G Model

ANIREP-5518; No. of Pages 9 ARTICLE IN PRESS

Animal Reproduction Science xxx (2016) xxx–xxx

Contents lists available at ScienceDirect

Animal Reproduction Science

journal homepage: www.elsevier.com/locate/anireprosci

Transcriptional abundance of antioxidant enzymes in

endometrium and their circulating levels in Zebu cows with
and without uterine infection
R.K. Baithalu a,∗ , S.K. Singh b , A. Kumaresan a,∗ , A.K. Mohanty c , T.K. Mohanty a , S.
Kumar c , S. Kerketta d , B.R. Maharana e , T.K. Patbandha d , N. Attupuram d , S.K.
Agarwal b
a
Animal Reproduction, Gynaecology and Obstetrics, National Dairy Research Institute, Karnal 132001, Haryana, India
b
Division of Animal Reproduction, Indian Veterinary Research Institute, Izatnagar, UP, India
c
Animal Biotechnology Center, National Dairy Research Institute, Karnal 132001, Haryana, India
d
Livestock Production Management, National Dairy Research Institute, Karnal 132 001, Haryana, India
e
Regional Research Center (LUVAS), Veterinary Subunit, Uchani, Karnal, Haryana, 132 001, India

a r t i c l e i n f o a b s t r a c t

Article history: Oxidative stress during peripartum period may compromise the uterine immunity. In
Received 4 July 2016 the present study, we assessed the oxidative stress and antioxidant status during peri-
Received in revised form partum period and studied their relationship with postpartum uterine infection in dairy
28 November 2016
cows. Peripheral blood concentrations of total antioxidant capacity (TAC), malondialde-
Accepted 12 December 2016
Available online xxx
hyde (MDA) and nitric oxide (NO) were determined (day −21, −7, on the day of calving
and day +7, +21, +35) in normal (n = 11), puerperal metritic (n = 7) and clinical endometritic
(n = 6) cows. Endometrial biopsy was performed on the day of calving and expression of
Keywords:
CAT, GPx4 and SOD2 genes was studied using qRT-PCR. Puerperal metritic cows had sig-
Antioxidative molecules
Oxidative molecules nificantly (P < 0.05) lower TAC (on day −7, day 0, day +7, +21 & +35), higher MDA (on day
Nitric oxide −21, −7 & on the day of calving) and NO (on day 0, +7 & day +35) concentrations compared
Catalase to normal cows. Similarly, clinical endometritic cows had significantly (P < 0.05) lower TAC
Glutathione peroxidase (on day −7, 0, +7 & +21), higher MDA (on day −21, −7, +7 and +35) and NO (on day +7, +21
Superoxide dismutase & +35) concentrations compared to normal cows. The expression of CAT and GPx4 genes
Uterine health was lower (P < 0.05) and SOD2 gene was higher (P < 0.05) in endometrial tissue of cows that
Peripartum developed uterine infection compared to normal cows. The relationship of peripheral levels
Cows
of MDA and NO with antioxidant enzymes expression in endometrial tissue was found sig-
nificant. Receiver operator characteristic analysis revealed that the concentrations of TAC
on day −7 to day +35, MDA on day −21 to day +7 and NO on the day of calving to day
+35 were highly correlated to the development of postpartum uterine infection in cows. It
may be inferred that the low serum TAC level and high level of lipid peroxidation and NO
during peripartum period influenced the endometrial expression of anitioxidative genes
that compromised the uterine health during postpartum period.
© 2016 Elsevier B.V. All rights reserved.

1. Introduction

∗ Corresponding authors. In dairy cattle, postpartum uterine infection is one of

E-mail addresses: rbaithalu@gmail.com (R.K. Baithalu),
the most important causes of sub-fertility and infertil-
ogkumaresan@gmail.com (A. Kumaresan). ity leading to increased involuntary culling and economic

http://dx.doi.org/10.1016/j.anireprosci.2016.12.008
0378-4320/© 2016 Elsevier B.V. All rights reserved.

