Dacheng Liang ORCID iD: 0000-0002-8898-3771

Title: Control of root-to-shoot long-distance flow by a key

ROS-regulating factor in Arabidopsis

Tianling Jin1 , Huiyan Wu1 † , Zhuying Deng1 † , Tingting Cai1, Junkai Li1,
Accepted Article
†

Zhangyong Liu2, Peter M. Waterhouse3, Rosemary G. White4, Dacheng Liang1,2*

1
Hubei Collaborative Innovation Center for Grain Industry, School of Agriculture,
Yangtze University, Jingzhou, Hubei Province, China

2
Engineering Research Center of Ecology and Agricultural Use of Wetland, Ministry
of Education/Hubei Key Laboratory of Waterlogging Disaster and Wetland
Agriculture, Yangtze University, Jingzhou, Hubei Province, China

3
Centre for Tropical Crops and Biocommodities, Queensland University of
Technology, Brisbane, Australia

4
Department of Plant Sciences, Research School of Biology, Australian National
University, ACT, Australia

Tianlin Jin: jintianlin99@gmail.com

Huiyan Wu: huiyanwu1004@163.com
Zhuying Deng: 201572341@yangtzeu.edu.cn
Tingting Cai: ttcai20220@163.com
Junkai Li: junkaili@yangtzeu.edu.cn
Zhangyong Liu: lzy1331@hotmail.com
Peter M. Waterhouse: peter.waterhouse@qut.edu.au
Rosemary G. White: rosemary.white@anu.edu.au
†
These authors contributed equally to this manuscript.
*
Correspondence address: Dachengliang@gmail.com
https://orcid.org/0000-0002-8898-3771
Running head: RCD1-modulated root-to-shoot long-distance movement

This article has been accepted for publication and undergone full peer review but
has not been through the copyediting, typesetting, pagination and proofreading
process, which may lead to differences between this version and the Version of
Record. Please cite this article as doi: 10.1111/pce.14375.

This article is protected by copyright. All rights reserved.

 Abstract

Inter-tissue communication is instrumental to coordinating the whole-body level

behavior for complex multicellular organisms. However, little is known about the
regulation of inter-tissue information exchange. Here, we carried out genetic
screens for root-to-shoot mobile silencing in Arabidopsis plants with a
Accepted Article
compromised small RNA-mediated gene silencing movement rate and identified
Radical-Induced Cell Death 1 (RCD1) as a critical regulator of root-shoot
communication. RCD1 belongs to a family of Poly (ADP-ribose) polymerase
(PARP) proteins which are highly conserved across land plants. We found that
RCD1 coordinates symplastic and apoplastic movement by modulating the sterol
level of lipid rafts. The higher superoxide production in rcd1 knockout plants
resulted in lower plasmodesmata (PD) frequency and altered PD structure in the
symplasm of the hypocotyl cortex. Furthermore, the mutants showed increased
lateral area of tracheary pits which reduced axial movement. Our study highlights
a novel mechanism through which root-to-shoot long-distance signaling can be
modulated both symplastically and apoplastically.

Key words: ROS, RCD1, superoxide, plasmodesmata, mobile silencing,

symplastic, apoplastic, tracheary pit

Running title: RCD1 regulates both symplastic and apoplastic flow.

Introduction

It is well-known that many extracellular signaling molecules travel between cells

to exert their effects in neighboring cells or distal cells so as to coordinate
behaviors of sending and receiving cells (Müller & Schier, 2011; Robert & Friml,
2009). The signaling molecules, such as sugar and phytohormones, are usually
small and very efficient to trigger downstream signaling cascades, thus delivering
cellular information at controlled times in the correct place. These intercellular
messengers normally engage in ligand-receptor interactions which have been
emerging as—at least at the molecular level—the key paradigm for intercellular
communication by which the individual cells can integrate into a unity
(Chaiwanon, Wang, Zhu, Oh, & Wang, 2016; Larrieu & Vernoux, 2015; Santner

This article is protected by copyright. All rights reserved.

 & Estelle, 2009). However, intercellular communication consists of more than
small molecule signaling, it also involves large molecule translocation.

An increasing body of evidence has shown that many macromolecules including

small peptide (e.g. Takahashi et al., 2018), small RNAs (e.g. Skopelitis et al.,
2018; Tsikou et al., 2018), protein (Chen et al., 2016; Corbesier et al., 2007;
Accepted Article
Ohkubo, Tanaka, Tabata, Ogawa-Ohnishi, & Matsubayashi, 2017; Xu et al., 2011)
and mRNA (e.g. Banerjee et al., 2006; Kim, Canio, Kessler, & Sinha, 2001; Xia et
al., 2018) can also act as mobile substances to transmit intercellular messages.
Unlike small chemical signals that communicate cellular activities, these
macromolecules are functional polymers, which themselves can perform
biological functions, and do not rely on an intracellular signaling pathway to
transmit their molecular/biological effect. For instance, the small RNAs
miR165/166 can establish a concentration gradient by their movement from
endodermis to xylem tissue in the root, leading to an inverse gradient of the target
gene PHB and the accurate differentiation of xylem cell types (Carlsbecker et al.,
2010). Therefore, regulation of intercellular movement of functional
macromolecules is critical for coordinating message-sharing cells/tissues while
keeping each cell/tissue’s integrity uncompromised. Generally, the non-cell
autonomous macromolecules (Pyott & Molnar, 2015) are thought to move through
plasmodesmata (PD) (Ding, 1997; Heinlein & Epel, 2004; William J. Lucas, 1995;
W. J. Lucas & Lee, 2004), and regulation of macromolecules intercellular
movement is dependent on PD permeability or SEL (size exclusion limit).

PD permeability is known to be modified by callose, whose deposition or removal

at the neck region of PD results in PD constriction or relaxation respectively
(Levy, Erlanger, Rosenthal, & Epel, 2007; Zavaliev, Ueki, Epel, & Citovsky,
2011). Genetic and molecular studies have sufficiently documented the role of
callose in regulating macromolecule movement through PD, e.g. the phloem
unloading of GFP protein into root apical meristem and microRNA (miR165/6)
intercellular transfer (Vaten et al., 2011). Callose plays an essential role in
regulating PD permeability, however, it may not regulate all properties of PD
(Nedukha, 2015); for instance, callose was not involved in the creation of
symplasmic boundaries in the shoot apical meristem (Rinne & van der Schoot,
1998). More recently, there were many other factors independent of callose that

This article is protected by copyright. All rights reserved.

 were identified to regulate PD development and function (e.g. reviewed by Han &
Kim, 2016; Kitagawa & Jackson, 2017; Wu, Kumar, Iswanto, & Kim, 2018).

In our previous study, we have shown apoplastic ROS controlled by a type III
peroxidase (POX) RCI3 is critical for root-to-shoot small RNA-mediated gene
silencing movement. This cell-wall localized peroxidase can effectively regulate
Accepted Article
intercellular RNAi movement without noticeable compromise of plant
development (D. Liang, White, & Waterhouse, 2014). The question remains how
the extracellular ROS signaling is transmitted into the symplast. In this work, a
central redox regulator RCD1 (Radical induced cell death 1) has been uncovered
for its role in modulating intercellular RNAi movement. Loss of function of RCD1
leads to high accumulation of superoxide, strongly repressing—independently of
callose—PD formation (lower PD frequency) and PD development in the cortical
cells. We further provide evidence for RCD1-regulated superoxide level and
propose that antagonistic interactions of superoxide and H2O2 signaling can adjust
intercellular RNAi movement and apoplastic flow.

Materials and Methods

Ethyl methanesulfonate (EMS) screening, genetic crossing and genome re-

sequencing

Genetic screening on impaired mobile silencing was mainly conducted as our

previous study (D. Liang et al., 2014). Briefly, M2 seeds (the second generation
following the EMS mutagenesis treatment) were sown onto Murashige and Skoog
(MS) medium containing 10 µM dexamethasone (Dex), grown for more than four
weeks. Totally more than 50,000 M2 seedlings were screened. The potential
mutants without total-shoot silencing were further checked under fluorescent
microscope (Zeiss Axio Zoom V16 microscope) to record stem silencing. Root
and shoot silencing in M3 seedlings (generated by selfing of M2 plants) were
compared with parental RtSS (expressing root-to-shoot silencing movement)
plants to make sure the late onset of gene silencing at the base of stem was
reproducible. We further selected mutants that retained the altered phenotype over
four generations (M4 generation). One of the mutants, tsg3 showed both root
silencing and very late silencing in the inflorescence stem compared to RtSS. tsg3
was backcrossed with RtSS and F1 individuals were self-fertilized to generate an

This article is protected by copyright. All rights reserved.

 F2 population. Thirty individual F2 plants were selected for DNA extraction using
a DNeasy Plant Mini Kit (Qiagen, Cat. No. 69104). The equally mixed DNA was
sequenced on Illumina HiSeq. 2500 and reads were aligned to the TAIR10
genome. The resulting sequence alignment file was converted to BAM files using
SAM tools. Only variants containing a base pair change from guanine to adenine
or from cytosine to thymine (SNP, single nucleotide polymorphism) were used for
Accepted Article

further analysis. The frequency of each SNP allele was then plotted to allow
identification of a ‘linked region’ with a higher overall frequency in the mutant
pool. The candidate variants were then annotated and prioritized based on the
changes induced.

