Developmental and Comparative Immunology 74 (2017) 178e189

Contents lists available at ScienceDirect

Developmental and Comparative Immunology

journal homepage: www.elsevier.com/locate/dci

Oral DNA vaccines based on CS-TPP nanoparticles and alginate

microparticles confer high protection against infectious pancreatic
necrosis virus (IPNV) infection in trout
Sohrab Ahmadivand a, Mehdi Soltani a, b, *, Mahdi Behdani c, Øystein Evensen d,
Ehsan Alirahimi c, Reza Hassanzadeh e, Ellahe Soltani f
a
Department of Aquatic Animal Health, Faculty of Veterinary Medicine, University of Tehran, P.O. Box 14155-6453, Tehran, Iran
b
Centre of Excellence of Aquatic Animal Health, University of Tehran, Tehran, Iran
c
Biotechnology Research Center, Venom & Biotherapeutics Molecules Laboratory, Pasteur Institute of Iran, Tehran, Iran
d
Department of Basic Sciences and Aquatic Medicine, Faculty of Veterinary Medicine and Biosciences, Norwegian University of Life Sciences, Oslo, Norway
e
Central Veterinary Laboratory, Iran Veterinary Organization, Tehran, Iran
f
Department of Microbiology, Faculty of Sciences, University of Tehran, Tehran, Iran

a r t i c l e i n f o a b s t r a c t

Article history: Infectious pancreatic necrosis virus (IPNV) is the etiological agent of a contagious viral disease causing
Received 19 March 2017 remarkable mortalities in different fish species. Despite the availability of commercial vaccines against
Received in revised form IPN, the disease still constitutes one of the main threats to the aquaculture industry worldwide. In this
3 May 2017
study, we developed a DNA vaccine encoding the VP2 gene of IPNV and evaluated its ability to induce
Accepted 3 May 2017
Available online 4 May 2017
protective immunity in rainbow trout fry (3 g) at doses of 10 and 25 mg/fish and boosting with the same
doses two weeks later through the oral route using chitosan/tripolyphosphate (CS-TPP) nanoparticles
and alginate microparticles incorporated into fish feed. The distribution of the administered vaccines in
Keywords:
IPNV
different organs and transcription of VP2 gene were confirmed by RT-PCR assay at day 30 post boost-
Trout vaccination. Transcript levels of IFN-1, Mx-1, IgM, IgT and CD4 genes was dependent on vaccine dose
Oral DNA vaccine and was significantly up-regulated in head kidney of all orally vaccinated fish groups compared to
CS-TPP nanoparticles controls (pcDNA3.1). Cumulative mortalities post-challenge with virulent isolate of the virus were lower
Alginate microparticles in the vaccinated fish and a relative percentage survival (RPS) of 59% and 82% were obtained for the 10
and 25 mg/fish pcDNA3.1-VP2 groups, respectively. Vaccination with the same amount of pcDNA3.1-VP2
encapsulated with CS-TPP nanoparticles resulted in RPS of 47 %and 70%, respectively. Detectable anti-
IPNV antibodies were shown until 90 days postvaccination. The orally administrated vaccines signifi-
cantly decreased VP4 transcripts thus contributing to reducing viral load in surviving fish on day 45 post-
challenge. In conclusion, these results show good to high protection post-vaccination alongside with
significant up-regulation of key immune genes and detectable levels of circulating antibodies after oral
administration of the DNA vaccine formulated in CS-TPP nanoparticles and alginate microparticles in fish
feed.
© 2017 Elsevier Ltd. All rights reserved.

1. Introduction viral infections (Brudeseth et al., 2013; Gudding et al., 2014).

Vaccination is the most effective method for prevention of in-
fectious diseases, however, most commercially available vaccines
are targeting bacterial diseases and there are relatively few against
* Corresponding author. Faculty of Veterinary Medicine, University of Tehran,
Tehran, Iran.
E-mail address: msoltani@ut.ac.ir (M. Soltani).
However, a number of vaccines such as live, formalin or heat
inactivated whole virus, fusion protein, subunit, virus-like particles,
and DNA vaccines have been tested experimentally against some
viral diseases of fish (Gudding et al., 2014; Munang'andu and
Evensen, 2015). DNA vaccine technology can provide safe and un-
der given conditions more effective vaccine, and have been shown
to induce strong innate immune responses, as well as humoral and
cellular adaptive immunities (Heppell and Davis, 2000; Kurath,
2005. Overview of recent DNA vaccine development for fish. In

