Journal of Ethnopharmacology 151 (2014) 1124–1132

Contents lists available at ScienceDirect

Journal of Ethnopharmacology
journal homepage: www.elsevier.com/locate/jep

Qi-Dan Fang ameliorates adriamycin-induced nephrotic syndrome rat

model by enhancing renal function and inhibiting podocyte injury
Jun-Biao Wu a, Shu-Fang Ye a, Chun-Ling Liang a, Yu-Cui Li a, Ying-Jia Yu b, Jie-Mei Lai a,
Hui Lin a, Jie Zheng a, Jiu-Yao Zhou a,n
a
Department of Pharmacology, College of Chinese Materia Medica, Guangzhou University of Chinese Medicine, Guangzhou 510006, PR China
b
Department of Pharmacy, Guangzhou Hospital of Integrated Traditional and West Medicine, Guangzhou 510860, PR China

art ic l e i nf o a b s t r a c t

Article history: Ethnopharmacological relevance: Nephrotic syndrome (NS) is a clinical syndrome with a variety of causes,
Received 12 August 2013 mainly characterized by heavy proteinuria. Podocyte injury plays a key role in proteinuria, one of the
Received in revised form principal means for the control of NS is to prevent podocyte injury. Qi-Dan Fang consists of two of the
14 December 2013
most extensively applied herbal remedies among Traditional Chinese Medicine (TCM) (Radix Astragali
Accepted 18 December 2013
Available online 3 January 2014
Mongolici and Radix Salviae Miltiorrhizae, with a weight ratio of 5:1) which are specifically used for the
treatment of various kidney diseases. In previous studies, we found that Qi-Dan Fang provides
Keywords: improvement to patients with adriamycin-induced nephrotic syndrome by alleviating proteinuria and
Qi-Dan Fang serum lipid. The aim of this study is to study the efficiency of Qi-Dan Fang on NS model rat with renal
Nephrotic syndrome dysfunction and podocyte injury, something which has not been carried out yet.
Renal function
Materials and methods: The rats were divided into Normal, Model, Jin Gui Shen Qi Pill (4.12 g/kg), Qi-Dan
Podocyte
Fang (3.09, 6.17 and 12.34 g/kg/d) groups, they were each given a single tail intravenous injection of
Adriamycin (6.0 mg/kg) except for the Normal group and were orally administered dosages of Qi-Dian Fang
and Jin Gui Shen Qi pills once daily for 7 weeks. Following the treatment, the content of cystation C (CysC),
blood urea nitrogen (BUN), serum creatinine (Scr) were measured with an autobiochemical analyser. The
pathomorphological changes to the glomeruli, the mRNA expressions of nephrin, podocin, CD2AP genes and
p53, bax, bcl-2 proteins expressions were also carried out to probe the effects of Qi-Dan Fang.
Results: (1) Qi-Dan Fang treatment raised the level of CysC in blood serum while lowering the content of BUN
and Scr in the adriamycin-induced nephrotic syndrome rat model; (2) Long-term administration of Qi-Dan
Fang was able to ameliorate pathomorphological change of glomeruli and repair the organization structure of
Glomerulus; (3) Qi-Dan Fang could increase the mRNA expression of nephrin, podocin and CD2AP genes,
down-regulate the expression of p53, bax proteins, while increased bcl-2 protein to protect the podocyte and
restore Glomerular selective filtration function.
Conclusions: Results of our present studies reveal that Qi-Dan Fang is able to enhance renal function, inhibit
podocyte injury to provide improvements to the Adriamycin-induced nephrotic syndrome.
& 2013 Elsevier Ireland Ltd. All rights reserved.

1. Introduction (ADR)-induced nephrotic syndrome, which was first reported by

Nephrotic syndrome (NS) is a clinical syndrome, which could
be caused by a variety of factors. It0 s characterized by heavy
proteinuria (more than 3.5 g/d), hypoalbuminemia, and edema.
Affected patients without effective treatment will in time develop
end-stage renal disease (Kaneko and Narita, 2013). The Adriamycin
Abbreviations: ADR, adriamycin; Qi-Dan Fang, the mixture of Radix Astragali
Mongolici (RA) and Radix Salviae Miltiorrhizae (RSM); BUN, blood urea nitrogen;
Scr, serum creatinine; CysC, Cystation C; RT-PCR, reverse transcription-polymerase
chain reaction
n
Corresponding author. Tel.: þ 86 18620783138; fax: þ 86 2039358084.
E-mail address: zhoujiuyao@tom.com (J.-Y. Zhou).
Bertani et al. (1982), is a classical nephrotic syndrome model. It was
induced by a single adriamycin injection in the tail vein of the rats.
ADR-induced nephrotic syndrome with heavy proteinuria in rats,
and the renal pathological changes are similar to those induced by
daunomycin or puromycin animonucleoside, including glomerular
capillary permeability increase (Pinto and Brewer, 1973).
Proteinuria is both a hallmark and a major risk factor for nephrotic
syndrome (Bagga and Srivastava, 2002). The renal function is closely
associated with urine protein excretion level. Podocytes, a kind of
highly differentiated cells forming multiple interdigitating foot pro-
cesses, are interconnected by the slit diaphragms and cover the
glomerular basement membrane surface (Reiser and Sever, 2013).
When the podocytes are injured or lost, protein molecules can pass

