See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/226433054

Development, field evaluation, and agronomic performance of transgenic

herbicide resistant rice

Article  in  Molecular Breeding · December 1996

DOI: 10.1007/BF00437914

CITATIONS READS

107 713

10 authors, including:

S. D. Linscombe Michael Braverman

Louisiana State University Rutgers, The State University of New Jersey
128 PUBLICATIONS   3,003 CITATIONS    31 PUBLICATIONS   367 CITATIONS   

SEE PROFILE SEE PROFILE

Michelle Leech
Monash University (Australia)
108 PUBLICATIONS   4,036 CITATIONS   

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Development of Plant Mutation resources View project

Rice Breeding View project

All content following this page was uploaded by Ajay Kohli on 05 February 2021.

The user has requested enhancement of the downloaded file.

Molecular Breeding 2: 359-368, 1996. 359
@ 1996 Kluwer Academic Publishers. Printed in Belgium.

Development, field evaluation, and agronomic performance of transgenic

herbicide resistant rice
J.H. Oard’ , S.D. Linscombe*, M.P. Braverman3, F. Jodari*, D.C. Blouin4, M. Leech’,
A. Kohli’, P. Vain’, J.C. Cooley6 & P. Christou’
‘Department ofAgronomy, Louisiana State University, Baton Rouge, LA, 70803-2110, USA (*authorfor
correspondence; fax (.504)388-1403; e-mail oard @lanmail.Isu.edu); 2Rice Research Station, Louisiana
Agricultural Experiment Station, Louisiana State University, Crowley, LA 70527-1429, USA; 3Department of
Plant Pathology and Crop Physiology, Louisiana State University, Baton Rouge, LA 70803, USA; 4Department of
Experimental Statistics, Louisiana State University, Baton Rouge, LA 70803, USA; ‘John Innes Centre, Norwich
Research Park, Colney, Norwich NR4 7UH, UK; ‘Agracetus, Inc., Middleton, WI 53562, USA

Received 2 1 December 1995; accepted in revised form 25 July 1996

Key words: bar gene,glufosinate, herbicide tolerance, particle bombardment,Oryza sativa L.

Abstract

The commercialcultivars ‘Gulfmont’, ‘IR72’ and ‘Koshihikari’ were genetically engineeredusingelectric discharge
particle bombardmentto expressthe bar gene which confers resistanceto the broad-rangeherbicide glufosinate.
Southern and northern blot analysesof transgenicmaterial revealed stableintegration and expressionof introduced
transgenesin the linesevaluated.In a few plants, silencingof the uidA markergenewasdetectedat the transcriptional
level. Field studieswere conducted in 1993 and 1994 at the Rice ResearchStation near Crowley, LA . This report
summarizesresults from the first two years of field trials for transgenic Gulfmont and Koshihikari. Transgenic
cultivar IR72 was tested in 1995 and preliminary results are similar to those reported for transgenic Gulfmont.
All 11 independently derived transgenic lines produced fertile, normal looking seed at maturity. Significant
differences were observedin the absenceof the herbicide betweenparental cultivars and transgenicGulfmont- and
Koshihikari-derived lines for days to 50% heading (20% of transgeniclines), plant height (13%), and grain yield
(7%). Foliar application of glufosinate had little or no effect on agronomic performanceof all transgenicGulfmont
and IR72 lines, while herbicide applications affected grain yield and plant height of sometransgenicKoshhikari.
Non-transgenic plants of all three cultivars at the 4-leaf stagewere killed within 7 days after 1.12 or 2.24 kg/ha
glufosinate applications. Significant differences among certain transgeniclines were observedfor agronomic traits
after herbicide applications. These results demonstratethat the bar gene was effective in conferring field-level
resistanceto glufosinate in rice. Variation amongtransgeniclines required traditional breeding selectionprocedures
to identify superioragronomic types with high levels of herbicide resistanceand showedthe necessityto generate
severalindependenttransgeniclines of each cultivar.