Please cite this article in press as: Baithalu, R.K., et al., Transcriptional abundance of antioxidant enzymes in
endometrium and their circulating levels in Zebu cows with and without uterine infection. Anim. Reprod. Sci. (2016),
http://dx.doi.org/10.1016/j.anireprosci.2016.12.008
G Model
ANIREP-5518; No. of Pages 9 ARTICLE IN PRESS
2 R.K. Baithalu et al. / Animal Reproduction Science xxx (2016) xxx–xxx
losses (Bartlett et al., 1986; Sheldon, 2004). The inci-
dence of uterine infection is quite high ranging from
12.7 to 47.9% in cattle and buffaloes including metri-
tis 20% (8–>40%); clinical endometritis 20% (5–>30%) and
subclinical endometritis 30% (11–>70%) (Le Blanc et al.,
2002; Hammon et al., 2006; Goshen and Shpigel, 2006;
McDougall et al., 2007).
During peripartum period, dairy animals undergo
numerous physiological stresses leading to generation of
pro-oxidative and oxidative molecules. The production of
low or moderate concentrations of reactive oxygen or
nitrogen species (ROS and RNS) is especially essential for
a number of normal physiological processes related to
innate and acquired immune response. For instance, ROS is
necessary for the oxygen-dependent destruction of invad-
ing pathogens (Valko et al., 2007) and can control the
magnitude and duration of the inflammatory response
since it is involved in signal transduction pathways
leading to the expression of cytokines, eicosanoids and
other immunoregulatory factors (Finkel, 2011). However,
very high production of oxidative molecules surpassing
the endogenous level of antioxidative molecules in the
host results oxidative stress situation where uncontrolled
release of oxidants modify and denature functional and
structural molecules of cells bringing cell injury and dys-
functions (Vaziri, 2008). Several endogenous antioxidant
defense mechanisms tightly regulate ROS accumulation
within tissues. Regulation of redox system is mainly
provided by antioxidative enzymes such as superoxide dis-
mutase, catalase, and glutathione peroxidase (Young and
Woodside, 2001; Willcox et al., 2004).
Several studies suggested that uncontrolled oxidative
stress leads to host immune dysfunction and aggravate
inflammatory responses that can increase the incidence
and severity of infectious diseases (Miller et al., 1993;
Sordillo and Atiken, 2009). Recent reports on redox changes
during peripartum period have drawn attention to corre-
late these changes with uterine health. Kizil et al. (2010)
reported that acute uterine infection in cows was associ-
ated with increased level of lipid peroxidation and altered
levels of antioxidative molecules. However, the influence of
these changes on uterine endometrial redox environment
especially in relation to postpartum uterine health is poorly
understood.
We hypothesized that alterations in oxidative and
antioxidative molecules in peripheral circulation may
influence the antioxidative defense mechanism in uterine
endometrium and contribute to development of uterine
infection during postpartum period in cows. Thus the
aim of the present study was (i) to estimate periph-
eral concentrations of total antioxidative capacity (TAC),
malondialdehyde (MDA) and nitric oxide (NO) during peri-
partum period and (ii) to study the expression of catalase
(CAT), glutathione peroxidase (GPx4) and superoxide dis-
mutase (SOD2) genes in uterine endometrium in Zebu cows
that did and did not develop postpartum uterine infection.
2. Materials and methods
The study was conducted on Zebu (Sahiwal) cows main-
tained at Livestock Research Centre of National Dairy
Please cite this article in press as: Baithalu, R.K., et al., Transcriptional abundance of antioxidant enzymes in
endometrium and their circulating levels in Zebu cows with and without uterine infection. Anim. Reprod. Sci. (2016),
http://dx.doi.org/10.1016/j.anireprosci.2016.12.008
Research Institute, Karnal, India. Sahiwal is one of the most
important descript dairy breed known for its high milk
yield (average 2270 kg of milk during a lactation), heat tol-
erance and disease resistance.
2.1. Experimental animals
A total number of 40 cows were selected during prepar-
tum period and out of these, 24 cows calved exactly one
day before or after the expected date of calving, were con-
sidered for the experiment. All the cows used in the study
were of 2–4 parity, apparently healthy, undergone nor-
mal calving without the occurrence of dystocia, retention
of fetal membrane and any other parturient problems and
were maintained under iso-managerial system under loose
housing system. The nutrient requirements of the animals
were mostly met with ad lib green fodder and measured
amount of concentrate as per National Research Council
(NRC, 2001) requirement. Animals for present experiment
were duly approved by Institute Animal Ethics Committee
(1705/Go/ac/13/CPCSEA).
2.2. Blood sampling protocol
Blood samples were collected from all the 24 experi-
mental cows on day −21, −7 (before calving), on the day of
calving (day 0) and day +7, +21 and
+35 (post calving) through jugular venipuncture using
®
9 mL blood serum collection tubes (Vacuette , Greiner Bio-
one Gmbh, Austria). Blood samples were kept at room
temperature for 1 h and centrifuged at 3000g for 15 min,
serum was separated and stored in cryovials at −20 ◦ C till
assay.
2.3. Endometrial biopsy sampling
Endometrial biopsy was performed using uterine biopsy
forceps (54 cm; M/S Hauptner, Solingen, Germany) on
the day of calving immediately after expulsion of fetal
membranes. All biopsies were performed by the same vet-
erinarian during the entire period of the study. Briefly,
animal was restrained and epidural anesthesia was admin-
istered. Biopsy instrument protected by sanitary sheath
was introduced into the vagina through the vulval open-
ing. The forcep was passed through the cervix, then to
the previously gravid horn (site of biopsy i.e. at the level
of bifurcation of uterine horns) by trans-rectal palpation.
Endometrial tissue was clipped off by closing jaws and the
instrument was withdrawn. The tissue was washed with
nuclease free water to remove any contamination of blood
and placed in RNA later (Qiagen, Austin, US) at room tem-
perature for 2 h and then samples were stored in −80 ◦ C till
further processing. Uterine fluid samples were obtained by
using universal gun with blue sheath.
2.4. Grouping of animals
All cows were evaluated for postpartum uterine infec-
tion on day 4, 10, 14, 17, 21, 24, 28, 35 and 42 postpartum
based on trans-rectal ultrasonography of uterus, uter-
ine fluid scoring and other clinical signs including rectal
G Model
ANIREP-5518; No. of Pages 9 ARTICLE IN PRESS
R.K. Baithalu et al. / Animal Reproduction Science xxx (2016) xxx–xxx
temperature. Cows with different grades of uterine infec-
tions were diagnosed as defined by Sheldon et al. (2009).
Briefly, puerperal metritis were diagnosed, if cows had a
fetid, watery uterine discharge with some necrotic debris,
flaccid uterus and associated with systemic signs of dis-
ease such as dullness, anorexia, fever (>39.5 ◦ C) within
21 says postpartum (especially within 10 days postpar-
tum). Clinical endometritis was confirmed when uterine
or cervico-vaginal fluid was purulent or mucopurulent in
nature at ≥3 weeks post partum. Cows that had undergone
normal puerperium without any postpartum uterine infec-
tion classified as normal (healthy) cows. Based on the above
criteria, cows were grouped into either normal (n = 11) or
puerperal metritic (n = 7) or clinical endometritic (n = 6)
2.5. Estimation of TAC, MDA, NO in the blood serum
Total antioxidant capacity was estimated in blood
serum by colorimetric assay (Quantichrome Antioxidant
Assay Kit; Bioassay Systems, USA). Malondialdehyde was
estimated using ELISA kit (USCN, Life Science Inc, China) as
per the protocols provided by the manufacturers. The stan-
dard curve and the concentration of TAC and MDA were
®
calculated using GraphPadPRISM 5.01 software package
(GraphPad software, USA). The minimal detectable concen-
tration of TAC and MDA were 1.5 ␮M trolox equivalent and
8.85 ng/mL, respectively.
The concentration of NO in serum was estimated using
modified Griess reaction as described by Shoker et al.
(1997). Briefly, serum proteins were precipitated using ace-
tonitrile (1:1 vol), vortexed thoroughly and held at room
temperature for a period of 1 h, followed by centrifuga-
tion at 7000 rpm for 5 min. Supernatant was transferred
to a 2 mL eppendorf tube and evaporated to dryness at
37 ◦ C. Contents were dissolved by adding equal volume
of mili Q water (same as serum sample taken initially for
deproteinization) and kept for 1 h at room temperature to
ensure complete solubilization of the contents. The stan-
dard curve was made using 1.56–100 ␮M concentration
of sodium nitrate (NaNO3 ). The nitrate content of sample
and standards were reduced to nitrite by taking samples
and standards in 96 well plate followed by addition of
vanadium chloride then Griess reagents (Greiss I reagent;
2% sulfanilamide in 5% HCl and Greiss II reagent; 0.1% N-
Naphthylethylendiaminedihydrochloride). The plate was
incubated at 37 ◦ C for 30 min and absorbance was read
at 540 nm wavelength in spectrophotometer (TECAN,
Seestrasse 103, Switzerland). The final concentration of
nitric oxide (␮M) in serum samples was calculated using
the linear regression equation.
2.6. Gene expression analysis
Real time expression of genes encoding antioxidative
enzymes such as CAT, GPx4, SOD2 were studied in endome-
trial tissue of cows that did and did not develop uterine
infection during postpartum period.
2.7. RNA isolation and quantitative real time PCR
Total RNA was isolated from 20 to 50 mg of endome-
trial tissue using RNeasy minikit (QIAGEN, Austin, US). The
Please cite this article in press as: Baithalu, R.K., et al., Transcriptional abundance of antioxidant enzymes in
endometrium and their circulating levels in Zebu cows with and without uterine infection. Anim. Reprod. Sci. (2016),
http://dx.doi.org/10.1016/j.anireprosci.2016.12.008
3
integrity of isolated RNA was checked using 1.5% agarose
gel electrophoresis. The concentration and purity of the
RNA samples was determined using Nano Quant Infinite
M200 PRO (TECAN, Seestrasse 103, and Switzerland). All
the samples had an A260/280 absorbance ratio between
1.85 and 2.0. The concentration of RNA from all the samples
was normalized to 500 ng/␮L. The cDNA was prepared from
RNA samples using cDNA synthesis kit (Thermoscientific,
U.S.) according to the manufacturers’ protocol.
2.8. Optimisation of quantitative real time PCR
(qRT-PCR)
PCR conditions for each gene were optimized
by semi-quantitative PCR using 0.5 ␮L of cDNA,
Green Master Mix (Thermoscientific, Wyman Street,
Waltham) and primers (0.25 ␮M). Primers were
designed from the bovine gene sequence data avail-
able at NCBI GenBank using Primer 3 software
(http://frodo.wi.mit.edu/cgi-bin/primer3/primer3 www.cgi).
Following optimization, the presence of a single product
was confirmed on a 1.5% agarose gel by electrophoresis.
Primer pair sequences along with optimized annealing
temperatures are presented in Table 1.
Quantitative real time PCR (qRT-PCR) was per-
formed on Light Cycler- 480 II (Roche Diagnostics, Basel,
Switzerland) using 2X-SYBR green master mix (Roche Diag-
nostics, Mannheim, Germany). For each sample and gene
transcript, a total reaction volume of 15 ␮L was prepared
containing 1 ␮L of cDNA, 1 ␮L each of (0.125 ␮M) forward
and reverse primer, 2X-SYBR green master mix (7.5 ␮L)
and rest of the volume adjusted with PCR grade water. To
ensure reproducibility and reduce variability, all samples
were run on a single plate and a non-template control was
also run on each plate in duplicate. The qRT-PCR analysis
was performed under following thermocyclic conditions:
5 min 95 ◦ C, 40 cycles of 95 ◦ C for 10 s, annealing tempera-
ture (Table 1) for 10 s and final extension at 72 ◦ C for 15 s.
To prevent acquisition of smaller non-specific products, a
melting curve analysis was performed. The relative gene
expression was calculated using the formula 2−Ct where,
Ct = Ct of the sample from cows that later turned into
either puerperal metritis or endometritis – Ct of the cali-
brator (sample from normal cows). The house keeping gene
used in the study was bovine beta actin. The efficiency of
the qRT-PCR reactions was similar between the gene of
interest and housekeeping gene.
2.9. Statistical analysis
Descriptive statistics were calculated for concentrations
of TAC, MDA and NO for all experimental groups (nor-
mal, puerperal metritic and clinical endometritic cows)
and the results were expressed as mean ± SEM. Two way
ANOVA using general linear model was performed to find
out the effects of experimental groups and period and
their interactions. Group wise multiple comparisons were
performed using Tukey’s post hoc test. The difference of
means was considered significant when the probability (P
value) was < 0.05. All the analyses were performed using
®
SigmaPlot 11 software (Systat software Inc., USA).
G Model
ANIREP-5518; No. of Pages 9 ARTICLE IN PRESS
4 R.K. Baithalu et al. / Animal Reproduction Science xxx (2016) xxx–xxx

