Journal of Periodontology; Copyright 2015 DOI: 10.1902/jop.2015.

150413

Lipopolysaccharide Activates the Unfolded Protein Response

(UPR) in Human Periodontal Ligament Fibroblasts

Ying Wang,*† Jiuyu Gong,†§ Hanyu Zeng,† Rongrong Liu,† Boquan Jin,† Lihua Chen,† and
Qintao Wang*
*
State Key Laboratory of Military Stomatology, Shaanxi Key Laboratory of Stomatology,
Department of Periodontology, School of Stomatology, The Fourth Military Medical
University, Xi'an, China.
†
Department of Immunology, School of Basic Medicine, Fourth Military Medical University,
Xi'an, China.
§
Hospital of Hubei Armed Police Corps, Wuhan, Hubei, China.
Any financial relationships between any author and a commercial firm that may pose a conflict of interest: No

BACKGROUND AND OBJECTIVE: The activation of the unfolded protein response (UPR) has
been demonstrated in periodontal diseases. However, the cellular and molecular mechanisms by which the UPR
is induced in periodontitis remain unclear. In this study, we investigated the effects of Lipopolysaccharide (LPS)
on the induction of the UPR in human periodontal ligament fibroblasts (HPDLFs) in vitro.

MATERIALS AND METHODS: HPDLFs isolated from human periodontal ligaments were
stimulated with various concentrations of Escherichia coli LPS (0.1 µg/mL, 1 µg/mL, 10 µg/mL) for the
indicated time points (0, 3, 6, 9, 12, 18 h). The mRNA and protein levels of molecular markers associated with
UPR activation, such as glucose-regulated protein 78 (GRP78), X-box binding protein 1 (XBP1), and C/EBP
homologous protein (CHOP), were measured at different time points of LPS treatment. Apoptosis of HPDLFs
was assessed by Annexin V-FITC and propidium iodide staining followed by flow cytometry.

RESULTS: LPS treatment of HPDLFs increased GRP78 mRNA and protein levels in a concentration-
dependent manner. Additionally, LPS also induced the expression, splicing, and activation of XBP1 mRNA.
Moreover, LPS-induced CHOP expression was concentration -dependent; a lower concentration of LPS (0.1
µg/mL) had no effect on CHOP mRNA levels, but higher concentrations of LPS (1 µg/ml and 10 µg/mL)
markedly increased CHOP mRNA and protein expression without inducing apoptosis.

CONCLUSION: Our findings demonstrate that activating the toll-like receptor (TLR)-4 signaling
pathway in HPDLFs using LPS triggers the UPR in vitro, warranting further investigation into the precise
mechanisms by which pathways promote this response under inflammatory conditions.

KEY WORDS:
lipopolysaccharides; unfolded protein response; periodontal diseases.

The accumulation of unfolded or misfolded proteins in the endoplasmic reticulum (ER) is a

hallmark of ER stress, and triggers a protective program known as the unfolded protein
response (UPR). The UPR maintains ER homeostasis and protects cells from apoptosis1.
Accumulating evidence suggests that ER stress is associated with a variety of diseases
1
 Journal of Periodontology; Copyright 2015 DOI: 10.1902/jop.2015.150413

including obesity, diabetes, neurodegenerative diseases, cancer, and inflammatory diseases2.

