Professional Documents
Culture Documents
Untitled
Untitled
1
Hubei Collaborative Innovation Center for Grain Industry, School of Agriculture,
Yangtze University, Jingzhou, Hubei Province, China
2
Engineering Research Center of Ecology and Agricultural Use of Wetland, Ministry
of Education/Hubei Key Laboratory of Waterlogging Disaster and Wetland
Agriculture, Yangtze University, Jingzhou, Hubei Province, China
3
Centre for Tropical Crops and Biocommodities, Queensland University of
Technology, Brisbane, Australia
4
Department of Plant Sciences, Research School of Biology, Australian National
University, ACT, Australia
This article has been accepted for publication and undergone full peer review but
has not been through the copyediting, typesetting, pagination and proofreading
process, which may lead to differences between this version and the Version of
Record. Please cite this article as doi: 10.1111/pce.14375.
Introduction
In our previous study, we have shown apoplastic ROS controlled by a type III
peroxidase (POX) RCI3 is critical for root-to-shoot small RNA-mediated gene
silencing movement. This cell-wall localized peroxidase can effectively regulate
Accepted Article
intercellular RNAi movement without noticeable compromise of plant
development (D. Liang, White, & Waterhouse, 2014). The question remains how
the extracellular ROS signaling is transmitted into the symplast. In this work, a
central redox regulator RCD1 (Radical induced cell death 1) has been uncovered
for its role in modulating intercellular RNAi movement. Loss of function of RCD1
leads to high accumulation of superoxide, strongly repressing—independently of
callose—PD formation (lower PD frequency) and PD development in the cortical
cells. We further provide evidence for RCD1-regulated superoxide level and
propose that antagonistic interactions of superoxide and H2O2 signaling can adjust
intercellular RNAi movement and apoplastic flow.
further analysis. The frequency of each SNP allele was then plotted to allow
identification of a ‘linked region’ with a higher overall frequency in the mutant
pool. The candidate variants were then annotated and prioritized based on the
changes induced.
The full length genomic region of tsg3 from wild type (WT) Col-0 was amplified
using the following primer: RCDpro-F2,
cactagtcagatctaccatggCTTACAAGATTGGGAAGACAGCCG; RCDgenofusA-
R2, cctcgcccttgctcaccatggATCCACCTGCACCTTCTTCATGG and then cloned
into T-DNA vector to fuse with GFP tag. The transformants were selected on
medium containing 50mg/ml kanamycin. Salk T-DNA line SALK_116432 was
ordered from Salk Institute (http://signal.salk.edu/). The CRISPR lines were
generated as previously described (Wang et al., 2015). Briefly, the target sites
were selected using an online tool: http://www.rgenome.net/cas-offinder/new, and
the following primers were designed to target the tsg3 locus: DT1-RCD1-BsF:
ATATATGGTCTCGATTGAAATAAGGGCAGTCTGCAGGTT; DT1-RCD1-
F0: TGAAATAAGGGCAGTCTGCAGGTTTTAGAGCTAGAAATAGC; DT2-
SRO1-R0:
AACCCTCAGCAGGCTTGACACCCAATCTCTTAGTCGACTCTAC; DT2-
SRO1-BsR: ATTATTGGTCTCGAAACCCTCAGCAGGCTTGACACCC.
Overexpressing lines
To generate an overexpressing line, the FSD1 and RCI3 genomic cDNA was
amplified using the following primers: FSD-Mfe-F1,
ctgattaacagctcgcaattgAAACTTGAGGTACTGATTCTATCTCTCATC; FSD-
Mfe-HA-R1, CAGGAACATCATAAGGATAacagctatggtgatgaattg; RCI-Mfe-F1,
ctgattaacagctcgcaattgCACACAACATAATCCTCCCAAACA; RCI-Mfe-HA-R1,
Superoxide measurement
and the clear bottom layer was adjusted pH to 7.0 by the addition of 1/50 volume
2.5 M Tris-HCl buffer pH 7.0. 2-OH-E+ was absorbed by the active resin after the
passage of 2-OH-E+ acetone extract through the Dowex active cation exchange
microcolumn. The microcolumn was washed with 1 ml 4 M NaCl, 1 ml ddH2O, 2
ml 100% ACN and 2 ml ddH2O, and 2-OH-E+ was then eluted with 1ml 10 M
HCl and diluted to 3 M by adding ddH2O. 2-OH-E+ was further purified by
passing the eluted 2-OH-E+ through the active HLB (Hydrophobic-lipophilic
balance) microcolumn at flow rate 2 ml min-1. The microcolumn was passed
through 1 ml 17% (v/v) ACN in phosphate buffer to wash off impurities. 2-OH-E+
was eluted by passing through 1.5 ml 25% ACN in phosphate buffer. The eluate
was mixed with an equal volume of chloroform by vigorous vortexing, and the
CHCl3/ACN layer was collected and evaporated in a vacuum rotatory evaporator
to obtain the 2-OH-E+. To quantify the fluorescence of 2-OH-E+, the above
obtained 2-OH-E+ was re-dissolved with 0.3 ml 50 mM phosphate buffer (pH 7.4)
containing 1% (v/v) DMSO, and added 0.02 ml 2 mg/ml DNA solution to enhance
the fluorescence of 2-OH-E+. The TFU (Total Fluorescent Units) including the FU
of 2-OH-E+ and other oxidation products such as E+ was measured at ex/em
515/567 nm (Synergy 2, BioTek). After adding 0.025 ml 0.003% H2O2 (v/v) and
10 µl 110U/ml horseradish peroxidase (HRP) and incubating for 30 min, the FU
of the solution was again recorded. The fluorescence of 2-OH-E+ is equal to TFU
– FU. Finally, the concentration was calculated using a 2-OH-E+ standard curve.