Introduction their products approved for commercial production

Significant advancesin cell biology and genedeliv-
ery techniqueshave allowed the incorporation of genes
conferring specific agronomic traits into many crop
plants [ 111. Recent examples of transgenic crops or
Approved for publication by the Director of the Louisiana Agri-
cultural Experiment Station as manuscript number 96-09-0070.
include delayed ripening in tomato, virus-resistant
squash, insect-resistantpotato and cotton, modified
oils in canola, and herbicide-resistantcotton and soy-
bean (31.
Genetic engineering of rice (Oryza sativa L.) has
made significant advancesin the past few years [5].
Direct DNA uptake into protoplasts has been repor-
ted for certain japonica and even fewer indica lines
360
[26,27,29]. However, the number of competent geno-
types for DNA uptake including elite cultivars remains
limited. Gene transfer by particle bombardment into
organized tissues such as immature embryos [7, 81 is
regarded as the most efficient and consistent genotype-
independent approach for gene transfer across japonica
and indica lines. In these studies, genetic and molecu-
lar analyses showed that stably integrated transgenes
in rice generally behaved in a simple, Mendelian man-
ner. With the recent development of Agrobacterium-
based methodology for the transformation of japon-
ica rice [20] arguments supporting singe gene transfer
between T-DNA borders are put forward as a good
reason for choosing Agrobacterium over alternative
transformation methods. However, recent reports show
that transgenic plants engineered with Agrobacterium
contain foreign DNA sequences outside the T-DNA
borders [23]. We have shown that bombardment-based
approaches are efficient with transformation frequen-
cies often exceeding 25-30% [8]. One can thus eas-
ily select populations with the desired copy number
and optimum levels of expression, either high or low,
depending on the particular application.
Glufosinate (trade names Liberty, Finale, Basta,
containing phosphinothricin), is a broad-spectrum
herbicide that inhibits glutamine synthetase. Field
studies have shown glufosinate to provide effective
weed control for a broad range of grass and broad-
leaf weeds [2]. The bar gene from Streptomyces
hygroscopicus encodes for phosphinothricin acetyl-
transferase that catalyzes the transfer of an acetyl moi-
ety from acetyl-coenzyme A to the amino group of
the molecule [ 131. Previous laboratory and greenhouse
studies have demonstrated bar to be effective in con-
ferring glufosinate resistance in soybean, tobacco, rice
and other plant species at the whole plant level [6, 16,
181.
We conducted extensive field tests over two con-
secutive years to evaluate stability and agronomic per-
formance of 11 independently derived bar-containing
transformed lines with and without glufosinate treat-
ments. In this study we report results from the first
two years for cvs. Gulfmont and Koshihikari. During
the third year of the trials, additional transgenic lines
were introduced from the cultivars IR72, Bengal, and
Cypress. Results on these lines will be reported in a
separate study. Our results indicate that extensive field
testing must be carried out to efficiently select bar-
containing lines with acceptable agronomic perform-
ance. This report describes the first successful field test
of transgenic herbicide-resistant rice.
Total world population is projected to increase from
5.3 billion in 1990 to 6 billion by the year 2000 and
up to 10 billion by 2025. Most of this increase will
most likely take place in the developing world, thus
putting more pressure on already limited and rapidly
depleting food supplies. It is obvious that increment-
al improvements in crop yield will not be adequate.
Advances in rice biotechnology in combination with
conventional breeding, including the introduction of
herbicide resistance and hybrid rice, provide a realistic
hope for assuring the availability of adequate food sup-
plies particularly in developing countries as we move
into the next century and beyond. Moreover, there is
an immediate need for such glufosinate-resistant rice in
the states of Arkansas and California where propanil-
and bensulfuron-resistant weeds, respectively, threaten
rice production. The development of efficient gene
transfer methodology for the creation of large num-
bers of transgenic rice plants from cultivars that are
being developed today provides an invaluable tool to
plant breeders and other disciplines to address prob-
lems that are otherwise very difficult to solve using con-
ventional breeding. Such experiments will be incom-
plete, however, unless transgenic germplasm is wisely
deployed in the field and extensively monitored. Res-
ults from studies such as the one reported here will
provide invaluable data to aid breeders, farmers, and
regulators in creating the type of partnership that will
be required to address issues in global food security,
particularly in the developing world.
Materials and methods
Gene constructs
Plasmid WRG2426 (CaMV 35S-promoter; adhl 51
intronl; bar; NpA + 35S-promoter; aphIV; NpA +
CaMV 35s promoter; amv leader; uidA:SpA) was con-
structed and used for stable transformation of rice [7].
The cloning of the bar gene [ 131, uidA gene [21], aph-
IVgene [28], CaMV 35s promoter (nucleotides 7013-
7440 of the CaMV sequence; [ 171, poly (A) adenyla-
tion site from the soybean ssu gene (304 bp, [ 191, maize
adhl 5’ intron 1 [4] and the poly (A) adenylation site
from the nos gene (27 1 bp; [ 141 in p WRG2426 were
previously described [7]. Both bar and the aphlvgenes
are transcribed in a clockwise fashion whereas uidA is
transcribed counter-clockwise.