Genetic complementation, SALK T-DNA insertion lines and CRISPR lines

The full length genomic region of tsg3 from wild type (WT) Col-0 was amplified
using the following primer: RCDpro-F2,
cactagtcagatctaccatggCTTACAAGATTGGGAAGACAGCCG; RCDgenofusA-
R2, cctcgcccttgctcaccatggATCCACCTGCACCTTCTTCATGG and then cloned
into T-DNA vector to fuse with GFP tag. The transformants were selected on
medium containing 50mg/ml kanamycin. Salk T-DNA line SALK_116432 was
ordered from Salk Institute (http://signal.salk.edu/). The CRISPR lines were
generated as previously described (Wang et al., 2015). Briefly, the target sites
were selected using an online tool: http://www.rgenome.net/cas-offinder/new, and
the following primers were designed to target the tsg3 locus: DT1-RCD1-BsF:
ATATATGGTCTCGATTGAAATAAGGGCAGTCTGCAGGTT; DT1-RCD1-
F0: TGAAATAAGGGCAGTCTGCAGGTTTTAGAGCTAGAAATAGC; DT2-
SRO1-R0:
AACCCTCAGCAGGCTTGACACCCAATCTCTTAGTCGACTCTAC; DT2-
SRO1-BsR: ATTATTGGTCTCGAAACCCTCAGCAGGCTTGACACCC.

Overexpressing lines

To generate an overexpressing line, the FSD1 and RCI3 genomic cDNA was
amplified using the following primers: FSD-Mfe-F1,
ctgattaacagctcgcaattgAAACTTGAGGTACTGATTCTATCTCTCATC; FSD-
Mfe-HA-R1, CAGGAACATCATAAGGATAacagctatggtgatgaattg; RCI-Mfe-F1,
ctgattaacagctcgcaattgCACACAACATAATCCTCCCAAACA; RCI-Mfe-HA-R1,

This article is protected by copyright. All rights reserved.

 CAGGAACATCATAAGGATAaaccaactaaaatgtcatga. The amplified fragment
was put under the control of the AtUBIQUITIN-10 promoter.

Diethyldithiocarbamate (DDC), salicylhydroxamic acid (SHAM) and

lovastatin treatment

All Arabidopsis plants were germinated on medium containing oxidative stress-

Accepted Article

inducing agents. The stock solution of 1M DDC (diethyldithiocarbamate) was

prepared by dissolving it into DDH2O. The 0.2M stock solution of SHAM
(salicylhydroxamic acid) and 5mM stock solution of lovastatin were prepared by
dissolving them into dimethylsulfoxide (DMSO) separately. Various
concentrations of DDC, SHAM and lovastatin were prepared by adding
appropriate amounts of stock solutions into the medium. As controls for these
treatments, plants were germinated on medium that contained an equivalent
amount of DMSO to that used for each chemical treatment.

Small RNA northern blot

RNA extraction and northern hybridization was performed as described

previously (D. Liang, White, & Waterhouse, 2012).

Dye loading, CFDA and fuchsin loading

Carboxyfluorescein diacetate (CFDA) loading was performed as described by

Jiang, Deng, White, Jin, & Liang (2019). 1% (w/v) acid fuchsin solution (sigma)
was freshly prepared and introduced into the plants by submerging the cut end of
roots (the cut was made 2-3 mm above the root tip) into the solution at room
temperature. The video clip was recorded in a Zeiss Axio Zoom V16 microscope.

Superoxide measurement

Superoxide radical detection was performed as previously described by Georgiou,

Papapostolou, & Grintzalis (2008) and Zielonka, Vasquez-Vivar, &
Kalyanaraman (2008) with modifications. Fresh plants were weighed and
immersed in 50uM HE (hydroethidium) solution for 30 min. The samples were then
washed with 1 ml 10 M HCl, followed by 3 water rinses. After centrifugation at
3,000 g at 4 ℃ for 5 min to remove access liquid, the samples were homogenized
in 0.1 ml 50 mM phosphate buffer (pH 7.4) containing 5U/ml catalase. The

This article is protected by copyright. All rights reserved.

 homogenates were mixed with 9 volumes of 100% acetone, and then with 1/100
volume 10 M NaOH. The mixture was vortexed vigorously and centrifuged for 5
min at 15,000 g at 4 ℃. The supernatant was diluted to 30% (v/v) with ddH2O and
the pH was adjusted below 3 by addition of 1/120 (v/v) 1 M HCl. After the
addition of 1/2 volume diethyl ether, the low pH mixture was vortexed vigorously
then centrifuged for 2 min at 3,000g at 25℃. The upper green layer was discarded
Accepted Article

and the clear bottom layer was adjusted pH to 7.0 by the addition of 1/50 volume
2.5 M Tris-HCl buffer pH 7.0. 2-OH-E+ was absorbed by the active resin after the
passage of 2-OH-E+ acetone extract through the Dowex active cation exchange
microcolumn. The microcolumn was washed with 1 ml 4 M NaCl, 1 ml ddH2O, 2
ml 100% ACN and 2 ml ddH2O, and 2-OH-E+ was then eluted with 1ml 10 M
HCl and diluted to 3 M by adding ddH2O. 2-OH-E+ was further purified by
passing the eluted 2-OH-E+ through the active HLB (Hydrophobic-lipophilic
balance) microcolumn at flow rate 2 ml min-1. The microcolumn was passed
through 1 ml 17% (v/v) ACN in phosphate buffer to wash off impurities. 2-OH-E+
was eluted by passing through 1.5 ml 25% ACN in phosphate buffer. The eluate
was mixed with an equal volume of chloroform by vigorous vortexing, and the
CHCl3/ACN layer was collected and evaporated in a vacuum rotatory evaporator
to obtain the 2-OH-E+. To quantify the fluorescence of 2-OH-E+, the above
obtained 2-OH-E+ was re-dissolved with 0.3 ml 50 mM phosphate buffer (pH 7.4)
containing 1% (v/v) DMSO, and added 0.02 ml 2 mg/ml DNA solution to enhance
the fluorescence of 2-OH-E+. The TFU (Total Fluorescent Units) including the FU
of 2-OH-E+ and other oxidation products such as E+ was measured at ex/em
515/567 nm (Synergy 2, BioTek). After adding 0.025 ml 0.003% H2O2 (v/v) and
10 µl 110U/ml horseradish peroxidase (HRP) and incubating for 30 min, the FU
of the solution was again recorded. The fluorescence of 2-OH-E+ is equal to TFU
– FU. Finally, the concentration was calculated using a 2-OH-E+ standard curve.
The 2-OH-E+ was synthesized by reaction of HE with nitrosodisulfonate radical
dianion (Fremy’s salt) and purified by an Alltech Prevail SPE C18 cartridge, then
concentrated by vacuum rotatory evaporator. The 2-OH-E+ serial solutions (0 –
1000 nM) were prepared in 50 mM phosphate buffer, pH 7.4. Their FUs were
measured at ex/em 515/567 nm to give a standard curve.

This article is protected by copyright. All rights reserved.

 Transmission electron microscopy (TEM)

For TEM, the hypocotyl samples were collected with length about 1.5-2 mm and
fixed in 2.5% glutaraldehyde in 0.1 M Phosphate Buffer (pH 7.4) overnight at 4 ℃.
The samples were briefly washed three times with PBS (0.1 M), then post-fixed
Accepted Article

with pre-cooled 1% OsO4 for 2-4 h at 4 ℃. After washing and dehydration in an

acetone series, the tissue blocks were sequentially infiltrated with epoxy
resin/acetone (1:2) mixture, epoxy resin/acetone (1:1) mixture, and epoxy resin for
a total of 36 h (12 h for each step) at 37 °C. The infiltrated samples were
polymerized in epoxy resin in labeled plastic capsules for 48 h at 60 ℃.
Longitudinal ultrathin sections of 90 nm through cortex layer were obtained with a
Leica EM UC7 ultramicrotome and sequentially mounted on electron microscopy
grids which were numbered and stored sequentially in grid storage box. For each
plant material, about 300-600 sections were made on the cortical cells. The
ultrathin sections were contrasted with uranyl acetate and lead citrate, and then
examined with a Tecnai G2 20 TWIN transmission electron microscope (FEI) at
an accelerating voltage of 200 kV. PD were recorded in the transverse walls and
the length of interface between the contiguous cortical cells was measured. PD
frequency (#/µm) in each sample was expressed as the ratio of the total number of
PD to the total length of interface.

Scanning Electron Microscopy and tracheary element observation

Tracheary element examination was previously described by Liu et al. (2022) and
Deng et al. (2021). Briefly, the hypocotyl region below the HEJ zone was
collected and immediately fixed in 4% paraformaldehyde in 1X PBS buffer for 30
min. The fixed samples were rinsed three times with PBS and dissected under
dissecting microscope. The parenchyma cells around the xylem tissue were peeled
off to expose the tangential walls, and the median longitudinal sections were
dissected to reveal pits on the radial walls. The dissected samples were further
washed in 1% Triton X-100 for 15 min, then rinsed in PBS for 15 min. The
dissected materials were dehydrated for 15 min each in an ethanol series of 25%,
50%, 75% and 100% ethanol. After three-times of washes with absolute ethanol,
the samples were dried in -20℃, low-vacuum drier (CHRIST). The dried samples

This article is protected by copyright. All rights reserved.

 were then mounted on stubs with pre-mounted carbon conductive films, and
coated with gold. Examination of the samples was performed with a MIRA3 field-
emission scanning electron microscope from TESCAN.