The 2-OH-E+ was synthesized by reaction of HE with nitrosodisulfonate radical
dianion (Fremy’s salt) and purified by an Alltech Prevail SPE C18 cartridge, then
concentrated by vacuum rotatory evaporator. The 2-OH-E+ serial solutions (0 –
1000 nM) were prepared in 50 mM phosphate buffer, pH 7.4. Their FUs were
measured at ex/em 515/567 nm to give a standard curve.
For TEM, the hypocotyl samples were collected with length about 1.5-2 mm and
fixed in 2.5% glutaraldehyde in 0.1 M Phosphate Buffer (pH 7.4) overnight at 4 ℃.
The samples were briefly washed three times with PBS (0.1 M), then post-fixed
Accepted Article
Tracheary element examination was previously described by Liu et al. (2022) and
Deng et al. (2021). Briefly, the hypocotyl region below the HEJ zone was
collected and immediately fixed in 4% paraformaldehyde in 1X PBS buffer for 30
min. The fixed samples were rinsed three times with PBS and dissected under
dissecting microscope. The parenchyma cells around the xylem tissue were peeled
off to expose the tangential walls, and the median longitudinal sections were
dissected to reveal pits on the radial walls. The dissected samples were further
washed in 1% Triton X-100 for 15 min, then rinsed in PBS for 15 min. The
dissected materials were dehydrated for 15 min each in an ethanol series of 25%,
50%, 75% and 100% ethanol. After three-times of washes with absolute ethanol,
the samples were dried in -20℃, low-vacuum drier (CHRIST). The dried samples
Lipid extraction
The lipid extraction mainly followed the protocol of Matyash et al. (2008). Briefly,
Accepted Article
the samples were dried, weighed and ground into fine powder. After 10 mg fine
powder was vortexed with 1.5 ml methanol, with 5 ml MTBE (methyl tert-butyl
ether) was added to the mixture which was then incubated overnight at room
temperature in a shaker. The addition of 1.25 ml of MS-grade water induced phase
separation, and after 10 min incubation at room temperature, the sample was
centrifuged at 1,000 g for 10 min. The organic phase was collected, and the lower
phase was re-extracted with 2 ml of the solvent mixture (MTBE/methanol/water
(10:2:1.6, v/v/v). The organic phases were combined then dried in a vacuum
centrifuge. To speed up sample drying, 200 µl methanol was added to the organic
phase after 25 min of centrifugation. The dried lipids were dissolved in 200 µl of
CHCl3/methanol/water (60:30:4.5, v/v/v) for storage.
Sterol quantification
Sterol extraction was performed according to Henry et al. (2015) with some
modifications: the samples were harvested, dried in a vacuum freeze dryer (-20 ℃),
then weighed and ground in liquid nitrogen. The lipid was extracted with 4 mL
chloroform:methanol (2:1) (v/v), and then filtered with PVDF syringe filter
(Rephiquik) after incubation at 70 ℃ for 1h. Fifty µg/ml 5α-Cholestane was added
as an internal standard. The extracts were then saponified with 2 mL 6% (w/v)
KOH in methanol for 3 h at 90 °C to release the sterol moiety of steryl esters.
Sterols were extracted from the above mixtures three times with 2 mL
hexane:water (1:1) (v/v) and dried in a vacuum freeze dryer. The dried residues
Results
Characterization of tsg3 mutant for impaired RNAi movement but not for
RNAi effection
Accepted Article
Longitudinal sections of hypocotyls revealed that the silencing front in the tsg3
mutant was barely detected at the root-hypocotyl junction while it was just
emerging in the RtSS line at 3 DAD (days after Dex) (Fig. 1a). At 6 DAD, the
silencing front had migrated half way up the wild type (WT) RtSS hypocotyl, but
had only reached the lower half of the tsg3 hypocotyl. The silencing front reached
the HEJ zone of WT plants by day 11, and in the mutant, reached the same stage
by day 14 (Fig. 1a). Linear regression analysis further showed the rate of silencing
movement in the tsg3 hypocotyl was significantly lower than in the WT
(p<0.0001, R square for RtSS and tsg3 was 0.87 and 0.85 respectively) (Fig. 1b).