http://dx.doi.org/10.1016/j.dci.2017.05.004
0145-305X/© 2017 Elsevier Ltd. All rights reserved.
 S. Ahmadivand et al. / Developmental and Comparative Immunology 74 (2017) 178e189
Progress in Fish Vaccinology (ed. Midlyng and Karger). Basel; pp.
201e213.)
DNA vaccines consist of plasmid DNA that are delivered through
the intramuscular route and encodes specific proteins expressed in
cells of the inoculated host inducing strong and long-lasting im-
munity. Oral delivery is preferred from a user viewpoint and is
almost stress-free to the fish (Embregts and Forlenza, 2016). Some
antigen-encapsulation methods have been tested for oral delivery
of vaccines against lymphocystis disease virus (LCDV; Tian et al.,
2008), infectious pancreatic necrosis virus (IPNV; de las heras
et al., 2010), infectious hematopoietic necrosis virus (IHNV;
Adomako et al., 2012; Ballesteros et al., 2015) and betanodavirus
infection (Vimal et al., 2014).
Many studies have been performed evaluating the microparti-
cles and nanoparticles (NPs) for oral delivery of DNA vaccines in
fish, however, nanoparticles are thought to be superior to micro-
particles because of the size consistency compared to microparti-
cles (Gregory et al., 2013; Vimal et al., 2014; Ballesteros et al., 2015).
Immune responses due to intestinal antigen uptake and the
related mechanisms are well documented as reviewed elsewhere
(Lokka and Koppang, 2016). Encapsulation of DNA vaccine is a
suitable strategy to deliver antigens at mucosal surface for inducing
immunity by targeting microfold (M)-like cells in higher verte-
brates and translocation to antigen presenting cells in the sub-
epithelial compartment (dendritic cells and macrophages) for
initiation of CD8 cytotoxic T cell responses (MHC-I pathway), CD4
helper T cells engagement (MHC-II pathway), as well as natural
killer (NK) cell activation (Tonheim et al., 2008; Fuglem et al., 2010;
Mutoloki et al., 2015). The orally delivered antigen can also activate
the antigen-specific B cells and antibody production via CD4 cells
resulting in adaptive humoral immune response (Tonheim et al.,
2008; Embregts and Forlenza, 2016). Furthermore, plasmid back-
bone contains unmethylated CpG motifs be adjuvants that bind to
Toll-like receptor 9 (TLR9) that initiates signal transduction
resulting in cellular immune response (Pietretti and Wiegertjes,
2014). Moreover, up-regulation of many genes related to innate
and adaptive-immune responses have been reported after oral DNA
vaccination of fish (Ballesteros et al., 2012, 2014 and 2015). None-
theless, antigen type, dose, encapsulation as well as delivery
methods influence all of the mentioned immune responses and
vaccine efficacy (reviewed in Embregts and Forlenza, 2016).
Chitosan and alginate are cationic and anionic biopolymers,
respectively, have received much attention and been extensively
studied for nano/micro encapsulation in different types of fish
vaccines that their properties and formulation methods have been
extensively reviewed elsewhere (Plant and Lapatra, 2011; Ji et al.,
2015; Mutoloki et al., 2015; Embregts and Forlenza, 2016).
Chitosan is non-toxic, biocompatible and biodegradable
biopolymer with the advantage of mucoadhesion which results in
the particles adhering to the mucus membrane facilitating delivery
(Takeuchi et al., 1996; Rao and Sharma, 1997). An alternative to
chitosan-based delivery systems for oral application is the chitosan/
tripolyphosphate (CS-TPP) nanoparticles, which is simple to pre-
pare and safe for use and has been used to encapsulate peptides and
proteins (Xu and Du, 2003), siRNA (Katas and Alpar, 2006), shRNA
(Wang et al., 2009), deliver drugs (Lam et al., 2006) as well as oral
plasmid DNA (Csaba et al., 2009; Vimal et al., 2012, 2014). The safety
and efficacy of CS-TPP nanoparticles have also been shown for oral
delivery of DNA vaccines against bacterial and viral pathogens of
fish (Vimal et al., 2012, 2014). As Vimal et al. (2014) reported,
administration of 100 mg/fish of an oral DNA vaccine encapsulated
with CS-TPP nanoparticles inducing the 60% protection in 10e15 g
Asian sea bass (Lates calcarifer) against nodavirus.
However, alginate particles to deliver some bacterins to fishes
have not resulted in an enough protection (Romalde et al., 2004;
179
Altun et al., 2010; Leal et al., 2010). Research into alginate de-
livery of DNA vaccines against viral pathogens of fishes such as
LCDV, IHNV and IPNV suggests an alternative effective delivery
strategy (Tian et al., 2008; de las heras et al., 2010; Ballesteros et al.,
2015).
IPNV is the etiological agent of a highly contagious viral disease,
infectious pancreatic necrosis (IPN), causing high mortalities in
different fish species worldwide (Reno, 1999; Evensen and Santi,
2008). The IPNV belongs to the family Birnaviridae, genus Aqua-
birnavirus with the bisegmented genome (A and B) of double-
stranded RNA where segment A is the largest segment (approxi-
mately 3.1 kbp). Segment A encodes VP2 that contains most of the
neutralizing epitopes of the virus (Tarrab et al., 1993; Frost et al.,
1995; Fridholm et al., 2007) and structural protein VP3 and the
protease, VP4. It also encodes a non-structural protein of unknown
function, VP5 (Evensen and Santi, 2008). IPNV infects both fry and
juveniles of farmed and wild fish e.g. Atlantic salmon, brook trout
and rainbow trout resulting in high morbidity and mortality
(Evensen and Santi, 2008). Moreover, the IPNV establishes lifelong
asymptomatic carriers shedding and spreading of the virus
(Rodriguez Saint-Jean et al., 1991; Johansen and Sommer, 1995).
Oral DNA vaccines are considered as a new strategy and ideal way
to immunize large numbers of small fish against IPNV (reviewed in
Evensen and Leong, 2013; Gudding et al., 2014; Hølvold et al., 2014;
Embregts and Forlenza, 2016). Ballesteros et al. (2014) showed high
protection (RPS ¼ 78%) of rainbow trout fry (1.5 g) against IPNV
using administration of 3 consecutive days of 10 mg/day/fish of VP2-
encoding DNA vaccine encapsulated in alginate microsphere in
feed. Nonetheless, considering the renewal period of intestinal
epithelium in the second gut segment depends on temperature and
fish species (10e15 days at 20  C) and antigen breakdown in the
harsh gastric and the high tolerogenic gut environment, optimizing
the time and dose of DNA plasmid delivery as well as the appro-
priate vaccine design is important for successful oral DNA vacci-
nation (Embregts and Forlenza, 2016).
In the present study, we constructed a DNA vaccine encoding
the VP2 protein of a prevalent isolate of IPNV (Sp strain) in trout
farms and examined its efficacy by testing different doses and
boosting 2 weeks later using oral delivery with CS-TPP nano-
particles and alginate microparticles incorporated into fish feed.
2. Materials and methods
2.1. Virus and cell culture
A prevalent isolate of the IPNV (Sp strain) in Iranian trout farms
was propagated in CHSE-214 cells (Fryer et al., 1965) for use in
immunoassays and for challenge of fish. The cells were cultured in
Minimal Essential Medium (MEM) supplemented with 10% FBS, L-
glutamine, 100 IU penicillin G and 100 mg/ml of streptomycin. The
virus was titrated according to Reed and Muench (1938).
2.2. Fish
Healthy rainbow trout (O. mykiss) weight of 3 ± 0.32 g were
obtained from a local hatchery in Tehran province (Firuzkuh city).
Fish were maintained at the faculty of veterinary medicine (Uni-