Lipid extraction

The lipid extraction mainly followed the protocol of Matyash et al. (2008). Briefly,
Accepted Article

the samples were dried, weighed and ground into fine powder. After 10 mg fine
powder was vortexed with 1.5 ml methanol, with 5 ml MTBE (methyl tert-butyl
ether) was added to the mixture which was then incubated overnight at room
temperature in a shaker. The addition of 1.25 ml of MS-grade water induced phase
separation, and after 10 min incubation at room temperature, the sample was
centrifuged at 1,000 g for 10 min. The organic phase was collected, and the lower
phase was re-extracted with 2 ml of the solvent mixture (MTBE/methanol/water
(10:2:1.6, v/v/v). The organic phases were combined then dried in a vacuum
centrifuge. To speed up sample drying, 200 µl methanol was added to the organic
phase after 25 min of centrifugation. The dried lipids were dissolved in 200 µl of
CHCl3/methanol/water (60:30:4.5, v/v/v) for storage.

Sterol quantification

Sterol extraction was performed according to Henry et al. (2015) with some
modifications: the samples were harvested, dried in a vacuum freeze dryer (-20 ℃),
then weighed and ground in liquid nitrogen. The lipid was extracted with 4 mL
chloroform:methanol (2:1) (v/v), and then filtered with PVDF syringe filter
(Rephiquik) after incubation at 70 ℃ for 1h. Fifty µg/ml 5α-Cholestane was added
as an internal standard. The extracts were then saponified with 2 mL 6% (w/v)
KOH in methanol for 3 h at 90 °C to release the sterol moiety of steryl esters.
Sterols were extracted from the above mixtures three times with 2 mL
hexane:water (1:1) (v/v) and dried in a vacuum freeze dryer. The dried residues

were derivatised with 100 µl BSTFA-TMCS (99:1) for 25min at 75 ℃, then

topped to 500 µl by adding N-hexane. Sterol levels were analyzed on an Agilent

7890A-5975C GC-MS system. Separation was performed on a DB-5MS column
(30m×0.25mm×0.25μm, Agilent Technologies) with helium as the carrier gas.

This article is protected by copyright. All rights reserved.

 The temperature program was: 100 °C for 5min, ramp to 280 °C at 10 °C/min,
300 °C at 5 °C/min, and hold for 20 min.

Results

Characterization of tsg3 mutant for impaired RNAi movement but not for
RNAi effection
Accepted Article

We previously identified the rci3 mutant by its efficient blockage of RNAi

movement from root to shoot without any noticeable phenotypic changes (D.
Liang et al., 2014). rci3 mutant was selected by its efficient RNAi in the roots, but
little sign of GFP silencing in the shoots (D. Liang et al., 2012). One may argue
that RNAi efficacy in the roots and shoots could be differentially performed, thus
accounting for the impaired shoot RNAi in the rci3 mutant, rather than the
impaired non-cell autonomy. To exclude this remote possibility, we adopted a
new strategy in which a potential mutant should show the RNAi effect in both root
and shoot, and is impaired only in the rate of RNAi movement. Under this
screening purview, a novel mutant tsg3 (Tiao-shan-gong 3, meaning in Chinese
the mountain porter transporting goods over mountains) was identified and
showed inducible root silencing (Fig. S1), and also shoot silencing which
developed three weeks later than in RtSS plants (Fig. S1).

Longitudinal sections of hypocotyls revealed that the silencing front in the tsg3
mutant was barely detected at the root-hypocotyl junction while it was just
emerging in the RtSS line at 3 DAD (days after Dex) (Fig. 1a). At 6 DAD, the
silencing front had migrated half way up the wild type (WT) RtSS hypocotyl, but
had only reached the lower half of the tsg3 hypocotyl. The silencing front reached
the HEJ zone of WT plants by day 11, and in the mutant, reached the same stage
by day 14 (Fig. 1a). Linear regression analysis further showed the rate of silencing
movement in the tsg3 hypocotyl was significantly lower than in the WT
(p<0.0001, R square for RtSS and tsg3 was 0.87 and 0.85 respectively) (Fig. 1b).
As the silencing front approached the HEJ zone, its progression was greatly
reduced in both RtSS and the mutant (Fig. 1c). The silencing front continued
shootward to induce systemic shoot silencing in the WT, but was almost
completely halted at the HEJ zone in tsg3 from 14 DAD to 28 DAD (Fig. 1a and
Fig.S1), leading to very delayed mobile silencing (Fig. S1). Furthermore, northern

This article is protected by copyright. All rights reserved.

 blots showed that small RNA from the GF region (the first 400-bp fragment of the
GFP gene, Liang et al., 2012) was not altered in the tsg3 mutant roots (Fig. 1d),
suggesting the generation of RNAi signal in the roots was viable. In the shoots,
the small RNA from P region of GFP (3’ region of GFP gene) could be detected
in the silenced RtSS, but was not detected in the non-silenced leaves of tsg3 if the
silencing front had not reached the tsg3 shoots (Fig. 1d). Similarly to the RtSS
Accepted Article

leaves, the P signal could be detected in the leaves of tsg3 although only after two
months of DEX treatment, further suggesting the production and propagation of
silencing signal was independent of the tsg3 mutation.

tsg3 is allelic to radical-induced cell death 1

To identify the tsg3 mutation that affected RNAi movement, we pooled F2

segregants from tsg3 backcrossed to RtSS and sequenced the whole genome by
Illumina HiSeq. 2000. Polymorphism analysis using Mutmap identified 25 single-
nucleotide polymorphisms (SNPs) on Chromosome 1, 6 SNPs on Chr. 4 and 5
SNPs on Chr. 5. From these candidate SNPs, 23 were located in the intergenic
regions, 3’ or 5’ UTR of annotated genes, or annotated transposons, and 13 were
located in the exons (Table S1). Of these SNPs in exonic regions, 5 were
synonymous and 8 were non-synonymous. To assess the possibility that the
potential missense SNPs were responsible for the tsg3 mutation, we further
checked the co-segregation of these SNPs with the tsg3 phenotype in another 120
F2 plants by Sanger sequencing. We thereby confirmed that the specific SNP, the
conversion of G in the 254th Trp-codon TGG into A at Chromosome 1 position
11614187—resulting in the formation of a premature stop codon TAG in
RADICAL-INDUCED CELL DEATH1 (RCD1, At1g32230)— fully co-segregated
with tsg3 mutant plants. This SNP was serendipitously found identical to rcd1-6
(rimb1) (Hiltscher et al., 2014). Accordingly, tsg3 was renamed rcd1-7 (Fig. 2a)
since this mutation was independently recovered from two distinct backgrounds.
For final verification, we first performed genomic complementation by
transforming a 5kb genomic fragment including 2.5kb promoter and 2.5kb coding
sequence into tsg3 and found that the dwarf and late-silencing phenotype was
rescued (Fig. S1). We then generated a different allele from the tsg3 mutant by
targeting the rcd1 gene in the PARP catalytic domain, producing a G insertion
allele in the coding position of the 369th AA, leading to a frameshift and

This article is protected by copyright. All rights reserved.

 subsequent premature stop codon mutation (Fig. 2b). As shown in Fig. 2c, the
silencing front was stopped in the HEJ zone of rcd1-cas9 allele compared to the
RtSS plant, exactly phenocopying the tsg3 mutant.

Superoxide accumulation and its inhibitory role in silencing movement

RCD1 was originally identified through apoplatic ROS screening (Overmyer et al.,
Accepted Article

2000) and it was further demonstrated that rcd1 mutant accumulate more
superoxide in independent studies based on nitroblue tetrazolium (NBT) staining
(Overmyer et al., 2000; Zhu, Du, Qian, Zou, & Hua, 2013). NBT staining of tsg3
produced similar results (Fig. 3a). Since NBT is less sensitive and specific for
detection of O2•– in biological samples (Jacek Zielonka et al., 2017), we turned to
quantitative measurement of superoxide by detecting the unique marker product of
O2•–, 2-hydroxyethidium (2-OH-E+) (Georgiou et al., 2008; Zhao et al., 2005; J.
Zielonka et al., 2008). We found that the WT Col-0 and WT RtSS plants generated
2-OH-E+ at concentrations of 42 and 46 nM/mg respectively, whereas the rcd1-3
(Fig. 2a) and rcd1-7 plants showed greatly elevated production of 2-OH-E+ of 75
and 58 nM/mg respectively (Fig. 3b). This result might suggest that higher
accumulation of O2•– would reduce the rate of silencing movement. We then
examined the O2•– level in rci3-2 mutant that showed reduced silencing movement
due to mutation in peroxidase 3 gene (D. Liang et al., 2014), and found the 2-OH-
E+ production was also elevated in the rci3-2 mutant (Fig. 3b), suggesting that the
elevated production of O2•– was reversely associated with the rate of silencing
movement. This conclusion was further corroborated by the observation that a
superoxide dismutase-encoding gene FSD1 (At4g25100) whose expression was
reduced in rcd1-1 mutant (Brosché et al., 2014), was also strongly repressed in
other rcd1 mutants (Fig. 3c).