0378-8741/$ - see front matter & 2013 Elsevier Ireland Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.jep.2013.12.028
 J.-B. Wu et al. / Journal of Ethnopharmacology 151 (2014) 1124–1132 1125

through the glomerular basement membrane surfaces and form museum. To assure of quality control, the materials were validated
proteinuria. Therefore, decreased number of podocyte is a key according to the Chinese Pharmacopeia (China Pharmacopoeia
determinant underlying the development of nephrotic syndrome Committee, 2010).
to renal failure. Reduced podocyte number is caused by desquamat-
ion of cells from the glomerular basement membrane and/or
2.1.2. Preparation of Qi-Dan Fang
apoptosis (Mundel and Shankland, 2002). P53 is necessary and
Amounts of RA and RSM were weighed according to a ratio of
sufficient for apoptosis, and apoptosis can be initiated by intracel-
5:1. RA and RSM were then grounded into a crude powder and
lular death signals that increase the level of p53, and also by
then mixed together by vortex. The powder was boiled with
extracellular signals mediated by bax/bcl-2 complex (Skirnisdottir
distilled water (800 ml per 100 g of mixture) for 2 h and filtered.
et al., 2001). P53 could directly activate the proapoptotic protein
After being repeated twice, the mixture of filtrate was concen-
bax independently to permeabilize mitochondria and engage the
trated to a relative density of 1.8 (room temperature) to obtain the
apoptotic program (Chipuk et al., 2004). Therefore, the critical role
extract. The extract was kept at 4 1C and dissolved in distilled
of p53 in the adriamycin-induced apoptotic signal networks is of
water before use. To guarantee the quality of the two herbs, HPLC
great importance. So it is a central to inhibit the podocyte from
were employed to detect the essence of main ingredients, Astra-
death or being destroyed to maintain renal function (Kelsey, 2013),
galoside IV and Calycosin-7-glucoside for RA, Salvianolic acid B
and the podocyte will be a potential target for reverse nephrotic
and Tanshinone II A for RSM. Details are provided in the support-
syndrome progression (Mathieson, 2012).
ing information.
Unfortunately in recent years, evidence to support specific
treatments of nephrotic syndrome is lacking. Immunosuppres-
sants (cyclosporine A, Steroid et al.) have been used based on 2.2. Regents
anecdotal evidence (Meyrier et al., 1988; Takeda et al., 1998).
However, immunosuppressant therapy can induce many serious Jin Gui Shen Qi Pill (Tong Ren Tang Technologies Co., Ltd, Beijing,
side effects, such as diverse organ failure (cardiac, renal, and ear), China, Lot. 0930113); Doxorubicin hydrochloride (Wangle Pharma-
toxicities (Yilmaz et al., 2006), fungal infection and a fast relapse ceutical Company, Shenzhen, China, Lot.0901E); test paper for urine
following any stoppage in therapy (Hirano and Fujinaga, 2013; protein (Guangzhou Pearl River Biochemical Reagents Co., Ltd,
Hodson and Craig, 2013). 20071102), Trizol, RT reagent Kit, SYBR Premix ExTaq II (Lot: NO.
Traditional Chinese medicines (TCMs), on the basis of syndrome D9108A, DRR037A and DRR081A, Takara, Dalian, China); the primers
differentiation, have been used with apparent safety and efficacy in for nephrin, podocin, CD2AP and GAPDH were synthesised by
treating and alleviating various complicated refractory diseases, Sangon Biotech, Co., Ltd (Shanghai, China). P53, bax, bcl-2 Antibody
such as cancer (Hsiao and Liu, 2010; Ito et al., 2002), nephrotic for Western blot were provided by Bioworld technology, Co., Ltd.
syndrome (Wei et al., 2002; Wang and Wang, 2004) and so on. (Lot: BS5528, BS2538, BS1511, USA); Goat anti Rabbit was obtained
Radix Astragali (RA) and Radix Salviae Miltiorrhizae (RSM), a tradi- from Boster Company (Lot. BA1054, Wuhan, Hubei, China).
tional Chinese herb, has been studied in the treatment of nephrotic
syndrome in this department for many years. RA does not only
2.3. Experimental animals and treatment protocol
decrease serum lipids including total cholesterol (TC), triglycerides
(TG), LDL-C, very low density lipoprotein-cholesterol (VLD-C) but
This study was carried out using 60 adult male Sprague-Dawley
also does improve serum albumin levels, plasma albumin levels,
rats (Certificate No. SCXK 2008-0020), weighing between 180 g and
and ameliorate blood protein metabolism disorder symptoms of
220 g sourced from the experimental animal centre of Guangzhou
nephrotic syndrome (Yuan et al., 2008; WZ et al., 2011). There are
university of Chinese medicine. The animal experimental procedures
positive functions in some aspects: delaying glomerular sclerosis,
were approved by the animal Ethics Committee of Guangzhou
increasing kidney blood perfusion and glomerular filtration rate,
university of Chinese medicine, Guangzhou, China. All rats were
reducing podocytes injury and protecting kidney function (M and
given standard rat chows and tap water ad libitum and housed at
JM, 2009; Zheng et al., 2012). RSM could suppress pain, activate
2372 1C. Except for 10 rats of the Normal group, all the other rats
blood circulation, eliminate stasis, and improve blood function,
were given 6.0 mg/kg Adriamycin (dissolved in saline) via a single
which has been proven to protect the kidneys in many experiments
intravenous injection from the tail respectively according to Bertani
and clinical researches (Shen, 1988; Ahn et al., 2010). In our
et al. (1982) protocol. Rats in the Normal group were injected with
previous researches, Qi-Dan Fang (RA combined with RSM, with
saline (6 ml/kg) only. After it was established that proteinuria was
an optimum of 5:1(Li et al., 2005) clearly reduced the level of
detected (about 2 weeks following the Adriamycin injection), the
urinary proteins, alleviated hyperlipidaemia, hyperlipemia symp-
model rats were randomly divided into five groups: Model, Jin Gui
toms, reduced blood viscosity, decreased blood pressure and
Shen Qi Pill (4.12 g/kg/d, P.O.), and Qi-Dan Fang (dose of 3.09, 6.17
increased the blood flow volume of auricle microcirculation ADR-
and 12.34 g/kg/d, respectively, P.O., the dosages selection were
induced nephrotic syndrome in model rats (Lin et al., 2012).
determined on basic of the dose in clinical, Chinese-language
Therefore, the aim of the present study is to further investigate
literature and our preliminary experiments).The Normal and Model
the protective effects of Qi-Dan Fang on ADR-induced nephrotic
groups were orally administrated with 10 ml/kg/d of saline. The
syndrome from the angle of renal function, and podocytes.
experimental period was seven weeks.