As the silencing front approached the HEJ zone, its progression was greatly
reduced in both RtSS and the mutant (Fig. 1c). The silencing front continued
shootward to induce systemic shoot silencing in the WT, but was almost
completely halted at the HEJ zone in tsg3 from 14 DAD to 28 DAD (Fig. 1a and
Fig.S1), leading to very delayed mobile silencing (Fig. S1). Furthermore, northern
leaves, the P signal could be detected in the leaves of tsg3 although only after two
months of DEX treatment, further suggesting the production and propagation of
silencing signal was independent of the tsg3 mutation.
RCD1 was originally identified through apoplatic ROS screening (Overmyer et al.,
Accepted Article
2000) and it was further demonstrated that rcd1 mutant accumulate more
superoxide in independent studies based on nitroblue tetrazolium (NBT) staining
(Overmyer et al., 2000; Zhu, Du, Qian, Zou, & Hua, 2013). NBT staining of tsg3
produced similar results (Fig. 3a). Since NBT is less sensitive and specific for
detection of O2•– in biological samples (Jacek Zielonka et al., 2017), we turned to
quantitative measurement of superoxide by detecting the unique marker product of
O2•–, 2-hydroxyethidium (2-OH-E+) (Georgiou et al., 2008; Zhao et al., 2005; J.
Zielonka et al., 2008). We found that the WT Col-0 and WT RtSS plants generated
2-OH-E+ at concentrations of 42 and 46 nM/mg respectively, whereas the rcd1-3
(Fig. 2a) and rcd1-7 plants showed greatly elevated production of 2-OH-E+ of 75
and 58 nM/mg respectively (Fig. 3b). This result might suggest that higher
accumulation of O2•– would reduce the rate of silencing movement. We then
examined the O2•– level in rci3-2 mutant that showed reduced silencing movement
due to mutation in peroxidase 3 gene (D. Liang et al., 2014), and found the 2-OH-
E+ production was also elevated in the rci3-2 mutant (Fig. 3b), suggesting that the
elevated production of O2•– was reversely associated with the rate of silencing
movement. This conclusion was further corroborated by the observation that a
superoxide dismutase-encoding gene FSD1 (At4g25100) whose expression was
reduced in rcd1-1 mutant (Brosché et al., 2014), was also strongly repressed in
other rcd1 mutants (Fig. 3c).
Since FSD1 plays a critical role in controlling O2•– levels (Alscher, Erturk, &
Accepted Article
Heath, 2002) and its significant reduction in the rcd1 mutant (Fig. 3c) may be
associated with reduced silencing movement, we introduced the FSD1 gene under
the control of the Ubiquitin promoter into both RtSS and the rcd1-7 mutant. The
silencing front in the rcd1 mutant overexpressing FSD1 crossed the HEJ zone
much faster than in the null lines and the rcd1 mutant (Fig. 3f-i). We also
observed that the silencing front moved faster in the FSD1-overexpressing RtSS
lines (Fig. 3i).
To test whether the reduced rate of mobile silencing was due to impaired
symplastic transport, we analyzed shootward CFDA mobility by using hypocotyl-
pinching method (Jiang et al., 2019). There was no difference in staining
efficiency in the 9 to 13 day-after-sowing (DAS) plants, however, from 14 DAS,
WT Col-0 and rcd1-3 began to diverge, and CFDA mobility eventually dropped
below 70% of WT in the rcd1-3 mutant (Fig. 4a), suggesting that symplastic
transport is retarded at this developmental stage in the rcd1 mutant.
We then asked how the silencing movement was retarded and whether we could
detect any structural changes in the symplastic connections. To do this, a series of
ultra-thin sections were obtained in the hypocotyl cortex layer in which the
transverse cell walls present a barrier to root-shoot vertical communication but
can be distinctly identified from the near-rectangle cell stacking arrangement (Fig.
4b). Besides, plasmodesmata in the cortex transverse walls were non-clustered
distributed, thus ideal for PD frequency comparison. More than 3000 sections
from 6 independent plants were examined and results showed that the PD
frequency was significantly reduced in the rcd1-3 mutant (0.047 PD/µm±0.016)
compared with WT Col-0 plant (0.104 PD/µm±0.023) (Fig. 4c). Furthermore, the
We previously showed that the silencing front moves through the vascular
parenchyma cells which are abundant in the xylem (D. Liang et al., 2012).
Furthermore, the earlier rcd1-1 mutant was characterized and identified by its
hypersensitive response to apoplastic ozone (Ahlfors et al., 2004). These lines of
evidence lead us to examine the pits in tracheary elements that have been
proposed to play a key role in regulating sap flow (Choat, Cobb, & Jansen, 2008;
Jensen et al., 2016). Since the pit spacing in WT and rcd1-3 was similar (Fig. S3),
we measured the area of alternate pits on the radial walls in 15-day old plants and
found that this was 11% larger in rcd1 plants compared to WT plants (Fig. 5a-c).