Furthermore, recent studies demonstrated that ER stress is associated with the pathogenesis
of periodontal disease, as the expression levels of X-box binding protein 1 (XBP1), activating
transcription factor 4 (ATF4), selenoprotein S (SEPS1), and C/EBP homologous protein
(CHOP) were significantly higher in tissues affected by periodontitis compared to gingivitis3.
In experimental periodontitis in mice, ER stress was also implicated in alveolar bone
resorption4.
In human periodontal ligament cells, nicotine-induced ER stress modulates extracellular
matrix (ECM) degradation through the downregulation of ECM molecules and upregulation
of matrix metalloproteinases (MMP-1, MMP-2, MMP-8, and MMP-9)5. Advanced glycation
end products (AGEs) mediate the inflammatory responses of human periodontal ligament
cells via the ER stress-induced NF-κB pathway6. Human periodontal ligament fibroblasts
(HPDLFs) are the most common periodontal ligament cells whose main function is to
synthesize collagen7. In addition, periodontal ligament stem cells (PDLSCs) within HPDLFs
can differentiate into osteoblasts or cementoblast-like cells involved in alveolar bone
alterations8, 9. In periodontitis, bacterial infection was reported to induce apoptosis of
HPDLFs10. However, few studies to date have addressed the consequences of bacterial
infection on the induction of ER stress and UPR activation in HPDLFs.
Periodontitis is a chronic inflammation of the periodontal supporting tissues caused by
bacterial infection that results in the destruction of periodontal connective tissue and alveolar
bone11. This progression depends on the activation of sensory receptors such as toll-like
receptors (TLRs)12, 13and NOD-like receptors (NLRs)14. Among these, TLR4 is expressed in
gingival fibroblasts15 (GFs) and HPDLFs, and functions as the innate sensor for pathogen-
associated molecular pattern (PAMP) of gram-negative bacteria, which may play an
important role in the progression of periodontitis. Indeed, TLR4 expression was increased in
gingival connective tissue from patients with chronic periodontitis16. Lipopolysaccharide
(LPS), a potent TLR4 agonist, was shown to induce the activation of UPR in macrophages17.
However, the ability of LPS to induce the UPR in HPDLFs has not been explored to date.
In this study, we investigated the effects of LPS treatment on the expression levels of
UPR markers in HPDLFs. We further examined whether LPS could induce ER stress-
mediated apoptosis through the CHOP signaling pathway.

MATERIALS AND METHODS

Primary Culture of HPDLFs

HPDLFs were obtained from normal periodontal ligaments from the third molar of five
systemically and periodontally healthy participants showing no clinical signs of inflammation
in the periodontal tissues. Excision was performed for orthodontic reasons. Periodontal
ligaments were dissected from the middle third of the root with a sharp blade, minced into
small pieces (≤1 mm3), and cultured in Dulbecco’s Modified Eagle’s Medium (DMEM), 1%
antibiotic (100 U/mL penicillin A and 100 U/ml streptomycin) and 10% (v/v) fetal bovine
serum (FBS) in a humidified atmosphere of 95% air and 5% CO2. Media was changed every

2
 Journal of Periodontology; Copyright 2015 DOI: 10.1902/jop.2015.150413

3 days. After reaching 80% confluence, cells were passaged with 0.25% trypsin and 0.01%
EDTA. Cells at passages 5-6 were used in experiments. This experimental procedure was
approved by the Ethics Committee of the Fourth Military Medical University (China), and the
informed consent of all participants was obtained in accordance with the Declaration of
Helsinki (n = 5, including three males and two females, ranging in age from 13 to 28).

Culture Stimulation
HPDLFs were seeded in 6-well plates at a density of 2×105 cells per well. Escherichia coli
LPS** (from Escherichia coli serotype 0111:B4) was added to HPDLF culture media
containing 10% FBS at different concentrations (0.1 µg/mL, 1 µg/mL, 10 µg/mL) for the
indicated time points (0, 3, 6, 9, 12, 18h).

Real-Time Reverse Transcription PCR (qRT-PCR)

After stimulation of HPDLFs, the culture media was aspirated and washed twice with
phosphate buffered saline (PBS). Total RNA was extracted using RNA IsoPlus‡ and was then
reverse transcribed to cDNA according to the manufacturer's instructions for the Primer
Script RT reagent kit‡. QuantiTect SYBR Green kits‡ were used to detect real-time PCR
products using the CFX96 instrument. The primer sequences are listed in Table 1. Sequence
amplification was performed under the following conditions: denaturation at 95º for 30 s
followed by 40 cycles at 95º for 5 s and 64º for 34 s. The relative gene expression was
calculated by the 2−ΔΔCt method, and values were normalized to the housekeeping gene
GAPDH. The reactions were run in triplicate, and three independent experiments were
performed.

