Co-IF staining showing expression of YFP (i.e., a lineage marker), K14 (a basal marker), and K8 (a luminal marker) in a representative mammary tumor
developed in the cohort depicted in Figure 5D. Scale bar = 50 mm.
(D) GSEA results showing comparisons of microarray data from tumors that developed in mice described in Figure 5D and from WT Krt8+ luminal MECs (cells of
origin) to gene sets representing mouse mammary tumor intrinsic subtypes. The gene sets were extracted from Pfefferle et al. In the plot, normalized enrichment
score (NES) and nominal P values (NOM p-val) are shown for each gene set. Gene sets for mouse subtypes most closely resembling human basal-like breast
cancer are highlighted in red (indicating the strongest similarities).

(legend continued on next page)

(E) No evidence of genomic amplification of a 1.15Mb amplicon on chromosome 9qA1 that encompasses multiple Mmp and Birc genes, the Hippo pathway-
related Yap1 gene, as well as another genomic amplicon spanning chromosome 6qA1-6qA2) that includes Cav2, Cav1 and Met was detected in Trp53/Brca1 null/
null tumors that developed in mice in the cohort depicted in Figure 5D. In both heatmaps, expression values of each gene (based on microarray results) were
normalized to the mean of WT luminal MEC samples.
(F) GSEA plots showing enrichment of a mesenchymal-related gene set in Trp53/Brca1 null/null MECs by comparison with Trp53 null or WT MECs, based on
RNaseq data as in Figure 6A. NES and nominal P values are shown.
(G) Representative images of H&E-stained sections of organoids generated with sorted YFP+ MECs from Trp53L/L;R26Y females or Trp53L/L;Brca1L/L;R26Y
females following intraductal injection of Ad-K8-Cre. Scale bar = 50 mm.
(H) Representative images showing organoids (left: YFP; right: phase contrast) generated with sorted YFP+ MECs from R26Y females, Trp53L/L;R26Y females,
and Trp53L/L;Brca1L/L;R26Y females, upon intraductal injection of Ad-K8-Cre. Organoids were cultured in the presence (left) or absence (right) of B27. Scale
bar = 50 mm.
(I) Quantitation of sizes (left) and organoid-forming efficiencies (i.e., number of organoids formed per 5,000 seeded cells) for organoids formed in (S5H) in the
presence (left) or absence (right) of B27. Data represent Mean ± SEM. *p % 0.05, **p % 0.01, ****p % 0.001.
(J) IF staining showing cells with K14 expression and those with ongoing DNA damage (i.e., 53BP1 positive) in Brca1/Trp53 null/null versus Trp53 null organoids
(luminal origin). Scale bar = 100 mm.
Figure S6. Loss of BRCA1 in Luminal MECs Leads to Aberrant Transdifferentiation and Accumulation of DNA Damage, Related to Figure 6
(A) Analysis of scRNaseq data based on Cell Ranger (10X Genomics). In t-SNE plots, arrows indicate in each tumor that tumor epithelial and mesenchymal cell
clusters exhibit a trend of transdifferentiation from LP-like cells (left) to EMT-like cells (middle), whose clusters are closest to mesenchymal cell clusters (right). LP:
luminal progenitor-like cells; B/M: cells with basal/mesenchymal transdifferentiation; EMT: epithelial-to-mesenchymal transition cells; M: mesenchymal cells.
Relative expression levels of select genes (black: epithelial genes; purple: LP/alveolar luminal genes; red: EMT TF/inducer genes; green: mesenchymal genes) are
shown for cells in the indicated tumor epithelial and mesenchymal clusters.
(B) Kaplan-Meier curves showing higher expression levels of SPARC, POSTN, AEBP1 and SFN correlate with worse patient outcomes [any event (AE)-free
survival, based on patients with basal-like breast cancers; for each gene, left: Hu’s SSP (Single Sample Predictor); right: Sorlie’s SSP], based on Breast Cancer
Gene-Expression Miner v4.2 (bc-GenExMiner v4.2) online tool.

