PROTEIN SYNTHESIS SIMULATION

A. Instructions
1. Launch the ConnectedBio Protein Synthesis simulation.
https://lab.concord.org/branch/cbio-amino-acids/embeddable-dev.html#interactives/connected-bio/DNA-
to-proteins/1-dna-to-protein.json
2. Enter this DNA nucleotide sequence (avoid extra spaces!):
ATGCTCTGTTTTATCTACGTCTCACCAACAGCCCATCAGAACAAG
3. Click Transcribe and watch the simulation, then write down the mRNA strand resulted in the result space
below.
4. Click Translate and watch the simulation
5. Examine the resulting protein by writing the sequences of amino acid are made.
 Click the amino acids to learn their names.
 Take a screenshot of the protein.

B. Result
nucleus
1. Where does the transcription take place? ……………………………. [1]

Write down the sequences of mRNA after transcription process. Write it in order from left to the right.
AUGCUCUGUUUUAUCUACGUCUCACCAACAGCCCAUCAGAACAAG
…………………………………………………………………………………………………………………………………………………………... [5]

ribosome
2. Where does the translation take place? ……………………………. [1]
The sequences of amino acid are made from Translation process.
Write the sequences in order start from the first amino acid is made (from left to right)
Methionine, Leucine, Cysteine, Phenylalanine, Isoleucine, Tyrosine, Valine, Serine,
…………………………………………………………………………………………………………………………………………………………...
Proline, Threonine, Alanine, Histidine, Glutamine, Asparagine, dan Lysine
………………………………………………………………………………………………………………………………………………………….. [10]
How many amino acids are made? ………………….. [1]

3. Describe the process in the simulation to a partner. What happens?

mRNA transcribed from DNA
..............................................................................................................................................................
mRNA leaves nucleus and travels to cytoplasm/ribosome
..............................................................................................................................................................
tRNA binds to amino acids
..............................................................................................................................................................
tRNA binds with mRNA and drops off correct amino acids
..............................................................................................................................................................
polypeptide chain grows
..............................................................................................................................................................
completed protein either used by cell or is packaged & exported
..............................................................................................................................................................
..............................................................................................................................................................
..............................................................................................................................................................[5]
4. Put your screen shoot of the protein result here.