2. Materials and methods 2.4. Blood sampling and tissue removal

2.1. Plant materials and the preparation of Qi-Dan Fang
2.1.1. Plant materials
Radix Astragalus (RA) and Radix Salvia Miltiorrhiza (RSM) were
purchased from Guangzhou Zhixin Pharmaceuticals Co. Ltd.,
Guangzhou (Lot. 091010). The herbal medicines were authenticated
by Prof.Qiu-Zhen Zhang, of the Guangdong Chinese medicine
2 ml blood was collected from the aorta abdominalis, centri-
fuged for 10 min at 3000 rpm, and after standing for 40 min, the
serum was isolated and stored at  80 1C for measurement of CysC,
BUN and Scr. The kidneys were rapidly extracted and weighed. The
cortical tissues from the two kidneys were individually assigned
into two parts: the portion from right kidneys were treated for
light microscopy and electron microscopy; the portion from the
1126 J.-B. Wu et al. / Journal of Ethnopharmacology 151 (2014) 1124–1132
left kidneys were frozen in liquid nitrogen and then maintained at
80 1C for later assays.
2.5. Measurement of renal function
Blood biochemical paraments BUN, Cr and CysC were measured
using the autobiochemical analyzer (HD-F2600, Guangdong
General Hospital, Guangzhou, China).
2.6. Pathomorphology features of the glomeruli
2.6.1. Light microscopy
The cortical tissues were fixed with 10% neutral formalin phos-
phate buffer, dehydrated using a graded alcohol series and embedded
in paraffin, and then were cut into 4 μm sections and stained with
haematoxylin-eosin (HE) and examined by an experienced patholo-
gist under the light microscope (TE2000, Nikon, Japan).
2.6.2. Electron microscopy
A portion of cortical tissues were cut into 1 mm cubes, fixed in
2.5% glutaraldehyde, and post-fixed in 1% Osmium tetroxide. The
samples were dehydrated through a graded alcohol series and
embedded in Epon 812. Four ultra-thin sections (60 nm) were cut
with a diamond knife from each sample and stained with uranyl
acetate and lead citrate. The sections were examined under an
electron microscope (JEM100CX-a, Japan) at 60 kv,  7500 magni-
fication.
2.7. Podocytes genes mRNA determination
Total RNA was extracted using Trizol reagent from renal cortical
tissues and the purity of the RNA was evaluated by measuring the
ratio of A260/A280. First-strand cDNA was generated by adding
2.4 μg total RNA, 5  PrimeScript Buffer,6 μl; PrimeScript RT
Enzyme Mix I,1.5 μl; Oligo dT Primer (50 μM),1.5 μl; Random
6 mers (100 μM), 1.5 μl and Rnase Free dH2O were used to reach
a total reaction volume of 30 μl. The condition of RT were as
follows: 15 min at 37 1C and 85 1C for 5 s.
All the primers were set spanned an intron and the information
of primer were performed in Table 1. The PCR reaction of
components were combined in a master mix composed of SYBR
Premix Ex TaqTM II(2  ), 10 μl; PCR Forward Primer (10 μM),
0.8 μl; PCR Reverse Primer (10 μM), 0.8 μl; ROX Reference DyeII
(50  ), 0.4 μl; dH2O, 6 μl; cDNA, 2 μl.
The real-time quantitative PCR used ABI7500 (Applied Biosys-
tems, USA) and the cycling program was set at 1 cycle of pre-
denaturation at 93 1C for 2 min, and then 40 cycles at 93 1C for
30 s, 55 1C for 1 min, 72 1C for 34 s, followed by 1 cycle at 72 1C for
5 min. All the real-time QPCR experimentation were conducted
strictly according to the rules of the MIQE.
2.8. Western blot analysis
Western blot analysis was performed to measure the total
protein levels of p53, bax and bcl-2 in the kidney cortical tissuesin
Table 1
Sequences of the primers for RT-PCR.
Genes Sense primers Antisense primers
(50 to 30 ) (50 to 30 )
Nephrin ATGGGCGCTAAGAGAGTCAC CGCAGTCAGGTTTTCAGACA
Podocin TCTTGTCCTCTCCTCCCTGA AGACGGAGGTCAACCTTGTG
CD2AP GCTGGTGGAAAGGTGAACTG CATCTCTGTCTTCCGCCTTC
GAPDH AAACCCATCACCATCTTCCA GTGGTTCACACCCATCACAA
all experimental groups. Renal cortical tissues were homogenized
in 1:10(w/v) ice-cold homogenization buffer plus 1 mM PMSF
and centrifuged at 550g for 5 min at 4 1C, and supernatants were
centrifuged at 4 1C, 12,000 rpm  10 min, and the supernatant was
collected. Protein concentration was determined by BCA assay kit
(KeyGEN Biotech, Nanjing, china) according to manufacturer0 s
protocol and 30 μg total protein of each samples were boiled in
equal protein lysate for 5 min, electrophoresed on 10% SDS-PAGE
(120 V, 60 min) and then subsequently transferred to a PVDF
membrane by electroblotting at 300 mA for 45 min.The mem-
branes were rinsed in TBS (150 mM NaCl, 0.05 M Tris–HCl, pH 7.6)
buffer for five times and then immersed for 1 h in blocking TBS
buffer containing 5% skimmed milk. After that, membranes were
incubated with the following primary antibodies: anti-p53 mAb
(1:3000), anti-bax mAb (1:3000), anti-bcl-2 mAb (1:3000) at 4 1C
overnight. After further washing, the membranes were incubated
with biotinylated goat anti-rabbit IgG (1:10,000) in TBS-T contain-
ing 5% skimmed milk for 2 h at room temperature. Then the
membrane reacted with mixture of equal volume ECL reagent A
and B. Then the specific protein bands were captured on X-ray
film, scanned and quantitated in relation to the housekeeping
gene GAPDH.
2.9. Statistical analysis
Data were shown as mean 7SD. Comparisons between values
obtained in the same group before and after drug administration
were made using the paired T-test. Comparisons among groups
were carried out using one-way analysis of variance (ANOVA)