Western Blot
Cells were harvested using cell lysis buffer‖ according to the manufacturer's instructions.
Protein concentration was quantified using the BCA Protein Assay kit. Thirty μg of proteins
were mixed with 5X sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-
PAGE) loading buffer, boiled for 5 min, and then separated by SDS–polyacrylamide gel
electrophoresis and transferred to a polyvinylidene difluoride membrane using a semidry
transblot system. The blot was blocked with 5% (w/v) non-fat skim milk and 0.1% (v/v)
Tween 20 in tris buffered saline (TBS) at room temperature for 1 h, followed by incubation
overnight at 4º with mouse anti-CHOP‖and rabbit anti-GRP78‖ at 1:1000. The blot was
incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG and horseradish
peroxidase-conjugated horse anti-mouse IgG‖ at 1:2000 for 1 h at room temperature, treated
with the Western blotting detection reagent ECL Plus¶, and a chemiluminescent signal was
detected using a luminescent image analyzer.

Flow Cytometry
To detect apoptosis, cells were detached with 0.01% EDTA, washed with phosphate-buffered
saline (PBS), and stained with Annexin-V and propidium iodide (PI) in PBS containing 20%
bovine serum albumin (BSA)**. Apoptotic cells were sorted using the FACS Calibur# flow
cytometer. Data were analyzed using FlowJo. At least 20,000 cells per sample were analyzed.

3
 Journal of Periodontology; Copyright 2015 DOI: 10.1902/jop.2015.150413

Statistical Analysis
All experiments in this study were performed three independent times with three independent
HPDLF cell lines, each representing an individual patient. Representative findings from one
independent experiment are shown. Experimental values are given as means ± standard
deviation (SD). The significance of the differences between control and experimental
treatments was evaluated by a two-way ANOVA in qRT-PCR experiments. Significance
testing for Western blot results was performed by unpaired two-tailed Student's t-test. P
values less than 0.05 were considered statistically significant.

RESULTS

LPS Induces GRP78 Expression in HPDLFs

GRP78 is a crucial molecular chaperone molecule activated by the UPR. To determine the
effects of LPS treatment on the activation of the UPR in HPDLFs, GRP78 mRNA and protein
levels were measured. We found that GRP78 mRNA levels increased gradually before
peaking at 6 hours of LPS treatment (Fig. 1A). LPS concentrations of 1 µg/ml and 10 µg/ml
induced higher GRP78 levels compared to 0.1 µg/ml, but no significant differences were
found between different LPS doses. Additionally, GRP78 protein levels also increased after
treatment of HPDLFs with 1 µg/ml LPS for 6, 12, and 18 hours, peaking at 12 hours (Fig.
1B).

LPS Promotes XBP1s Production

After ER stress, IRE1-α and ATF6 are released from GRP78 to support protein folding in
UPR. IRE1-α oligomerizes and activates its ribonuclease domain through self-
phosphorylation. Activated IRE1 catalyzes the excision of a 26-nucleotide unconventional
intron from XBP1u mRNA. Removal of this intron causes a frameshift in the XBP1 coding
sequence, resulting in the translation of the mature spliced isoform of XBP1 (XBP1s)
containing a potent transactivation domain. Transcription factor ATF6 can specifically bind
to the promoter of the XBP1 gene, increase its transactivation, and increase the synthesis of
IRE1α-spliced XBP1s18. Therefore, XBP1s is an important marker of the activated UPR.
XBP1 mRNA levels increased 3 hours after LPS stimulation (p < 0.05), and continued to
increase gradually until 6 hours (Fig. 2A). XBP1 expression was not significantly affected by
different concentrations of LPS. Moreover, XBP1s mRNA levels were detected as early as 6
hours after treatment of HPDLFs with 0.1 µg/ml LPS, and XBP1 mRNA splicing continued
to increase gradually (Fig. 2B).