Furthermore, the uniseriate pits in tangential xylem walls in rcd1 plants were 46%
larger in area than in WT Col-0 plants (Fig. 5d-f). In 23-day old plants, the pit
area was 17% larger in rcd1-3 mutants in comparison to the wild type (Fig. 5g-i)
(5.39 and 6.32 µm2 respectively), and the area in the uniseriate pits of rcd1-3
mutant was also 28% larger (5.16 and 6.62 µm2 respectively) (Fig. 5j-l).
Since the area (or diameter) of bordered pits was shown to affect xylem flow in
trees (Domec et al., 2008; Flynn, 2007), we wondered whether xylem flow in rcd1
mutant was changed. We loaded the apoplastic dye fuchsin in the roots (Fig. 5m)
and showed that the staining ratio of fuchsin in the shoots of rcd1 plants was
greatly reduced (Fig. 5n). As shown in the Supplemental Movie 1, the fuchsin was
slower to reach the shoots in rcd1 mutants. Since inhibitors of ROS metabolic
enzymes caused late shootward silencing (Fig. 3d, e), we examined whether these
inhibitors could also affect pit-mediated flow. As shown in Fig. 5o-q, both SHAM
and DDC, but not H2O2 significantly reduced fuchsin staining in a 2 h timeframe
(Fig. 5o-q). This effect was attenuated with the longer time exposure to SHAM
and DDC, although the residual effects were longer for SHAM due to the stability
of these two drugs. Interestingly, H2O2 treatment had the opposite effect, which is
Recent discoveries have revealed the important role of lipids and sterols in the
PD-mediated intercellular transport (Grison et al., 2015; Zhang et al., 2017). As
we did not find significant differences in callose deposition between the rcd1
mutant and WT Col-0 plants (Fig. S4), we wondered if lipid or sterol profiles were
altered in the rcd1 mutant. The total amount of FAMEs (fatty acid methyl esters)
in rcd1 and WT Col-0 were determined by gas chromatography-mass
spectrometry (GC-MS), and were found not to differ (Fig. S5). Further sterol
profiling showed that β-sitosterol was significantly reduced in the leaf tissues, but
not in the root tissues of rcd1 plants when compared to WT Col-0 or RtSS plants
(Fig. 6a-c). Similarly, rci3-2 plants accumulated less β-sitosterol in the roots than
all other lines. Stigmasterol was barely detected in leaves, however, it was readily
detected in roots (Fig. 6d). Compared to WT Col-0 and RtSS, three allelic rcd1
mutants accumulated less stigmasterol in the root tissues. This was also true for
rci3-2 mutants with impaired mobile silencing (Fig. 6d), suggesting that the
reduced levels of β-sitosterol and stigmasterol played a role in impaired RNAi
movement. We further examined the effects of statins (e.g. lovastatin) that can
inhibit sterol formation (Bach & Lichtenthaler, 1983; Grison et al., 2015) and
found that shoot silencing in RtSS was delayed in the presence of 0.5-5 µM
lovastatin (Fig. 6e), further supporting that sterols are essential for normal
silencing signal movement.
Discussion
apoplastic pathway.
SHAM- and DDC-induced O2•– strongly repressed mobile silencing (Fig. 3),
which contrasted with the accelerated silencing movement induced by H2O2 (D.
Liang et al., 2014). Such opposite effects caused by O2•– and H2O2 strongly
supported that different ROS impact the intercellular communication differently
of evidence indicate O2•– signaling function differentiates from that of the H2O2
signaling although the components of O2•– pathway are nearly completely
uncharacterized. Despite this, one of the consequences of higher O2•– would lead
to sterol downregulation as shown in Fig. 6. Actually, these results are reasonably
fair given that sterols act as antioxidant and their evolutionary advent coincides
with the rise of oxygen (Galea & Brown, 2009), therefore the immediate response
to elevated oxygen/ROS via sterol modulation (Jin, Wang, Deng, Liu, & Liang,
2021) could be evolutionarily conserved.
Sterols have been widely identified as one of the main components of membrane
microdomains or lipid rafts that display the property of detergent resistance
(Brown & London, 1998; Lefebvre et al., 2007; Lingwood & Simons, 2010). In
addition, the lipids rafts are highly enriched with redox proteins in Medicago
(Lefebvre et al., 2007), and also essential for rice immunity to blast fungus
(Nagano et al., 2016), implying that the association of redox balance with lipid
rafts is critical for lipid raft-mediated process. Interestingly, recent studies have
shown that PD membrane is found enriched with sterols and sphigolipids
compared to the bulk of plasma membrane, which is similar to the profile of lipid
rafts (Grison et al., 2015). Indeed, our results also showed that sterol depletion by
sterol inhibitor delayed gene silencing movement (Fig. 6) which was consistent
with its role in modulating cell-to-cell GFP unloading (Grison et al., 2015).