Gene transfer
Immature rice embryos 12-I 5 days old from Gulfmont,
Koshihikari and IR72 were harvested from expan-
ded panicles and sterilized with 2% sodium hypo-
chlorite for 5 min. They were subsequently rinsed
repeatedly with sterile distilled water and the glumes
were removed under a dissecting microscope. Imma-
ture embryos were then aseptically removed andplated
on MS or CC media supplementedwith 2,4-D at 0.5 or
2.0 mg/l with the adaxial sidein contact with the medi-
um [ 12, 191.Particle bombardmentwas carried out as
describedelsewhere[7]. Explants were bombardedat
an accelerating voltage of 16 kV. After bombardment,
embryos were plated on fresh media and embryogenic
callus and plantlets were recovered as described [7].
Two days after bombardment,explants were plated on
hygromycin-containing media (usually 50 mg/l) and
selectionpressurewas maintainedthroughout the pro-
liferation and regenerationphases.
Nucleic acid isolation
Nucleic acids were isolated from 5 g fresh weight
leaf material using standardcetyltrimethylammonium
bromide (CTAB) DNA extraction methods[24]. Nuc-
leic acid wasethanol-precipitatedfrom the supematant
in the presenceof 0.3 M NaOAc, pH 6.0. Total RNA
was selectively isolated by the addition of l/3 volume
8 M LiCl and incubated at 4C overnight. RNA was
pelleted by centrifugation at 15000 x g for 30 min at
4 ‘C and the supematantdecanted.DNA wasprecipit-
ated from the supematantby standardNaOAc/ethanol
procedures. Total RNA was incubated for 30 min at
37 “C with 10 units of human placental ribonuclease
inhibitor (BRL), 10units of RNase-freeD NAase (Pro-
mega)in 10 mM Tris-HCl, pH 8.3,50 mM KCl, 1.5 m
M M gC12.After extraction with phenol/chloroform,
the supematantwas precipitated with 0.3 M NaOAc
and the RNA was dissolvedin 500 ~1 sterile water.
Southern/northern hybridizations
Total DNA and RNA were isolated from one-month
old, greenhouse-grownplants. Seven pg DNA was
digested overnight at 37 “C with XbaI or SacI, frac-
tionated through a 0.8% agarosegel and blotted onto
nylon membranes(Hybond-N, Amersham). For north-
em blot analyses, 15 pg RNA denatured by gly-
oxylation [ lo] followed by electrophoresis through
1.5% agarosegels in 1x TAE buffer (40 mM Tris-
361
acetic acid, pH 7.0) and then blotted onto nylon mem-
branes.Probe DNA (either the uidA or the bar gene)
was prepared by PCR amplification using appropri-
ate primers and plasmid WRG2426 as template. The
conditions usedfor the ‘hot start’ PCR amplification
were 95 “C/5 min., followed by 39 cycles of 95 oC,
1 min, 55 “C/l min and 72 “C/l min. Sequencesof
the primers were as follows: for amplification of the
uidA 5’-coding region, oligos TAGATATCACACTCT-
GTCTG and GGAATTGATCAGCGTTGGTG were
used. For amplification of a fragment containing the
bar region plus part of the upstream 35s promoter,
oligos AAGAAGACGTTCCAACCACG and AAT-
CATCGCAAGACCGGCAA were used. The region
of the amplification containing the 35s promoter was
removed by digestingthe PCR product with NcoI prior
to gel purification. The amplified uidA and bar gene
probe DNA was gel-purified and oligo-labeled in the
presenceof [32P] dCTP [ 151. DNA or RNA gel-blot
filters were hybridized at 65 “C in 4x SET (0.6 M
NaCl, 0.12 M Tris/HCl pH 8.0,0.008 M EDTA), 10x
Denhardt’s solution, 0.1% SDS, 0.1% sodium pyro-
phosphate, 100 pg/ml herring sperm DNA and 10%
dextran sulfate. Filters were washedtwice at 65 ‘C in
0.1 x SSC, 0.5% SDS.
GUS assays
Three leaf segmentswere harvested from 5 different
plant of each line and incubated overnight at 37 “C in
GUS assaybuffer [21].
Field experiments
Field experiments were conducted in 1993, 1994 and
1995 at the LSU Agricultural Center Rice Research
Station near Crowley, LA. The experimental design
was a randomized complete block with four replica-
tions using a split-plot arrangement.Glufosinate was
applied to the main plots at rates of 0, 1.12, and
2.24 kg/ha. For the 1993 and 1994 trials, subplots
had rice lines including six transgenicGulfmont lines,
nine transgenic Koshihikari lines, and untransformed
Gulfmont and Koshihikari parental cultivars. Due to
limited seedsupply, R2 and R3 transgeniclines were
drill-seeded in 2 m rows on 4 June in 1993. Plot
size was increasedto 3.6 m x 1.42 m for the 2 June
and 3 June plantings in 1994 and 1995, respectively.
Normal agronomicand fertilization practiceswere fol-
lowed to promote optimal plant growth. Weeds were
controlled in the plots by application of propanil at the
362
rate of 3 kg/ha. Glufosinate treatments were applied
with a backpack sprayer at the 3-to-4-leaf stage. The
variables measured were: days from seeding to 50%
heading, plant height (cm) 14 days after herbicide
application, plant height (soil line to extended panicle