LPS Induces CHOP Expression in a Concentration-Dependent Manner

CHOP, also known as growth arrest and DNA damage-inducible gene 153 (GADD153), is an
important molecule during ER stress-induced apoptosis. We found that treatment of HPDLFs
with a lower concentration of LPS (0.1 µg/ml) did not significantly affect CHOP mRNA
levels, but higher concentrations of LPS (1 µg/mL and 10 µg/mL) markedly increased CHOP
expression (Fig. 3A). Accordingly, CHOP protein levels also increased after treatment with 1

4
 Journal of Periodontology; Copyright 2015 DOI: 10.1902/jop.2015.150413

µg/mL LPS for 6, 12, and 18 hours, peaking at 12 hours (Fig. 3B). CHOP is a transcription
factor that is activated during excessive ER stress, and plays an important role in ER stress-
induced apoptotic cell death. To investigate whether higher concentrations of LPS could
induce apoptosis through the CHOP signaling pathway, we treated HPDLFs with 10 µg/mL
LPS and quantified apoptotic cells by flow cytometry. We found that LPS treatment did not
induce apoptosis of HPDLFs (Fig. 4). Our results are consistent with those of Woo et al.
which showed that the activation of TLRs induced the UPR, but a TLR-TRIF-dependent
pathway could also divert cells from CHOP overexpression and apoptosis19.

DISCUSSION

Our studies are the first to demonstrate that LPS induces the activation of the UPR in
HPDLFs, suggesting that the TLR4 signaling pathway may trigger the upregulation of UPR-
related molecules in periodontal tissues. Escherichia coli (E. coli) LPS, a classical and
selective TLR4 agonist20, is a non-periodontal pathogenic LPS. Compared to the hexa-
acylated lipid A of E. coli LPS, Porphyromonas gingivalis (P. gingivalis) LPS possesses both
tetra-acylated (PgLPS1435/1449) and penta-acylated (PgLPS1690) forms of lipid A 21. Hexa-
acylated E. coli LPS preferentially activates the TLR4/NF-κB cascade, whereas
heterogeneous P. gingivalis LPS may employ different signaling pathways to modulate
downstream pro-inflammatory responses. Dendritic cells stimulated with serotype b of A.
actinomycetemcomitans or serotype K1 of P. gingivalis exhibited higher levels of TLR2 or
TLR4, respectively22. Structural variation in periodontal pathogenic LPS may also
differentially affect UPR activation. Our present study suggests that the TLR4 signaling
pathway induced the activation of the UPR. Our findings represent an important experimental
phenomenon, and enable a more rigorous investigation of the mechanisms underlying the
UPR in periodontitis in future studies.
In our study, the activation of the UPR was marked by the induction of three molecular
markers, GRP78, XBP1, and CHOP. GRP78, a member of the HSP70 molecular chaperone
family, directly interacts with the three ER stress sensors, protein kinase RNA-like ER kinase
(PERK), activating transcription factor 6 (ATF6), and inositol-requiring protein 1 (IRE1), and
maintains them in inactive forms in quiescent cells. When the UPR is activated, PERK,
ATF6, and IRE1 are released from GRP78 to transduce signals across the ER membrane to
the cytosol and the nucleus. Many studies have shown that LPS induces GRP78 expression in
various cell types23, and the capacity of LPS to induce ER stress through all three canonical
pathways was completely governed by the ER resident chaperones, GRP94 and GRP7824, 25.
We also found that LPS treatment results in increased levels of GRP78 in HPDLFs.
XBP1 is another important mediator of the activated UPR. In addition to its role in
maintaining cellular homeostasis, XBP1 plays a crucial role in inflammation. Previous
studies have shown that LPS-induced production of IFN-β and interleukin (IL)-6 by
monocytes/macrophages depends on the activation of the UPR and, specifically, XBP126, 27.
XBP1 also contributes to LPS-induced inflammation through the induction of caspase-11, a
prerequisite for the activation of pro-IL-1β28. Conversely, the activation of XBP1 is also
associated with anti-inflammatory mechanisms. In retinal endothelial cells, ER stress-induced