Antisense suppression of a putative sterol carrier gene leads to reduced PD
permeability in cotton fibre (Zhang et al., 2017). All this growing evidence
highlights the role of sterol in redox protein-enriched membrane lipids for
establishing cell-to-cell communication.
diffused through the lateral pits due to the increased pits area (Fig. 5), however the
root-to-shoot systemic movement via symplasm (Fig. 1 and Fig. 4) and the
shootward flow through xylem (Fig. 5) was lowered down. Therefore, the distinct
modifications of symplastic and apoplastic systems by rcd1 mutation lead to the
corresponding consequences that are physiologically diverse, or even opposite
upon the treatment with different ROS-inducing agents. For the basis of ROS
modification on apoplastic system, the pits membrane would be a highly potential
target given their role in mediating mass flow through apoplastic system (Choat et
al., 2008; Neumann, Weissman, Stefano, & Mancuso, 2010; van Doorn, Hiemstra,
& Fanourakis, 2011). Unlike the PD membrane, the pits membranes are consisted
of cellulose, pectin, lignin and microfibris (Choat et al., 2008; van Doorn et al.,
2011). Because Glucosided β-sitosterol was shown to act as a primer for cellulose
synthesis (Peng, Kawagoe, Hogan, & Delmer, 2002), the reduction of sterol in
rcd1 mutant might impact cellulose-associated process. This is, indeed, the case
for the pits membrane which is mainly composed of cellulose (Choat et al., 2008;
van Doorn et al., 2011). The radial and tangential pits have showed the increased
pit area which could be due to the less deposit of cellulose on the primary wall
(Fig. 5). As a result, the upward movement of sap was reduced (Fig. 7).
Alternatively, the pits membrane may be directly impacted by the increased O2•–
in the rcd1 mutant since cell wall polysaccharides are prone to be depolymerized
by ROS (Fry, 1998).
In summary, we report a novel role for RCD1, emerging as an important hub for
ROS homeostasis and stress signaling, in regulating the root-to-shoot long
distance movement both symplastically and apoplastically. Our finding that sterol
level, particularly of the β-sitosterol and stigmasterol was greatly affected by rcd1
mutation highlights the need to explore how the lipid rafts, mainly consisting of
sterol and sphingolipids, are subject to RCD1-modulated ROS homeostasis and
Acknowledgement
We were grateful to Pei zhang and Du an-na from Wuhan Institute of Virology,
Chinese Academy of Science, for their assistance in providing TEM micrographs.
Part of the TEM work was also performed at the Life Science Instrument Center
of Yangtze University with the help of Ruochao Hao and Jinwang Qu. We would
also like to thank Dr. Xianzhu Meng for his help on the SEM. This work was
supported by the National Natural Science Foundation of China (31671257).
Conflict of interest
Author Contribution
D.L. conceived the project and designed the experiments. T.J., H.W., Z.D., T.C.
carried out the experiments. Z.L. and J.L. provided experimental support. T.J.,
H.W., P.M.W., R.G.W. and D.L. analyzed the data; D.L. wrote the manuscript.
R.G.W revised the manuscript. All authors have read and agreed to publish this
manuscript.
Ahlfors, R., Lang, S., Overmyer, K., Jaspers, P., Brosche, M., Tauriainen, A.,... Kangasjarvi,
J. (2004). Arabidopsis RADICAL-INDUCED CELL DEATH1 belongs to the WWE
protein-protein interaction domain protein family and modulates abscisic acid,
ethylene, and methyl jasmonate responses. Plant Cell, 16(7), 1925-1937.
Accepted Article
doi:10.1105/tpc.021832
Alscher, R. G., Erturk, N., & Heath, L. S. (2002). Role of superoxide dismutases (SODs) in
controlling oxidative stress in plants. J Exp Bot, 53(372), 1331-1341.
Auh, C. K., & Murphy, T. M. (1995). Plasma Membrane Redox Enzyme Is Involved in the
Synthesis of O2- and H2O2 by Phytophthora Elicitor-Stimulated Rose Cells. Plant
Physiol, 107(4), 1241-1247. doi:10.1104/pp.107.4.1241
Bach, T. J., & Lichtenthaler, H. K. (1983). Inhibition by mevinolin of plant growth, sterol
formation and pigment accumulation. Physiol Plant, 59(1), 50-60.
doi:10.1111/j.1399-3054.1983.tb06570.x
Banerjee, A. K., Chatterjee, M., Yu, Y., Suh, S.-G., Miller, W. A., & Hannapel, D. J. (2006).
Dynamics of a Mobile RNA of Potato Involved in a Long-Distance Signaling
Pathway. Plant Cell, 18(12), 3443-3457. doi:10.1105/tpc.106.042473
Barberon, M., & Geldner, N. (2014). Radial Transport of Nutrients: The Plant Root as a
Polarized Epithelium. Plant Physiol, 166(2), 528-537. doi:10.1104/pp.114.246124
Brosché, M., Blomster, T., Salojärvi, J., Cui, F., Sipari, N., Leppälä, J.,... Kangasjärvi, J.