versity of Tehran, Tehran) laboratory with a flow-through system of
fresh water (7 L/min) at 15  C, and fed daily with a pelleted diet
(Skretting, UK). Fish were acclimatized for 2 weeks in the labora-
tory before vaccination. All applicable guidelines for the care and
use of animals were followed.
180 S. Ahmadivand et al. / Developmental and Comparative Immunology 74 (2017) 178e189
2.3. Construction of the DNA vaccine (pcDNA3.1-VP2)
The VP2 gene of IPNV was cloned into a eukaryotic expression
vector pcDNA3.1 (Invitrogen, USA) under the control of the cyto-
megalovirus (CMV) promoter, yielding pcDNA3.1-VP2. The
pcDNA3.1-VP2 was verified using HindIII and XhoI endonuclease
analysis and the recombinant plasmid was then amplified in
Escherichia coli (TOP10), and the cells were grown in LB broth with
ampicillin. The constructed plasmid DNA was then isolated with
the Endofree Plasmid Mega Purification Kit (Qiagen, USA) according
to the manufacturer's instructions. The DNA concentration was
measured using a spectrophotometer (NanoDrop 2000, Thermo
scientific, Spain), and stored at 20  C until use.
2.4. Encapsulation of DNA vaccine
The pcDNA3.1-VP2 and pcDNA3.1 plasmids were encapsulated
in sodium alginate microparticles and CS-TPP nanoparticles as
described previously (Bozkir and Saka, 2004; de las heras et al.,
2010), lyophilized and stored at 4  C. Briefly, an equal volume of
heated CS-TPP (prepared by ionic gelation process; Vimal et al.,
2012) and pcDNA3.1-VP2 solutions was quickly mixed together
and vortexed at 2500 rpm for 30 s. The pcDNA3.1-VP2 loaded CS-
TPP particles were separated by centrifugation at 20,000 rpm for
30 min at 10  C.
For preparation of microparticles, 1.5 mL of pcDNA-VP2 (1 mg/
ml) were mixed with 2.5 mL of sodium alginate (3% w/v), then the
mixture after stirrer (10 min at 500 rpm) was emulsified (30 min at
900 rpm) with Span 80 (0.5 ml) and paraffin oil (100 mL). A volume
of 2.5 ml of 0.15 M CaCl2 was then added to the emulsion and
stirred at 900 rpm for 2 h. Alginate microparticles were collected by
centrifugation (10 min at 1000g) and washed with ethanol (70%).
The unbound pcDNA-VP2 content in the supernatants was
quantified by UV spectrophotometer at 260 nm. The encapsulation
efficiency (EE) was calculated using the following equation:
EE ¼ [(Total amount of pcDNA3.1-VP2  Free amount of
pcDNA3.1-VP2 in supernatant)/Total amount of pcDNA3.1-
VP2]  100.
2.5. Vaccination
Rainbow trout (3 ± 0.32) g were orally immunized with feed
pellets at 5% of body weight containing alginate microparticles and
CS-TPP nanoparticles loaded with pcDNA3.1-VP2 (named
AlgepcDNAVP2 and CS-TPPepcDNAVP2, respectively) in separate
trial groups (each group 90 fish) at temperature 15  C for 90 days.
The feed pellets containing vaccine were prepared according to
Ballesteros et al. (2014).
Two groups of trout were immunized with vaccine-coated feed
pellets containing CS-TPP nanoparticles loaded with 10 or 25 mg of
pcDNA3.1-VP2 and boosted 15 days later with the same amount of
plasmid. In control group, fish orally immunized with CS-TPP
nanoparticles containing 10 mg of empty-plasmid (pcDNA3.1) and
boosted 15 days later with the same amount of empty-plasmid.
Furthermore, the same experiment was performed using alginate
microparticles loaded with the same concentration of pcDNA3.1-
VP2. Unvaccinated fish feed with commercial pellets used as
negative controls (Fig. 1).
2.6. Transcription and tissue distribution of DNA vaccine
(pcDNAvp2) by RT-PCR
At day 30 post-vaccination three fish from each group were
sacrificed by overexposure to clove oil, and then tissues of spleen,
gill, head kidney, liver and intestine were removed aseptically, and
RNA was extracted from 20 mg of the homogenized tissues using
the RiboEx SL Total RNA extraction kit (GeneAll, Korea). The cDNA
synthesis was carried out in a total volume of 25 ml from 5 ml of
extracted RNA using HyperScript™ First Strand Synthesis Kit
(GeneAll, Korea) according to the manufacturer's recommenda-
tions. Primer pairs, SVP2-F (50 GTTCGACAAGCCATACGTCC 30 ) and
SVP2-R (50 GCTTGGTGATGTTCTCGGTC 30 ) were used to RT-PCR
amplification of exogenous VP2 gene with an expected size of
405 bp. The RT-PCR amplifications were performed in a final vol-
ume of 25 ml containing 12.5 ml Taq DNA Polymerase Mix Red
(GeneAll, Korea), 2 ml of cDNA, 1 ml of each primer pair (10 pmol)
and 8.5 ml nuclease-free water. Amplification was carried out with
40 cycles of 94  C for 30 s, 58  C for 30 s and 72  C for 45 s followed
by a final extension at 72  C for 10 min. The amplification products
were resolved by electrophoresis using a 1% agarose under UV light.
2.7. Immune gene transcription (RT-qPCR)
At days 3, 7, 15 and 22 post-vaccination 3 trout from each group
were sacrificed with overexposure to clove oil then the head-
kidney tissue was removed aseptically, and relative expression of
IFN-1 and Mx-1 mRNA and genes related to adaptive immune re-
sponses consisting of IgM, IgT, CD4 and CD8 was assessed 15 and 30
days post vaccination (dpv) were quantified using Real-Time PCR
(Applied Biosystems) and SYBR Green qPCR Master Mix. RNA
extraction and cDNA synthesis were performed as described above
(section 2.6).
Each RT-qPCR reaction (containing 12.5 ml 2SYBR Green PCR
Master Mix, 200 nM of each primer 100 ng cDNA template and
nuclease-free water up to final volume of 25 ml) were carried out in
duplicate and incubated for 15 min at 95  C (1 cycle), followed by 40
cycles at 95  C for 15 s, 59  C for 1 min. The melting curve of each
amplicon was examined. The expression of the target genes was
corrected based on the endogenous control expression (EF-1 a) and
calculated relative to empty plasmid according to the 2-DDCt method
as fold change (Livak and Schmittgen, 2001). However, relative
expression of VP4 gene in challenged fish was showed as 2-DCt,
where DCt was determined by subtracting the average EF1-a Ct
value from the average target Ct. All amplifications were performed
in duplicate. The primers used are listed in Table 1.
2.8. IPNV challenge and viral replication
At 30 days post booster vaccination 30 fish form each group in
two subgroups (n ¼ 15) were challenged by IP injection of 0.2 ml/
fish with IPNV at 107 TCID50 mL1 and unvaccinated fish were
injected with the same volume of PBS. The mortality was recorded
daily for 30 days and the identity of IPNV in the dead fish was
confirmed through amplification of the VP4 viral gene. At day 45
post-challenge when fish did not exhibit clinical symptoms, three
trout from each group were sacrificed and spleen and head kidney
were removed for RT-qPCR analysis of IPNV-VP4 gene as an indi-
cator of viral replication according to Ballesteros et al. (2014).
2.9. Indirect enzyme-linked immunosorbent assay (ELISA)
On days 15, 30, 45, 60 and 90 post-vaccination, three fish of each
group were anesthetized by clove oil and the blood samples were
collected from the caudal vein, clotted and serua samples were
collected by centrifuging at 500g for 10 min. Serua samples were
stored at 20  C until used. Briefly, 96-well ELISA plates were
coated by with 100 ml (10 7) well1 IPNV (previously propagated in
CHSE-214 cells) dissolved in coating buffer (carbonate-bicarbonate
solution, pH ¼ 9.6) cells in and incubated overnight at 4  C.
Following a wash in phosphate buffered saline containing 0.05%
 S. Ahmadivand et al. / Developmental and Comparative Immunology 74 (2017) 178e189 181