5
 Journal of Periodontology; Copyright 2015 DOI: 10.1902/jop.2015.150413

XBP1 attenuates TNFα-stimulated ICAM-1 and VCAM-1 expression, while reducing

vascular permeability29. Our findings reveal that LPS increases XBP1 mRNA levels as well
as promotes the splicing and activation of XBP1s in HPDLFs. However, the precise role of
activated XBP1 during the development and progression of periodontitis requires further
investigation.
In our study, low concentrations of LPS (0.1 μg/mL) elicited increased expression of
GRP78 and XBP1, but had no effect on CHOP mRNA expression, suggesting that the
primary role of lower concentrations of LPS is to induce UPR activation and maintain the ER
in a steady state. Woo et al also found that lower concentrations of LPS (1 ng/mL)
maintained ER homeostasis and prevented apoptosis by inhibiting the CHOP pathway in
monocytes/macrophages30. However, higher concentrations of LPS (1 μg/mL and 10 μg/mL)
significantly induced CHOP mRNA and protein expression, indicating an imbalance in ER
homeostasis. Interestingly, we still did not observe apoptosis under these conditions, and
CHOP levels did not increase as a function of the dose or timing of LPS treatment. This
finding is consistent with that of a previous study which reported that LPS (150 μg/mL)
induced CHOP expression, but not apoptosis, and thapsigargin (TG) induced apoptosis was
prevented in LPS-pretreated macrophages because ER-protective mechanisms were activated
before the onset of CHOP expression and the overall induction of CHOP was low10, 31. In
addition, CHOP is critical for mediating autophagic cell death by decreasing Bcl-2
expression32. In gingival fibroblasts, 4-PBA, a classical inhibitor of ER stress, could protect
against ER stress-induced cell death and autophagy33. CHOP is not only associated with
apoptosis, but is also involved in the regulation of the inflammatory signal transduction
pathway. For example, the process by which LPS-induced dendritic cells produce IL-23 relies
on CHOP activation34. In macrophages, LPS-induced activation of pro-caspase-1 and pro-IL-
1β occurs in a CHOP-dependent manner35. Therefore, we speculated the LPS-induced CHOP
may be involved in the inflammation development of periodontitis. In summary, to the best of
our knowledge, this is the first report showing LPS treatment could increase the expression
levels of UPR markers in HPDLFs.

CONFLICTS OF INTEREST
There are no conflicts of interest.

ACKNOWLEDGMENTS
This study was supported by the National Natural Science Foundation of China (NNSF, No. 91442108,
81470742), Beijing, China.

REFERENCES
1. Wang S, Kaufman RJ. The impact of the unfolded protein response on human disease. J Cell Biol
2012;197:857-867.

2. Jiang D, Niwa M, Koong AC. Targeting the IRE1alpha-XBP1 branch of the unfolded protein response in
human diseases. Semin Cancer Biol 2015;33:48-56.

6
 Journal of Periodontology; Copyright 2015 DOI: 10.1902/jop.2015.150413

3. Domon H, Takahashi N, Honda T, et al. Up-regulation of the endoplasmic reticulum stress-response in

periodontal disease. Clin Chim Acta 2009;401:134-140.

4. Yamada H, Nakajima T, Domon H, Honda T, Yamazaki K. Endoplasmic reticulum stress response and
bone loss in experimental periodontitis in mice. J Periodontal Res 2015;50:500-508.

5. Lee SI, Kang KL, Shin SI, Herr Y, Lee YM, Kim EC. Endoplasmic reticulum stress modulates nicotine-
induced extracellular matrix degradation in human periodontal ligament cells. J Periodontal Res
2012;47:299-308.

6. Xu J, Xiong M, Huang B, Chen H. Advanced glycation end products upregulate the endoplasmic reticulum
stress in human periodontal ligament cells. J Periodontol 2015;86:440-447.