We subsequently applied diethyldithiocarbamate (DDC) to increase O2•–

concentration by inhibiting superoxide dismutase activity (Auh & Murphy, 1995;
Iqbal & Whitney, 1991). Indeed, treatment with 1mM DDC led to more than 3-
fold increase in superoxide level compared with the untreated plants (Fig. S2). We
then checked DDC effects on silencing movement. As shown in Fig. 3d, the
spread of root-to-shoot silencing was substantially delayed with the gradually
elevated DDC treatment. Similarly, the inhibitor of several redox enzymes

This article is protected by copyright. All rights reserved.

 including peroxidase, alternative oxidase and lipoxygenase (Rich, Wiegand, Blum,
Moore, & Bonner, 1978), salicylhydroxamic acid (SHAM) also delayed silencing
spread although the onset of its inhibitory effect was slightly later (Fig. 3e). All
these results indicated that O2•– plays a negative role in the control of silencing
movement.

Since FSD1 plays a critical role in controlling O2•– levels (Alscher, Erturk, &
Accepted Article

Heath, 2002) and its significant reduction in the rcd1 mutant (Fig. 3c) may be
associated with reduced silencing movement, we introduced the FSD1 gene under
the control of the Ubiquitin promoter into both RtSS and the rcd1-7 mutant. The
silencing front in the rcd1 mutant overexpressing FSD1 crossed the HEJ zone
much faster than in the null lines and the rcd1 mutant (Fig. 3f-i). We also
observed that the silencing front moved faster in the FSD1-overexpressing RtSS
lines (Fig. 3i).

Symplastic transport was inhibited in rcd1 mutant

To test whether the reduced rate of mobile silencing was due to impaired
symplastic transport, we analyzed shootward CFDA mobility by using hypocotyl-
pinching method (Jiang et al., 2019). There was no difference in staining
efficiency in the 9 to 13 day-after-sowing (DAS) plants, however, from 14 DAS,
WT Col-0 and rcd1-3 began to diverge, and CFDA mobility eventually dropped
below 70% of WT in the rcd1-3 mutant (Fig. 4a), suggesting that symplastic
transport is retarded at this developmental stage in the rcd1 mutant.

We then asked how the silencing movement was retarded and whether we could
detect any structural changes in the symplastic connections. To do this, a series of
ultra-thin sections were obtained in the hypocotyl cortex layer in which the
transverse cell walls present a barrier to root-shoot vertical communication but
can be distinctly identified from the near-rectangle cell stacking arrangement (Fig.
4b). Besides, plasmodesmata in the cortex transverse walls were non-clustered
distributed, thus ideal for PD frequency comparison. More than 3000 sections
from 6 independent plants were examined and results showed that the PD
frequency was significantly reduced in the rcd1-3 mutant (0.047 PD/µm±0.016)
compared with WT Col-0 plant (0.104 PD/µm±0.023) (Fig. 4c). Furthermore, the

This article is protected by copyright. All rights reserved.

 majority of the PD in WT (87%, n=690) appeared to be a straight tunnel structure
(Fig. 4d), whereas some PD (about 35%, n=290) appeared zigzagged in the rcd1
mutant (Fig. 4e). These results strongly indicated that the reduced PD frequency
and altered PD structure in rcd1 mutant led to the reduced silencing front
movement, and also the reduced symplastic dye staining efficiency.
Accepted Article
Area of radial and tangential pits were increased in the rcd1 mutant

We previously showed that the silencing front moves through the vascular
parenchyma cells which are abundant in the xylem (D. Liang et al., 2012).
Furthermore, the earlier rcd1-1 mutant was characterized and identified by its
hypersensitive response to apoplastic ozone (Ahlfors et al., 2004). These lines of
evidence lead us to examine the pits in tracheary elements that have been
proposed to play a key role in regulating sap flow (Choat, Cobb, & Jansen, 2008;
Jensen et al., 2016). Since the pit spacing in WT and rcd1-3 was similar (Fig. S3),
we measured the area of alternate pits on the radial walls in 15-day old plants and
found that this was 11% larger in rcd1 plants compared to WT plants (Fig. 5a-c).
Furthermore, the uniseriate pits in tangential xylem walls in rcd1 plants were 46%
larger in area than in WT Col-0 plants (Fig. 5d-f). In 23-day old plants, the pit
area was 17% larger in rcd1-3 mutants in comparison to the wild type (Fig. 5g-i)
(5.39 and 6.32 µm2 respectively), and the area in the uniseriate pits of rcd1-3
mutant was also 28% larger (5.16 and 6.62 µm2 respectively) (Fig. 5j-l).

Since the area (or diameter) of bordered pits was shown to affect xylem flow in
trees (Domec et al., 2008; Flynn, 2007), we wondered whether xylem flow in rcd1
mutant was changed. We loaded the apoplastic dye fuchsin in the roots (Fig. 5m)
and showed that the staining ratio of fuchsin in the shoots of rcd1 plants was
greatly reduced (Fig. 5n). As shown in the Supplemental Movie 1, the fuchsin was
slower to reach the shoots in rcd1 mutants. Since inhibitors of ROS metabolic
enzymes caused late shootward silencing (Fig. 3d, e), we examined whether these
inhibitors could also affect pit-mediated flow. As shown in Fig. 5o-q, both SHAM
and DDC, but not H2O2 significantly reduced fuchsin staining in a 2 h timeframe
(Fig. 5o-q). This effect was attenuated with the longer time exposure to SHAM
and DDC, although the residual effects were longer for SHAM due to the stability
of these two drugs. Interestingly, H2O2 treatment had the opposite effect, which is

This article is protected by copyright. All rights reserved.

 in line with the previously observed effect of H2O2 in accelerating mobile
silencing (D. Liang et al., 2014). Altogether these results indicated rcd1 mutation-
induced genetic and ROS modulating agents-induced chemical perturbation to
superoxide level impacted on the pit-mediated shootward flow.

Beta-sitosterol and stigmasterol were significantly reduced in the rcd1 mutant

Accepted Article

Recent discoveries have revealed the important role of lipids and sterols in the
PD-mediated intercellular transport (Grison et al., 2015; Zhang et al., 2017). As
we did not find significant differences in callose deposition between the rcd1
mutant and WT Col-0 plants (Fig. S4), we wondered if lipid or sterol profiles were
altered in the rcd1 mutant. The total amount of FAMEs (fatty acid methyl esters)
in rcd1 and WT Col-0 were determined by gas chromatography-mass
spectrometry (GC-MS), and were found not to differ (Fig. S5). Further sterol
profiling showed that β-sitosterol was significantly reduced in the leaf tissues, but
not in the root tissues of rcd1 plants when compared to WT Col-0 or RtSS plants
(Fig. 6a-c). Similarly, rci3-2 plants accumulated less β-sitosterol in the roots than
all other lines. Stigmasterol was barely detected in leaves, however, it was readily
detected in roots (Fig. 6d). Compared to WT Col-0 and RtSS, three allelic rcd1
mutants accumulated less stigmasterol in the root tissues. This was also true for
rci3-2 mutants with impaired mobile silencing (Fig. 6d), suggesting that the
reduced levels of β-sitosterol and stigmasterol played a role in impaired RNAi
movement. We further examined the effects of statins (e.g. lovastatin) that can
inhibit sterol formation (Bach & Lichtenthaler, 1983; Grison et al., 2015) and
found that shoot silencing in RtSS was delayed in the presence of 0.5-5 µM
lovastatin (Fig. 6e), further supporting that sterols are essential for normal
silencing signal movement.

Discussion

Multicellular organisms have evolved specialized structures—e.g. mammalian gap

junctions and tunneling nanotubes, fungal septal pores and plant’s
plasmodesmata—for intercellular communication, which is considered as a
physiological key to the evolutionary success of complex multicellular life (Knoll,
2011; Niklas & Newman, 2013). As sessile but the most successful evolutionary
organisms in terrestrial ecosystem, plants, unlike animals, which have circulatory

This article is protected by copyright. All rights reserved.

 system to coordinate each part of body, are evolved with at least three types of
conducting systems, i.e. the PD-connected cytoplasm (symplast), apoplast and
transcellular pathway to allow for the integration and communication of various
tissues and cell types under recurring stress conditions (Barberon & Geldner,
2014). Here, we provided genetic and molecular evidence illustrating that the
ROS-balancing factor RCD1 is involved in regulating both symplastic and
Accepted Article

apoplastic pathway.