Table 1
Primers used in real time PCR.

Primer Name Sequence Ta Amplicon Size (bp) Ac. No.

Cat F CATTGCGGGCCATCTGAAAG 58 97 NM 001035386.2

Cat R CTGGATGCGGGAGCCATATT
GPX4F ATACGCCGAGTGTGGTTTAC 59 99 NM 174770.3
GPx4 R CCAGCGGCGAACTCTTT
SOD 2F TCAATAAGGAGCAGGGACGC 60 85 NM 201527.2
SOD 2 R AGCAGGGGGATAAGACCTGT
Beta actin F AGATGACCCAGATCATGTTCGA 118 NM 173979
Beta actin R TCACCGGAGTCCATCACGAT

Receiver operating characteristics (ROC) curves were

performed to determine whether TAC, MDA and NO lev-
els can be potential marker for differentiating uterine
health status of cows during peripartum period. ROC
curves plotted sensitivity versus 1-specificity for the com-
plete range of cut-off points. Parameter was considered
for differentiation of uterine health status when area
under curve close to 1 is observed together with sta-
tistical significance (P < 0.05). Optimal cut off value of
TAC, MDA and NO was calculated with maximum sen-
sitivity (Se) and specificity (Sp) for differentiating the
normal cows from infected cows. Furthermore, optimum
cut off value was used to dichotomise all experimen- Fig. 1. Peripartum changes in serum total antioxidant capacity (TAC) in
tal cows into two health categories (if samples were normal cows (NC) and cows that developed puerperal metritis (PM) and
clinical endometritis (CE). A, B differs significantly (P < 0.05) between NC,
above or below the cut off value indicated as nega-
PM & CE.
tive (normal cows)) and below or above that indicated
as positive (cows with uterine infection i.e. puerperal 3.2. Malondialdehyde
metritis or clinical endometritis) and a simple 2 × 2 con-
tingency table was constructed to predict the relative The mean serum MDA concentration was significantly
risk (RR) for development of uterine infection in Sahiwal low on day −21, −7 and on the day of calving in the
cows. normal cows than puerperal metritic cows. Although the
Comparisons of gene expression between normal cows mean serum MDA concentration was higher in clinical
and cows that developed puerperal metritis and clinical endometritic cows throughout peripartum compared to
endometritis were tested using the non-parametric Mann- normal cows, however, significant difference was observed
Whitney test. Results were represented as mean ± S.E.M., only on the day −21, −7 and on day +7 and +35. When
and considered as significant when P < 0.05. Spearman’s comparison was made across the days in each group, mean
rank correlation co-efficient was used to determine the serum level of MDA was significantly higher on the day of
correlation among the different genes expression and calving compared to other days in both normal and puer-
peripheral level of TAC, MDA and NO. peral metritic cows. However, such clear trend was not
noticed in clinical endometritic cows.