7. Somerman MJ, Archer SY, Imm GR, Foster RA. A comparative study of human periodontal ligament cells
and gingival fibroblasts in vitro. J Dent Res 1988;67:66-70.

8. Xiao L, Nasu M. From regenerative dentistry to regenerative medicine: progress, challenges, and potential
applications of oral stem cells. Stem Cells Cloning 2014;7:89-99.

9. Prateeptongkum E, Klingelhoffer C, Muller S, Ettl T, Morsczeck C. Characterization of progenitor cells and

stem cells from the periodontal ligament tissue derived from a single person. J Periodontal Res 2015.

10. Thammasitboon K, Goldring SR, Boch JA. Role of macrophages in LPS-induced osteoblast and PDL cell
apoptosis. Bone 2006;38:845-852.

11. Graves D. Cytokines that promote periodontal tissue destruction. J Periodontol 2008;79:1585-1591.

12. Morandini AC, Chaves Souza PP, Ramos-Junior ES, et al. Toll-like receptor 2 knockdown modulates
interleukin (IL)-6 and IL-8 but not stromal derived factor-1 (SDF-1/CXCL12) in human periodontal
ligament and gingival fibroblasts. J Periodontol 2013;84:535-544.

13. Hou L, Sasaki H, Stashenko P. Toll-like receptor 4-deficient mice have reduced bone destruction following
mixed anaerobic infection. Infect Immun 2000;68:4681-4687.

14. Liu J, Wang Y, Ouyang X. Beyond toll-like receptors: Porphyromonas gingivalis induces IL-6, IL-8, and
VCAM-1 expression through NOD-mediated NF-kappaB and ERK signaling pathways in periodontal
fibroblasts. Inflammation 2014;37:522-533.

15. Uehara A, Takada H. Functional TLRs and NODs in human gingival fibroblasts. J Dent Res 2007;86:249-
254.

16. Fatemi K, Radvar M, Rezaee A, et al. Comparison of relative TLR-2 and TLR-4 expression level of disease
and healthy gingival tissue of smoking and non-smoking patients and periodontally healthy control patients.
Aust Dent J 2013;58:315-320.

17. Koide N, Naiki Y, Odkhuu E, et al. Involvement of oncogenic protein beta-catenin in LPS-induced
cytotoxicity in mouse mononuclear leukemia RAW 264.7 cells. Oncol Res 2013;21:59-65.

18. Guo FJ, Xiong Z, Lu X, Ye M, Han X, Jiang R. ATF6 upregulates XBP1S and inhibits ER stress-mediated
apoptosis in osteoarthritis cartilage. Cell Signal 2014;26:332-342.

19. Woo CW, Kutzler L, Kimball SR, Tabas I. Toll-like receptor activation suppresses ER stress factor CHOP
and translation inhibition through activation of eIF2B. Nat Cell Biol 2012;14:192-200.

7
 Journal of Periodontology; Copyright 2015 DOI: 10.1902/jop.2015.150413

20. Triantafilou M, Triantafilou K. Lipopolysaccharide recognition: CD14, TLRs and the LPS-activation
cluster. Trends Immunol 2002;23:301-304.

21. Herath TD, Darveau RP, Seneviratne CJ, Wang CY, Wang Y, Jin L. Tetra- and penta-acylated lipid A
structures of Porphyromonas gingivalis LPS differentially activate TLR4-mediated NF-kappaB signal
transduction cascade and immuno-inflammatory response in human gingival fibroblasts. PLoS One
2013;8:e58496.

22. Diaz-Zuniga J, Monasterio G, Alvarez C, et al. Variability of the dendritic cell response triggered by
different serotypes of Aggregatibacter actinomycetemcomitans or Porphyromonas gingivalis is toll-like
receptor 2 (TLR2) or TLR4 dependent. J Periodontol 2015;86:108-119.

23. Zou X, Xu J, Yao S, Li J, Yang Y, Yang L. Endoplasmic reticulum stress-mediated autophagy protects
against lipopolysaccharide-induced apoptosis in HL-1 cardiomyocytes. Exp Physiol 2014;99:1348-1358.

