Genetic Engineering

Genetic engineering refers to the direct manipulation of DNA to alter an organism’s characteristics. This is
usually performed with bacteria and viruses and involves the addition of new genes to the chromosome complement or
the replacement of certain genes by other genes.
Genetic engineering are geared towards a variety of uses in agriculture, industries and medicine. The goal is to
study ways of improving man’s way of life through advances in biotechnology.
In plants, genetic engineering aims to produce plants that manufacture natural insecticides and to produce
plants that contain genes which enables them to produce their own nitrogen nutrients-thus, no need for fertilizers.
In animals, this successfully produces a variety of transgenic insects, roundworms, and vertebrates.
In medicine, genetic engineering has been used to mass-produce insulin, human growth hormones, follistim
(for treating infertility), human albumin, monoclonal antibodies, antihemophilic factors, vaccines, and many other
drugs.

The Process in Genetic Engineering (Crops)

The process of genetic engineering requires the successful completion of a series of five steps
(http://agbiosafety.unl.edu/education/summary.htm).
Step 1: DNA Extraction

DNA extraction is the first step in the genetic engineering process. In order to work with
DNA, scientists must extract it from the desired organism. A sample of an organism
containing the gene of interest is taken through a series of steps to remove the DNA.

Step 2: Gene Cloning

The second step of the genetic engineering process is gene cloning. During DNA
extraction, all of the DNA from the organism is extracted at once. Scientists use gene cloning to
separate the single gene of interest from the rest of the genes extracted and make thousands of
copies of it.

Step 3: Gene Design

Once a gene has been cloned, genetic engineers begin the third step, designing
the gene to work once inside a different organism. This is done in a test tube by cutting the
gene apart with enzymes and replacing gene regions that have been separated/span.

Step 4: Transformation
The new gene is inserted into some of the cells using various techniques. Some of the
more common methods include the gene gun, agrobacterium, microfibers, and electroporation.
The main goal of each of these methods is to transport the new gene(s) and deliver them into the
nucleus of a cell without killing it. Transformed plant cells are then regenerated into transgenic
plants. The transgenic plants are grown to maturity in greenhouses and the seed they produce,
which has inherited the transgene, is collected. The genetic engineer's job is now complete. He/she will
hand the transgenic seeds over to a plant breeder who is responsible for the final step.

Step 5: Backcross Breeding

The fifth and final part of producing a genetically engineered crop is backcross
breeding. Transgenic plants are crossed with elite breeding lines using traditional plant breeding
methods to combine the desired traits of elite parents and the transgene into a single line. The
offspring are repeatedly crossed back to the elite line to obtain a high yielding transgenic line.
The result will be a plant with a yield potential close to current hybrids that expresses the trait
encoded by the new transgene.
MUTATION

This refers to the change in the DNA material of organisms. We all know that the DNA contained in our genes
is responsible for the way we look, behave, and others. Therefore, changing the DNA sequence in an organism will
cause changes in all the aspects of its life, either good or bad (deleterious or beneficial). Deleterious mutations
can affect the characteristics of the organism and in turn, reduce their fitness and increase their susceptibility to
several illnesses, such as cancer while beneficial mutations can lead to the reproductive success and adaptability
of an organism to its environment. Whether the changes can be helpful or not, mutation is essential in evolution for
this contributes to the genetic variation we can see today. Without this, evolution cannot occur.
Mutation can occur through germ line mutation - occur in gametes (eggs or sperm cells) and can be passed
onto offspring or through somatic mutations- occur in non-reproductive cells and are not passed on to the
following generation. An example of which is the cancer tumor. Those mutations that occur in the germ line are the
most important to large-scale evolution because they can be transmitted to offspring.