Fig. 1. Protocol of immunization, virus challenge and sampling times. Fish were orally immunized with alginate microparticles and CS-TPP nanoparticles containing 10 and 25 mg of
pcDNA3.1-VP2 and boosted 15 days later with the same amount of vaccine. Control fish groups were fed with alginate microparticles and CS-TPP nanoparticles containing 10 mg of
empty-plasmid and boosted 15 days. Unvaccinated fish were used as negative controls. On 30 days post-booster vaccination fish were challenged by IP injection of 0.2 ml/fish with
IPNV at 107 TCID50 mL1.

Table 1
The primers used for the RT-qPCR.

Genes Acc. No FW-Primer (50 -30 ) Rev-Primer (50 -30 )

VP4 M18049 AGGAGATGACATGTGCTACACCG CCAGCGAATATTTTCTCCACCA

IgM X65263 ACCTTAACCAGCCGAAAGGG TGTCCCATTGCTCCAGTCC
IgT AY870265 AGCACCAGGGTGAAACCA GCGGTGGGTTCAGAGTCA
CD4 AY973030 CCTGCTCATCCACAGCCTAT CTTCTCCTGGCTGTCTGACC
CD8 NM_001124263 AGTCGTGCAAAGTGGGAAAG GGTTGCAATGGCATACAGTC
IFN-1 NM_001124531 AAAACTGTTTGATGGGAATATGAAA CGTTTCAGTCTCCTCTCAGGTT
MX-1 NM_001171901 AGCTCAAACGCCTGATGAAG ACCCCACTGAAACACACCTG
EF-1 a AF498320 GATCCAGAAGGAGGTCACCA TTACGTTCGACCTTCCATCC

Tween 20 (PBS-T), the wells were blocked with 3% dried skimmed
milk in phosphate buffered saline (300 ml/well) and incubated for
2 h at 22  C. Plates were washed with PBS-T then serum samples
serially diluted with PBST-5% BSA, were added to the wells (100 ml
well1) and incubate for 3 h at 22  C. PBS was used as negative
control. The plates were again washed with PBS-T then 100 mL of
the anti-rainbow trout IgM monoclonal antibody (Aquatic Di-
agnostics Ltd, Stirling, Scotland) were added to the wells and
incubate for 60 min at 22  C. After washing with PBS-T, the bound
antibodies were detected by adding 100 ml well1 anti-mouse IgG-
HRP (Bio-Rad) diluted 1/1000 in conjugate buffer (1% BSA solution)
and incubation for 60 min at 22  C. After washing with PBS-T
antibody binding was then visualized by adding 100 mL of tetra-
methylbenzidine dihydrochloride (TMB; BioLegend, USA) to each
well and incubation for 10 min at 22  C. The reactions were stopped
by adding 50 mL of stop the solution (2 M H2SO4 in distilled water)
to the wells. The plates were read at 450 nm in Epoch Microplate
Spectrophotometer (BioTek).
2.10. Statistics analysis
Data was statistically analyzed by one-way analysis of variance
(ANOVA) using SPSS package (SPSS 1998). Differences were
considered statistically significant at p < 0.05.
3. Results
The encapsulation efficiency of alginate sodium and CS-TPP to
encapsulate pcDNA3.1-VP2 were determined and the results
revealed high encapsulation efficiencies with 87.8% and 84.2% of
DNA binding with alginate sodium microparticles and CS-TPP
nanoparticles, respectively.
3.1. Transcription analysis of AlgepcDNAVP2 and CS-
TPPepcDNAVP2
Transcription analyses of VP2 gene in tissues of spleen, head
kidney, gill, liver and intestine in orally vaccinated fish with
182 S. Ahmadivand et al. / Developmental and Comparative Immunology 74 (2017) 178e189
AlgepcDNAVP2 and CS-TPPepcDNAVP2, and the control groups
(n ¼ 3) at 30 dpv were performed by RT-PCR reaction. The RT-PCR
products with an expected size of 405 bp specific to the VP2 gene of
IPNV were obtained in the all tested tissue samples of vaccinated
fish that confirmed the distribution of the administered oral vac-
cines in different tissues of organism and transcription of VP2 as
well. No amplification was detected in tissue samples from the
unvaccinated fish (control groups). The results are shown in Fig. 2.
3.2. The RT-qPCR analysis of immune-related genes in the head
kidney of orally vaccinated trout
3.2.1. Transcription of innate immune-related genes (IFN-1 and
MX-1 gene)
The effect of oral DNA vaccination with the AlgepcDNAVP2 or
CS-TPPepcDNAVP2 through the feed on the expression of IFN-1 and
MX-1 genes related to the innate immune response, and IgM, IgT,
CD4 and CD8 genes belong to adaptive-immune response in the
head kidney of vaccinated trout was evaluated by RT-qPCR analysis.
The expression of induced genes is shown in fold values
(pcDNAVP2/pcDNA). The RT-qPCR analysis revealed a significant
increase in the expression of IFN-1 and MX-1 genes of vaccinated
fish with 10 or 25 mg dose of either the AlgepcDNAVP2 or CS-
TPPepcDNAVP2 relative to control group (empty plasmid; pcDNA)
on 3, 7, 15, 22 dpv (Fig. 3). However, the expression levels of IFN-1
and MX-1 genes in fish received 25 mg of vaccines (AlgepcDNAVP2
or CS-TPPepcDNAVP2) were significantly higher than 10 mg of one
(about 2 fold). The RT-qPCR for IFN-1 and Mx of the same cDNA
from vaccinated trout showed similar kinetics, with peaking at 3
dpv, which then decreased by day 15 and increased again on 22 dpv
after boosting at 15 dpv.
3.2.2. Transcription of adaptive immune-related genes (IgM, IgT,
CD4 and CD8 genes)
The results of RT-qPCR assays for adaptive immune-related
genes including CD4, CD8, IgM and IgT genes in the head kidney
of vaccinated fish are shown in Fig. 4. The transcription levels of
IgM and IgT genes were significantly up-regulated in all vaccinated
groups related to control group (pcDNA). In addition, the effect of
the oral vaccines on IgM and IgT genes expression was dose-
dependent and on 30 dpv their levels were significantly higher
than 15 dpv. The transcription levels of CD4 gene was significantly
higher in the kidney of orally vaccinated fish with 25 mg dose of
Fig. 2. RT-PCR analysis of VP2 gene of IPNV in different organs of oral vaccinated fish with different doses (10 mg and 25 mg) of AlgepcDNAVP2 (A) and CS-TPPepcDNAVP2 (B) at day
30 post-vaccination. Lanes are M: 100-bp DNA ladder; 1e2: spleen, 3e4: gill, 5e6: liver, 7e8: kidney, 9e10: intestine; P: positive control (pcDNA3.1-VP2), N: negative control
(empty-pcDNA3.1). RT-PCR products were analyzed on a 1% agarose gel.
either the AlgepcDNAVP2 or CS-TPPepcDNAVP2 in comparison
with the control group (pcDNA) or fish vaccinated with 10 mg of the
oral vaccines on 15 and 30 dpv. However, no significant change was
observed in CD8 gene expression in the head kidney of vaccinated
fish.
3.3. IPNV challenge/cumulative mortality and relative percent
survival (RPS)
The orally vaccinated and control groups were challenged with
IPNV at 30 days post-vaccination. The cumulative mortality was
recorded daily for 30 days. The results of cumulative mortality and
RPS are shown in Fig. 5AeB. Cumulative mortalities in unvaccinated
control were 57%, and 57% and 54% in groups vaccinated with
empty plasmid encapsulated with alginate microparicles and CS-
TPP nanoparticles, respectively. Fish vaccinated with alginate
microparicles of 10 or 25 mg pcDNA3.1-VP2 gave cumulative mor-
talities of 24% and 10%, resulting in RPS of 59% and 82%, respec-
tively. Cumulative mortalities in CS-TPPepcDNAVP2 groups were of
30% and 17%, with corresponding RPS of 47 and 70% for the 10 and
25 mg groups, respectively.
3.4. IPNV challenge/viral load
The relative expression of VP4 gene in kidney and spleen
vaccinated and unvaccinated trout was determined by RT-qPCR in
surviving fish post-challenge (Fig. 6). The results showed signifi-
cantly lower levels of VP4 mRNA in surviving vaccinated fish at 45
days post-challenge (P<0.05). The highest level of VP4 expression
was observed in the head kidney of the non-vaccinated IPNV group,
approximately 15 and 9 folds higher than (AlgepcDNAVP2 and CS-
TPPepcDNAVP2) vaccinated and infected fish. The expression level
of VP4 in head kidney was slightly higher than spleen tissues as
well as in IPNV control (unvaccinated) to empty-plasmid vacci-
nated. The VP4 expression in spleen and kidney of vaccinated trout
was nearly undetectable. Nonetheless, VP4 expression in vacci-
nated fish with 25 mg of the vaccines (AlgepcDNAVP2 or CS-
TPPepcDNAVP2) was significantly lower than 10 mg of one (about 3
fold).
3.5. Anti-IPNV serum antibodies of orally vaccinated fish
The serua samples obtained from orally vaccinated fish with
 S. Ahmadivand et al. / Developmental and Comparative Immunology 74 (2017) 178e189 183