(2014). Transcriptomics and functional genomics of ROS-induced cell death
regulation by RADICAL-INDUCED CELL DEATH1. PLoS Genet, 10(2), e1004112.
Retrieved from doi:10.1371/journal.pgen.1004112
Brown, D. A., & London, E. (1998). Functions of lipid rafts in biological membranes. Annu
Rev Cell Dev Biol, 14, 111-136. doi:10.1146/annurev.cellbio.14.1.111
Carlsbecker, A., Lee, J.-Y., Roberts, C. J., Dettmer, J., Lehesranta, S., Zhou, J.,... Benfey, P.
N. (2010). Cell signalling by microRNA165/6 directs gene dose-dependent root
cell fate. Nature, 465(7296), 316-321.
Chaiwanon, J., Wang, W., Zhu, J. Y., Oh, E., & Wang, Z. Y. (2016). Information Integration
and Communication in Plant Growth Regulation. Cell, 164(6), 1257-1268.
doi:10.1016/j.cell.2016.01.044
Chen, X., Yao, Q., Gao, X., Jiang, C., Harberd, N. P., & Fu, X. (2016). Shoot-to-Root Mobile
Transcription Factor HY5 Coordinates Plant Carbon and Nitrogen Acquisition.
Curr Biol, 26(5), 640-646. doi:10.1016/j.cub.2015.12.066
Choat, B., Cobb, A. R., & Jansen, S. (2008). Structure and function of bordered pits: new
discoveries and impacts on whole-plant hydraulic function. New Phytol, 177(3),
608-625. doi:10.1111/j.1469-8137.2007.02317.x
Corbesier, L., Vincent, C., Jang, S., Fornara, F., Fan, Q., Searle, I.,... Coupland, G. (2007).
FT protein movement contributes to long-distance signaling in floral induction of
Arabidopsis. Science, 316(5827), 1030-1033. doi:10.1126/science.1141752
Deng, Z., Wu, H., Jin, T., Cai, T., Jiang, M., Wang, M., & Liang, D. (2021). A Sequential
Three-Phase Pathway Constitutes Tracheary Element Connection in the
Arabidopsis/Nicotiana Interfamilial Grafts. Front Plant Sci, 12.
doi:10.3389/fpls.2021.664342
Ding, B. (1997). Cell-to-cell transport of macromolecules through plasmodesmata: a
novel signalling pathway in plants. Trends Cell Biol, 7(1), 5-9. doi:10.1016/s0962-
8924(97)20041-3
58).
Lefebvre, B., Furt, F., Hartmann, M.-A., Michaelson, L. V., Carde, J.-P., Sargueil-Boiron,
F.,... Mongrand, S. (2007). Characterization of Lipid Rafts from Medicago
truncatula Root Plasma Membranes: A Proteomic Study Reveals the Presence of
a Raft-Associated Redox System. Plant Physiol, 144(1), 402-418.
doi:10.1104/pp.106.094102
Levy, A., Erlanger, M., Rosenthal, M., & Epel, B. L. (2007). A plasmodesmata-associated
β-1,3-glucanase in Arabidopsis. The Plant Journal, 49(4), 669-682.
doi:doi:10.1111/j.1365-313X.2006.02986.x
Li, L., Lai, E. Y., Wellstein, A., Welch, W. J., & Wilcox, C. S. (2016). Differential effects of
superoxide and hydrogen peroxide on myogenic signaling, membrane potential,
and contractions of mouse renal afferent arterioles. American Journal of
Physiology-Renal Physiology, 310(11), F1197-F1205.
doi:10.1152/ajprenal.00575.2015
Liang, D. (2018). A Salutary Role of Reactive Oxygen Species in Intercellular Tunnel-
Mediated Communication. Frontiers in Cell and Developmental Biology, 6(2).
doi:10.3389/fcell.2018.00002
Liang, D., White, R. G., & Waterhouse, P. M. (2012). Gene silencing in Arabidopsis
spreads from the root to the shoot, through a gating barrier, by template-
dependent, nonvascular, cell-to-cell movement. Plant Physiol, 159(3), 984-1000.
doi:10.1104/pp.112.197129
Liang, D., White, R. G., & Waterhouse, P. M. (2014). Mobile gene silencing in Arabidopsis
is regulated by hydrogen peroxide. PeerJ, 2, e701. doi:10.7717/peerj.701
Lingwood, D., & Simons, K. (2010). Lipid rafts as a membrane-organizing principle.
Science, 327(5961), 46-50. doi:10.1126/science.1174621
Liu, X., Wu, H., Zeng, Y., Deng, Z., Wang, X., & Liang, D. (2022). The dynamic changes of
tracheary elements in an intraspecific quinoa (Chenopodium quinoa) graft.