Why do mutations occur? Mutations can occur due to various factors which can include the following.
a. Failure of the DNA to copy accurately b. exposure to specific chemicals c. exposure to radiations

MECHANISMS OF EVOLUTION

Evolution means that a population is changing in its genetic make-up over generations. This refers also to the
process that has transformed life on earth from its earliest forms to the vast diversity that characterizes it today,
which is a never ending study. Major changes are not drastic but may only appear after thousands or millions of
years.
Let’s review the important concepts in understanding the mechanisms of evolution.
a. Population is a localized group of individuals belonging to the same species.
b. Species is a group of populations that have the potential to interbreed in nature.
A population evolves because the population contains the collection of genes called gene pool- it consists of
all alleles at all gene loci in all individuals of the population. This then now can lead to the five key processes of
change which are the following.
GENE FLOW or MIGRATION
This refers to any movement of individuals, and/or the genetic material they carry, from one population to another. How
does this happen?
Let’s say we have an individual migrating to a new population (either coming from one geographic location and
joins a different population of a species) and interbreeds with this population. The interbreeding will result in the
contribution of a part of the individual’s genes to the gene pool of the local population.
The introduction of new alleles contributes to the variability within a given population or the receiving
population since there is a new combination of traits. In this process, we need to take note that the process of gene flow
does not totally change the allele frequencies of species as a whole. It can only alter frequencies in local populations.
The greater the allele frequencies between the local population and the migrant individuals and the larger their numbers
are, the greater the effect the migrant have in changing the genetic components of the local population.
Maintained gene flow also acts against speciation by recombining the gene pools of different populations and in
such a way, repairing the developing differences in genetic variation. Thus, gene flow has the effect of minimizing the
genetic differences between populations. Human migrations have occurred throughout the history of mankind and are
defined as the movement of people from one place to another. However, in a genetic context, this movement needs to
be associated with the introduction of new alleles into a population through successful mating of individuals from
different populations.
In the cordillera alone, we already have what we call as “mestizo” and “mestiza” as a result of the migration of
foreigners in our place.
 GENETIC DRIFT
This mechanism of evolution refers to the change in the frequencies of alleles in a population over
generations due to chance. It’s not all about organisms with high fitness, it’s all about random changes. This
actually occurs in all population types, but it affects more the small population. Why would this mechanism
occur? It occurs when the alleles that are being passed on to the next generations are random samples of the
alleles in the current population.

We can see that genetic drift in a population can led to the elimination of a certain allele by chance. In each
generation, a random set of individuals reproduces to produce the next set of generations. The frequency of alleles in
the next generation will be the same with that of the individuals reproducing.
For example: The American Bison was haunted
before and they almost got extinct. Even if they have
recovered now, their population have little genetic
variation.
Source:

https://cdn.pixabay.com/photo/2012/04/18/22/44/bison-38130_640.png
Genetic drift can increase due to natural or human-caused events, such as disasters
which can kill a large portion of the population (bottleneck effect) or when a small
group splits off
from the main population to start a colony in another region (founder effect).
How are they different?
Bottleneck Effect Founder Effect
- sudden decline in population size due to natural - small group starts a new population on a new location
disasters or human-caused events

- the remaining population contains less genetic - the founder of the new colony is not genetically
variability representative of the population they came from, thus
less genetic variability

Source: Source:
https://nectunt.bifi.es/to-learn-more-overview/mechanisms- https://nectunt.bifi.es/to-learn-more-overview/mechanism
of-evolutionary-change/ s-of-evolutionarychange/
As they expand, they pass on genes similar to theirs leading to less variation

Ex: With the genetic analysis of Arius manillensis or
Manila sea catfish using the mitochondrial control region,
evidences confirmed that genetic bottleneck occurred in
the species (Santos & Quilang, 2012).
Ex: The manila clam (Ruditapes philippinarum) is now
established in North America and Europe. Studies
conducted revealed the occurrence of founder effect in
the European population evidenced by its reduced genetic
variability (Cordero, Delgado, Liu, Ruesink & Saavedra,
2017)

NATURAL SELECTION
This describes Darwin’s “survival of the fittest, elimination of the unfit” which is in contrast to that of the genetic drift
but also a part of explaining diversity in the planet. It simply means those who can adapt to their various environmental
situations like predation, disasters, diseases, climate change, change in habitat, exposure to chemicals/toxins as well as able
 to attract their mates and others would likely survive, reproduce, and expand their population. Those who can’t, would
likely die and their genetic line would disappear. Darwin’s idea of finches are the common examples for this.
Our country, the Philippines is a perfect place for natural selection to occur as it is beaming with natural resources
which include the plants and animals discovered and yet to be discovered.