Fig. 3. IFN-1 and MX-1 gene expression in the kidney of orally vaccinated trout with AlgepcDNAVP2 (left) and CS-TPPepcDNAVP2 (right) in feed, at 3, 7, 15 22 days post vaccination.
Rainbow trout fry (weight of 3 g; n ¼ 90) were orally immunized with alginate microparticles (A) and CS-TPP nanoparticles (B) containing 10 and 25 mg of pcDNA3.1-VP2 and
boosted 15 days later with the same amount of vaccine. Control fish groups were fed with alginate microparticles and CS-TPP nanoparticles (B) containing 10 mg of empty-plasmid
and boosted 15 days, and unvaccinated fish were used as negative controls. Data were normalized based on endogenous EF-1a gene and presented as mean fold increase relative to
empty plasmid (2-DDCT method; n ¼ 3e5). Asterisks and black point indicate significant differences (p < 0.05 and >2 folds) between vaccinated and unvaccinated fish or between
vaccinated fish with10 and 25 mg of pcDNA3.1-VP2, respectively.

alginate microparticles or CS-TPP nanoparticles loaded with
pcDNA3.1-VP2 were tested for anti-IPNV antibodies using ELISA.
Anti-IPNV antibodies in the serua of all vaccinated fish groups were
detected 90 dpv (Fig. 7AeB). The antibody levels in sera of vacci-
nated trout were progressively increased by 45e60 days post-
vaccination and reached the peak of antibody and then gradually
decreased. The level antibody in AlgepcDNAVP2 and CS-
TPPepcDNAVP2 were significantly higher than control groups
(p<0.05). Also, the levels of Anti-IPNV antibodies expression in
vaccinated fish with 25 mg pcDNA3.1-VP2 encapsulated with algi-
nate microsphere and CS-TPP nanoparticles were significantly
higher than 10 mg groups.
4. Discussion
Current commercial vaccines against IPN are mostly inactivated
vaccines, delivered intraperitoneally and a few subunit oral vac-
cines are available in Norway (MSD) but in principle no longer in
use, in Chile (Centrovet, Chile) and in Canada (Merck Animal
Health, USA). IP injection vaccination imposes stress and may result
in some local side effects. Also, this way of vaccination is unusable
for mass vaccination of small fish (Embregts and Forlenza, 2016).
Moreover, subunit and inactivated vaccines predominantly induce
humoral immune response which may prevent against mortality
but is insufficient to prevent a carrier state or virus shedding
(Bootland et al., 1995; Melby and Falk, 1995; Urquhart et al., 2008).
Despite the advances in fish vaccination and the availability of some
commercial vaccines, IPN outbreaks occur in vaccinated fish
because of the above reasons. Therefore, providing an effective
vaccine for immunization of a large number of small fish is still a
necessary way and oral DNA vaccine delivery is one potential
alternative goal.
In this study, we examined the efficacy and immune responses
induced by a DNA vaccine encoding VP2 gene of an isolate of IPNV
(Sp strain) delivered by the oral route using CS-TPP nanoparticles
and alginate microparticles incorporated into fish feed for rainbow
trout fry.
Several studies on the tissue distribution and persistence of
plasmid DNA have been reported for DNA vaccines after oral
vaccination using CS-TPP nanoparticles and alginate microparticles
in fish. These formulations were found promising as delivery sys-
tems that protect against degradation in the stomach and anterior
184 S. Ahmadivand et al. / Developmental and Comparative Immunology 74 (2017) 178e189

Fig. 4. CD4, CD8, IgM and IgT gene expression in trout after the oral administration of the alginat microparticles (left) and CS-TPP nanoparticles (right) loaded with pcDNA3.1-VP2 in
feed, at 15 and 30 dpv. Rainbow trout fry (weight of 3 g; n ¼ 90) were orally immunized as described in the legend of Fig. 3. Data were normalized based on endogenous EF-1a gene
and presented as mean fold increase relative to empty plasmid (2-DDCT method; n ¼ 5). Asterisks and black point indicate significant differences (p < 0.05 and >2 fold) between
vaccinated and unvaccinated fish or between vaccinated fish with10 and 25 mg of pcDNA3.1-VP2, respectively.

gut, allowing uptake of plasmid or antigen in the posterior of trout fed with feed containing alginate microparticles encapsu-
(Tonheim et al., 2008; de las heras et al., 2010; Vimal et al., 2012, lated DNA vaccine (Ballesteros et al., 2014, 2015). Also, expression of
2014; Ballesteros et al., 2014, 2015). For instance, transcript of the the capsid protein gene of nodavirus has been reported in tissues of
IPNV-VP2 and IHNV-G genes have been shown in different tissues Asian sea bass after oral DNA vaccination using CS-TPP
 S. Ahmadivand et al. / Developmental and Comparative Immunology 74 (2017) 178e189 185

Fig. 5. Cumulative mortalities of orally immunized rainbow trout with alginate microparticles (A) and CS-TPP nanoparticles (B) loaded with pcDNA3.1-VP2, and challenged by IP
injection of IPNV at 2  106 TCID50/fish. Unvaccinated fish were injected with PBS. Mortality was recorded daily for 30 days.

nanoparticles (Vimal et al., 2014). Our results revealed transcription
and distribution of the pcDNA3.1-VP2 by RT-PCR in tissues of
spleen, head kidney, gill, liver and intestine of rainbow trout fry fed
with feed containing AlgepcDNAVP2 and CS-TPPepcDNAVP2 sug-
gesting a good protection of the vaccines from degradation stomach
condition, and uptake across the intestinal epithelium and distri-
bution to other organs.
Type I Interferons (IFNs) are the first line of defense against viral
infections that act through the JAK-STAT pathway by inducing the
transcription of Mx and other interferon stimulated genes (ISGs)
that limit viral replication and spread (Robertsen, 2006).
Here, the transcript levels of IFN-1 and MX-1 genes were
significantly up-regulated in all vaccinated fish groups compared to
the control group (pcDNA3.1) dependent on vaccine doses (10 or
25 mg) with similar kinetics, peaking at 3 dpv and decreased by day
15 with slight increase on 22 dpv after boosting at 15 dpv. An up-
regulation of IFN-1 and MX-1 genes have been shown in brown
trout (Salmo trutta; de las heras et al., 2010; Ballesteros et al., 2012)
and rainbow trout (O. mykiss; de las heras et al., 2010; Ballesteros
et al., 2014) only up to 15 days after oral DNA vaccination against
186 S. Ahmadivand et al. / Developmental and Comparative Immunology 74 (2017) 178e189

Fig. 6. Relative expression of the IPNV-VP4 gene in kidney and spleen tissues of vaccinated and non-vaccinated trout infected with IPNV. Transcription of the VP4 gene was
recorded in the kidneys and spleen of vaccinated or non-vaccinated control fish at 45 days post-challenge. Data are represented relative to EF1-a expression (2-DCT method; n ¼ 3).
Different letters indicate significant differences between groups at p < 0.05. IPNV ¼ non-vaccinated, challenged controls; CS-TPP-pcDNA3.1 and Alg-pcDNA3.1 are fish given empty
plasmid, then challenged; others are different vaccine groups, then challenged as indicated.