(legend continued on next page)

(C) IF staining for 53BP1+ cells (red) in mammary glands from R26Y-only (WT) or Trp53L/L;R26Y control female mice one month after intraductal injection of Ad-
K8-Cre. Scale bar = 50 mm.
(D) Quantification for percentages of 53BP1+ cells in Figures 6I and (C). The percentage was assessed by quantification of 53BP1+ nuclei against DAPI+ nuclei
within the selected region of interest using Image Pro software (Rockville, USA). The number of 53BP1+ nuclei from 20 random fields in tissue sections was
counted up to 300 cells per region. 1 m or 5 m: 1 month or 5 months post Ad-K8-Cre intraductal injection, respectively. Statistics: ****p % 0.001.
(E) Representative IF staining shows that almost all Trp53/Brca1 null/null tumor epithelial cells stained positive for 53BP1 (green arrowheads), whereas non-
epithelial cells (e.g., stromal cells) were 53BP1 negative (white arrowheads). Scale bar = 50 mm.
(F) IF staining for g-H2AX + cells (red) in mammary glands from R26Y-only (WT) or Trp53L/L;R26Y control female mice performed one month after intraductal
injection of Ad-K8-Cre. IF staining for g-H2AX + cells was also performed on mammary glands of Trp53L/L;Brca1L/L;R26Y female mice at the indicated times after
intraductal injection of Ad-K8-Cre; staining was also performed on tumor cells of these animals that were detected > 8 months after Ad-K8-Cre injection.
Figure S7. Accumulation of ICL Damage Promotes a Luminal to Basal/Mesenchymal Cell Fate Change, Related to Figure 7
(A-B) Quantitation of K5 positive (A) or 53BP1 positive (B) organoids after Trp53 or Trp53/Brca1 knockout or exposure of Trp53 null mouse organoid MECs to
cisplatin or etoposide. Data represent Mean ± SEM. ****p % 0.001.
(C) IF images that depict a loss of BRCA1 foci in Trp53 null luminal organoid cells after CRISPR/Cas9-mediated editing of Brca1 (gBrca1), compared to those that
underwent editing of either Numb (gNumb) or the neutral Rosa26 genomic region (gRosa26). Scale bar = 10 mm
(D) western blots showing a loss of NUMB expression in Trp53 null luminal organoid cells after CRISPR/Cas9-mediated editing of Numb.
(E) Representative images depicting Trp53 null luminal organoids (left: phase contrast; right: YFP expressing) following CRISPR/Cas9-mediated editing of either
the neutral Rosa26 genomic region (gRosa26), Brca1 (gBrca1), or Numb (gNumb). Scale bar = 100 mm

(legend continued on next page)

(F) Representative microscopic images showing Trp53 null luminal organoid cells with comet tails upon CRISPR/Cas9-mediated editing of either Brca1 or Numb,
by comparison with cells that underwent editing of a neutral genomic region (gRosa26) or no editing (gPlant). Quantitation of the comet tails is shown in Figures 7E
and 7F. Scale bar = 10 mm.
(G) western blot showing a loss of HES1 protein expression in Trp53 null luminal organoid cells after CRISPR/Cas9-mediated editing of Hes1.
(H) Representative images depicting Trp53 null luminal organoids (left: phase contrast; right: YFP) following CRISPR/Cas9-mediated editing of either the neutral
Rosa26 genomic region (gRosa26) or Hes1 (gHes1). Scale bar = 100 mm.
(I) Quantitation of organoid size from H. Statistics: *** = p % 0.005.
(J) qRT-PCR analysis showing upregulation of selected basal (e.g., Krt5) and mesenchymal (e.g., Vim, Snai1, Zeb1) genes in Trp53 null luminal organoid cells
following CRISPR/Cas9-mediated editing of Hes1. By comparison, results in cells after editing of a neutral genomic region (Rosa26, control) are shown.
(K) Lower expression levels of NUMB and HES1 in BLBC in comparison to those of other human breast cancer subtypes, based on the Breast Cancer Gene-
Expression Miner (bc-GenExMiner) online tool. P values shown here are based on Dunnett-Tukey-Kramer’s test; NS = not significant.
(L-N) Proposed models based upon the results of scRNaseq to explain the cellular origin and progression of mammary tumors that developed in Trp53L/L;
Brca1L/L;R26Y female mice after intraductal injection of Ad-K8-Cre. See Discussion for details. LP*: refers to luminal progenitor-like premalignant cells that are in
the course of expressing basal/mesenchymal genes; LP**: refers to luminal progenitor-like tumor cells that express both basal and mesenchymal genes; B*:
refers to cells that express basal-like genes. B/M refers to cells expressing basal and mesenchymal genes. EMT are tumor cells that manifest a mesenchymal
gene expression phenotype.