EVIDENCES OF EVOLUTION

The millions of species alive today did not just pop into existence; they are the result of continuing
evolutionary changes that started with organisms living billions of years in the past. Many types of clues enable us to
hypothesize about how modern species evolved from extinct ancestors and to understand the relationships among
organisms that live today.
Comparisons among living organisms provided early evidence of the evolutionary relationships among
species.
In this lesson, we shall focus on the evidences and evolutionary relationship among organisms using the
evidence of evolution. The following are the five scientific disciplines that provide evidences of evolution.
THE FOSSIL RECORD
The succession of fossil forms is compatible with what is known from other types of evidence about the major branches
of descent in the tree of life. For instance, evidence from biochemistry, molecular biology, and cell biology places
prokaryotes as the ancestors of all life and indeed the oldest known fossils are prokaryotes. Another example is the
chronological appearance of the different classes of vertebrate animals in the fossil record. Fossil fishes predate all other
vertebrates, with amphibians next, followed by reptiles, then mammals and birds. This sequence is consistent with the
history of vertebrate descent as revealed by many other types of evidence.
The Darwinian view of life predicts that evolutionary transitions should leave signs in the fossil record. Indeed,
paleontologists have discovered many transitional forms that link even older fossils to modern species. For example, a
series of fossils documents the changes in skull shape and size that occurred as mammals evolved from reptiles. Every
year, paleontologists turn up other important links between contemporary forms and their ancestors. In the past few
years, for instance, researchers have found fossilized whales that link these aquatic mammals to their terrestrial
predecessors.

Transitional fossils linking past and present.

Whales evolved from terrestrial ancestor, an evolutionary transition that left many signs, including fossil
evidence. Paleontologists digging in Egypt have recently identified extinct whales that had hind limbs. (Modern whales
have forelimbs in the form of flippers but lack hind limbs, although there are tiny skeletal remnants of hind limbs that do
not extend from the body.) Shown here are the fossilized leg bones of Basilosaurus, one of those ancient whales. The
legs were half a meter long and were well muscled, but these whales were already aquatic animals that no longer used
their legs to support their weight and walk. Here in the Philippines, the discovery of bones at the Callao cave in Cagayan
on the year 2007, 2011, 2015 led to the discovery of a new species of human termed as Homo luzonensis. This discovery
can pave the way in understanding more the concept of human evolution.
EVIDENCE OF EVOLUTION
1. Paleontology
The study on this, involves fossils that reveal the prehistoric existence of extinct species. As a result, changes and the
formation of new species can be studied.
 Fossil deposits are often found among sediment layers, where the deepest fossils represent the oldest
specimens. For example, fossil oysters removed from successive layers of
Source:https://www.google.com/search?
q=paleontology+evidence+of+evolution+sample+image&tbm=isch&ved=cp
Sediment show glacial changes in the size of the oyster shell alternating with rapid changes in shell. Large, rapid
changes produce new species. One example of which are the bones found in Kalinga.
Various researchers who visited the Philippines found animal bones and stone tools in Kalinga since
the 1950s. With the findings, they need to prove that an ancient hominin had lived in the place. Therefore, the team of
researchers dug a test pit in the area, and they found bones belonging to a long-extinct rhinoceros. There are signs
showing a clear evidence of butchery on the retrieved bones. The question now is, who butchered the Philippine
rhinoceros? This discovery is still leading scientists to discover more the existence of other living organisms before.