3. Results 3.3. Nitric oxide

3.1. Total antioxidant capacity
The normal cows that had undergone normal puer-
perium had significantly (P < 0.05) higher concentration
of serum TAC during peripartum period than the cows
that suffered with either puerperal metritis (on day −7,
0, +7, +21 and +35) or clinical endometritis (on day −7,
0, +7 and + 21) (Fig. 1). There was no significant differ-
ence in the concentration of TAC in normal cows across
the sampling period, however, significant decrease in the
TAC concentration was observed on the day of calving and
day +7 compared to concentration on the day −21 in cows
that developed puerperal metritis and clinical endometritis
respectively.
The mean serum NO concentrations was significantly
(P < 0.05) higher on the day of calving, day +7 and +35 in
puerperal metritic cows compared to normal cows. When
the concentration of NO was compared between clinical
endometritic and normal cows, significant difference was
observed on day +7, +21 and +35. On comparison across the
days in normal cows, the mean serum concentration of NO
was significantly high on day −7 and on the day of calv-
ing than other days. Similarly, in puerperal metritic cows,
the mean concentrations of NO was significantly higher
(P < 0.05) on the day of calving compared to day −21, +21
and +35. However, the mean serum concentrations of NO
did not differ significantly across the days of sampling in
clinical endometritic cows (Figs. 2 and 3).

Please cite this article in press as: Baithalu, R.K., et al., Transcriptional abundance of antioxidant enzymes in
endometrium and their circulating levels in Zebu cows with and without uterine infection. Anim. Reprod. Sci. (2016),
http://dx.doi.org/10.1016/j.anireprosci.2016.12.008
G Model
ANIREP-5518; No. of Pages 9 ARTICLE IN PRESS
R.K. Baithalu et al. / Animal Reproduction Science xxx (2016) xxx–xxx
Fig. 2. Peripartum changes in serum malondialdehyde (MDA) in normal
cows (NC) and cows that developed puerperal metritis (PM) and clinical
endometritis (CE). A, B differs significantly (P < 0.05) between NC, PM &
CE.
Fig. 3. Peripartum changes in serum Nitric oxide (NO) in normal cows
(NC) and cows that developed puerperal metritis (PM) and clinical
endometritis (CE). A, B differs significantly (P < 0.05) between NC, PM &
CE.
3.4. Endometrial expression of genes encoding CAT, GPx4
and SOD2
The level of expression of genes encoding antioxidant
enzymes in the endometrial tissues on the day of calv-
ing are presented in Fig. 4. Expression of gene encoding
CAT enzyme was 10 and 5.2 folds lower in endometrial
tissue of cows that developed puerperal metritis and clin-
ical endometritis, respectively, as compared to normal
cows. Similarly, the endometrial tissue from cows that
developed puerperal metritis and clinical endometritis had
lower GPx4 gene expression (3.4 and 2.06 folds, respec-
tively) compared to normal cows. Contradict to above
findings, endometrial expression of SOD2 gene was higher
in cows that developed uterine infection (2.02 folds higher
in puerperal metritic cows and 2.3 folds higher in clinical
endometritic cows) than the normal cows.
Relationship among circulating levels of TAC, MDA,
NO and endometrial expression of antioxidative genes
The concentration of total antioxidants in the periph-
eral circulation was positively correlated (P < 0.01) with
the expression levels of antioxidative genes encoding CAT
and GPx4 in endometrial tissue and negatively corre-
lated with gene encoding SOD2 (Table 2). The correlation
between MDA concentration was found negative (P < 0.01)
with endometrial expression of CAT, GPx4, and positive
with expression of SOD2 (P < 0.05). Similarly, a negative
Please cite this article in press as: Baithalu, R.K., et al., Transcriptional abundance of antioxidant enzymes in
endometrium and their circulating levels in Zebu cows with and without uterine infection. Anim. Reprod. Sci. (2016),
http://dx.doi.org/10.1016/j.anireprosci.2016.12.008
5
correlation of peripheral NO concentration with endome-
trial expression of CAT (P < 0.05) and GPx4 was observed,
however, the relationship between circulating NO concen-
tration and endometrial expression of SOD2 (P < 0.001) was
positive.
3.5. Receiver operator characteristic (ROC) analysis and
relative risk (RR)
Area under curve (AUC) and optimum threshold val-
ues of TAC, MDA and NO at different time periods, along
with their corresponding Se, Sp and RR are presented in
Table 3. ROC curve analysis suggested that the optimum
serum TAC cut-off point and relative risk for development
of uterine infection was 120.6 ␮M and 3.75 times on day
−7, 121.3 ␮M and 6 times on day 0, 119.3 ␮M and infi-
nite times on day +7, 129.5 ␮M and 8.05 times on day
+21 and 129.2 ␮M and 2.26 times on day +35, respec-
tively. Similarly, cutoff values and relative risk of serum
MDA concentrations for development of postpartum uter-
ine infection was 247.7 ␮g/L and 4.58 times on day −21,
323.8 ␮g/L and 4.0 times on day −7, 378.5 ␮g/L and 6.8
times on day 0 and 292.6 ␮g/L and 4.0 times on day +7. Like-
wise, the blood concentrations of NO on day 0 (28.62 ␮M
and 1.5 times), day +7 (12.33 ␮M and infinite times), day
+21 (12.28 ␮M and 3.3 times) and day +35 (10.67 ␮M and
6.5 times) were more suitable for identifying the risk of
developing postpartum uterine infection.
4. Discussion
Impaired antioxidant to oxidative status leads to
oxidative damage resulting in immunosuppresion and
aggravate the inflammatory conditions (Valko et al., 2007;
Bhattacharyya et al., 2014). Several studies suggested that
oxidative stress during peripartum period increased the
susceptibility of dairy cows to postpartum infectious and
metabolic diseases (Bernabucci et al., 2005; Castillo et al.,
2005; Sordillo and Aitken, 2009). However, peripartum
changes in oxidative and antioxidative molecules and their
relationship with uterine health in dairy animals have not
been understood in detail. We report here that altered
concentrations of TAC, MDA and NO in peripheral circu-
lation and expression of CAT, GPx4 and SOD2 gene in
endometrium significantly contribute to development of
uterine infection in cows.
We observed that normal cows had high level of TAC
and low level of MDA and NO during peripartum period
than the cows that developed postpartum uterine infec-
tion. Further, it was observed that the TAC level in normal
cows was high and almost constant throughout peripartum
period. However, in cows that developed puerperal metri-
tis during postpartum, the concentration of TAC declined
towards parturition and lowest level was observed on the
day of calving. In clinical endometritic cows, the mean
concentration of TAC declined significantly towards par-
turition and lowest level was observed on day +7. In line
with our observations, Hanafi et al. (2008) and Heidarpour
et al. (2012) reported that low level of blood TAC level was
associated with endometritis in cows and buffaloes, respec-
tively. Antioxidants are scavengers that detoxify excess
G Model
ANIREP-5518; No. of Pages 9 ARTICLE IN PRESS
6 R.K. Baithalu et al. / Animal Reproduction Science xxx (2016) xxx–xxx