followed by Duncan0 s test. po 0.05 was considered statistically
significant.
3. Results
3.1. Effects of Qi-Dan Fang on renal function
ADR-induced nephrotic syndrome is accompanies with the
decline of renal function. BUN, Scr and CysC, three important renal
function important indicator indexes, were detect in the present
study. The data showed ADR at 6 mg/kg increased the levels of BUN,
Scr and CysC significantly (po0.01), After the treatment with Qi-
Dan Fang for 7 weeks, the content of BUN, Scr and CysC decreased
markly (po0.01 or po0.05, Fig. 1), indicating that Qi-Dan Fang
could enhance renal function by reducing the synthesis or increasing
the excretion of BUN, Scr and CysC in ADR-induced nephrotic
syndrome rats.
3.2. Qi-Dang Fang effect on changes of glomerular pathomorphology
3.2.1. Light microscopy
While minute changes of glomeruli could not be observed under
light microscopy in all experimental groups, kidney tubular lumen
heavy dilation and oedema were able to be detected in the Model
group, which was compared with the Normal group (Fig. 2A and
Fig. 3B). After treated with Qi-Dan Fang the above histopathology
were ameliorated in a dose-dependent manner,to a certain extent,
especially with high dosages (12.34 g/kg) of Qi-Dan Fang (Fig. 2D–F),
inferring that Qi-Dan Fang could alleviate the pathological damage
of kidney in ADR-induced nephrotic syndrome rats.
Product
size (bp)
3.2.2. Electron microscopy
171 As the structure and function defects of podocytes play an
195 important role in the development of nephrotic syndrome, we
192
investigated the ultrastructural changes in podocytes. The results
198
showed that, in the Model group, the foot process were extensive
 J.-B. Wu et al. / Journal of Ethnopharmacology 151 (2014) 1124–1132
Fig. 1. Bar graphs showing the actual measurements of the levels of BUN, Scr and CysC in serum in the six different groups (all detected by autobiochemical analyzer),
vertical bars represent the standard errors of the means, n¼ 8. Asterisks and pound sign denote significant differences. nnp o 0.01 vs. Normal; #p o 0.05, ##po 0.01 vs. Model.
effacement and the width of foot process was much bigger than
that of the Normal group (Fig. 3A and B).These ultrastructural
changes were similar to human minimal change nephrotic syn-
drome (Xing et al., 2006). Fortunately, Qi-Dan Fang could suppress
the foot process effacement and reduce the width of foot process
(Fig. 3D–F).The present results tell us that Qi-Dan Fang inhibited
the podocytes structure defects and recovered the function of
podocytes.
3.3. Effects of Qi-Dang Fang on podocyte genes mRNA expression
Nephrin, podocin and CD2AP are three of the functional genes
for podocytes, which have been demonstrated to be involved in
the development of proteinuria. In order to disclose the underlying
mechanism of effect of Qi-Dan Fang, Nephrin, podocin and CD2AP
mRNA were determined. The results showed that Nephrin, podo-
cin and CD2AP mRNA in the renal of ADR-induced nephrotic
syndrome rats were highly down-regulated, which compared with
Normal group. However, Qi-Dan Fang could enhanced the expres-
sion of renal nephrin, podocin and CD2AP mRNA (p o0.01 or
p o0.05, Fig. 4A–C).
3.4. Effects of Qi-Dang Fang on p53, bax and bcl-2
proteins expression
P53, bax and bcl-2 proteins immediate cell apoptosis by the
way of intracellular and/or extracellular death signals. For the sake
of to explore the potential mechanisms effect of Qi-Dan Fang, p53,
bax and bcl-2 total proteins concentration in the renal tissue were
determined. The results showed that p53, bax protein were highly
1127
up-regulated, bcl-2 protein level was dramatically reduced in the
renal of ADR-induced nephrotic syndrome rats when in comparison
with Normal group. Luckily, Qi-Dan Fang could down-regulated p53
and bax levels, while increased bcl-2 protein expression (po0.01 or
po0.05, Fig. 5). Taken together, these results suggested that ADR-
induced renal apoptosis was due to increased p53, bax and reduced
bcl-2 and these are direct targets of Qi-Dan Fang in mediating the
reduction of apoptosis.
4. Discussion
Nephrotic syndrome is a series of clinical symptoms, including
proteinuria, hypoalbuminemia, oedema, hyperlipidaemia and lipi-
duria (Kaneko and Narita, 2013). It can be classified according to
the clinical responses to steroids or on histological characteristics.
Depending on its response to steroids, nephrotic syndrome can be
classified into Steroid responsive nephrotic syndrome (SSNS), and
Steroid resistant nephrotic syndrome (SRNS). According to histological
characteristics, nephrotic syndrome can be classified into seven types:
Minimal change nephrotic syndrome (MCD, 77%), Focal Segmental
Glomerulosclerosis (FSGS, 7%), Membrano proliferative glomerulone-
phritis (MPGN, 8%), Membranous nephropathy (MN, 2%), Proliferative
glomerulonephritis (PGN, 2%), Mesangial proliferation (2%) and Focal
and global glomerulosclerosis (2%) (Rajesh, 2012).
Despite the advanced technology and drugs that have or are
currently being developed to prevent and treat nephrotic syn-
drome, treatment options and resources remain woefully limited
and unchanged and subsequently have failed to arrest or reverse
the effects of the disease since last century (Reiser and Sever,
1128 J.-B. Wu et al. / Journal of Ethnopharmacology 151 (2014) 1124–1132