2. Biogeography
Geography is being used to describe the distribution of
species. This information has revealed that unrelated species in different
regions of the world look alike when found in similar environment. This
provides strong evidence for the role of natural selection in evolution.
Rabbits did not exist in Australia until introduced by humans. A
native Australian wallaby resembles a rabbit both in structure and habit. As
similar as these two animals appear, they are not that closely related. The rabbit is a placental mammal, while the wallaby
is a marsupial mammal. The fetus of a placental mammal develops in the female uterus, obtaining nourishment from the
mother through the placenta. The fetus of a marsupial leaves the mother’s uterus at an early stage in the abdominal pouch.
The great similarity of the rabbit and the wallaby is the result of natural selection.

3. Embryology
This reveals similar stages in development (ontogeny) among related
species. The similarities help
establish evolutionary
relationships (phylogeny).
Gill slits and tails are found in fish, chicken, pig, and human
embryos.
Comparative anatomy
This describes two kinds of structures that contribute to the identification of
evolutionary relationships among species.
Homologous structures are body parts that resemble one another
in different species because they have evolved from a common
ancestor. Because anatomy may be modified for survival in specific
environments, homologous structures may look different but will
resemble on another in pattern (how they are put together). The
forelimbs of cats, bats, whales, and humans are homologous because
they all evolved from a common ancestral animal.
Analogous structures are body parts that resemble one another in different species not because they
have evolved from a common ancestor, but because they evolved independently as adaptations to their
environments. The fins and body shapes of sharks, penguins and porpoises are analogous because they are
adaptations to swimming.

5. Molecular biology
This examines the nucleotide and amino acid
sequences of DNA and proteins from different
species. Closely related species share higher
percentages of sequences than species distantly
related. In addition, all living things share the same
genetic code. This data strongly favors evolution of
different species through modification of ancestral
genetic information.
 More than 98% of the nucleotide sequences in humans and chimpanzees are identical.

SPECIES DIVERSITY AND CLADITICS

In Linnaeus’s time, the physical attribute of organisms was the basis in classifying certain
organisms. For example, those with feathers were classified as birds and those with hairs were
classified as mammals.
Darwin’s theory of evolution specifically on descent with modification changed the entire
way that biologists thought about classification. His idea has given rise to the study of phylogeny, the
evolutionary history of a species or a group of species. Phylogeny is a kind of genealogy that follows
a lineage’s evolutionary relationship through time. We can say that it is similar to that of the family
tree where certain families trace their roots and adds to them. Biologists today do not group
organisms only based on their physical similarities and differences but based on their evolutionary
descent or phylogeny or looking into and aligning organisms into their common ancestor. Phylogeny
is represented by a phylogenetic tree.

This Phot o by Unknown Author is licensed unde r CC B Y -S A

Source:http://media.opencurriculum.org/articles_manual/ck12_biology/phylogenetic -classification/2.png

Figure 1. Phylogenetic tree

In figure 1, species 1, 2, and 3 have a common ancestor. As the tree branches, species three was
separated from species 1 and 2 since it has a different characteristic which means, species 1 and 2
share the same common ancestor.
One way of classifying organisms showing phylogeny is through cladistics, the “biological
classification system that involves the categorization of organisms based on shared traits” (BD
Editors, 2017). This was introduced by Willi Hennig. The term cladistics comes from word clade
which “refers to the group of organisms that includes an ancestor species and all of its descendants”
(Cladistics-Advanced, 2016). This is being presented through a diagram called as cladogram.
Derived characters (characteristics that appear in recent parts of a lineage but not in its older
members) can be used to construct a cladogram, a diagram that show the evolutionary relationships
among a group of organisms. Cladograms are useful tools that help scientists understand how one
lineage branched from another in the course of evolution. Just as a family tree shows the relationship
among different lineages within a family, a cladogram represents a type of evolutionary tree, showing
evolutionary relationships among group of organisms (Miller and Levine, 2002).
 Sister group
outgroup

nodes nodes
branches
root root
This Phot o by Unknown Author is licensed unde r CC B Y - S A
Source : https://upload.wikimedia.org/wikipedia/co mmons/thumb/1/1b/Identical_cladograms.svg/1200p x - Identical_cladograms.svg.pn g (photo modified)