in cm) at maturity, and grain yield (kg/ha) adjusted to
12% moisture content.
Data for grain yield, days from seeding to 50%
heading, and plant height were analyzed using the
ANOVA procedure as described by the SAS Institute,
[25]. Treatment means were separated based on least
significant difference (P = 0.05). Only data from
transgenic lines were analyzed over herbicide treat-
ments because all other non-genetically engineered
plants were killed by glufosinate applications. Data
from control treatments (0 kg/ha glufosinate) were also
analyzed separately across all lines.
Results and discussion
Molecular characteristics ofjield-derived plants
Fifteen lines representing 11 independenttransform-
ation events were analyzed. Four independenttrans-
formation events were analyzed at both Rl and R2
generations. Southern-blot analysis of the transgenic
lines was used to characterize patterns of integration
of the unselectedgenes(uidA and bar) carried on the
transformingWRG2426 plasmidDNA. Analyses were
performed initially on one memberonly of a segregat-
ing population for each line. Consequently, only gen-
eral statementsregarding the fate of transgenescan
be made as we were probably dealing with segreg-
ating populations for the transgene(s).Subsequently,
additional membersof eachfamily were analyzed and
results confirmed stableintegration and expressionof
transgenesin all families analyzed. Northern analyses
were usedto determine the transcriptional state of the
uidA and bar transgenes.Southern blot analysis with
gene specific probes showed that in 9 of the plants
representingthe 15 lines, both the I*idA and bar trans-
geneswere present(Fig. 1). The complexities of band
patterns and intensities were similar when the band-
ing patterns within the sameline were compared for
the uidA and bar transgenes,indicating that the trans-
forming unit was inherited as a complete entity in the
9 lines. Comparison of the complexities of banding
patternsfor the uidA andthe bar transgeneswithin the
9 independentlines showedthere to be 5 different pat-
terns of integration of the uidA transgene,whereasat
least 8 different integration patterns were revealed for
the bar transgene, suggestingrecombination events.
DNA from 2 lines, GFMT 5 17-5-Rl and GFMT 5 17-
2-Rl, showedhybridization to the bar probe, but not
to the uidA geneprobe. In lines GFMT 526-l) GFMT-
5 17-1-Rl , GFMT-5 17-7-Rl, and KOSH 496-3-R2,
neither the bar nor the uidA transgeneswere detec-
ted. Becauseall plant lineagesexhibited resistancein
the field following herbicide application, segregation
for bar and uidA was probably occurring in the plant
analyzed here. This result wasconfirmed by analyzing
additional membersfrom thesefamilies (seebelow).
We are currently developing homozygous linesfor the
transgenesand thesewill be usedfor a more in-depth
molecular analysisof transgenestructure and function.
A comparison of the Southern and northern blot
data provides evidence for mechanismsof gene silen-
cing at the transcriptional level. Nucleic acid extrac-
ted from the GFMT 517-3-Rlline showed hybridiz-
ation to the uidA gene probe at the DNA level, but
no transcript was detected in theseplants for the uidA
transgeneat the RNA level. Of the 11 lines in which
the bar transgenewas detected at the DNA level, 5
lines (KOSH 496- 1-Rl, KOSH496- 1-R2, KOSH 496-
3-RI, KOSH496-4-Rl and KOSH 496-4-R2) showed
no hybridization to the bar gene probe at the RNA
level. The putative silencing effect was detected in
plants with 1 to 5 hybridizing bands in Southern blot
analysis which suggeststhat the transcriptional silen-
cing effect is independentof the numberof integration
sites of the uidA or bar genes (Fig. 1). Becauseall
the plant lineagesexhibited resistancein the field fol-
lowing herbicide application, the absenceof bar RNA
could be due to insufficient resolution of our northern
analysesor due to transgenesilencing in the particular
plant tested.
The expected size of the transcript from the GUS
gene in plasmidWRG2426 is 2.0 kb; sucha transcript
wasobservedin RNA only from the lines KOSH 495- l-
Rl, KOSH 495- l-R2, and KOSH 496-2-Rl . All indi-
vidual plants testedfor GUS activity for each of these
lines were all GUS-positive. Transcripts greater than
12 kb were detectedin RNA from lines KOSH 496- l-
Rl, KOSH 496- 1-R2, KOSH 493-3-Rl, KOSH 496-4-
R2 and KOSH 496-4-Rl. Although the RNA samples
were subject to DNAse treatment, the treatment may
have been only partially successfulin theseparticular
RNA samples,and the high-molecular-weight ( 12 kb)
bandsmay have resulted from probe hybridization to
contaminating DNA. However, DNA contamination is
unlikely becauseno high-molecular-weight band was
 363