IPNV. Our results suggest that the both vaccines were processed
and epitopes presented by MHC receptors, inducing IFN response
and may produce specific T-lymphocytes for cellular adaptive im-
mune responses. Also, these results reflect the involvement of the
Type-I IFN pathway in the antiviral response against IPNV and a
positive effect made by a booster vaccination on this pathway.
Regarding the adaptive cellular immune response, we also
found a significant increase in transcript levels of CD4 (a marker of
helper T cell) in fish fed with feed containing 25 mg pcDNA-VP2
vaccines encapsulated in both CS-TPP nanoparticles and alginate
microparticles but no significant enhancement was seen in CD8 (a
marker of cytotoxic T cell) transcript levels. An induction in CD4 and
CD8 genes has been reported in rainbow trout when an oral IHNV-
DNA vaccine (100 mg/fish) encapsulated in alginate microparticles
was administered (Ballesteros et al., 2015). In contrast, despite a
sufficient protection, transcription of these T-cell surface markers
were not significantly increased in trout vaccinated 3 consecutive
days with 10 mg/fish of an IPNV-DNA vaccine encapsulated in
alginate microsphere in feed (Ballesteros et al., 2014). These
controversial results might be explained by differences in the
quality, quantity and vaccine strain. Another possibility is the
wrong choice of the tissue or time for evaluating the CD8 and CD4
responses. Nonetheless, further verifications using functional
studies and the transcript analysis of other CD8/CD4 T cells genes
markers such as Eomesodermin (Eomes), Granzyme A, T-bet and
FoxP3 and GATA3 (Munang'andu et al., 2013) are required to find
out the exact cellular immune responses to oral DNA vaccines.
In teleost fish, B cells differentiate occurs in the head kidney, the
primary lymphoid tissue and the main source of Ig-secreting B cells
(Zwollo et al., 2005). IgM and IgT are two distinct lineages of B cells
in fish that are important for mucosal immune responses as their
populations can be increased after oral vaccination (Hansen et al.,
2005; Ballesteros et al., 2013). In this study, we also examined the
IgT and IgM gene expression in the head kidney of orally vaccinated
trout, at 15 and 30 dpv. As expected, the constructed DNA vaccine
strongly enhanced the expression of these two genes which is
similar to previous studies that revealed both IgM and IgT are up-
regulated in response to alginate encapsulated oral DNA vaccine
against IPNV and IHNV in rainbow trout (Ballesteros et al., 2014,
2015), as well as in the orally vaccinated grouper larvae (Epi-
nephelus coioides) against betanodavirus infection (NNV; Kai et al.,
2014). Overall, our results revealed IgT and IgM gene response to
oral stimulation and activity of our constructed vaccine to stimulate
systemic responses and mucosal immunity and substantiate Ig-
secreting cells are induced following vaccination with the con-
structed vaccine.
Moreover, the constructed oral DNA vaccines induced circu-
lating anti-IPNV antibodies, peaking at 6e8 weeks post vaccination
for each group, gradually decreasing at later time. The up-
regulation of IgM, IgT and CD4 in vaccinated fish suggest activa-
tion of B and T cells and consequently antibody production.
Moreover, the kinetics of release of the encapsulated DNA vaccines
and degradation of the pcDNA3.1 vector may explain a gradual
increase of antibody level in sera of vaccinated trout, i.e. an issue of
timing.
Exception the trout vaccinated with 10 mg CS-TPPepcDNAVP2
 S. Ahmadivand et al. / Developmental and Comparative Immunology 74 (2017) 178e189 187