Figure 2. Parts of a Cladogram

a. Root – This is the common ancestor of all the organism and the starting point of all
cladograms.
b. Branches – These are lines that connect all the parts in a cladogram.
• In some instances, the length of the branch represents the extent of relationship among
different taxa (Sapkuta, 2020).
c. Node – This refers to the hypothetical ancestor which gives rise to two or more daughter
taxa. It is also the diverging area in a clade where organisms diverge into different groups.
d. Outgroup – These are organisms mostly not related to the group in a cladogram.
• It serves as the point of reference for the rest of the cladogram.
e. Sister group – closest relatives in the cladogram
f. Ingroup – groups of related taxa

Constructing a Cladogram
Let’s construct a cladogram based on the given activity under what’s new.
We can construct a cladogram either with the use of the organisms’ morphological structure
or its molecular character. Let’s take a look at how these two are being used.

A. MORPHOLOGICAL STRUCTURE
1. Determine the defined characters to be used.

Derived Characters in Organisms

Organism Derived Character

backbone legs hair

Earthworm X X X
Tilapia ✓ X X
Lizard ✓ ✓ X
Human ✓ ✓ ✓
In here, our derived characters are the backbone, legs, and hair.
Note: Derived characters are not influenced by environmental factors. It should be derived or
primitive.

2. Classify the identified organisms according to their shared characters/Group the taxon by
synapomorphies (shared characteristics).

Group the organisms belonging to each identified character. You may use a Venn diagram in
grouping the organisms. In grouping the organisms, start with the character common in all organisms
and place them outside.
 •tilapia
backbone •lizard
•human
•lizard
legs
•human

hair •human

In our grouping above, we can see here that the most common character among the given
organisms is the backbone and the least is the hair.

3. Construct the cladogram.

In constructing cladograms, we follow these steps.

a. Identify the organism having the fewest identified character (outgroup).

b. Identify the 2nd to the last organism having the fewest identified character
and present the character that differentiates it from other groups. Do the same steps
for the succeeding organisms until the last one.

hair

legs

backbone

When we look at the cladogram, we can interpret it as follows.

a. Earthworm is not related to any of the other organisms as it does not have a backbone, legs, and
hair.
b. Lizard is more closely related to the human than the tilapia and the human.
c. As we go to the right of the diagram, the organisms are becoming less related to each other.
d. It can be inferred that the earthworm came first, followed by the tilapia, lizard, and the human in
the process of evolution.
e. It is likely that the backbone evolved first, then the legs, and the hair in the process of evolution.

The morphological differences also have its own limitation since some organisms have
undergone adaptive radiation (organisms have very different feature, e.g., pentadactyl limb) and
convergent evolution (organisms have very similar features, e.g., wings in birds, bats, and insects).

B. MOLECULAR CHARACTERS
The DNA sequence or protein sequence (amino acid) can be used to construct a cladogram.
Using the morphological structures of organisms are not enough to prove their evolutionary
relationships. Using DNA and amino acid sequences are of importance to validate them.

Let us assume that the following are the DNA sequence of the given organisms.
earthworm CTTATCGACCCGTTTATCCTACATTCCCGTCTACCTTCGT
cat TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT
lizard CTAATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT
dolphin CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAG
a. Align the DNA sequences together.
b. Afterwhich, compare the 2 sequences together like earthworm and cat, to be followed by
earthworm and lizard, earthworm and dolphin, and so on.
Count the number of different sequences and place them on the table. In the case of the
earthworm and the cat, they have 12 different sequences as presented below.
C TT G AC C C G TTT TC C T ATTC C C G TC T C TT C G T
ATC A AC AC
TT C C C C C G TTT TC C T T TTC C C AT C T TA G T
AATC A AC AC A
c. Let us do the same with the others and complete the table.
earthworm cat lizard dolphin
earthworm 12 9 13
cat 4 3
lizard 5
dolphin
d. Identify the organisms with the fewest differences between them. In
cat
this case, we have the cat and dolphin. This means that they are
closely related.
dolphin
e. Draw the first groupings to show their evolutionary relationship.