Fig. 4. Endometrial expression of genes encoding catalase (A), GPx4 (B) and SOD2 (C) on the day of calving in normal cows (NC) and cows that developed
puerperal metritis (PM) and clinical endometritis (CE) (*P < 0.05, ** P < 0.01, *** P < 0.001).

Table 2
Relationship of peripheral TAC, MDA, NO level with expression of genes encoding antioxidative enzymes in endometrial tissue in Sahiwal cows.

TAC MDA NO Catalase GPX4 SOD2 SOD3

TAC 1
MDA −0.804*** 1
NO −0.524 0.755** 1
Catalase 0.755** −0.804*** −0.671* 1
GPX4 0.86*** −0.783** −0.413 0.671* 1
SOD2 −0.886*** 0.666* 0.375 −0.68* −0.739** 1
SOD-3 −0.706** 0.895*** 0.86*** −0.853*** −0.699* 0.648* 1

*P < 0.05, ** P < 0.01, *** P < 0.001.

oxidants, which help in maintaining the body’s delicate oxi-
dant/antioxidant balance (Agarwal et al., 2012). However,
at low level they are unable to protect the cells against oxi-
dants resulting onset of various disease conditions (Miller
et al., 1993; Sordillo and Atiken, 2009). In the present
study, we observed cows that had lower concentration of
TAC during peripartum period developed postpartum uter-
ine infection. It is possible that antioxidant concentrations
observed in these animals were not sufficient to protect
cells and tissues against oxidative damage, compromising
the host defense system and ultimately resulted in devel-
opment of uterine diseases.
Malondialdehyde is considered as the final product of
lipid peroxidation and a marker of oxidative stress. Maxi-
mum level of MDA was observed on day −7, +7 with the
highest level on day of calving. In line with our obser-
vation, Heidarpour et al. (2012) have reported a higher
concentration of MDA in cows with uterine infection. It was
also reported that MDA levels were increased in a varieties
of inflammatory conditions including mastitis in does (El-
Deeb, 2013) and cows (Castillo et al., 2006), pneumonia
in calves (El-Bahr and EL-Deeb, 2013), during parturition
and early lactation in cows (Castillo et al., 2005, 2006). It is
known that productions of inflammatory diseases are asso-
ciated with elevated levels of oxidants. Malondialdehyde
is a reactive carbonyl compound and when its level is high
shows damaging effect on cells and alters their functioning
either by reacts with DNA to form DNA adducts or damage
the cellular protein (Pratico et al., 1998; Marnett, 1999).
Cows that have been exposed to high level of oxidative
stress indicated by very high peripheral concentrations of
MDA and low concentrations of peripheral TAC during peri-
partum period have suffered from acute uterine disorder
such as puerperal metritis during 10 days of postpartum.
After calving uterine endometrium is exposed to several
infectious agents (Sheldon et al., 2009) and prone to damag-

Please cite this article in press as: Baithalu, R.K., et al., Transcriptional abundance of antioxidant enzymes in
endometrium and their circulating levels in Zebu cows with and without uterine infection. Anim. Reprod. Sci. (2016),
http://dx.doi.org/10.1016/j.anireprosci.2016.12.008
G Model
ANIREP-5518; No. of Pages 9 ARTICLE IN PRESS
R.K. Baithalu et al. / Animal Reproduction Science xxx (2016) xxx–xxx 7

Table 3
Receiver operator characteristic (ROC) analysis of serum TAC, MAD and NO as predictor of postpartum uterine infections in Sahiwal cows.

Day AUC P-value Optimum threshold Se (%) 95% CI Sp (%) 95% CI RR

value

TAC (␮M)
−7 0.894 <0.001 120.6 83.33 58.58–96.42 90 55.50–99.75 3.75,
P <0.001
0 0.922 <0.001 121.3 88.89 65.29–98.62 100 69.15–100 6.00,
P < 0.001
7 0.969 <0.001 119.3 100 81.47–100 90 55.50–99.75 Inf.,
P < 0.001
21 0.927 <0.001 129.5 94.44 72.71–99.86 80 44.3–97.48 8.053,
P < 0.001
35 0.711 0.068 129.2 77.78 52.36–93.59 60 26.24–87. 84 2.26,
P = 0.020

Malonidialdehyde (␮g/L)
−21 0.897 0.001 247.7 84.62 54.55–98.08 88.89 51.75–99.72 4.58,
P = 0.002
−7 0.889 0.002 323.8 76.92 46.19–94.96 100 66.37–100 4.0,
P < 0.001
0 0.863 0.004 378.5 92.31 63.97–99.81 77.78 39.99–97.19 6.86,
P = 0.001
7 0.829 0.010 292.6 76.92 46.19–94.96 100 66.37–100 4.0,
P = 0.001

NO (␮moles/L)
0 0.552 0.66 28.62 38.46 13.86–68.42 81.82 48.2–97.72 1.52,
P = 0.386
7 1.000 <0.001 12.33 100 75.29–100 100 71.51–100 Inf.,
P < 0.001
21 0.846 0.004 12.28 76.92 46.19–94.96 81.82 48.22–97.72 3.33,
P = 0.014
35 0.846 0.004 10.67 84.62 54.55–98.08 100 71.51–100 6.50,
P < 0.001