RCD1 has been emerging as a hub in regulating ROS homeostasis by coordinating

the ROS retrograde signaling from mitochondria and chloroplast (Shapiguzov et
al., 2019). Functional disruption of RCD1 resulted in altered ROS metabolism,
chloroplastic redox status and mitochondrial respiration (Fujibe et al., 2004;
Heiber et al., 2007; Hiltscher et al., 2014; Shapiguzov et al., 2019). Our adoption
of specific superoxide measurement (Georgiou et al., 2008; J. Zielonka et al.,
2008) in rcd1 further consolidated that ROS imbalance was mainly due to the
over-accumulation of O2•– (Fig. 3) that causes cell death by apoplastically-applied
ozone. Interestingly, the ozone-induced lesion spread in rcd1 mutant was locally
contained (Overmyer et al., 2000). We now suggest that the cell death
containment could be construed as the impairment of cell-to-cell communication
in rcd1 (Fig. 4). Collectively this evidence reveals a critical novel role of RCD1 in
intercellular communication.

An emerging paradigm for intercellular communication is that hydrogen peroxide,

another ROS species, is proposed as a positive regulator for intercellular tunnel-
mediated transport, probably by its role in regulating membrane formation and
cell wall remodeling (Dacheng Liang, 2018; D. Liang et al., 2014). Other findings
have shown that ROS and redox signaling direct callose deposition, thereby
negatively regulating symplastic permeability (Benitez-Alfonso et al., 2011,
Stonebloom et al., 2009). We found that O2•–, independently of callose, can
downregulate intercellular communication.

SHAM- and DDC-induced O2•– strongly repressed mobile silencing (Fig. 3),
which contrasted with the accelerated silencing movement induced by H2O2 (D.
Liang et al., 2014). Such opposite effects caused by O2•– and H2O2 strongly
supported that different ROS impact the intercellular communication differently

This article is protected by copyright. All rights reserved.

 (Dacheng Liang, 2018), which might be due to their inherent chemical reactivity
to different signaling targets. Similar scenarios also occurred in other organisms;
for instance, O2·− and H2O2 induced different signaling pathways in vascular
muscle cells, eventually resulting in opposite effects on myogenic contractions (Li,
Lai, Wellstein, Welch, & Wilcox, 2016), and the increased O2•– could mitigate the
oxidative stress under H2O2 treatment (Thorpe et al., 2013). Together these lines
Accepted Article

of evidence indicate O2•– signaling function differentiates from that of the H2O2
signaling although the components of O2•– pathway are nearly completely
uncharacterized. Despite this, one of the consequences of higher O2•– would lead
to sterol downregulation as shown in Fig. 6. Actually, these results are reasonably
fair given that sterols act as antioxidant and their evolutionary advent coincides
with the rise of oxygen (Galea & Brown, 2009), therefore the immediate response
to elevated oxygen/ROS via sterol modulation (Jin, Wang, Deng, Liu, & Liang,
2021) could be evolutionarily conserved.

Sterols have been widely identified as one of the main components of membrane
microdomains or lipid rafts that display the property of detergent resistance
(Brown & London, 1998; Lefebvre et al., 2007; Lingwood & Simons, 2010). In
addition, the lipids rafts are highly enriched with redox proteins in Medicago
(Lefebvre et al., 2007), and also essential for rice immunity to blast fungus
(Nagano et al., 2016), implying that the association of redox balance with lipid
rafts is critical for lipid raft-mediated process. Interestingly, recent studies have
shown that PD membrane is found enriched with sterols and sphigolipids
compared to the bulk of plasma membrane, which is similar to the profile of lipid
rafts (Grison et al., 2015). Indeed, our results also showed that sterol depletion by
sterol inhibitor delayed gene silencing movement (Fig. 6) which was consistent
with its role in modulating cell-to-cell GFP unloading (Grison et al., 2015).
Antisense suppression of a putative sterol carrier gene leads to reduced PD
permeability in cotton fibre (Zhang et al., 2017). All this growing evidence
highlights the role of sterol in redox protein-enriched membrane lipids for
establishing cell-to-cell communication.

Given the sterol level is regulated through RCD1-controlled ROS homeostasis

(Fig. 7), an important question arises as how the original role of RCD1 in sensing
the apoplastic O2•– is linked to the symplastic regulation. The rcd1 mutant is

This article is protected by copyright. All rights reserved.

 sensitive to apoplastic ROS (ozone in this case) (Overmyer et al., 2000), but
resistant to chloroplastic ROS induced by methyl viologen treatment (Fujibe et al.,
2004). Interpretation of these contradictory results is still inconclusive in that the
same mutation primed two opposite reactions responding to outside (apoplastic)
and inside (symplastic) ROS introduction. From the viewpoint of transmission of
apoplastic signaling, it is plausible that ROS signaling molecules could be quickly
Accepted Article

diffused through the lateral pits due to the increased pits area (Fig. 5), however the
root-to-shoot systemic movement via symplasm (Fig. 1 and Fig. 4) and the
shootward flow through xylem (Fig. 5) was lowered down. Therefore, the distinct
modifications of symplastic and apoplastic systems by rcd1 mutation lead to the
corresponding consequences that are physiologically diverse, or even opposite
upon the treatment with different ROS-inducing agents. For the basis of ROS
modification on apoplastic system, the pits membrane would be a highly potential
target given their role in mediating mass flow through apoplastic system (Choat et
al., 2008; Neumann, Weissman, Stefano, & Mancuso, 2010; van Doorn, Hiemstra,
& Fanourakis, 2011). Unlike the PD membrane, the pits membranes are consisted
of cellulose, pectin, lignin and microfibris (Choat et al., 2008; van Doorn et al.,
2011). Because Glucosided β-sitosterol was shown to act as a primer for cellulose
synthesis (Peng, Kawagoe, Hogan, & Delmer, 2002), the reduction of sterol in
rcd1 mutant might impact cellulose-associated process. This is, indeed, the case
for the pits membrane which is mainly composed of cellulose (Choat et al., 2008;
van Doorn et al., 2011). The radial and tangential pits have showed the increased
pit area which could be due to the less deposit of cellulose on the primary wall
(Fig. 5). As a result, the upward movement of sap was reduced (Fig. 7).
Alternatively, the pits membrane may be directly impacted by the increased O2•–
in the rcd1 mutant since cell wall polysaccharides are prone to be depolymerized
by ROS (Fry, 1998).

In summary, we report a novel role for RCD1, emerging as an important hub for
ROS homeostasis and stress signaling, in regulating the root-to-shoot long
distance movement both symplastically and apoplastically. Our finding that sterol
level, particularly of the β-sitosterol and stigmasterol was greatly affected by rcd1
mutation highlights the need to explore how the lipid rafts, mainly consisting of
sterol and sphingolipids, are subject to RCD1-modulated ROS homeostasis and

This article is protected by copyright. All rights reserved.

 controlling inter-tissue communication. Our establishment that different ROS
regulated by RCD1 and RCI3 peroxidase cause different effects on long-distance
movement further reveals the complexity of inter-tissue communication, and
further investigation into the physiological and molecular basis of two
transporting systems related to ROS signaling might help us to understand the
underlying mechanisms of root-to-shoot transport.
Accepted Article

Acknowledgement

We were grateful to Pei zhang and Du an-na from Wuhan Institute of Virology,
Chinese Academy of Science, for their assistance in providing TEM micrographs.
Part of the TEM work was also performed at the Life Science Instrument Center
of Yangtze University with the help of Ruochao Hao and Jinwang Qu. We would
also like to thank Dr. Xianzhu Meng for his help on the SEM. This work was
supported by the National Natural Science Foundation of China (31671257).

Conflict of interest

The authors declare that they have no conflict of interest.

Author Contribution

D.L. conceived the project and designed the experiments. T.J., H.W., Z.D., T.C.
carried out the experiments. Z.L. and J.L. provided experimental support. T.J.,
H.W., P.M.W., R.G.W. and D.L. analyzed the data; D.L. wrote the manuscript.
R.G.W revised the manuscript. All authors have read and agreed to publish this
manuscript.

This article is protected by copyright. All rights reserved.