f. Determine the average difference of sequence between cat and earthworm (12 differences) and
dolphin and earthworm (13 differences). It has a total of 25. Divide it by two, we get 12.5. Let us
complete the table following the same step.
Cat/ dolphin earthworm lizard
Cat/ dolphin 12.5 4.5
earthworm 9
lizard

g. Repeat step d. In this case we have the cat/dolphin and lizard.

h. We therefore add lizard in our cladogram cat

dolphin

lizard
With the remaining organism, we will add it into the cladogram to complete it.
cat

dolphin

lizard
earthworm

In the cladogram, we can say that, the cat and dolphin are closely related to each other but
not that much to the lizard. Also, the earthworm is the least closely related to the other 3 organisms.
Using DNA, RNA and amino acids are very important in classifying organisms and in determining
evolutionary relationships. If two organisms have almost the same amino acid sequence or DNA
sequence, this would imply that they may share a common ancestor. At times, when scientists are
comparing molecular sequences, they may use a non-coding DNA , gene sequences or amino acid
sequences. The non-coding DNA has the best means of comparison since mutation will occur more
readily in these sequences.
 Amino acid sequences are usually being used to compare distantly related species while DNA or
RNA base sequences are being used to compare closely related organisms (“Molecular Evidence”,
n.d.).
Comparing DNAs can also be used to determine the time when a certain species evolved. The
method being used is called the molecular clock. It also relies on a repeating process to mark time –
mutation since some genes or protein sequences may undergo mutation at a relative constant rate.
Using this method now can help biologists estimate how long the species have been separated.

Figure 3. Molecular Clock

This Photo by Unknown Author is licensed under CC BY-SA-NC

http://www.practicallyscience.com/wp-content/uploads/2015/08/FIG01-evolutions-molecular-
clock-v20-op.jpg
The molecular clocks present the “model organisms” and their change in DNA using non-coding
DNA, protein DNA, and ribosomal “RNA” DNA. The genetic differences between the organisms and
us, humans are almost proportional to the amount of time that passed since our “last common
ancestor”.

a. Non-coding DNA = also known as neutral DNA, changes the fastest and can be used to date
the last common ancestors from 1-100 million years ago
b. Protein DNA = it changes 10x slower than the neutral DNA and can be used to date the last
common ancestors for most of evolutionary history
c. Ribosomal RNA DNA = changes 100x slower than non-coding DNA and can be used to date
the most ancient last common ancestors all the way back to near the origin of life (“Models’
Organisms and DNA’s “Molecular Clock”, 2015).

In making cladograms showing hypothesis of ancestry and descent, analysis of characters is a must
and finding the relationship of these to other clades is important. Also, if there are many hypothesized
cladogram, choosing the best, means applying the concept of parsimony, that is choosing the simplest
one (with the least number of changes).

Why is there a need for phylogeny/cladistics?

1. useful in creating systems of classification

With the diverse species we have on Earth, there is a need to know the
relationship of organisms to be able to understand how they work.

2. use to predict the properties of organisms

Knowing the characteristics of organisms through cladistics is very important
since it provides information on how organisms will behave. Thus, providing
scientists, researchers, and others as to how we can utilize organisms to our
advantage, such as in the production of medicines, fighting diseases, improving
crop yields, and others.

3. helps elucidate mechanisms of evolution

Using cladistics would help clear things on how organisms evolve over time,
how often do they change, and others. It's possible also to compare existing
organisms with the previous ones to look for explanations on the extinction of
species and to look for their diversity as well.
 4. understanding the evolution and transmission of diseases
The best way for our medical practitioners to understand how certain disease-
causing organisms work, there is a need to know more about the organisms through
their evolutionary characteristics.

5. helps in the conservation of species

Knowing the evolutionary relationship of species would help in the protection
of the whole phylogenetic tree avoiding now extinction ofspecies.

In the Philippines, research studies on molecular phylogeny are being conducted on several species
such as the Rafflesia, ayungin (Philippine Tigerperches or silver perch), and Philippine freshwater
eels.