Lane:

Blot B Lane:

Figure 1. Southern blot analysis of DNA from transgenic rice plants for pWRG2426. Genomic DNA was digested with SacI (Blot A) or XbaI
(Blot B), transferred to nylon membranes and probed with P3*-labelled gus gene probe DNA (Blot A) or similarly labelled bar gene DNA (Blot
B). Blots A and B have identical lane loadings of genomic DNA isolated from the following lines: GmT 5 17-2~~1 (lane 1); GWT 517.5.~1
(2); CFMT517-3-RI (3); GJ?‘MT 517-l-R] (4); G 526-l (5); KOSH496-3-R2 (6); GFMT517-7-RI (7); KOSH496-4.Rl (8); KOSH496-4-R2
(9); KOSH 495-l-R2 (lo); KOSH 495.l-R1 (11); KOSH 496.3.Rl (12); KOSH 496.l-R2 (13); KOSH 496-l-R1 (14); KOSH 496-2-Rl, Lanes
16, 17 and 18 contain pWRG2426 at 1, 5 and 10 copies respectively per genome, digested with either Sac1 (Blot A) or Xbd (Blot B).
364
observed when the same RNA sample was probed with
the bar-gene. The putative high-molecular-weight tran-
scripts are likely to be untranslatable because no GUS
activity was detected in leaf material from all independ-
ent plant of each of these lines. These experiments are
being pursued further to develop a better understand-
ing of these phenomena. Interestingly, those plants
from which genomic DNA revealed the greatest num-
ber of hybridization bands in Southern analyses with
the uidA gene probe (KOSH 496-1-Rl, KOSH 496-
I-R2, KOSH 496-3-Rl, and KOSH 496-4-R2) also
showed the presence of a very large, relatively low
abundant transcript of over 12 kb that hybridized to
the GUS gene probe in northern analyses. In addition,
the lines exhibiting the simplest integration patterns
of the uidA gene (KOSH 495 1-Rl, KOSH 495- 1-R2,
and KOSH 496-2-Rl) showed GUS expression more
consistently across different plants of these lines. A
large transcript hybridizing to the bar gene probe was
detected in lines KOSH 496- 1-Rl and KOSH 496- l-
R2 that similarly suggested the more complex integ-
ration pattern for the bar transgene (Fig. 2). These
data suggest that there may be a correlation between
complexity of integration sites and reorganization of
the input plasmid to produce a large transcriptional
unit containing multiple copies of the uidA and bar
messages. How such transcripts are produced remains
unclear and will be the subject of future work. We may
speculate, however, that it probably results from com-
plex extrachromosomal pre-integration recombination
events which results in the formation of a large tran-
scriptional unit containing multiple copies of the uidA
gene between a promoter and termination signal. The
possibility that the transcripts are polycistronic, being
a composite of uidA, bar, and aphlV RNA sequences
is not supported from our northern hybridization data.
More recently, about 5 plants for each of the
11 independent transformation events were analyzed
by Southern hybridization. All the lines including
GFMT526-1, GFMT517-I-Rl, GFMT517-7-RI and
KOSH496-3-R2 contained at least the bar gene. The
banding pattern of transgenes in the Rl progeny was
identical for all the plants belonging to the same
line except for KOSH495-l-R1 where at least two
sites of integration of the transgenes were observed
[9]. For three lines (KOSH496-1-Rl, KOSH496-3-
Rl, and KOSH496-4-RI), identical band patterns were
observed up to the R2 generation. These analyses lead
us to reiterate the stable transmission of characters to
the progeny of the primary transformants.
Agronomic pegormance of transgenic material After
herbicide treatments
As shown in Fig. 3, all non-transgenic plants were
killed within 7 days after 1.12 and 2.24 kg/ha glufos-
inate applications at the 3-to-4 leaf stage. In contrast,
Gulfmont and Koshihikari-derived transgenic lines sur-
vived glufosinate treatments to produce fertile, nor-
mal looking seeds. These results demonstrate that rice
can be genetically engineered for field level resistance
to glufosinate herbicide which has been shown to be
effective in controlling red rice and other important
rice weeds. It must be pointed out that these exper-
iments were conducted under weed free conditions.
Gulfmont derived transgenic lines displayed no visible
injury due to herbicide treatments, but all Koshihikari
lines exhibited initial yellowing and some stunting 2
to 3 days after glufosinate application. The yellowing
disappeared 7 days after treatment, however, stunting
for some lines was observed at harvest maturity. This
result was consistent with glufosinate applications of
the same transgenic material in previous greenhouse
screens (Christou, unpublished).
Significant differences among the Gulfmont and
Koshihikari-derived transgenic lines for grain yield
were detected both at the 1.12 and 2.24 kg/ha rates
(Table 1). The range between highest and lowest grain
yielding Gulfmont lines (GFMT-5 17-3-Rl and GFMT-
517-2-Rl) was 1785 and 1680 kg/ha for 1.12 and
2.24 kg/ha herbicide rates, respectively, which were
not significantly different from each other at LSDo.05.
Some Koshihikari lines displayed significant differ-
ences in yield, but with greater high-low ranges of
2 177 and 4 145 kg/ha at the two herbicide rates. These
results are consistent with the observed treatment x
line interaction from the analysis of variance (Table 2).
A few untreated Gulfmont and Koshihikari lines yiel-
ded below the untransformed parental cultivars, but
80% of the lines yielded equal or better than the con-
trols. Differences in mean grain yields across herbi-
cide treatments were not statistically significant with-
in Gulfmont-derived lines (Table 1) which indicates
glufosinate applications did not significantly alter per-
formance of this material. In contrast, grain yields for
33% of the Koshihikari lines were significantly reduced
with increasing glufosinate rates. Variation for grain
yield among transgenic lines may be explained by pos-
ition effects of the bar or uidA transgenes.
As with grain yield, significant differences among
transgenic lines for mature plant height were observed
for each herbicide rate (Table 1). A 6 to 7 cm range in
 365