Fig. 2. HE-stained sections in the kidney tissue of ADR-NS rats of the six different groups (  400), showing the condition of kidney tubular lumen with heavy dilation and
edema. Black arrowheads represent kidney tubular. (A) Saline-treated group; (B) ADR-treated group; (C) ADR þ JGSQP (4.12 g/kg)-treated group; (D) ADR þQi-Dan Fang
(3.09 g/kg)-treated group; (E) ADR þ Qi-Dan Fang (6.17 g/kg)-treated group; (F) ADR þQi-Dan Fang (12.34 g/kg)-treated group.

Fig. 3. Micrographs reflect podocytes and filtration barrier changes (transmission electron microscopy (TEM), Magnification:  7000). After injecting saline or ADR and then
followed up by orally administration of distilled water or Qi-Dan Fang once daily for 7 weeks. On day 50, the kidney samples were collected and detected under the TEM. The
arrowheads represent foot process. (A) Saline-treated group; (B) ADR-treated group; (C) ADRþ JGSQP (4.12 g/kg)-treated group; (D) ADR þQi-Dan Fang (3.09 g/kg)-treated
group; (E) ADR þ Qi-Dan Fang (6.17 g/kg)-treated group; (F) ADR þQi-Dan Fang (12.34 g/kg)-treated group.
 J.-B. Wu et al. / Journal of Ethnopharmacology 151 (2014) 1124–1132
Fig. 4. Bar graphs representing the nephrin, podocin and CD2AP mRNA levels in the kidney tissue. Asterisks and the pound sign designate significant differences.
nn
p o 0.01 vs. Normal; ##po 0.01 vs. Model. All values are means 7 SD (n¼8).
2013). Clearly, the present pharmaceutical treatments are not
sufficient for patient to prevent nephrotic syndrome from devel-
oping into renal failure. At end-stage, dialysis and kidney trans-
plantation are the final options for the patients (Meguid El Nahas
and Bello, 2005). Therefore, it becomes exceedingly clear that we
have better to seek out another effective target and drug to treat
nephrotic syndrome.
Until now, many different animal models have been developed
to study the functions of specific podocyte proteins (e.g., nephrin,
podocin, et al.) and their role in the pathogenesis of proteinuria
and glomerulosclerosis (Gigante et al., 2009; Mollet et al., 2009;
Holmberg and Jalanko, 2011). In our present study, we used a
single Adriamycin injection method to induce the nephrotic
syndrome model, which phenotype are similar to those patient
clinical syndrome, and is a classical nephrotic syndrome model
and is widely used (Pedrycz et al., 2003; Li et al., 2009; Ramadan
et al., 2012). The model0 s mechanisms are by means of DNA
intercalation and inhibition of macromolecular biosynthesis for
causing glomerular injury (Simic et al., 2012). The ADR-induced
glomerulopathy is characterized by the broadening of foot process
base width, thickening of glomerular basement membrane (GBM)
and reduction in slit pore diameter. In addition, extensive efface-
ment podocyte foot processes is the key morphological change in
glomerulopathy (Rashikh et al., 2013). All the features of glomer-
ulopathy could be observed in the Model group rats during our
research, and could be restored by administration of Qi-Dan Fang.
The concentration of creatinine, blood urea nitrogen and
cystatin C in serum, which are three important indexes to reflect
renal function, depend on the glomerular filtration rate (GFR).
1129
Renal dysfunction reduces the capability to filter them, and the
levels of them then rise (Hosten, 1990; Tkaczyk et al., 2004). In this
study, the rats did show a notable increase in the serum creatinine,
blood urea nitrogen and cystatin C, 7 weeks following injection of
ADR, indicating that renal filtrating function was being destroyed
by ADR. This study results showed that doses of 6.17, 12.34 g/kg of
Qi-Dan Fang was able to decrease the levels of BUN, Cr and CysC in
serum, while 3.09 g/kg of Qi-Dan Fang could not (data not shown).
Podocyte function of maintaining the filtration barrier of glo-
merulus depend on nephrin, podocin and CD2-associated proteins,
which are demonstrated to be involved in maintaining the struc-
tural integrity of the slit diaphragms (Coward et al., 2005). This
present study shows that the podocytes function seems to contain
factors that are nephrin, podocin, and CD2AP and that are down-
regulated in nephrotic syndrome model rats, when placed in
comparison with Normal rats. And the results are consistent with
what has been reported (Mao et al., 2006; Fukuda et al., 2012). The
results suggest that the imbalance of nephrin, podocin, and CD2AP
expression will lead to a dysregulated ultrafiltration of glomerulus.
Qi-Dan Fang could restore the imbalances of the genes expression
and prevent the podocytes from being injured.
P53 protein expression has been proved to be correlated with
apoptosis, which is employed as a transcriptional activator that
will leads cell cycle arrest, cellular senescence or apoptosis (Harris
and Levine, 2005). Increased apoptosis has been observed as an
important characteristic of renal failure (Kovacevic et al., 2013).
P53 pathway activation is induced by a number of stress signals
that impact upon cellular homeostatic mechanisms that monitor
DNA replication, chromosome segregation and cell division.
1130 J.-B. Wu et al. / Journal of Ethnopharmacology 151 (2014) 1124–1132

Fig. 5. Effect of Qi-Dan Fang on levels of p53,bax,bcl-2 proteins expression after induced by ADR. Western blot analysis for total p53, bax, bcl-2 and housekeeping protein
GAPDH in renal tissue. Bar graphs representing the p53, bax, bcl-2 expressions relative densities to GAPDH. Asterisks and the pound sign designate significant differences.
nn
p o 0.01 vs. Normal; ##po 0.01 and #p o 0.05 vs. Model. All values are means 7 SD.

