A two-color acid-free cartilage and bone stain

for zebrafish larvae

MB Walker1, CB Kimmel2
1
Stowers Institute for Medical Research, Kansas City, Missouri and 2University of Oregon, Eugene, Oregon

Submitted July 11, 2006; revised December 1, 2006; accepted December 5, 2006

Abstract
Traditionally, cartilage is stained by alcian blue using acidic conditions to differentiate tissue
staining. The acidic conditions are problematic when one wishes to stain the same specimen for
Biotech Histochem Downloaded from informahealthcare.com by Brown University on 03/20/13

mineralized bone with alizarin red, because acid demineralizes bone, which negatively affects
bone staining. We have developed an acid-free method to stain cartilage and bone simultaneously
in zebrafish larvae. This method has the additional advantage that PCR genotyping of stained
specimens is possible.

Key words: alcian blue, alizarin red, PCR genotyping

The traditional two-color stain of Dingerkus and has been used for staining histological specimens
For personal use only.

Uhler (1977) can readily detect the dense miner-
alized bone matrix in adult fish. On the other hand,
mineralized bone matrix is very thin and delicate in
newly forming bones in young larvae of zebrafish
and other small fish, and is exceedingly difficult to
detect using the traditional two color alcian blue
and alizarin red stain. The difficulty arises because
alizarin red binding depends on mineralization of
the bone matrix and the acid traditionally used in
alcian blue protocols decalcifies the matrix by
dissolving hydroxyapatite. Alcian blue is a posi-
tively charged dye that is thought to stain cartilage
through an electrostatic interaction with negatively
charged acidic mucopolysaccharides (Scott 1996).
Magnesium chloride, according to the principle of
critical electrolyte concentration (CEC), has been
used to differentiate alcian blue staining of muco-
substances (Scott and Dorling 1965). The principle
of this method is that different concentrations of
magnesium ions can be used to compete with
alcian blue for the negative charges of acidic
mucopolysaccharides to differentiate different
types of mucosubstances. While the CEC method
under mildly acidic conditions, it has not been
examined for staining intact larvae under acid-
free conditions (Kindblom and Angervall 1975,
Schofield et al. 1975, Mallinger et al. 1986). We
have tested concentrations of magnesium chloride
required to differentiate cartilage staining of intact
larvae and have developed an acid-free double stain
protocol suitable for staining cartilage and bones in
young fish larvae. We also include acid-free mod-
ifications for staining adult zebrafish.
Materials and methods
Fish husbandry
Fish were raised under standard conditions at
28.58C (Westerfield 1993, Kimmel et al. 1995).
Embryos were obtained from crosses between AB
wild-type adults and raised in E2 embryo media
with methylene blue added to inhibit fungal
growth (Brand 2002).
Acid-free double staining protocol

Address for correspondence: Dr. Macie B. Walker Stowers
Institute for Medical Research 1, 1000 E. 50th St., Kansas City,
MO 64110. Phone: 816-926-4105. E-mail: mwa@stowers-ins
titute.org
– Biological Stain Commission
Biotechnic & Histochemistry 2007, 82(1): 23
28.
In our acid-free double stain, MgCl2 is used in
place of acid to differentiate cartilage staining.
We tested MgCl2 concentrations in the range of
0
200 mM and our staining was performed as
described below.