Lane:

Figure 2. Northern-blot analysis of RNA from transgenic rice plants for pWRG2426. Total RNA (15 mug) was fractionated through 1.5%
agarose gels. transferred to nylon membranes and probed with 3’P-labelled bar gene DNA. Lanes l-6 show RNA from the GFMT lines and
lanes 7-15 RNA from the KOSH lines as follows: GPMT 517-I-R1 (lane I); 517-2-RI (2); 517.3.RI (3); 517.5.Rl (4); 517-7-Rl (5); 526-l
(6);KOSH495-I-RI (7);495-I-R2(8);496-I-R1 (9);496-I-R2(10);496-2-Rl (11):496-3.RI (12);496-3.R2(13);496-4-RI (14);496-4.R2
(15).

96 injury
100

80

60

40

20

0
1 2 3 4 5 6 7 8 9 ,I0 11 12 13 14 15 16 17 18 19 20 21 222324

m 1 lb ai/A 2 lb at/A

Figure 3. Transgenic lines were sprayed with glufosinate ammonium and injury was recorded eight days after application. Lanes l-l 5 represent
transgenic plants (see text for more details). Controls are shown in lanes 1624. Two different application rates were used. All control plants
suffered severe injury after eight days which resulted to death in all cases.

height was observed for Gulfmont-derived lines while
Koshihikari lines displayed a 11 to 12 cm range within
treatments. Mean height values across treatments were
not statistically different among Gulfmont lines while
a majority 67% of Koshihikari lines showed significant
reductions in plant height with increasing glufosinate
rates. Plant height 14 days after the 1.12 kg/ha glufosin-
ate spraying showed a slight decrease of 2.4 cm among
transgenic lines when compared to the no herbicide
treatment in 1993 experiments.
366
T&e I. Mean values of grain yield (kg/ha), plant height (cm), and days to 50% heading for 15 transgenic
lines and 2 parental cultivars treated with 0, 1.12, and 2.24 kg/ha glufosinate herbicide, 1993-1994. Rice
Research Station, Crowley, LA.

Transgenic line Days to

Grain yield (kg/ha) Plant height (cm) to 50% heading
0 1.12 2.24 0 1.12 2.24 0 1.12 2.24

GFMT-517-l-R1 4985 4847 5044 87.6 86.5 86.4 83.1 84.9 83.6
GFMT-5 17-2-R 1 4232 4834 4513 90.5 89.4 90.7 85.5 85.7 87.4
GFMT-5 17-3-R 1 5133 5786 6193 86.6 84.9 86.5 83.1 84.5 84.8
GFMT-517.5-Rl 3722 4060 4553 83.2 83.6 84.2 84.6 85.7 86.0
GFMT-5 17-7-R 1 5505 5227 5843 94.0 90.6 90.5 84.5 85.5 85.6
GFMT-526-l 4917 4889 5053 86.8 86.0 85.5 83.5 83.6 85.5
Gulfmont (parent) 4764 0 0 86.7 0 0 83.4 0 0

KOSH-495-l -Rl 4131 5295 4272 92.2 92.0 89.2 76.1 75.7 76.1
KOSH-495-l -R2 4191 5332 4379 91.7 90.6 88.5 76.4 75.9 77.4
KOSH-496-l -Rl 4702 4211 2897 88.6 83.7 77.2 73.5 75.5 76.2
KOSH-496-l -R2 5387 3622 2334 89.5 80.5 79.0 74.4 76.4 77.7
KOSH-496.2-Rl 4675 5448 4164 87.0 86.5 83.2 74.9 74.6 75.9
KOSH-496-3-RI 3582 3311 2976 90.9 87.1 85.0 74.2 73.9 74.9
KOSH-496.3-R2 3975 3712 2954 94.7 86.4 86.2 74.1 74.6 75.2
KOSH-496-4-R 1 4345 4439 3722 87.8 81.2 80.9 73.1 74.1 75.5
KOSH-496-4-R2 4143 4296 326 I 87.0 81.6 78.9 73.7 74.9 76.1
Koshihikari (parent ) 4093 0 0 91.9 0 0 74.5 0 0

Least significant difference (LSD, P = 0.05) for means in each column: grain yield = 822; plant height =
3.6; days to 50% heading ~1.5. LSD (P = 0.05) for means in each row: grain yield = 1004; plant height =
4.3; days to 50% heading = 1.8.

Table 2. Analysis of variance for grain yield. plant height, and days to 50%
heading for 11 transgenic lines combined over 1993-1994 experiments.