24. Coope A, Milanski M, Arruda AP, et al. Chaperone insufficiency links TLR4 protein signaling to
endoplasmic reticulum stress. J Biol Chem 2012;287:15580-15589.

25. Masson GS, Nair AR, Dange RB, Silva-Soares PP, Michelini LC, Francis J. Toll-like receptor 4 promotes
autonomic dysfunction, inflammation and microglia activation in the hypothalamic paraventricular nucleus:
role of endoplasmic reticulum stress. PLoS One 2015;10:e0122850.

26. Zeng L, Liu YP, Sha H, Chen H, Qi L, Smith JA. XBP-1 couples endoplasmic reticulum stress to
augmented IFN-beta induction via a cis-acting enhancer in macrophages. J Immunol 2010;185:2324-2330.

27. Martinon F, Chen X, Lee AH, Glimcher LH. TLR activation of the transcription factor XBP1 regulates
innate immune responses in macrophages. Nat Immunol 2010;11:411-418.

28. Wree A, Eguchi A, McGeough MD, et al. NLRP3 inflammasome activation results in hepatocyte
pyroptosis, liver inflammation, and fibrosis in mice. Hepatology 2014;59:898-910.

29. Li J, Wang JJ, Zhang SX. Preconditioning with endoplasmic reticulum stress mitigates retinal endothelial
inflammation via activation of X-box binding protein 1. J Biol Chem 2011;286:4912-4921.

30. Woo CW, Cui D, Arellano J, et al. Adaptive suppression of the ATF4-CHOP branch of the unfolded protein
response by toll-like receptor signalling. Nat Cell Biol 2009;11:1473-1480.

31. Nakayama Y, Endo M, Tsukano H, Mori M, Oike Y, Gotoh T. Molecular mechanisms of the LPS-induced
non-apoptotic ER stress-CHOP pathway. J Biochem 2010;147:471-483.

32. Liu K, Shi Y, Guo X, et al. CHOP mediates ASPP2-induced autophagic apoptosis in hepatoma cells by
releasing Beclin-1 from Bcl-2 and inducing nuclear translocation of Bcl-2. Cell Death Dis 2014;5:e1323.

33. Kim DS, Li B, Rhew KY, et al. The regulatory mechanism of 4-phenylbutyric acid against ER stress-
induced autophagy in human gingival fibroblasts. Arch Pharm Res 2012;35:1269-1278.

34. Goodall JC, Wu C, Zhang Y, et al. Endoplasmic reticulum stress-induced transcription factor, CHOP, is
crucial for dendritic cell IL-23 expression. Proc Natl Acad Sci U S A 2010;107:17698-17703.

35. Endo M, Mori M, Akira S, Gotoh T. C/EBP homologous protein (CHOP) is crucial for the induction of
caspase-11 and the pathogenesis of lipopolysaccharide-induced inflammation. J Immunol 2006;176:6245-
6253.

8
 Journal of Periodontology; Copyright 2015 DOI: 10.1902/jop.2015.150413

Correspondence: Prof. Qintao Wang, Department of Periodontology, School of Stomatology,

The Fourth Military Medical University, No.169, Changle West Road, Xi'an, Shaanxi,
710032, China. Fax: 086-029-8322-3047; e-mail: yznmbk@fmmu.edu.cn. Prof. Lihua Chen,
Department of Immunology, School of Basic Medicine, Fourth Military Medical University,
No.169, Changle West Road, Xi'an, Shaanxi, 710032, China. Fax: 086-029-8325-3816; e-
mail: chenlh@fmmu.edu.cn.
Submitted July 8, 2015; accepted for publication November 21, 2015.

*Fig. 1.