Apoptotic pathway could be mediated by p53 dependently, and
down-regulated p53 kept the kidney away from being injured or
apoptosis (Ye et al., 2010; Kang et al., 2011). Our results also showed
that ADR increased the levels of p53 in renal tissue and inhibition of
p53 by Qi-Dan Fang protected kidney from ADR-induced apoptosis,
which indicating that p53 may be a critical target whereby Qi-Dan
Fang suppresses apoptosis. Further studies are needed to define the
mechanisms underlying this effect.
As previously mentioned, apoptosis can be initiated not only by
increase the level of p53, but also by bax/bcl-2 complex (Ozer
et al., 2012). We next examined the levels of bcl-2 family proteins
bax and bcl-2 to explored the mechanisms of antiapoptosis effect
of Qi-Dan Fang in kidney. The ratio of bax/bcl-2 index better
reflects the apoptosis process than isolated Bcl-2 level (Faria et al.,
2006). In addition, some evidences have demonstrated that the
transcriptional expression of bax is induced by p53 and mediates
the proapoptotic effect of p53 (Miyashita and Reed, 1995). Our
results showed that ADR induced apoptosis in nephrotic syndrome,
with increased p53, bax, bax/bcl-2 and decreased Bcl-2 levels and
Qi-Dan Fang reversed these changes. The results suggested that Qi-
Dan Fang alleviated nephrotic syndrome by reducing apoptosis
through p53 pathway. However, whether the down-regulation effect
of Qi-Dan Fang on p53 via regulating bcl-2 family proteins still need
further research.
There is no doubt that Chinese herbal compounds, a combined
drug treatment of two or more compounds, could offer beneficial
synergistic relief effects for nephrotic syndrome. As introduced
before, the Chinese herb Radix Astragali (RA) and Radix Salviae
Miltiorrhizae (RSM) showed to have protective effects and improve
on nephrotic syndrome (Yuan et al., 2008; WZ et al., 2011; Zheng
et al., 2012). Qi-Dan Fang, which is a compound of Radix Astragali
(RA) and Radix Salviae Miltiorrhizae (RSM), have also been verified
to be able to fight against nephrotic syndrome by the ways of
decreasing the amount of urinary protein, restoring glomerular
 J.-B. Wu et al. / Journal of Ethnopharmacology 151 (2014) 1124–1132
filtration membrane barrier, alleviating hyperlipidaemia, hyperli-
pemia symptoms, reducing blood viscosity, alleviating serum lipid,
decreasing the level of blood pressure and increasing the blood
flow volume of auricle microcirculation in our laboratory (Lin et al.,
2012). However, whether Qi-Dan Fang has the abilities to restore
the dysfunction of renal, inhibit podocytes injury and apoptosis in
protecting the kidney in ADR-induced nephrotic syndrome, is cur-
rently unknown as there are no relevant reports of such as of yet.
Thus, we formed this study to investigate the effect of Qi-Dan Fang to
renal function, and podocytes.
5. Conclusions
To sum up, the investigations suggest that the renal function and
podocytes have been destroyed in nephrotic syndrome, In vivo
treatment with Qi-Dan Fang significantly reduced the concentration
of creatinine, blood urea nitrogen and cystatin C in serum, restored
glomerular morphological change, up-regulated the expression of
nephrin, podocin and CD2AP mRNA and inhibited activation of
apoptotic genes. These results add further credibility to the opinion
that Qi-Dan Fang ameliorates ADR-induced renal dysfunction, podo-
cytes injury. This study provides an important effective pharmacolo-
gical and therapeutic basic of the TCM in the treatment of nephrotic
syndrome.
Acknowledgements
This research was supported by grants from Natural Science
Foundation of Guangdong Province (Project No. S2011020005170).
We also grateful to Jinan University (Department of Analysis and
Test Centre) for providing Electron Microscope Facility and Prof.
Qiu-Zhen Zhang (Guangdong Chinese medicine museum) for
assuring the quality of the Chinese herbal medicine.
Appendix A. Supplementary material
Supplementary data associated with this article can be found in
the online version at http://dx.doi.org/10.1016/j.jep.2013.12.028.
References
Ahn, Y.M., Kim, S.K., Lee, S.H., Ahn, S.Y., Kang, S.W., Chung, J.H., Kim, S.D., Lee, B.C.,
2010. Renoprotective effect of Tanshinone IIA, an active component of Salvia
miltiorrhiza, on rats with chronic kidney disease. Phytother. Res.: PTR 24,
1886–1892.
Bagga, A., Srivastava, R.N., 2002. Nephrotic syndrome and proteinuria. Indian
J. Pediatri. 69, 1053–1054.
Bertani, T., Poggi, A., Pozzoni, R., Delaini, F., Sacchi, G., Thoua, Y., Mecca, G., Remuzzi, G.,
Donati, M.B., 1982. Adriamycin-induced nephrotic syndrome in rats: sequence of
pathologic events. Lab. Invest.; A Journal of Technical Methods and Pathology 46,