 References

Ahlfors, R., Lang, S., Overmyer, K., Jaspers, P., Brosche, M., Tauriainen, A.,... Kangasjarvi,
J. (2004). Arabidopsis RADICAL-INDUCED CELL DEATH1 belongs to the WWE
protein-protein interaction domain protein family and modulates abscisic acid,
ethylene, and methyl jasmonate responses. Plant Cell, 16(7), 1925-1937.
Accepted Article
doi:10.1105/tpc.021832
Alscher, R. G., Erturk, N., & Heath, L. S. (2002). Role of superoxide dismutases (SODs) in
controlling oxidative stress in plants. J Exp Bot, 53(372), 1331-1341.
Auh, C. K., & Murphy, T. M. (1995). Plasma Membrane Redox Enzyme Is Involved in the
Synthesis of O2- and H2O2 by Phytophthora Elicitor-Stimulated Rose Cells. Plant
Physiol, 107(4), 1241-1247. doi:10.1104/pp.107.4.1241
Bach, T. J., & Lichtenthaler, H. K. (1983). Inhibition by mevinolin of plant growth, sterol
formation and pigment accumulation. Physiol Plant, 59(1), 50-60.
doi:10.1111/j.1399-3054.1983.tb06570.x
Banerjee, A. K., Chatterjee, M., Yu, Y., Suh, S.-G., Miller, W. A., & Hannapel, D. J. (2006).
Dynamics of a Mobile RNA of Potato Involved in a Long-Distance Signaling
Pathway. Plant Cell, 18(12), 3443-3457. doi:10.1105/tpc.106.042473
Barberon, M., & Geldner, N. (2014). Radial Transport of Nutrients: The Plant Root as a
Polarized Epithelium. Plant Physiol, 166(2), 528-537. doi:10.1104/pp.114.246124
Brosché, M., Blomster, T., Salojärvi, J., Cui, F., Sipari, N., Leppälä, J.,... Kangasjärvi, J.
(2014). Transcriptomics and functional genomics of ROS-induced cell death
regulation by RADICAL-INDUCED CELL DEATH1. PLoS Genet, 10(2), e1004112.
Retrieved from doi:10.1371/journal.pgen.1004112
Brown, D. A., & London, E. (1998). Functions of lipid rafts in biological membranes. Annu
Rev Cell Dev Biol, 14, 111-136. doi:10.1146/annurev.cellbio.14.1.111
Carlsbecker, A., Lee, J.-Y., Roberts, C. J., Dettmer, J., Lehesranta, S., Zhou, J.,... Benfey, P.
N. (2010). Cell signalling by microRNA165/6 directs gene dose-dependent root
cell fate. Nature, 465(7296), 316-321.
Chaiwanon, J., Wang, W., Zhu, J. Y., Oh, E., & Wang, Z. Y. (2016). Information Integration
and Communication in Plant Growth Regulation. Cell, 164(6), 1257-1268.
doi:10.1016/j.cell.2016.01.044
Chen, X., Yao, Q., Gao, X., Jiang, C., Harberd, N. P., & Fu, X. (2016). Shoot-to-Root Mobile
Transcription Factor HY5 Coordinates Plant Carbon and Nitrogen Acquisition.
Curr Biol, 26(5), 640-646. doi:10.1016/j.cub.2015.12.066
Choat, B., Cobb, A. R., & Jansen, S. (2008). Structure and function of bordered pits: new
discoveries and impacts on whole-plant hydraulic function. New Phytol, 177(3),
608-625. doi:10.1111/j.1469-8137.2007.02317.x
Corbesier, L., Vincent, C., Jang, S., Fornara, F., Fan, Q., Searle, I.,... Coupland, G. (2007).
FT protein movement contributes to long-distance signaling in floral induction of
Arabidopsis. Science, 316(5827), 1030-1033. doi:10.1126/science.1141752
Deng, Z., Wu, H., Jin, T., Cai, T., Jiang, M., Wang, M., & Liang, D. (2021). A Sequential
Three-Phase Pathway Constitutes Tracheary Element Connection in the
Arabidopsis/Nicotiana Interfamilial Grafts. Front Plant Sci, 12.
doi:10.3389/fpls.2021.664342
Ding, B. (1997). Cell-to-cell transport of macromolecules through plasmodesmata: a
novel signalling pathway in plants. Trends Cell Biol, 7(1), 5-9. doi:10.1016/s0962-
8924(97)20041-3

This article is protected by copyright. All rights reserved.

 Domec, J. C., Lachenbruch, B., Meinzer, F. C., Woodruff, D. R., Warren, J. M., & McCulloh,
K. A. (2008). Maximum height in a conifer is associated with conflicting
requirements for xylem design. Proc Natl Acad Sci U S A, 105(33), 12069-12074.
doi:10.1073/pnas.0710418105
Flynn, K. (2007). A review of The Permeability, Fluid Flow, and Anatomy of Spruce ( Picea
SPP.). Wood and Fiber Science, 27, 278-284.
Fry, S. C. (1998). Oxidative scission of plant cell wall polysaccharides by ascorbate-
induced hydroxyl radicals. Biochem J, 332(Pt 2), 507-515.
Fujibe, T., Saji, H., Arakawa, K., Yabe, N., Takeuchi, Y., & Yamamoto, K. T. (2004). A
Accepted Article

methyl viologen-resistant mutant of Arabidopsis, which is allelic to ozone-

sensitive rcd1, is tolerant to supplemental ultraviolet-B irradiation. Plant Physiol,
134(1), 275-285. doi:10.1104/pp.103.033480
Galea, A. M., & Brown, A. J. (2009). Special relationship between sterols and oxygen:
were sterols an adaptation to aerobic life? Free Radic Biol Med, 47(6), 880-889.
doi:10.1016/j.freeradbiomed.2009.06.027
Georgiou, C. D., Papapostolou, I., & Grintzalis, K. (2008). Superoxide radical detection in
cells, tissues, organisms (animals, plants, insects, microorganisms) and soils. Nat
Protoc, 3(11), 1679-1692. doi:10.1038/nprot.2008.155
Grison, M. S., Brocard, L., Fouillen, L., Nicolas, W., Wewer, V., Dormann, P.,... Bayer, E. M.
(2015). Specific membrane lipid composition is important for plasmodesmata
function in Arabidopsis. Plant Cell, 27(4), 1228-1250.
doi:10.1105/tpc.114.135731
Han, X., & Kim, J. Y. (2016). Integrating Hormone- and Micromolecule-Mediated
Signaling with Plasmodesmal Communication. Mol Plant, 9(1), 46-56.
doi:10.1016/j.molp.2015.08.015
Heiber, I., Ströher, E., Raatz, B., Busse, I., Kahmann, U., Bevan, M. W.,... Baier, M. (2007).
The <em>redox imbalanced</em> Mutants of Arabidopsis Differentiate
Signaling Pathways for Redox Regulation of Chloroplast Antioxidant Enzymes.
Plant Physiol, 143(4), 1774-1788. doi:10.1104/pp.106.093328
Heinlein, M., & Epel, B. L. (2004). Macromolecular transport and signaling through
plasmodesmata. Int Rev Cytol, 235, 93-164. doi:10.1016/s0074-7696(04)35003-5
Henry, L. K., Gutensohn, M., Thomas, S. T., Noel, J. P., & Dudareva, N. (2015). Orthologs
of the archaeal isopentenyl phosphate kinase regulate terpenoid production in
plants. Proc Natl Acad Sci U S A, 112(32), 10050-10055.
doi:10.1073/pnas.1504798112
Hiltscher, H., Rudnik, R., Shaikhali, J., Heiber, I., Mellenthin, M., Meirelles Duarte, I.,...
Baier, M. (2014). The radical induced cell death protein 1 (RCD1) supports
transcriptional activation of genes for chloroplast antioxidant enzymes. Front
Plant Sci, 5, 475-475. doi:10.3389/fpls.2014.00475
Iqbal, J., & Whitney, P. (1991). Use of cyanide and diethyldithiocarbamate in the assay of
superoxide dismutases. Free Radic Biol Med, 10(1), 69-77.
Jensen, K. H., Berg-Sørensen, K., Bruus, H., Holbrook, N. M., Liesche, J., Schulz, A.,... Bohr,
T. (2016). Sap flow and sugar transport in plants. Reviews of Modern Physics,
88(3), 035007. doi:10.1103/RevModPhys.88.035007
Jiang, M., Deng, Z., White, R. G., Jin, T., & Liang, D. (2019). Shootward Movement of
CFDA Tracer Loaded in the Bottom Sink Tissues of Arabidopsis. JoVE(147),
e59606. doi:doi:10.3791/59606
Jin, T., Wang, X., Deng, Z., Liu, X., & Liang, D. (2021). ROS-induced dramatic lipid changes
in Arabidopsis. Redox Report, 26(1), 190-196.
doi:10.1080/13510002.2021.2002001

This article is protected by copyright. All rights reserved.

 Kim, M., Canio, W., Kessler, S., & Sinha, N. (2001). Developmental changes due to long-
distance movement of a homeobox fusion transcript in tomato. Science, 293.
doi:10.1126/science.1059805
Kitagawa, M., & Jackson, D. (2017). Plasmodesmata-Mediated Cell-to-Cell
Communication in the Shoot Apical Meristem: How Stem Cells Talk. Plants (Basel,
Switzerland), 6(1), 12. doi:10.3390/plants6010012
Knoll, A. H. (2011). The multiple origins of complex multicellularity. Annu. Rev. Earth
Planet. Sci., 39, 217-239. doi:10.1146/annurev.earth.031208.100209
Larrieu, A., & Vernoux, T. (2015). Comparison of plant hormone signalling systems (Vol.
Accepted Article