LPS induces GRP78 expression. (A) qRT-PCR was performed on HPDLFs treated with 0.1 μg/mL, 1 μg/mL, and
10 μg/mL of LPS for the indicated times. Graph represents relative mRNA expression levels of GRP78
normalized to GAPDH. Significance was tested by two-way ANOVA. (B) Western blot depicts GRP78 protein
levels in HPDLFs treated with1 μg/mL LPS for the indicated times. GAPDH was used as a loading control. The
blot is representative of three independent experiments. Graph represents quantitative densitometry of GRP78
protein levels normalized to GAPDH and bars indicate the mean fold change between LPS-treated and control
cells. Significance was tested by unpaired two-tailed Student's t-test. All error bars represent the standard
deviation. ***p < 0.001, **p < 0.01, *p <0.05.

*Fig. 2.

LPS induces XBP1 mRNA expression and splicing. (A) qRT-PCR was performed on HPDLFs treated with 0.1
μg/mL, 1 μg/mL, and 10 μg/mL of LPS for the indicated times. Graph represents relative mRNA expression
levels of XBP1 normalized to GAPDH. (B) qRT-PCR was performed on HPDLFs treated with 0.1 μg/mL for the
indicated times. Graph represents relative mRNA expression levels of spliced XBP1 (XBP1s) normalized to
GAPDH. All error bars represent the standard deviation and significance was tested by two-way ANOVA. ***p
< 0.001, **p < 0.01, *p <0.05.

*Fig. 3.

LPS induces CHOP expression in a concentration-dependent manner. (A) qRT-PCR was performed on HPDLFs
treated with 0.1 μg/mL, 1 μg/mL, 10 μg/mL of LPS for the indicated times. Graphs represent relative mRNA
expression levels of CHOP normalized to GAPDH. Significance was tested by two-way ANOVA. (B) Western
blot depicts CHOP protein levels in HPDLFs treated with 1 µg/mL LPS for the indicated times. GAPDH was
used as a loading control. The blot is one representative of three independent experiments. Graph represents
quantitative densitometry of GRP78 protein levels normalized to GAPDH and bars indicate the mean fold
change between LPS-treated and control cells. Significance was tested by unpaired two-tailed Student's t-test.
All error bars represent standard deviation. ***p < 0.001, **p < 0.01, *p < 0.05.

*Fig. 4.

LPS fails to induce apoptosis of HPDLFs. Flow cytometry analysis of HPDLFs treated with 10 µg/mL LPS for
the indicated times (cells treated with 1 μM tunicamycin represented the positive control). Cells were stained for
Annexin-V and propidium iodide (PI) to mark apoptotic cells.

9
 Journal of Periodontology; Copyright 2015 DOI: 10.1902/jop.2015.150413

Table 1
Primers Sequence (5'- 3') Size (bp)
GAPDH Sense GCCACCCAGAAGACTGTGGATGGC 189
Antisense CATGATGGCCATGAGGTCCACCAC
GRP78 Sense TCAAGTTCTTGCCGTTCAAGG 148
Antisense AAATAAGCCTCAGCGGTTTCTT
CHOP Sense CAAGAGGTCCTGTCTTCAGATGA 247
Antisense TCTGTTTCCGTTTCCTGGTTC
XBP-1 Sense CCTGGTTGCTGAAGAGGAGG 119~145
Antisense CCATGGGGAGATGTTCTGGAG
XBP-1s Sense GGTCTGCTGAGTCCGCAGCAGG 311
Antisense GGGCTTGGTATATATGTGG
**
Sigma-Aldrich, St. Louis, MO

‡ TaKaRa, Dalian, China.

‖Cell Signaling Technology, Beverly, MA, USA.

¶ Amersham Pharmacia Biotech Inc., Piscataway, NJ, USA.

# Becton–Dickinson, San Jose, CA, USA.

10
Journal of Periodontology; Copyright 2015 DOI: 10.1902/jop.2015.150413

11
Journal of Periodontology; Copyright 2015 DOI: 10.1902/jop.2015.150413

12
Journal of Periodontology; Copyright 2015 DOI: 10.1902/jop.2015.150413

13
Journal of Periodontology; Copyright 2015 DOI: 10.1902/jop.2015.150413

14