Fig. 7. Anti-IPNV antibodies in serum of orally vaccinated fish with alginate microsphere (A) and CS-TPP nanoparticles (B) loaded with pcDNA3.1-VP2 in feed. Serua samples were
collected on days 15, 30, 45, 60 and 90 dpv, analyzed by ELISA. Data is mean optical density (OD; at 450 nm) of anti-IPNV antibodies in serum of vaccinated fish at a dilution of 1:100.
Different letters indicate significant differences between groups at p < 0.05. Control ¼ non, vaccinated; CS/TPP-pcDNA3.1 are vaccinated with empty plasmid; others are vaccine
groups as indicated.
188 S. Ahmadivand et al. / Developmental and Comparative Immunology 74 (2017) 178e189
(RPS ¼ 47%), a high protection was seen during the challenging the
vaccinated fish with the virulent strain of IPNV. Moreover, the RPS
in the trout vaccinated with AlgepcDNAVP2 was also higher than
CS-TPPepcDNAVP2 which may be due to polymer type and/or
encapsulation efficiency (Wendorf et al., 2008).
RT-qPCR analysis IPNV-VP4 gene in the surviving fish also
revealed a higher expression in unvaccinated fish compared to
vaccinated trout suggesting inhibiting and decreasing of viral load,
the advantage of DNA vaccine over commercially available vaccines
for prevention of the carrier state (Bootland et al., 1995; Ballesteros
et al., 2014, 2015; Cui et al., 2015).
In conclusion, this study describes the development of protec-
tive oral DNA vaccines encoding the VP2 protein of IPNV using CS-
TPP nanoparticles and alginate microsphere incorporated into fish
feed. The results show that the constructed DNA vaccine protected
by CS-TPP nanoparticles as well as alginate microsphere gave a
great protection to IPNV and a well prevention carrier state in the
survivors. To our knowledge, this is the first report describing CS-
TPP nanoparticles for oral delivery of DNA vaccines against a viral
pathogen in rainbow trout. It applicability for other fish pathogens/
diseases should be explored.
Conflict of interest
Authors declare that they do not have any conflict of interest.
Acknowledgments
We are grateful for the generous collaboration of Pasteur Insti-
tute of Iran and Central Veterinary Laboratory of Iran Veterinary
Organization (National laboratory). This study was funded by the
Research Council of the University of Tehran and the Centre of
Excellence of Aquatic Animal Health, University of Tehran, Iran
(750).
References
Adomako, M., St-Hilaire, S., Zheng, Y., Eley, J., Marcum, R.D., Sealey, W.,
Donahower, B.C., LaPatra, S., Sheridan, P.P., 2012. Oral DNA vaccination of
rainbow trout, Oncorhynchus mykiss (Walbaum), against infectious haemato-
poietic necrosis virus using PLGA [Poly (D,L-Lactic-Co-Glycolic Acid)] nano-
particles. J. Fish. Dis. 35, 203e214.
Altun, S., Kubilay, A., Ekici, S., Didinen, B.I., Diler, O., 2010. Oral vaccination against
Lactococcosis in rainbow trout (Oncorhynchus mykiss) using sodium alginate
and poly (lactide-co-glycolide) carrier. Kafkas Univ. Vet. Fak. Derg. 16, 211e217.
Ballesteros, N., Rodriguez Saint-Jean, S., Encinas, P.A., Perez-Prieto, S., Coll, J., 2012.
Oral immunization of rainbow trout to infectious pancreatic necrosis virus
(IPNV) induces different immune gene expression profiles in head kidney and
pyloric ceca. Fish. Shellfish Immunol. 33, 174e185.
Ballesteros, N.A., Rodriguez Saint-Jean, S., Perez-Prieto, S.I., 2014. Food pellets as an
effective delivery method for a DNA vaccine against infectious pancreatic ne-
crosis virus in rainbow trout (Oncorhynchus mykiss,Walbaum). Fish. Shellfish
Immunol. 37, 220e228.
Ballesteros, N.A., Alonso, M., Saint-Jean, S.R., Perez-Prieto, S.I., 2015. An oral DNA
vaccine against infectious haematopoietic necrosis virus (IHNV) encapsulated
in alginate microspheres induces dose-dependent immune responses and sig-
nificant protection in rainbow trout (Oncorrhynchus mykiss). Fish. Shellfish
Immunol. 45, 877e888.
Ballesteros, N.A., Castro, R., Abos, B., Rodríguez Saint-Jean, S.S., Perez-Prieto, S.I.,
Tafalla, C., 2013. The pyloric caeca area is a major site for IgMþ and IgTþ B cell
recruitment in response to oral vaccination in rainbow trout. PLoS One 8, 66118.
Bootland, L.M., Dobos, P., Stevenson, R.M.W., 1995. Immunization of adult brook
trout, Salvelinus fontinalis (Mitchill), fails to prevent the infectious pancreatic
necrosis virus (IPNV) carrier state. J. Fish. Dis. 18, 449e458.
Bozkir, A., Saka, O.M., 2004. Chitosan nanoparticles for plasmid DNA delivery: effect
of chitosan molecular structure on formulation and release characteristics. Drug
Deliv. 11, 107e112.
Brudeseth, B.E., Wiulsrød, R., Fredriksen, B.N., Lindmo, K., Løkling, K.E., Bordevik, M.,
Steine, N., Klevan, A., Gravningen, K., 2013. Status and future perspectives of
vaccines for industrialised fin-fish farming. Fish. Shellfish Immunol. 35,
1759e1768.
Csaba, N., Koping Hoggard, M., Alonso, M.J., 2009. Ionically crosslinked chitosan/
tripolyphosphate nanoparticles for oligonucleotide and plasmid DNA delivery.
Int. J. Pharm. 382, 05e14.
Cui, L.C., Guan, X.T., Liu, Z.M., Tian, C.Y., Xu, Y.G., 2015. Recombinant lactobacillus
expressing G protein of spring viremia of carp virus (SVCV) combined with
ORF81 protein of koi herpesvirus (KHV): a promising way to induce protective
immunity against SVCV and KHV infection in cyprinid fish via oral vaccination.
Vaccine 33, 3092e3099.
de las heras, A.I., Rodríguez Saint-Jean, S., Perez-prieto, S.I., 2010. Immunogenic and
protective effects of an oral DNA vaccine against infectious pancreatic necrosis
virus in fish. Fish. Shellfish Immunol. 28, 562e570.
Embregts, C.W., Forlenza, M., 2016. Oral vaccination of fish: lessons from humans
and veterinary species. Dev. Comp. Immunol. 64, 118e137.
Evensen, Ø., Leong, J.A., 2013. DNA vaccines against viral diseases of farmed fish.
Fish. Shellfish Immunol. 35, 1751e1758.
Evensen, Ø., Santi, N., 2008. Infectious pancreatic necrosis virus. In: Mahy, B.W.J.,
Van Regenmortel, M.H.V. (Eds.), Encyclopedia of Virology, third ed. Academic
Press, Oxford, pp. 83e89.
Fridholm, H., Eliasson, L., Everitt, 2007. EImmunogenicity properties of authentic
and heterologously synthesized structural protein VP2 of infectious pancreatic
necrosis virus. Viral Immunol. 20, 635e648.
Frost, P., Havarstein, L.S., Lygren, B., Stahl, S., Endresen, C., Christie, K.E., 1995.
Mapping of neutralization epitopes on infectious pancreatic necrosis viruses.
J. General Virol. 76, 1165e1172.
Fryer, J.L., Yusha, A., Pilcher, K.S., 1965. The in vitro cultivation of tissue and cells of
Pacific salmon and steelhead trout. Ann. N.Y. Acad. Sci. 126, 566e586.
Fuglem, B., Jirillo, E., Bjerkås, I., Kiyono, H., Nochi, T., Yuki, Y., Raida, M., Fischer, U.,
Koppang, E.O., 2010. Antigen-sampling cells in the salmonid intestinal epithe-
lium. Dev. Comp. Immunol. 34, 768e774.
Gregory, A.E., Titball, R., Williamson, D., 2013. Vaccine delivery using nanoparticles
frontiers in cellular and infection microbiology, 3, 13. http://dx.doi.org/10.3389/