AUC, area under curve;TAC, total antioxidant capacity; MAD, Malondialdehyde; NO, Nitric oxide; CI, confidence interval; Se, sensitivity; SP, specificity; inf,
infinite; RR, risk ratio.

ing effect of oxidants (Bernabucci et al., 2005; Castillo et al.,
2005), hence, high production of oxidants and low level
of total antioxidants may compromise the uterine defense
mechanism, resulting uterine health disorders.
Peripheral NO concentration was maximum on day
−7 and day of calving then declined to low level during
postpartum period in normal cows. However, puerperal
metritic cows had maximum concentration of NO on day
−7 and +7 with peak level on the day of calving and
then declined towards day +21. Similarly, those cows
developed clinical endometritis maintained a persistent
high level of NO during peripartum period with peak on
day +21. Although literature pertaining to NO concen-
trations during peripartum period in cattle seems to be
scanty, however, Li et al. (2010) have reported high periph-
eral NO concentration in uterine infection than normal
cows. Similarly, Mili and Pandita (2014) have observed
high level of NO in buffaloes with uterine infection than
normal buffaloes. Further, higher endometrial expression
of gene encoding nitric oxide synthase (NOS) was also
observed in cows that developed uterine infection during
first week after calving (Herath et al., 2009). Nitric oxide
is an inflammatory mediator synthesized by different cells
e.g. macrophages, neutrophils, epithelial and endothelial
cells and play important role in mediating cytoimmunity
and inflammation toxicity (Frean et al., 1997; Korhonen
et al., 2005). In human, increased level of NO (almost
100-fold) is associated with pelvic inflammatory disease
conditions (Sioutas et al., 2008). Nitric oxide when reacted
with O2 − produced strong oxidant i.e. peroxidize deuto-
nitrate (ONOO-) which damage the integrity of cells and
tissues and aggravate the inflammatory reactions (Padmaja
and Huie, 1993; Pacher et al., 2007). It has also been
reported that ROS/RNS are also involved in the activa-
tion of several transcription factors, such as NF-kB and
AP-1 that leads to production of several pro-inflammatory
cytokines (TNF␣, IL-1␤, IL-6, IL-8) and adhesive proteins
and aggravate the inflammatory reaction and inducing cell
death (Barnes and Karin, 1997). Hence, high concentrations
of oxidants like MDA and NO and low concentrations of
antioxidants (TAC) during peripartum period (on day −7,
0 and +7, +21 and +35) resulted oxidative stress condi-
tion which compromise the uterine defense mechanism
to eliminate the infection leading to colonization and per-
sistence of infection resulting in development of uterine
health disorders.
Role of oxidative and antioxidative molecules including
their levels has been well studied in different physiological
(Castillo et al., 2005; Konvicna et al., 2015) and disease con-
ditions (Castillo et al., 2006; Hanafi et al., 2008; Heidarpour
et al., 2012), however, peripartum alterations in antiox-
idant and pro-oxidant molecules and their influence on
endometrial expression of genes encoding antioxidative
enzymes in cows has not been explored. We observed
that genes encoding CAT and GPx4 expression were sig-
nificantly lower and gene encoding SOD2 expression was