16–23.
Chipuk, J.E., Kuwana, T., Bouchier-Hayes, L., Droin, N.M., Newmeyer, D.D., Schuler, M.,
Green, D.R., 2004. Direct activation of Bax by p53 mediates mitochondrial
membrane permeabilization and apoptosis. Science 303, 1010–1014.
Coward, R.J., Foster, R.R., Patton, D., Ni, L., Lennon, R., Bates, D.O., Harper, S.J.,
Mathieson, P.W., Saleem, M.A., 2005. Nephrotic plasma alters slit diaphragm-
dependent signaling and translocates nephrin, Podocin, and CD2 associated
protein in cultured human podocytes. J. Am. Soc. Nephrol. 16, 629–637.
Faria, J.R., Yamamoto, M., Faria, R.M., Kerbauy, J., Oliveira, J.S., 2006. Fludarabine
induces apoptosis in chronic lymphocytic leukemia–the role of P53, Bcl-2, Bax,
Mcl-1, and Bag-1 proteins. Braz. J. Med. Biol. Res. 39, 327–333.
Fukuda, A., Wickman, L.T., Venkatareddy, M.P., Wang, S.Q., Chowdhury, M.A.,
Wiggins, J.E., Shedden, K.A., Wiggins, R.C., 2012. Urine Podocin:Nephrin mRNA
Ratio (PNR) as a Podocyte Stress Biomarker. Nephrol. Dial. Transplant.: Official
Publication of the European Dialysis and Transplant Association—European
Renal Association 27, 4079–4087.
Gigante, M., Pontrelli, P., Montemurno, E., Roca, L., Aucella, F., Penza, R., Caridi, G.,
Ranieri, E., Ghiggeri, G.M., Gesualdo, L., 2009. CD2AP mutations are associated
with sporadic nephrotic syndrome and focal segmental glomerulosclerosis
1131
(FSGS). Nephrol. Dial. Transplant.: Official Publication of the European Dialysis
and Transplant Association—European Renal Association 24, 1858–1864.
Harris, S.L., Levine, A.J., 2005. The p53 pathway: positive and negative feedback
loops. Oncogene 24, 2899–2908.
Hirano, D., Fujinaga, S., 2013. Two dosing regimens for steroid therapy in nephrotic
syndrome. Pediatr. Nephrol. (online) 06 (February).
Hodson, E.M., Craig, J.C., 2013. Corticosteroid therapy for steroid-sensitive nephrotic
syndrome in children: dose or duration? J. Am. Soc. Nephrol. 24, 7–9.
Holmberg, C., Jalanko, H., 2011. Congenital nephrotic syndrome of the finnish type—
key to the mechanisms of proteinuria. Duodecim; laaketieteellinen aikakaus-
kirja 127, 1017–1025.
Hosten, A.O., 1990. BUN and Creatinine. In: Walker, H.K., Hall, W.D., Hurst, J.W.
(Eds.), Clinical Methods: The History, Physical, and Laboratory Examinations,
third ed., Boston.
Hsiao, W.L., Liu, L., 2010. The role of traditional Chinese herbal medicines in cancer
therapy–from TCM theory to mechanistic insights. Planta Med. 76, 1118–1131.
Ito, T., Seo, N., Yagi, H., Ohtani, T., Tokura, Y., Takigawa, M., Furukawa, F., 2002.
Unique therapeutic effects of the Japanese–Chinese herbal medicine, Sairei-to,
on Th1/Th2 cytokines balance of the autoimmunity of MRL/lpr mice.
J. Dermatol. Sci. 28, 198–210.
Kaneko, Y., Narita, I., 2013. Nephritis and nephrotic syndrome. Nihon Jinzo Gakkai
shi 55, 35–41.
Kang, K.P., Park, S.K., Kim, D.H., Sung, M.J., Jung, Y.J., Lee, A.S., Lee, J.E., Ramkumar, K.
M., Lee, S., Park, M.H., Roh, S.G., Kim, W., 2011. Luteolin ameliorates cisplatin-
induced acute kidney injury in mice by regulation of p53-dependent renal
tubular apoptosis. Nephrol. Dial. Transplant.: Official Publication of the Eur-
opean Dialysis and Transplant Association—European Renal Association 26,
814–822.
Kelsey, R., 2013. Podocyte biology: protein network involved in maintaining kidney
permeability. Nat. Rev. Nephrol. 9, 64.
Kovacevic, L.M., Puizina-Ivic, N., Ljutic, D., Brakus, S.M., Govorko, D.K., Jelicic, I.,
Miric, D., Resic, J., Saraga-Babic, M., 2013. Differences in epidermal thickness
and expression of apoptosis regulatory proteins in the skin of patients with
chronic renal failure and pruritus. Acta Histochem. 115, 144–150.
Li, S., Jun, C.X., Dong, H.J., Gao, Z.S., Chun, M.J., 2005. Comparisons different doses of
Astragali membranaceus and Salvia miltiorrhiza in rats proteinuria. Chin. J.
New Drugs Clin. Rem. 19, 205–208.
Li, Y., Bi, X., Zhu, G., Han, Z., Ye, Y., Liang, Y., Zhang, L., Hao, Z., Zeng, G., He, H., Zhong, W.,
2009. Protective effect of glycyrrhizin on nephrotic syndrome induced by adriamy-
cin in rats. Clinical and investigative medicine. Med. Clin. Exp. 32, 229–238.
Lin, J., Nie, H., Chou, A., Ye, S.-f., Zhou, J, 2012. Effects of Qi-Dan Fang on renal
function and serum lipid in nephrotic syndrome rats induced by adriamycin.
J. Pharm. Biomed. Sci. 24, 26–30.
M, X., JM, F., 2009. The mechanism of Astragalus membranaceus in nephrotic
syndrome. Med. J. West China 21, 474–475.
Mao, J., Zhang, Y., Du, L., Dai, Y., Yang, C., Liang, L., 2006. Expression profile of
nephrin, podocin, and CD2AP in Chinese children with MCNS and IgA nephro-
pathy. Pediatr. Nephrol. 21, 1666–1675.
Mathieson, P.W., 2012. The podocyte as a target for therapies—new and old. Nat.