Journal of Plant Physiology, 273, 153691. doi:10.1016/j.jplph.2022.153691
Lucas, W. J. (1995). Plasmodesmata: intercellular channels for macromolecular transport
in plants. Curr Opin Cell Biol, 7(5), 673-680. doi:10.1016/0955-0674(95)80109-X
Lucas, W. J., & Lee, J. Y. (2004). Plasmodesmata as a supracellular control network in
plants. Nat Rev Mol Cell Biol, 5(9), 712-726. doi:10.1038/nrm1470
Matyash, V., Liebisch, G., Kurzchalia, T. V., Shevchenko, A., & Schwudke, D. (2008). Lipid
extraction by methyl-tert-butyl ether for high-throughput lipidomics. J Lipid Res,
49(5), 1137-1146. doi:10.1194/jlr.D700041-JLR200
Müller, P., & Schier, A. F. (2011). Extracellular Movement of Signaling Molecules. Dev
Cell, 21(1), 145-158. doi:10.1016/j.devcel.2011.06.001
Nagano, M., Ishikawa, T., Fujiwara, M., Fukao, Y., Kawano, Y., Kawai-Yamada, M., &
Shimamoto, K. (2016). Plasma Membrane Microdomains Are Essential for Rac1-
RbohB/H-Mediated Immunity in Rice. The Plant Cell, 28(8), 1966-1983.
doi:10.1105/tpc.16.00201
Xia, C., Zheng, Y., Huang, J., Zhou, X., Li, R., Zha, M.,... Zhang, C. (2018). Elucidation of the
Mechanisms of Long-Distance mRNA Movement in a Nicotiana
benthamiana/Tomato Heterograft System. Plant Physiol, 177(2), 745-758.
doi:10.1104/pp.17.01836
Xu, X. M., Wang, J., Xuan, Z., Goldshmidt, A., Borrill, P. G. M., Hariharan, N.,... Jackson, D.
(2011). Chaperonins Facilitate KNOTTED1 Cell-to-Cell Trafficking and Stem Cell
Function. Science, 333(6046), 1141-1144. doi:10.1126/science.1205727
Zavaliev, R., Ueki, S., Epel, B. L., & Citovsky, V. (2011). Biology of callose (beta-1,3-glucan)
turnover at plasmodesmata. Protoplasma, 248(1), 117-130. doi:10.1007/s00709-
010-0247-0
Zhang, Z., Ruan, Y.-L., Zhou, N., Wang, F., Guan, X., Fang, L.,... Zhang, T. (2017).
Suppressing a Putative Sterol Carrier Gene Reduces Plasmodesmal Permeability
and Activates Sucrose Transporter Genes during Cotton Fiber Elongation. Plant
Cell, 29(8), 2027-2046. doi:10.1105/tpc.17.00358
Zhao, H., Joseph, J., Fales, H. M., Sokoloski, E. A., Levine, R. L., Vasquez-Vivar, J., &
Kalyanaraman, B. (2005). Detection and characterization of the product of
hydroethidine and intracellular superoxide by HPLC and limitations of
fluorescence. Proc Natl Acad Sci U S A, 102(16), 5727-5732.
doi:10.1073/pnas.0501719102
Zhu, Y., Du, B., Qian, J., Zou, B., & Hua, J. (2013). Disease Resistance Gene-Induced
Growth Inhibition Is Enhanced by rcd1 Independent of Defense Activation in
Arabidopsis. Plant Physiol, 161(4), 2005-2013. doi:10.1104/pp.112.213363
Zielonka, J., Hardy, M., Michalski, R., Sikora, A., Zielonka, M., Cheng, G.,... Kalyanaraman,
B. (2017). Recent Developments in the Probes and Assays for Measurement of
the Activity of NADPH Oxidases. Cell Biochem Biophys, 75(3), 335-349.
doi:10.1007/s12013-017-0813-6
Zielonka, J., Vasquez-Vivar, J., & Kalyanaraman, B. (2008). Detection of 2-
hydroxyethidium in cellular systems: a unique marker product of superoxide and
hydroethidine. Nat Protoc, 3(1), 8-21. doi:10.1038/nprot.2007.473
Figure 1. Mobile silencing in RtSS and tsg3 mutant. (a) Root-to-shoot silencing
mobile progression in parent plant RtSS and tsg3 mutant from 3 DAD (days after
Dex) and 21 DAD. Long arrows indicate the movement of silencing front. Dashed
line, root-hypocotyl junction. Scale bar in each panel is 500 µM. (b) Mobile
distance of silencing front in the hypocotyl region of RtSS and tsg3 mutant. (c)
Mobile distance of silencing front in the HEJ (hypocotyl-epicotyl junction) zone of
RtSS and tsg3 muant. (d) Detection of small RNA from “P” region (332 bp in the 3’
end of GFP gene) in RtSS and tsg3 mutant.