Please cite this article in press as: Baithalu, R.K., et al., Transcriptional abundance of antioxidant enzymes in
endometrium and their circulating levels in Zebu cows with and without uterine infection. Anim. Reprod. Sci. (2016),
http://dx.doi.org/10.1016/j.anireprosci.2016.12.008
G Model
ANIREP-5518; No. of Pages 9 ARTICLE IN PRESS
8 R.K. Baithalu et al. / Animal Reproduction Science xxx (2016) xxx–xxx
significantly higher in endometrial tissue of cows that
developed uterine infection as compared to normal cows.
It is likely that lower antioxidant activity (i.e. CAT and
GPx4) and higher SOD2 activity in endometrium provided
an environment that was more prone to lipid peroxida-
tion in cows that developed uterine infection. One possible
explanation for this differential expression is that higher
activity of SOD2 and lower activity of CAT and GPx4 may
lead to more productions of free hydroxyl radicals that
are highly reactive and could aggravate the inflammation
and cell damage (Mello Filho et al., 1984) and compro-
mise the uterine health in cows. We have also observed
a significant correlation between peripheral concentra-
tions of MDA, NO and antioxidant enzymes expression in
endometrial tissue suggesting that endometrial expression
of antioxidative enzymes may be regulated by circulat-
ing level of oxidative and antioxidative molecules. Kizil
et al. (2010) have also reported lower concentration of CAT
and GPx4 activity associated with high peripheral levels
of MDA in cows with acute metritis compared to normal
cows. Konvicna et al. (2015) have also observed a reduction
of antioxidative defense activity including GSH-Px activ-
ity with increase of MDA and SOD activity during initial
period after parturition as compared to late pregnancy
and late lactation. Sordillo (2013) suggested that oxidative
stress could lead to dysfunction of host immune system and
inflammatory responses that can increase the incidence
and severity of infectious diseases also supports our results
on altered expression of anti- and pro-oxidative molecules
in endometrium and systemic circulation associated with
uterine infection in cows.
Using receiver operator characteristic (ROC) analysis,
we tested the accuracy of differentiating cows with nor-
mal uterine health from cows with uterine infection based
on antioxidative and oxidative molelecules. ROC curved
revealed that serum levels of TAC could be considered
as sensitive and specific molecule on day −7 to day +35
to differentiate the healthy cows from uterine infected
cows. Although similar type of study was scanty, how-
ever, studies on different aspects have shown TAC as a
potential marker for differentiating seminal quality in male
(Mahfouz et al., 2009), diagnosis of thyroid cancer (Wang
et al., 2011). Similarly, MDA could accurately differentiate
healthy cows from uterine infected cows on day −21 to day
+7. Kizil et al. (2010) also reported plasma MDA level above
183 ␮g/L increased the risk for development of puerperal
metritis in cows. Other studies have also reported MDA as a
reliable marker for predicting different inflammatory con-
ditions including appendicitis (Kavakli et al., 2011), male
infertility (Amarasekara et al., 2014) and for diagnosis and
prognosis of atherosclerosis (Heinecke, 2003). Similarly,
peripheral NO level on day +7 could accurately predict the
uterine health status in cows. It is difficult to compare our
results as there is no report available showing association
between NO and uterine health in dairy animals. However,
other studies reported NO as a potential marker for diag-
nosis and predicting outcome of various disease conditions
including neonatal sepsis (Kadir et al., 2015), hepatopor-
tal sclerosis (Purnak et al., 2012), hepatocellular carcinoma
(Moety and Moety, 2011).
Please cite this article in press as: Baithalu, R.K., et al., Transcriptional abundance of antioxidant enzymes in
endometrium and their circulating levels in Zebu cows with and without uterine infection. Anim. Reprod. Sci. (2016),
http://dx.doi.org/10.1016/j.anireprosci.2016.12.008
5. Conclusions
In conclusion, the present study has highlighted the
peripheral changes in oxidant/antioxidant molecules (TAC,
MDA and NO concentrations) in association with endome-
trial expression of genes encoding antioxidative genes in
relation to development of postpartum uterine infection
in zebu cows. Results suggest that low serum TAC level
and high level of MDA and NO during peripartum period
influenced the endometrial expression of anitioxidative
genes that compromised the uterine health resulting devel-
opment of postpartum puerperal metritis and clinical
endometritis in cows. Hence, high magnitude of oxidative
stress during prepartum and immediate period after par-
turition could be the possible reason for development of
postpartum uterine infection in dairy cows.
Conflict of interest
None of the authors have any conflict of interest to
declare.
Acknowledgements
The authors thank the Indian Council of Agricultural
Research, Government of India, the Director, ICAR-National
Dairy Research Institute, Karnal, Haryana and the Director,
ICAR-Indian Veterinary Research Institute, Bareilly, U.P.,
India for providing necessary facilities and logistics support
to conduct the study.
References
Agarwal, A., Aponte-Mellado, A., Premkumar, B.J., Shaman, A., Gupta, S.,
2012. The effects of oxidative stress on female reproduction: a
review. Reprod. Biol. Endocrinol. 10, 49.
Amarasekara, D.S., Wijerathna, S., Fernando, C., Udagama, P.V., 2014.
Cost-effective diagnosis of male oxidative stress using the nitroblue
tetrazolium test: useful application for the developing world.
Andrologia 46, 73–79.
Barnes, P.J., Karin, M., 1997. Nuclear factor-kB–a pivotal transcription
factor in chronic inflammatory diseases. N. Engl. J. Med. 336,
1066–1071.
Bartlett, P.C., Kirk, J.H., Wilke, M.A., Kaneene, J.B., Mather, E.C., 1986.
Metritis complex in Michigan Holstein-Friesian cattle: incidence,
descriptive epidemiology and estimated economic impact. Prev. Vet.
Med. 4, 235–248.
Bernabucci, U., Ronchi, B., Lacetera, N., Nardone, A., 2005. Influence of
body condition score on relationships between metabolic status and
oxidative stress in periparturient dairy cows. J. Dairy Sci. 88,
2017–2026.
Bhattacharyya, A., Chattopadhyay, C., Mitra, S., Crowe, S.E., 2014.
Oxidative stress: an essential factor in the pathogenesis of
gastrointestinal mucosal diseases. Physiol. Rev. 94 (2), 329–354.
Castillo, C., Hernandez, J., Bravo, A., Lopez-Alonso, M., Pereira, V.,
Benedito, J.L., 2005. Oxidative status during late pregnancy and early
lactation in dairy cows. Vet. J. 169 (2), 286–292.
Castillo, C., Hernandez, J., Valverde, I., Pereira, V., Sotillo, J., Lopez Alonso,
M., Benedito, J.L., 2006. Plasma malondialdehyde (MDA) and total
antioxidant status (TAS) during lactation in dairy cows. Res. Vet. Sci.
80 (2), 133–139.
El-Bahr, S.M., EL-Deeb, W.M., 2013. Acute phase proteins, lipid profile
and proinflammatory cytokines in healthy and bronchopneumonic
water buffalo calves. Am. J. Biochem. Biotechnol. 9, 34–40.