Source of Grain Plant Days to

variation df yield height 50% heading

Year 1 1915667 1.73 10347**

Rep(Year) 6 2971177LX** 45.0” 17.2**
Herbicide treatment (H) 2 4882800* * 625** 66.0**
Year x H 2 25287769’* 37.5 6.6
Rep x H (Year) 12 3393646** 56.7” 7.7**
Line 14 9256424*’ 245” 580**
Year x Line 14 4357877’=+ 28.7’” 12.6**
H x Line 28 2346831’: 38.9** 2.9
Year x H x Line 28 482202 17.5 2.0

*, ** Mean squares significant at P < 0.05 and P < 0.01. respectively.

Most Gulfmont and Koshihikari-derived lines (55% would probably have minima1 effect on agronomic
to 67%) displayed no significant differences in days to performance of the transgenic material. An example
50% heading across herbicide treatments (Table 1). of transgenic and non-transgenic lines treated with
Moreover, heading values were nearly equal or only glufosinate is shown in Fig. 4.
slightly greater without herbicide treatment when com-
pared to the untransformed controls. The 2- to 3-day
statistically significant delay in maturity in some lines

Figure 4. Field response of transgenic and non-transgenic
untransformed Cypress; row 2, transgenic RI Gulfmont line; row 3. transgenic RI Koshihikari
transformed Koshihikari line: row 6, transformed RI Gulfmont Line; row 7. untransformed
Concerns with transgenic rice expressing herbicide
resistance
Genetic engineering of rice must consider the potential
of transgenic plants expressing a given trait that may
pose a risk to the environment, the farmer or consumer.
One of the major issues that needs to be addressed in
the case of commercial white rice is its relationship
to red rice (Oryza sativa L.). This weed is found in
the southern United States and in several other rice
growing areas in the world where it shares many mor-
phological, physiological, biochemical and other traits
with cultivated rice, making it difficult to control. In
situations where herbicide resistance is a target for rice
improvement, the possibility of pollen transfer from
cultivated to red rice needs to be studied very care-
fully in development of weed management practices.
In addition to competing with cultivated rice for essen-
tial resources thereby reducing crop yields, red rice
reduces the quality of the harvested product due to the
red color of the seed coat [22]. It should be possible to
arrive at an optimum window for herbicide application
by gaining as much understanding as possible on pol-
len dispersal and out-crossing rates between cultivated
and red rice. Transgenic rice plants with easily storable
367
lines 14 days after application of glufosinate at 2.24 kg/ha rate. Row 1 (left),
line: row 4, untransformed Koshihikari; row 5,
Gulfmont.
characteristics will provide some of the answers that
are needed to make a critical assessment of the risks
and benefits of targeting herbicide resistance as a goal
in rice improvement programs. Results from field tri-
als in which several of these issues are being addressed
will guide breeders and farmers in developing prudent
procedures for minimizing pollen transfer from cultiv-
ated rice to red rice. It is only with the use of transgenic
plants that these vital questions can be answered.
Conclusions
Particle acceleration and the bar gene proved to be an
effective combination for development of elite trans-
genie rice cultivars that are resistant to the broad-
spectrum herbicide glufosinate. Transgenic Gulfmont
lines were in general more glufosinate resistant than
the Koshihikari lines which suggests that genetic back-
ground played a role in expression of the transferred
bar gene. A good number of transgenic lines showed
stable and acceptable agronomic performance across
herbicide treatments, but significant variation for all
traits was observed within lines in the absence of herb-
icide applications. This variability is most probably the
368