Rev. Nephrol. 8, 52–56.
Meguid El Nahas, A., Bello, A.K., 2005. Chronic kidney disease: the global challenge.
Lancet 365, 331–340.
Meyrier, A., Condamin, M.C., Simon, P., 1988. Treatment with cyclosporine of adult
idiopathic nephrotic syndrome resistant to corticosteroids and other immuno-
suppressants. Transplant. Proc. 20, 259–261.
Miyashita, T., Reed, J.C., 1995. Tumor suppressor p53 is a direct transcriptional
activator of the human bax gene. Cell 80, 293–299.
Mollet, G., Ratelade, J., Boyer, O., Muda, A.O., Morisset, L., Lavin, T.A., Kitzis, D.,
Dallman, M.J., Bugeon, L., Hubner, N., Gubler, M.C., Antignac, C., Esquivel, E.L.,
2009. Podocin inactivation in mature kidneys causes focal segmental glomer-
ulosclerosis and nephrotic syndrome. J. Am. Soc. Nephrol. 20, 2181–2189.
Mundel, P., Shankland, S.J., 2002. Podocyte biology and response to injury. J. Am.
Soc. Nephrol. 13, 3005–3015.
Ozer, H., Yenicesu, G., Arici, S., Cetin, M., Tuncer, E., Cetin, A., 2012. Immunohis-
tochemistry with apoptotic-antiapoptotic proteins (p53, p21, bax, bcl-2), c-kit,
telomerase, and metallothionein as a diagnostic aid in benign, borderline, and
malignant serous and mucinous ovarian tumors. Diagn. Pathol. 7, 124.
Pedrycz, A., Czerny, K., Wieczorski, M., Hernik, D., 2003. Hiponatremia during
pregnancy with adriamycin-induced nephrotic syndrome in rats. Ann. Univ.
Mariae Curie Sklodowska Med., 58; , pp. 86–90.
Pinto, J.A., Brewer, D.B., 1973. Morphometry of the glomeruli in puromycin
aminonucleoside nephrotic syndrome. J. Pathol., 109. (Pxi).
Rajesh, N.G., 2012. Nephrotic syndrome. Paediatr. Child Health 22, 337–340.
Ramadan, R., Faour, D., Awad, H., Khateeb, E., Cohen, R., Yahia, A., Torgovicky, R.,
Cohen, R., Lazari, D., Kawachi, H., Abassi, Z., 2012. Early treatment with
everolimus exerts nephroprotective effect in rats with adriamycin-induced
nephrotic syndrome. Nephrol. Dial. Transplant.: Official Publication of the
European Dialysis and Transplant Association—European Renal Association
27, 2231–2241.
Rashikh, A., Pillai, K.K., Ahmad, S.J., Akhtar, M., Najmi, A.K., 2013. Aliskiren alleviates
doxorubicin-induced nephrotoxicity by inhibiting oxidative stress and podo-
cyte injury. J. Renin. Angiotensin Aldosterone Syst. 14, 14–22.
Reiser, J., Sever, S., 2013. Podocyte biology and pathogenesis of kidney disease.
Annu. Rev. Med. 64, 357–366.
Shen, Y.C., 1988. The protective effects of Salvia miltiorrhiza on the warm ischemic
kidney: experimental study in animals. Chin. J. Surg. 26 (759–761), 783.
1132 J.-B. Wu et al. / Journal of Ethnopharmacology 151 (2014) 1124–1132
Simic, I., Tabatabaeifar, M., Schaefer, F., 2012. Animal models of nephrotic
syndrome. Pediatr. Nephrol. 28, 2079–2088.
Skirnisdottir, I., Sorbe, B., Seidal, T., 2001. P53, bcl-2, and bax: their relationship and
effect on prognosis in early stage epithelial ovarian carcinoma. Int. J. Gynecol.
Cancer: Official Journal of the International Gynecological Cancer Society 11,
147–158.
Takeda, A., Ohgushi, H., Niimura, F., Matsutani, H., 1998. Long-term effects of
immunosuppressants in steroid-dependent nephrotic syndrome. Pediatr.
Nephrol. 12, 746–750.
Tkaczyk, M., Nowicki, M., Lukamowicz, J., 2004. Increased cystatin C concentration
in urine of nephrotic children. Pediatr. Nephrol. 19, 1278–1280.
Wang, W., Wang, S., 2004. Nephrotic syndrome and the TCM treatment. J. Tradit.
Chin. Med. 24, 201–203.
Wei, L., Ye, R., Luan, T., Lu, R., Chen, B., 2002. Long-term effect of TCM decoctions in
treatment of nephrotic syndrome. J. Tradit. Chin. Med. 22, 83–86.
WZ, Y., GS, G., XS, H., 2011. Effect of astragale injection on serum lipids in nephrotic
syndrome. Pract. Pharm. Clin. Remedi. 14, 194–195.
Xing, Y., Ding, J., Fan, Q., Guan, N., 2006. Diversities of podocyte molecular changes
induced by different antiproteinuria drugs. Exp. Biol. Med. 231, 585–593.
Ye, W., Gong, X., Xie, J., Wu, J., Zhang, X., Ouyang, Q., Zhao, X., Shi, Y., Zhang, X., 2010.
AChE deficiency or inhibition decreases apoptosis and p53 expression and
protects renal function after ischemia/reperfusion. Apoptosis 15, 474–487.
Yilmaz, S., Atessahin, A., Sahna, E., Karahan, I., Ozer, S., 2006. Protective effect of
lycopene on adriamycin-induced cardiotoxicity and nephrotoxicity. Toxicology
218, 164–171.
Yuan, W., Wang, J., Wu, T., 2008. Chinese herbal medicine Huangqi type formula-
tions for nephrotic syndrome. Cochrane Database Syst. Rev.
Zheng, R., Deng, Y., Chen, Y., Fan, J., Zhang, M., Zhong, Y., Zhu, R., Wang, L., 2012.
Astragaloside IV attenuates complement membranous attack complex induced
podocyte injury through the MAPK pathway. Phytother. Res. 26, 892–898.