El-Deeb, W.M., 2013. Clinico-biochemical investigations of gangrenous
mastitis in does: immunological responses and oxidative stress
biomarkers. J. Zhejiang Univ. Sci. B 14, 33–39.
Finkel, T., 2011. Signal transduction by reactive oxygen species. J. Cell
Biol. 194, 7–15.
G Model
ANIREP-5518; No. of Pages 9 ARTICLE IN PRESS
R.K. Baithalu et al. / Animal Reproduction Science xxx (2016) xxx–xxx
Frean, S.P., Bryant, C.E., Frolin, I.L., Elliott, J., Lees, P., 1997. Nitric oxide
production by equine articular cells in vitro. Equine Vet. J. 29, 98–102.
Goshen, T., Shpigel, N.Y., 2006. Evaluation of intrauterine antibiotic
treatment of clinical metritis and retained fetal membranes in dairy
cows. Theriogenology 66, 2210–2218.
Hammon, D.S., Evjen, I.M., Dhiman, T.R., Goff, J.P., Walters, J.L., 2006.
Neutrophil function and energy status in Holstein cows with uterine
health disorders. Vet. Immunol. Immunopathol. 113, 21–29.
Hanafi, E.M., Ahmed, W.M., Abd El Moez, S.I., El Khadrawy, H.H., Abd El
Hameed, A.R., 2008. Effect of clinical endometritis on ovarian activity
and oxidative stress status in egyptian Buffalo-Cows. Am. Eurasian J.
Agric. Environ. Sci. 4 (5), 530–536.
Heidarpour, M., Mohri, M., Fallah-Rad, A.H., Shahreza, F.D., Mohammad,
M., 2012. Oxidative stress and trace elements before and after
treatment in dairy cows with clinical and subclinical endometritis.
Rev. Med. Vet. 163 (12), 628–633.
Heinecke, J.W., 2003. Oxidative stress: new approaches to diagnosis and
prognosis in atherosclerosis. Am. J. Cardiol. 6, 12A–16A.
Herath, S., Lilly, S.T., Santos, N.R., Gilbert, R.O., Goetze, L., Bryant, C.E.,
White, J.O., Cronin, J.O., Sheldon, I.M., 2009. Expression of genes
associated with immunity in the endometrium of cattle with
disparate postpartum uterine disease and fertility. Rep. Biol.
Endocrinol. 7, 55.
Kadir, M.R., Yuniati, T., Somasetia, D.H., 2015. Serum nitric oxide as early
predictor of poor outcome in neonatal sepsis. Am. J. Infect. Dis.
Microbiol. 3 (4), 137–140.
Kavakli, H.S., Erel, O., Becel, S., 2011. Oxidative stress in diagnosis of
acute appendicitis patients. Sci. Res. Essays 6 (8), 1766–1770.
Kizil, O., Akar, Y., Yuksel, M., Saat, N., 2010. Oxidative stress in cows with
acute puerperal metritis. Rev. Med. Vet. 161 (7), 353–357.
Konvicna, J., Vargova, M., Paulíkova, I., Kovac, G., Kostecka, Z., 2015.
Oxidative stress and antioxidant status in dairy cows during
prepartal and postpartal periods. Acta Vet. Brno 84, 133–140.
Korhonen, R., Lahti, A., Kankaanranta, H., Moilanen, E., 2005. Nitric oxide
production and signaling in inflammation. Curr. Drug Targets
Inflamm. Allergy 4, 471–479.
Le Blanc, S.J., Duffield, T.F., Leslie, K.E., Bateman, K.G., Keefe, G.P., Walton,
J.S., Johnson, W.H., 2002. Defining and diagnosing postpartum
clinical endometritis and its impact on reproductive performance in
dairy cows. J. Dairy Sci. 85, 2223–2236.
Li, D., Liu, Y., Li, Y., Lv, Y., Pei, X.Y., Guo, D., 2010. Significance of nitric
oxide concentration in plasma and uterine secretes with puerperal
endometritis in dairy cows. Vet. Res. Commun. 34, 315–321.
Mahfouz, R., Sharma, R., Sabanegh, E., Agarwal, A., 2009. Diagnostic value
of the total antioxidant capacity (TAC) in human seminal plasma.
Fertil. Steril. 91 (3), 805–811.
Marnett, L.J., 1999. Lipid peroxidation – DNA damage by
malondialdehyde. Mutat. Res. 424 (1–2), 83–95.
McDougall, S., Macaulay, R., Compton, C., 2007. Association between
endometritis diagnosis using a novel intravaginal device and
reproductive performance in dairy cattle. Anim. Reprod. Sci. 99,
9–23.
Mello Filho, A.C., Hoffmann, M.E., Meneghini, R., 1984. Cell killing and
DNA damage by hydrogen peroxide are mediated by intracellular
iron. Biochem. J. 218, 273–275.
Please cite this article in press as: Baithalu, R.K., et al., Transcriptional abundance of antioxidant enzymes in
endometrium and their circulating levels in Zebu cows with and without uterine infection. Anim. Reprod. Sci. (2016),
http://dx.doi.org/10.1016/j.anireprosci.2016.12.008
9
Mili, B., Pandita, S., 2014. Association of selected humoral and cell
mediated immuno mediators with postpartum reproductive
disorders in buffaloes. J. Cell Tissue Res. 14 (3), 4491–4494.
Miller, J.K., Brzezinska-Slebodzinska, E., Madsen, F.C., 1993. Oxidative
stress, antioxidants, and animal function. J. Dairy Sci. 76 (9),
2812–2823.
Moety, A.A., Moety, H.A., 2011. Evaluation of nitric oxide as a novel
diagnostic marker for hepatocellular carcinoma. Alexandria J. Med.
47 (1), 31–35.
National Research Council, 2001. Nutrient Requirements of Dairy Cattle,
Seventh revised edition. The National Academies Press, Washington,
DC.
Pacher, P., Beckman, J.S., Liaudet, L., 2007. Nitric oxide and peroxynitrite
in health and disease. Physiol. Rev. 87, 315–424.
Padmaja, S., Huie, R.E., 1993. The reaction of nitric oxide with organic
peroxyl radicals. Biochem. Biophys. Res. Commun. 195, 539–544.
Pratico, D., Iuliano, L., Basili, S., Ferro, D., Camastra, C., Cordova, C.,
FitzGerald, G.A., Violi, F., 1998. Enhanced lipid peroxidation in
hepatic cirrhosis. J. Invest. Med. 46 (2), 51–57.
Purnak, T., Beyazit, Y., Ibis, M., Koklu, S., Efe, C., Ozaslan, E., Ciftci, A.,
Tenlik, I., 2012. The involvement of nitric oxide in the
physiopathology of hepatoportal sclerosis. Clin. Biochem. 45
(16–17), 1450–1454.
Sheldon, I.M., Cronin, J., Goetze, L., Donofrio, G., Schuberth, H.J., 2009.
Defining postpartum uterine disease and the mechanisms of
infection and immunity in the female reproductive tract in cattle.
Biol. Reprod. 81, 1025–1032.
Sheldon, I.M., 2004. The post-partum uterus. Vet. Clin. North Am. Food
Anim. Pract. 20, 569–591.
Shoker, A.S., Humanly, Y., Murabit, M.A., Hadeeah, J., ALGhoul, A., Kamal,
O., 1997. Analysis of in vitro effect of exogenosnitric oxide on human
lymphocytes. Mol. Cell. Biochem. 171, 75–83.
Sioutas, A., Ehren, I., Lundberg, J.O., Wiklund, N.P., Gemzell-Danielsson,
K., 2008. Intrauterine nitric oxide in pelvic inflammatory disease.
Fertil. Steril. 89, 948–952.
Sordillo, L.M., Aitken, S.L., 2009. Impact of oxidative stress on the health
and immune function of dairy cattle. Vet. Immunol. Immunopathol.
128 (1–3), 104–109.
Sordillo, L.M., 2013. Selenium-dependent regulation of oxidative stress
and immunity in periparturient dairy cattle. Vet. Med. Int. 2013,
2013.
Valko, M., Leibfritz, D., Moncol, J., Cronin, M.T., Mazur, M., Telser, J., 2007.
Free radicals and antioxidants in normal physiological functions and
human disease. Int. J. Biochem. Cell Biol. 39, 44–84.
Vaziri, N.D., 2008. Causal link between oxidative stress, inflammation,
and hypertension. Iran. J. Kidney Dis. 2, 1–10.
Wang, D., Feng, J., Zeng, P., Yang, Y., Luo, J., Yang, Y., 2011. Total
oxidant/antioxidant status in sera of patients with thyroid cancers.
Endocr. Relat. Cancer 18, 773–782.
Willcox, J.K., Ash, S.L., Catignani, G.L., 2004. Antioxidants and prevention
of chronic disease. Review. Crit. Rev. Food. Sci. Nutr. 44, 275–295.
Young, I., Woodside, J., 2001. Antioxidants in health and disease. J. Clin.
Pathol. 54, 176–186.