fcimb.2013.00013.
Gudding, R., Lillehaug, A., Evensen, Ø. (Eds.), 2014. Fish Vaccination. John Wiley &
Sons, Ltd, Chichester, UK. http://dx.doi.org/10.1002/9781118806913.ch22.
Hansen, J.D., Landis, E.D., Phillips, R.B., 2005. Discovery of a unique Ig heavy-chain
isotype (IgT) in rainbow trout: implications for a distinctive B cell develop-
mental pathway in teleost fish. Proc. Natl. Acad. Sci. U. S. A. 102, 6919e6924.
Heppell, J., Davis, H.L., 2000. Application of DNA vaccine technology to aquaculture.
Adv. Drug Deliv. Rev. 43, 29e43.
Hølvold, L.B., Myhr, A.I., Dalmo, R.A., 2014. Strategies and hurdles using DNA vac-
cines to fish. Veterinary Res. 45 (1), 21.
 Roher, N., 2015. Nanodelivery systems as new tools for
Ji, J., Torrealba, D., Ruyra, A.,
immunostimulant or vaccine administration: targeting the fish immune sys-
tem. Biol. (Basel) 4, 664e696.
Johansen, L.H., Sommer, A.I., 1995. Multiplication of infectious pancreatic necrosis
virus (IPNV) in head kidney and blood leukocytes isolated from Atlantic salmon,
Salmo Salar L. J. Fish. Dis. 18, 147e156.
Kai, Y.H., Wu, Y.C., Chi, S.C., 2014. Immune gene expressions in grouper larvae
(Epinephelus coioides) induced by bath and oral vaccinations with inactivated
betanodavirus. Fish. Shellfish Immunol. 40, 563e569.
Katas, H., Alpar, H.O., 2006. Development and characterisation of chitosan nano-
particles for siRNA delivery. J. Control. Release 115, 216e225.
Kurath, G., 2005. Overview of recent DNA vaccine development for fish. Dev. Biol.
121, 201e213.
Lam, T.D., Hoang, V.D., Lien, L.N., Thinh, N.N., Dien, P.G., 2006. Synthesis and char-
acterization of chitosan nanoparticles used as drug. J. Chem. 44, 105e109.
Leal, C.A.G., Carvalho-Castro, G.A., Sacchetin, P.S.C., Lopes, C.O., Moraes, A.M.,
Figueiredo, H.C.P., 2010. Oral and parenteral vaccines against Flavobacterium
columnare: evaluation of humoral immune response by ELISA and in vivo ef-
ficiency in Nile tilapia (Oreochromis niloticus). Aquac. Int. 18, 657e666.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using
realtime quantitative PCR and the 2DDCt method. Methods 25, 402e408.
Lokka, G., Koppang, E.O., 2016. Antigen sampling in the fish intestine. Dev. Comp.
Immunol. 64, 138e149.
Melby, H.P., Falk, K., 1995. Study of the interaction between a persistent infectious
pancreatic necrosis virus (IPNV) infection and experimental infectious salmon
anaemia (ISA) in Atlantic salmon. Salmo salar L. J. Fish. Dis. 18, 579e586.
Munang’andu, H.M., Evensen, O., 2015. A review of intra- and extracellular antigen
delivery systems for virus vaccines of finfish. J. Immunol. Res. 960859. http://dx.
doi.org/10.1155/2015/960859.
Munang'andu, H.M., Fredriksen, B.N., Mutoloki, S., Dalmo, R.A., Evensen, O., 2013.
The kinetics of CD4þ and CD8þ T-cell gene expression correlate with protection
in Atlantic salmon (Salmo salar L) vaccinated against infectious pancreatic ne-
crosis. Vaccine 31, 1956e1963.
Mutoloki, S., Munang'andu, H.M., Evensen, Ø., 2015. Oral vaccination of fish e an-
tigen preparations, uptake, and immune induction. Front. Immunol. 6, 519.
http://dx.doi.org/10.3389/fimmu.2015.00519.
Pietretti, D., Wiegertjes, G.F., 2014. Ligand specificities of Toll-like receptors in fish:
indications from infection studies. Dev. Comp. Immunol. 43, 205e222.
Plant, K.P., Lapatra, S.E., 2011. Advances in fish vaccine delivery. Dev. Comp.
Immunol. 35, 1256e1262.
Rao, S.B., Sharma, C.P., 1997. Use of chitosan as a biomaterial: studies on its safety
and hemostatic potential. J. Biomed. Mater. Res. 34, 21e28.
Reed, L.J., Muench, H.A., 1938. Simple method of estimating fifty percent endpoints.
Am. J. Hyg. 27, 493e497.
Reno, P.W., 1999. Infectious pancreatic necrosis and associated aquatic birnaviruses.
In: Woo, P.T.K., Bruno, D.W. (Eds.), Fish Diseases and Disorders. CAB
 S. Ahmadivand et al. / Developmental and Comparative Immunology 74 (2017) 178e189
International, New York, pp. 1e56.
Robertsen, B., 2006. The interferon system of teleost fish. Fish. Shellfish Immunol.
20, 172e191.
Rodriguez Saint-Jean, S., Vilas Minondo, M.P., Palacios, A., Perez-Prieto, S., 1991.
Detection of infectious pancreatic necrosis virus in a carrier population of
rainbow trout (Oncorhynchus mykiss, Richardson), by flow cytometry. J. Fish. Dis.
14.
Romalde, J.L., Luzardo-Alvarez, A., Ravelo, C., Toranzo, A.E., Blanco-Wendez, J., 2004.
Oral immunization using alginate microparticles as a useful strategy for booster
vaccination against fish lactoccocosis. Aquaculture 236, 119e129.
Takeuchi, H., Yamamoto, H., Niwa, T., Hino, T., Kawashima, Y., 1996. Enteral ab-
sorption of insulin in rats from mucoadhesive chitosan-coated liposomes.
Pharm. Res. 13, 896e901.
Tarrab, E., Berthiaume, L., Heppell, J., Arella, M., Lecomte, J., 1993. Antigenic char-
acterization of serogroup ‘A’ of infectious pancreatic necrosis virus with three
panels of monoclonal antibodies. J. General Virol. 74, 2025e2030.
Tian, J.Y., Sun, X.Q., Chen, X.G., 2008. Formation and oral administration of alginate
microspheres loaded with pDNA coding for lymphocystis disease virus (LCDV)
to Japanese flounder. Fish. Shellfish Immunol. 24, 592e599.
Tonheim, T.Ch, Bøgwald, J., Dalmo, R.A., 2008. What happens to the DNA vaccine in
fish? A review of current knowledge. Fish Shellfish Immunol 25, 1e18.
Urquhart, K., Murray, A.G., Gregory, A., O'Dea, M., Munro, L.A., Smail, D.A.,
189
Shanks, A.M., Raynard, R.S., 2008. Estimation of infectious dose and viral
shedding rates for infectious pancreatic necrosis virus in Atlantic salmon, Salmo
salar L, post-smolts. J. Fish. Dis. 31, 879e887.
Vimal, S., Abdul, Majeed, S., Nambi, K.S.N., Madan, N., Farook, M.A., Venkatesan, C.,
Taju, G., Venu, S., Subburaj, R., Thirunavukkarasu, A.R., Sahul Hameed, A.S., 2014.
Delivery of DNA vaccine using Chitosan-Tripolyphosphate (CS-TPP) nano-
particles in Asian sea bass, Lates calcarifer (Bloch, 1790) for protection against
nodavirus infection. Aquaculture 420e421, 240e246.
Vimal, S., Taju, G., Nambi, K.S.N., Abdul Majeed, S., Sarath Babu, V., Ravi, M., Sahul
Hameed, A.S., 2012. Synthesis and characterization of CS-TPP nanoparticles for
oral delivery of gene in fish. Aquaculture 358e359, 14e22.
Wang, S.L., Yao, H.H., Guo, L.L., Dong, L., Li, S.G., Gu, Y.P., Qin, Z.H., 2009. Selection of
optimal sites for TGFB1 gene silencing by chitosaneTPP nanoparticle-mediated
delivery of shRNA. Cancer Genet. Cytogenet 190, 8e14.
Wendorf, J., Chesko, J., Kazzaz, J., Ugozzoli, M., Vajdy, M., O'Hagan, D., Singh, M.,
2008. A comparison of anionic nanoparticles and microparticles as vaccine
delivery systems. Hum. Vaccines 4, 44e49.
Xu, Y., Du, 2003. Effect of molecular structure of chitosan on protein delivery
properties of chitosan nanoparticles. Int. J. Pharm. 250, 215e226.
Zwollo, P., Cole, S., Bromage, E., Kaattari, S., 2005. B cell heterogeneity in the teleost
kidney: evidence for a maturation gradient from anterior to posterior kidney.
J. Immunol. 174, 6608e6616.