58).
Lefebvre, B., Furt, F., Hartmann, M.-A., Michaelson, L. V., Carde, J.-P., Sargueil-Boiron,
F.,... Mongrand, S. (2007). Characterization of Lipid Rafts from Medicago
truncatula Root Plasma Membranes: A Proteomic Study Reveals the Presence of
a Raft-Associated Redox System. Plant Physiol, 144(1), 402-418.
doi:10.1104/pp.106.094102
Levy, A., Erlanger, M., Rosenthal, M., & Epel, B. L. (2007). A plasmodesmata-associated
β-1,3-glucanase in Arabidopsis. The Plant Journal, 49(4), 669-682.
doi:doi:10.1111/j.1365-313X.2006.02986.x
Li, L., Lai, E. Y., Wellstein, A., Welch, W. J., & Wilcox, C. S. (2016). Differential effects of
superoxide and hydrogen peroxide on myogenic signaling, membrane potential,
and contractions of mouse renal afferent arterioles. American Journal of
Physiology-Renal Physiology, 310(11), F1197-F1205.
doi:10.1152/ajprenal.00575.2015
Liang, D. (2018). A Salutary Role of Reactive Oxygen Species in Intercellular Tunnel-
Mediated Communication. Frontiers in Cell and Developmental Biology, 6(2).
doi:10.3389/fcell.2018.00002
Liang, D., White, R. G., & Waterhouse, P. M. (2012). Gene silencing in Arabidopsis
spreads from the root to the shoot, through a gating barrier, by template-
dependent, nonvascular, cell-to-cell movement. Plant Physiol, 159(3), 984-1000.
doi:10.1104/pp.112.197129
Liang, D., White, R. G., & Waterhouse, P. M. (2014). Mobile gene silencing in Arabidopsis
is regulated by hydrogen peroxide. PeerJ, 2, e701. doi:10.7717/peerj.701
Lingwood, D., & Simons, K. (2010). Lipid rafts as a membrane-organizing principle.
Science, 327(5961), 46-50. doi:10.1126/science.1174621
Liu, X., Wu, H., Zeng, Y., Deng, Z., Wang, X., & Liang, D. (2022). The dynamic changes of
tracheary elements in an intraspecific quinoa (Chenopodium quinoa) graft.
Journal of Plant Physiology, 273, 153691. doi:10.1016/j.jplph.2022.153691
Lucas, W. J. (1995). Plasmodesmata: intercellular channels for macromolecular transport
in plants. Curr Opin Cell Biol, 7(5), 673-680. doi:10.1016/0955-0674(95)80109-X
Lucas, W. J., & Lee, J. Y. (2004). Plasmodesmata as a supracellular control network in
plants. Nat Rev Mol Cell Biol, 5(9), 712-726. doi:10.1038/nrm1470
Matyash, V., Liebisch, G., Kurzchalia, T. V., Shevchenko, A., & Schwudke, D. (2008). Lipid
extraction by methyl-tert-butyl ether for high-throughput lipidomics. J Lipid Res,
49(5), 1137-1146. doi:10.1194/jlr.D700041-JLR200
Müller, P., & Schier, A. F. (2011). Extracellular Movement of Signaling Molecules. Dev
Cell, 21(1), 145-158. doi:10.1016/j.devcel.2011.06.001
Nagano, M., Ishikawa, T., Fujiwara, M., Fukao, Y., Kawano, Y., Kawai-Yamada, M., &
Shimamoto, K. (2016). Plasma Membrane Microdomains Are Essential for Rac1-
RbohB/H-Mediated Immunity in Rice. The Plant Cell, 28(8), 1966-1983.
doi:10.1105/tpc.16.00201

This article is protected by copyright. All rights reserved.

 Nedukha, O. M. (2015). Callose: Localization, functions, and synthesis in plant cells.
Cytology and Genetics, 49(1), 49-57. doi:10.3103/s0095452715010090
Neumann, P. M., Weissman, R., Stefano, G., & Mancuso, S. (2010). Accumulation of
xylem transported protein at pit membranes and associated reductions in
hydraulic conductance. J Exp Bot, 61(6), 1711-1717. doi:10.1093/jxb/erq037
Niklas, K. J., & Newman, S. A. (2013). The origins of multicellular organisms. Evol Dev,
15(1), 41-52. doi:10.1111/ede.12013
Ohkubo, Y., Tanaka, M., Tabata, R., Ogawa-Ohnishi, M., & Matsubayashi, Y. (2017).
Shoot-to-root mobile polypeptides involved in systemic regulation of nitrogen
Accepted Article

acquisition. Nat Plants, 3, 17029. doi:10.1038/nplants.2017.29

Overmyer, K., Tuominen, H., Kettunen, R., Betz, C., Langebartels, C., Sandermann, H., &
Kangasjärvi, J. (2000). Ozone-sensitive arabidopsis rcd1 mutant reveals opposite
roles for ethylene and jasmonate signaling pathways in regulating superoxide-
dependent cell death. Plant Cell, 12(10), 1849-1862. doi:10.1105/tpc.12.10.1849
Peng, L., Kawagoe, Y., Hogan, P., & Delmer, D. (2002). Sitosterol-beta-glucoside as
primer for cellulose synthesis in plants. Science, 295(5552), 147-150.
doi:10.1126/science.1064281
Pyott, D. E., & Molnar, A. (2015). Going mobile: Non-cell-autonomous small RNAs shape
the genetic landscape of plants. Plant Biotechnol J, 13(3), 306-318.
doi:10.1111/pbi.12353
Rich, P. R., Wiegand, N. K., Blum, H., Moore, A. L., & Bonner, W. D. (1978). Studies on the
mechanism of inhibition of redox enzymes by substituted hydroxamic acids.
Biochimica et Biophysica Acta (BBA) - Enzymology, 525(2), 325-337.
doi:10.1016/0005-2744(78)90227-9
Rinne, P. L., & van der Schoot, C. (1998). Symplasmic fields in the tunica of the shoot
apical meristem coordinate morphogenetic events. Development, 125(8), 1477-
1485.
Robert, H. S., & Friml, J. (2009). Auxin and other signals on the move in plants. Nat Chem
Biol, 5, 325. doi:10.1038/nchembio.170
Santner, A., & Estelle, M. (2009). Recent advances and emerging trends in plant
hormone signalling. Nature, 459(7250), 1071-1078. doi:10.1038/nature08122
Shapiguzov, A., Vainonen, J. P., Hunter, K., Tossavainen, H., Tiwari, A., Järvi, S.,...
Kangasjärvi, J. (2019). Arabidopsis RCD1 coordinates chloroplast and
mitochondrial functions through interaction with ANAC transcription factors.
eLife, 8, e43284. doi:10.7554/eLife.43284
Skopelitis, D. S., Hill, K., Klesen, S., Marco, C. F., von Born, P., Chitwood, D. H., &
Timmermans, M. C. P. (2018). Gating of miRNA movement at defined cell-cell
interfaces governs their impact as positional signals. Nat Commun, 9(1), 3107.
doi:10.1038/s41467-018-05571-0
Takahashi, F., Suzuki, T., Osakabe, Y., Betsuyaku, S., Kondo, Y., Dohmae, N.,... Shinozaki,
K. (2018). A small peptide modulates stomatal control via abscisic acid in long-
distance signalling. Nature, 556(7700), 235-238. doi:10.1038/s41586-018-0009-2
Thorpe, G. W., Reodica, M., Davies, M. J., Heeren, G., Jarolim, S., Pillay, B.,... Dawes, I. W.
(2013). Superoxide radicals have a protective role during H2O2 stress. Mol Biol
Cell, 24(18), 2876-2884. doi:10.1091/mbc.e13-01-0052
Tsikou, D., Yan, Z., Holt, D. B., Abel, N. B., Reid, D. E., Madsen, L. H.,... Markmann, K.
(2018). Systemic control of legume susceptibility to rhizobial infection by a
mobile microRNA. Science, 362(6411), 233-236. doi:10.1126/science.aat6907
van Doorn, W. G., Hiemstra, T., & Fanourakis, D. (2011). Hydrogel regulation of xylem
water flow: an alternative hypothesis. Plant Physiol, 157(4), 1642-1649.
doi:10.1104/pp.111.185314

This article is protected by copyright. All rights reserved.

 Vaten, A., Dettmer, J., Wu, S., Stierhof, Y. D., Miyashima, S., Yadav, S. R.,... Helariutta, Y.
(2011). Callose biosynthesis regulates symplastic trafficking during root
development. Dev Cell, 21(6), 1144-1155. doi:10.1016/j.devcel.2011.10.006
Wang, Z. P., Xing, H. L., Dong, L., Zhang, H. Y., Han, C. Y., Wang, X. C., & Chen, Q. J. (2015).
Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates
homozygous mutants for multiple target genes in Arabidopsis in a single
generation. Genome Biol, 16(1), 144. doi:10.1186/s13059-015-0715-0
Wu, S. W., Kumar, R., Iswanto, A. B. B., & Kim, J. Y. (2018). Callose balancing at
plasmodesmata. J Exp Bot, 69(22), 5325-5339. doi:10.1093/jxb/ery317
Accepted Article