Figure 2. rcd1 alleles and knockout mutant through CRISPR/CAS9 approach. (a)
Genomic structure of RCD1 gene and T-DNA insertion lines. (b) New allele of
RCD1 gene by CRISPR-CAS9 genome editing tool. The G addition in the coding
th
position of 369 AA caused frameshift mutation of RCD1 gene. (c) Comparison of
silencing front movement in the RtSS and rcd1-cas9 lines. At 15 DAD, the
silencing front was stopped at the HEJ zone of rcd1-cas9 line and it moved a little
further into HEJ zone at 25 DAD, which is exactly similar to the tsg3 mutant. Scale
bar is 500 µM.
Figure 3. Superoxide quantification and its impact on mobile silencing. (a) NBT
staining to detect superoxide accumulation in the tsg3 and RtSS plants. (b)
Quantitative measurement of superoxide via 2-OH-E surrogate. (c) Q-PCR analysis
of FSD1 expression level in three independent alleles. (d) Effect of superoxide
dismutase inhibitor on the percentage of RtSS shoots showing silencing under
different concentrations of DDC. (e) Effect of SHAM on the percentage of RtSS
shoots showing silencing. (f) 15 DAD in RtSS plants. (g) Ubi-FSD1 expression in
rcd1-7 mutant. (h) Ubi-null vector in rcd1-7 mutant. (i) Ubi-FSD1 expression in
RtSS plants. Scale bar is 500 µM.
Figure 4. CFDA movement and PD frequency and structure in WT Col-0 plants and
rcd1-3 mutant. (a) Shoot staining efficiency of CFDA loaded in the roots of WT
Col-0 and rcd1-3 mutant. (b) Schematic of hypocotyl cortex cell walls and PD on
the transverse walls. The cortex cells were approximately cubic in shape and
aligned to the root-shoot axis. Bar on transverse wall (T) represents PD. The
dotted line represents the cell wall. R, radial; T, transverse. (c) PD frequency on
the transverse walls of longitudinally sectioned cortex layer in WT Col-0 and rcd1-
3 mutant. Three independent plants in WT Col-0 and rcd1-3, respectively, were
used for TEM analysis. In each sample, about 300-600 ultrasections were made
for PD frequency analysis. p value was calculated using chi-square test. (d) PD
structure in WT Col-0 plants. (e) PD structure in rcd1-3 mutant. Note the
zigzagged PD in the rcd1-3 mutant.
Figure 5. Pits measurement and fuchsin loading in WT Col-0 and rcd1 mutant. (a)
Alternate pits on the tangential and radial walls of hypocotyl in 15-day old WT
Col-0 plants. (b) Alternate pits on the tangential and radial walls of hypocotyl in
15-day old rcd1-3 mutant. (c) Pit size in 15-day old WT Col-0 plants and rcd1-3
mutant. (d) Uniseriate pits on the radial walls of 15-day old WT Col-0 plants. (e)
Uniseriate pits on the radial walls of 15-day old rcd1-3 mutant. (f) Uniseriate pits
size in 15-day old WT Col-0 plants and rcd1-3 mutant. (g) Alternate pits on the
tangential and radial walls of hypocotyl in 23-day old WT Col-0 plants. (h)
Alternate pits on the tangential and radial walls of hypocotyl in 23-day old rcd1-3
mutant. (i) Pit size in 23-day old WT Col-0 plants and rcd1-3 mutant. (j) Uniseriate
pits on the radial walls of 23-day old WT Col-0 plants. (k) Uniseriate pits on the
radial walls of 23-day old rcd1-3 mutant. (l) Uniseriate pits size in 23-day old WT
Col-0 plants and rcd1-3 mutant. (m) Leaf vasculature staining at 35 and 90 min
after fuchsin was loaded in roots of WT Col-0 plants and rcd1-3 mutant. (n) The
ratio of fuchsin translocation from root to shoot in WT Col-0 plants and rcd1-3
Figure 6. Sterol contents in the mutant alleles rcd1-3, -7, rcd1-cas9, rci3-2, RtSS
and WT Col-0 plants, and its modulation on mobile silencing. (a) GC/MS analysis
of the reference sample. (b) β-sitosterol content in the shoots including
hypocotyls. (c) β-sitosterol content in the roots. (d) Stigmasterol content in the
roots. Stigmasterol cannot be detected in the shoots. (e) Effect of lovastatin on
the percentage of RtSS shoots showing silencing. Error bars indicate SD from four
replicate samples. The data were evaluated by Student’s t test; * P < 0.05 and **
P < 0.01. DW, dry weight.
Figure S1. The silencing phenotype in the RtSS and tsg3 mutant.
Figure S2. Superoxide level in WT Col-0 Arabidopsis plants treated with DDC
Accepted Article
Figure S3. The spacing of pits in the 15-day old WT Col-0 and rcd1-3 plants.
Figure S4. Callose staining in WT Col-0 plants and rcd1 allelic mutants.