result of position effects of integrated transgenes and 13. De Block M, Botterman J, Vandewiele M, Doekx J, Thoen C,
underscores the fact that plant breeding methods must Gossele V. Rao Movva. Thompson C, Van Montagu M, Lee-
man J: Engineering herbicide resistance in plants by expression
be used to identify transgenic material that is equal in of a detoxifying enzyme. EMBO J 6: 25 13-25 18 (1987).
agronomic performance to the original parental cul- 14. Depicker A, Stachel S, Dhaese P, Zambryski P & Good-
tivar. man HM: Nopaline synthase: transcript mapping and DNA
sequence. J Mol Appl Genet 1: 499-5 12 (1982).
15. Feinberg AP. Vogelstein B: A technique for radio-labeling
DNA restriction endonuclease fragments to high specific activ-
Acknowledgments ity. Anal Biochem 137: 266-267 (1994).
16. Fromm ME, Moorish F, Armstrong C. Williams R. Thomas J,
Kleig TM: Inheritance and expression of chimeric genes in the
Agracetus, Inc. for making plasmid.pWRG2426 avail-
progeny of transgenic maize plants. BioAechnology 8: 833-
able and where these transgenic lines were generated. 844 (1990).
Diana Wenger and Tameria Ford for generating the 17. Gardner R, Howarth A, Hahn P, Brown-Leudi M, Shepard R.
transgenic rice lines. Messing J: The complete nucleotide sequence of an infectious
clone of cauliflower mosaic virus by M13mp7 shotgun sequen-
cing. Nucl Acids Res 9: 2871-2888 (198 I).
18. Gordon-Kamm WJ, Spencer TM, Mangano JV, Chambers SA,
References Adams WR, Willetsw NG, Rice, TB, Mackey CJ, Krueger RW,
Kausch AP, Lemaux PG: Transformation of maize cells and
I. Berry-Lowe, SL. McKnight TD, Shah DM, Meagher RB: The regeneration of fertile transgenic plants. Plant Cell 2: 603-6 18
nucleotide sequence, expression and evolution of one member (1990).
of a multigene family encoding the small subunit of ribulose- 19. Hartke S. Lorz H: Somatic embryogenesis and plant regener-
I -5-biphosphate carboxylase in soybean. J Mol Appl Genet I : ation from various indica rice (Orvzn safiva L.) genotypes. J
483498 (1982). Genet Breed 43: 205-214 (1989).
2. Braverman MP Linscombe SD: Field evaluation of transgenic 20. Hiei Y, Ohta S, Komari T, Kumashiro T: Efficient transforma-
glufosinate resistant rice. Proc South Weed Sci Sot 47: 22 tion of rice (0r.r~ snrir~a L.) mediated by Agrobacterim and
(1994). sequence analysis of the boundaries of the T-DNA. Plant J 6:
3. Bullock WO: U.S. biotech firms slow R&D spending. NBIAP 271-282 (1994).
News Rep (Sep), pp. 8-9 (1995 ). 21. Jefferson RA, Kavanagh TA, Bevan MW: GUS fusions: p-
4. Callis J, Fromm M, Walbot V: Expression of mRNA elec- glucuronidase as a sensitive and versatile gene fusion marker
troporated into plant and animal cells. Nucl Acids Res 15: in higher plants. EMBO J 6: 3901-3907 (1987).
5823-583 I (1987). 22. Pantone DJ, Baker JB: Weed-crop competition models and
5. Christou P: Applications to plants, In: Yang N-S, Christou P response-surface analysis of red rice competition in cultivated
(eds) Particle Bombardment Technology for Gene Transfer, rice: areview. CropSci 31: 105-llO(1991).
pp. 171-198. Oxford University Press, Oxford/New York 23. Ramanathan V, Veluthambi K: Transfer of non-T-DNA por-
(1994). tion of the Agrobactrrium nrrnefaciens Ti plasmid pTiA6 from
6. Christou P, McCabe DE, Martinell BJ, Seain WF: Soy- the left terminus of TL-DNA. Plant Mol Biol 28: 1149-l 154
bean genetic engineering-commercial production of transgenic (1995).
plants. Trends Biotechnol. 8: 145-151 (1990). 24. Rogers SO, Bendlich AL: Extraction of total cellular DNA
I. Christou P, Ford T, Kofron M: Production of transgenic rice from plants, algae and fungi. In: Gelvin SB. Schilperoort
(0r-v:~ snrivcl L.). Plants from agronomically important indica AR (eds) Plant Molecular Biology Manual, 2nd edn., vol. I.
and japonica varieties via electric discharge particle accel- pp. l-8. Kluwer Academic Publishers, Dordrecht, Netherlands
eration of exogenous DNA into immature zygotic embryos. (1994).
Bio/technology 9: 957-962 (199 I ). 25. SAS Institute: SAS/STAT User’s Guide, vol. 2, 4th ed., ver-
8. Christou P, Ford TS, Kofron M: The development of a variety- sion 6, SAS Institute, Gary. NC (1990).
independent gene-transfer method for rice. Trends Biotechnol 26. Shimamoto K, Terada R, Iaawa T, Fujimoto H: Fertile trans-
IO: 239-246 (1992). genie plants regenerated from transformed protoplasts. Nature
9. Cooley JT. Ford TL. Christou P: Molecular and genetic char- 338: 274-277 (1989).
acterization of elite transgenic rice plants produced by electric 21. Toriyama K. Arimoto Y, Uchimaya H, Hinata K: Trans-
discharge particle acceleration. Theor Appl Genet 90: 97-104 genie rice plants after direct gene transfer into protoplasts.
( 1995). BioAechnology 6: 1072-1074 (1988).
10. Covey S.N, Lomonosoff GP. Hull R: Characterization of cauli- 28. Van den Elaen PJM, Townsend J, Lee KY. Bedbrook JR: A
flower mosaic virus DNA sequences which encode major poly- chimeric hygromycin resistance gene as a selectable marker in
adenylated transcripts. Nucl Acids Res 9: 6735 (198 I). plant cells. Plant Mol Biol 5: 299-302 (1985).
II. Dale PJ, Irwin JA, Scheffler JA: The experimental and commer- 29. Zhang HM, Yang H. Rech EL, Golds TJ, Davis AS. Mul-
cial release of transgenic crop plants. Plant Breed I I I: l-22 ligan BJ, Cocking EC: Transgenic rice plants produced
(1993). by electroporation-mediated plasmid uptake into protoplasts.
12. Datta SK, Peterhaus A. Datta K, Potrykus I: Genetically Plant Cell Rep 7: 379-383 (1988).
engineered fertile indica rice recovered from protoplasts.
Bio/technology 8: 736-740 (1990).

View publication stats