Xia, C., Zheng, Y., Huang, J., Zhou, X., Li, R., Zha, M.,... Zhang, C. (2018). Elucidation of the
Mechanisms of Long-Distance mRNA Movement in a Nicotiana
benthamiana/Tomato Heterograft System. Plant Physiol, 177(2), 745-758.
doi:10.1104/pp.17.01836
Xu, X. M., Wang, J., Xuan, Z., Goldshmidt, A., Borrill, P. G. M., Hariharan, N.,... Jackson, D.
(2011). Chaperonins Facilitate KNOTTED1 Cell-to-Cell Trafficking and Stem Cell
Function. Science, 333(6046), 1141-1144. doi:10.1126/science.1205727
Zavaliev, R., Ueki, S., Epel, B. L., & Citovsky, V. (2011). Biology of callose (beta-1,3-glucan)
turnover at plasmodesmata. Protoplasma, 248(1), 117-130. doi:10.1007/s00709-
010-0247-0
Zhang, Z., Ruan, Y.-L., Zhou, N., Wang, F., Guan, X., Fang, L.,... Zhang, T. (2017).
Suppressing a Putative Sterol Carrier Gene Reduces Plasmodesmal Permeability
and Activates Sucrose Transporter Genes during Cotton Fiber Elongation. Plant
Cell, 29(8), 2027-2046. doi:10.1105/tpc.17.00358
Zhao, H., Joseph, J., Fales, H. M., Sokoloski, E. A., Levine, R. L., Vasquez-Vivar, J., &
Kalyanaraman, B. (2005). Detection and characterization of the product of
hydroethidine and intracellular superoxide by HPLC and limitations of
fluorescence. Proc Natl Acad Sci U S A, 102(16), 5727-5732.
doi:10.1073/pnas.0501719102
Zhu, Y., Du, B., Qian, J., Zou, B., & Hua, J. (2013). Disease Resistance Gene-Induced
Growth Inhibition Is Enhanced by rcd1 Independent of Defense Activation in
Arabidopsis. Plant Physiol, 161(4), 2005-2013. doi:10.1104/pp.112.213363
Zielonka, J., Hardy, M., Michalski, R., Sikora, A., Zielonka, M., Cheng, G.,... Kalyanaraman,
B. (2017). Recent Developments in the Probes and Assays for Measurement of
the Activity of NADPH Oxidases. Cell Biochem Biophys, 75(3), 335-349.
doi:10.1007/s12013-017-0813-6
Zielonka, J., Vasquez-Vivar, J., & Kalyanaraman, B. (2008). Detection of 2-
hydroxyethidium in cellular systems: a unique marker product of superoxide and
hydroethidine. Nat Protoc, 3(1), 8-21. doi:10.1038/nprot.2007.473

This article is protected by copyright. All rights reserved.

 Figure legend
Accepted Article

Figure 1. Mobile silencing in RtSS and tsg3 mutant. (a) Root-to-shoot silencing
mobile progression in parent plant RtSS and tsg3 mutant from 3 DAD (days after
Dex) and 21 DAD. Long arrows indicate the movement of silencing front. Dashed
line, root-hypocotyl junction. Scale bar in each panel is 500 µM. (b) Mobile
distance of silencing front in the hypocotyl region of RtSS and tsg3 mutant. (c)
Mobile distance of silencing front in the HEJ (hypocotyl-epicotyl junction) zone of
RtSS and tsg3 muant. (d) Detection of small RNA from “P” region (332 bp in the 3’
end of GFP gene) in RtSS and tsg3 mutant.

This article is protected by copyright. All rights reserved.

Accepted Article

Figure 2. rcd1 alleles and knockout mutant through CRISPR/CAS9 approach. (a)
Genomic structure of RCD1 gene and T-DNA insertion lines. (b) New allele of
RCD1 gene by CRISPR-CAS9 genome editing tool. The G addition in the coding
th
position of 369 AA caused frameshift mutation of RCD1 gene. (c) Comparison of
silencing front movement in the RtSS and rcd1-cas9 lines. At 15 DAD, the
silencing front was stopped at the HEJ zone of rcd1-cas9 line and it moved a little
further into HEJ zone at 25 DAD, which is exactly similar to the tsg3 mutant. Scale
bar is 500 µM.

This article is protected by copyright. All rights reserved.

Accepted Article

Figure 3. Superoxide quantification and its impact on mobile silencing. (a) NBT
staining to detect superoxide accumulation in the tsg3 and RtSS plants. (b)
Quantitative measurement of superoxide via 2-OH-E surrogate. (c) Q-PCR analysis
of FSD1 expression level in three independent alleles. (d) Effect of superoxide
dismutase inhibitor on the percentage of RtSS shoots showing silencing under
different concentrations of DDC. (e) Effect of SHAM on the percentage of RtSS
shoots showing silencing. (f) 15 DAD in RtSS plants. (g) Ubi-FSD1 expression in
rcd1-7 mutant. (h) Ubi-null vector in rcd1-7 mutant. (i) Ubi-FSD1 expression in
RtSS plants. Scale bar is 500 µM.

This article is protected by copyright. All rights reserved.

Accepted Article

Figure 4. CFDA movement and PD frequency and structure in WT Col-0 plants and
rcd1-3 mutant. (a) Shoot staining efficiency of CFDA loaded in the roots of WT
Col-0 and rcd1-3 mutant. (b) Schematic of hypocotyl cortex cell walls and PD on
the transverse walls. The cortex cells were approximately cubic in shape and
aligned to the root-shoot axis. Bar on transverse wall (T) represents PD. The
dotted line represents the cell wall. R, radial; T, transverse. (c) PD frequency on
the transverse walls of longitudinally sectioned cortex layer in WT Col-0 and rcd1-
3 mutant. Three independent plants in WT Col-0 and rcd1-3, respectively, were
used for TEM analysis. In each sample, about 300-600 ultrasections were made
for PD frequency analysis. p value was calculated using chi-square test. (d) PD
structure in WT Col-0 plants. (e) PD structure in rcd1-3 mutant. Note the
zigzagged PD in the rcd1-3 mutant.

This article is protected by copyright. All rights reserved.

Accepted Article

Figure 5. Pits measurement and fuchsin loading in WT Col-0 and rcd1 mutant. (a)
Alternate pits on the tangential and radial walls of hypocotyl in 15-day old WT
Col-0 plants. (b) Alternate pits on the tangential and radial walls of hypocotyl in
15-day old rcd1-3 mutant. (c) Pit size in 15-day old WT Col-0 plants and rcd1-3
mutant. (d) Uniseriate pits on the radial walls of 15-day old WT Col-0 plants. (e)
Uniseriate pits on the radial walls of 15-day old rcd1-3 mutant. (f) Uniseriate pits
size in 15-day old WT Col-0 plants and rcd1-3 mutant. (g) Alternate pits on the
tangential and radial walls of hypocotyl in 23-day old WT Col-0 plants. (h)
Alternate pits on the tangential and radial walls of hypocotyl in 23-day old rcd1-3
mutant. (i) Pit size in 23-day old WT Col-0 plants and rcd1-3 mutant. (j) Uniseriate
pits on the radial walls of 23-day old WT Col-0 plants. (k) Uniseriate pits on the
radial walls of 23-day old rcd1-3 mutant. (l) Uniseriate pits size in 23-day old WT
Col-0 plants and rcd1-3 mutant. (m) Leaf vasculature staining at 35 and 90 min
after fuchsin was loaded in roots of WT Col-0 plants and rcd1-3 mutant. (n) The
ratio of fuchsin translocation from root to shoot in WT Col-0 plants and rcd1-3

This article is protected by copyright. All rights reserved.

 mutant. (o) The ratio of fuchsin translocation in SHAM-treated plants. (p) The
ratio of fuchsin translocation in DDC-treated plants. (q) The ratio of fuchsin
translocation in H2O2-treated plants. 15 to 30 plants were included for each time
point in (n), (o), (p) and (q). Asterisks indicate a significant difference (one asterisk
indicates p < 0.05, two asterisks indicate p < 0.001) between Col-0 and rcd1-3 at
individual time point using Student's t-test. Scale bar in (a), (b), (d), (e), (g), (h),
Accepted Article

(j), (k) is 5 µm.

Figure 6. Sterol contents in the mutant alleles rcd1-3, -7, rcd1-cas9, rci3-2, RtSS
and WT Col-0 plants, and its modulation on mobile silencing. (a) GC/MS analysis
of the reference sample. (b) β-sitosterol content in the shoots including
hypocotyls. (c) β-sitosterol content in the roots. (d) Stigmasterol content in the
roots. Stigmasterol cannot be detected in the shoots. (e) Effect of lovastatin on
the percentage of RtSS shoots showing silencing. Error bars indicate SD from four
replicate samples. The data were evaluated by Student’s t test; * P < 0.05 and **
P < 0.01. DW, dry weight.

This article is protected by copyright. All rights reserved.

Accepted Article

Figure 7. A model for RCD1-mediated ROS regulation of root-to-shoot long-

distance flow. RCD1 has been emerging as an important hub in regulating ROS
homeostasis in Arabidopsis. The unbalanced ROS due to rcd1 mutation lead to
the reduced incorporation of phytosterols into the lipid rafts, which, in turn,
compromise the structural and functional integrity of PD membrane and pits
membrane. These consequences eventually impact both symplastically and
apoplastically on the root-to-shoot long-distance flow. Phospholipids,
sphingolipids, free sterols are depicted in blue, orange, and green, respectively.

This article is protected by copyright. All rights reserved.

 Supporting information

Figure S1. The silencing phenotype in the RtSS and tsg3 mutant.

Figure S2. Superoxide level in WT Col-0 Arabidopsis plants treated with DDC
Accepted Article

and SHAM agents.

Figure S3. The spacing of pits in the 15-day old WT Col-0 and rcd1-3 plants.

Figure S4. Callose staining in WT Col-0 plants and rcd1 allelic mutants.

Figure S5. Lipid quantification in WT Col-0 plants and rcd1-3 mutant.

Video S1. Time-lapse fuchsin movement in WT Col-0 and rcd1-3 corresponding

to Fig. 5m, n.

This article is protected by copyright. All rights reserved.