DOI:10.1080/10520290701333558 23
 Preparation of acid-free double stain solution
An acid-free double stain solution was made in two
parts that are mixed together just prior to staining.
Part A includes alcian blue 8 GX (C.I. 58005, Sigma,
St. Louis, MO) for cartilage staining and Part B
includes alizarin red S (C.I. 74240, Sigma) for bone
staining. The final concentrations for Part A are
0.02% alcian blue, 0
200 mM MgCl2, and 70%
ethanol. Part A was made by first making a stock
of 0.4% alcian blue in 70% ethanol. Because alcian
blue is not readily soluble in 70% ethanol, we
added the powder to a smaller volume of 50%
ethanol, incubated at 378 C and occasionally mixed
to dissolve; 95% ethanol and water then were
added to obtain final concentrations. One hundred
Biotech Histochem Downloaded from informahealthcare.com by Brown University on 03/20/13
milliliters of Part A was made by adding together
5 ml 0.4% alcian blue in 70% ethanol, 70 ml 95%
ethanol, and MgCl2 and water to obtain final
concentrations. Part B is 0.5% alizarin red S powder
dissolved in water. Parts A and B can be stored at
room temperature for several months up to a year.
An acid-free double stain solution containing 10 ml
of Part B and 1 ml of Part A was mixed just prior to
staining.
For personal use only.
Tissue fixation
At 6.5 days postfertilization (dpf), larvae were
anesthetized with tricaine, and up to 100 larvae
were collected in a single 1.5 ml tube (Westerfield
1993). E2 embryo medium was removed and 1 ml
4% paraformaldehyde (PFA) in phosphate buffered
saline (PBS) was added to fix tissues (Maniatis et al.
1989). After rocking at room temperature for 2 h,
the fixative was removed and larvae were washed
and dehydrated with 1 ml 50% ethanol, with rock-
ing, at room temperature for 10 min.
Staining
After removing the 50% ethanol, 1 ml of acid-free
double stain solution was added to larvae and
rocked at room temperature overnight.
Bleaching
Bleach was used to remove pigmentation. Bleach
solution was made by mixing just before use equal
volumes of 3% H2O2 and 2% KOH to give final
concentration of 1.5% H202 and 1% KOH. After
removing the stain solution, 1 ml water was added,
mixed by inversion, and removed. One milliliter of
bleach solution was added and the tubes sat with
lids open at room temperature for 20 min.
Clearing
Tissues were cleared with successive changes of a
solution of glycerol and KOH. After removing the
24 Biotechnic & Histochemistry 2007, 82(1): 23
28
bleach, 1 ml of a solution of 20% glycerol and 0.25%
KOH was added and rocked at room temperature
for 30 min to overnight. This solution was replaced
by 1 ml 50% glycerol and 0.25% KOH and rocked at
room temperature for 2 h to overnight. Larvae were
viewed in the same solution under a Leica dissect-
ing microscope.
Storage
Larvae were stored in a solution of 50% glycerol
and 0.1% KOH at 48 C and photographed with
either a Zeiss Axiophot or a Leica dissecting
microscope with digital camera attached.
Low acid double staining protocol
We also stained 6.5 dpf larvae with a low acid
double stain for comparison with our acid-free
staining protocol. A low acid double stain com-
monly is used to stain cartilage and bone in mouse
embryos. ‘‘Low acid’’ refers to the concentration of
acetic acid in the staining solution. In a low acid
double stain, 5% acetic acid is used rather than the
traditional 20% acetic acid. Our adaptation of the
low acid double stain for zebrafish larvae is
described below.
Preparation of low acid double stain solution
One hundred milliliters of low acid stain solution
was made by mixing 5 ml 0.4% alcian blue in 70%
ethanol, 5 ml glacial acidic acid, 70 ml 95% ethanol,
and 20 ml water. A low acid double stain solution
was made by mixing 10 ml 0.5% alizarin red S and
1 ml low acid stain solution just prior to staining.
Tissue fixation, staining, bleaching, clearing
and storage
Tissue fixation, staining, bleaching, clearing and
storage are performed as described in the acid-free
stain protocol with the following exception: we
reduced the concentration of the bleach to final
concentrations of 0.75% H2O2 and 0.5% KOH,
because acid-stained tissues did not hold up well
with stronger bleaching.
Polymerase chain reaction (PCR) protocol
Because DNA is not stable with storage, we sorted
larvae according to their skeletal phenotypes as
soon as possible after staining and collected whole
samples for genotyping. Samples were rinsed in
PBSTw (PBS with the addition of 0.1% Tween 20)
and placed in a PCR tube. The addition of Tween 20
reduces the stickiness of the larvae, but also
removes bone stain. Excess liquid was removed
 and samples were digested with proteinase K using
standard protocols (Westerfield 1993). We used 1 ml
of digest in a 20 ml PCR reaction and analyzed PCR
products by gel electrophoresis.
Results
MgCl2 differentiates alcian blue staining in
zebrafish larvae
We tested 0
200 mM MgCl2 concentrations for
the ability to differentiate alcian blue staining in
zebrafish larvae in an acid-free double stain.
Typical acid-free double stained larvae are shown
in Fig. 1. We found 20
60 mM MgCl2 concentra-
Biotech Histochem Downloaded from informahealthcare.com by Brown University on 03/20/13
Acid-free double stain is a sensitive method for
detecting bones in zebrafish larvae
Flat mounts of typical acid-free and low acid
double stained larvae are shown in Fig. 2. Similar
cartilage elements are stained by both protocols,
but bone staining is greatly enhanced by the acid-
free method. For simplicity, cartilage elements are
labeled in blue and bone in red. In the acid-free
double stained larvae, bone staining is detected in
the neurocranium in the parasphenoid and occipi-
tal bones as well as the tip of the notochord
(Fig. 2A). In the pharyngeal skeleton, the acid-free
method stains the opercle, branchiostegal rays,
entopterygoid, ceratobranchial 5 and cleithrum,

tions sufficient to differentiate tissues for alcian
blue staining. Higher concentrations of MgCl2
reduced cartilage staining, but did not negatively
affect bone staining.
For personal use only.
and variably detects the maxilla, dentary, and
hyomandibular and ceratohyal chondral bones
(Fig. 2B,C). The dentary at this stage is a thin
ossification overlying Meckel’s Cartilage. Bone

Fig. 1. Magnesium chlo-

ride differentiates alcian
blue staining in zebrafish
larvae without negatively
affecting alizarin red bone
staining. Concentrations
of MgCl2 were tested in
the range of 0
200 mM
(A
E) 20
60 mM MgCl2
was sufficient to differ-
entiate tissues in 6.5 dpf
larvae fixed for 2 h with
4% PFA in PBS. Aster-
isks in D, early forming
vertebrae.

Acid-free double skeletal stain 25

Biotech Histochem Downloaded from informahealthcare.com by Brown University on 03/20/13
For personal use only.

Fig. 2. Acid-free double staining is a sensitive method to detect bones in zebrafish larvae. Flat mounts of 6.5 dpf larvae
stained by acid-free (A
C) or low acid (D
F) double stain. Anterior is to the left. Dorsal view of the neurocranium (A,D).
Ventral view of the pharyngeal skeleton (B,E). Lateral view of the jaw and jaw support (C,F). Bones are labeled as
follows: PS, parasphenoid; OC, occipitals; NC, notochord; Max, maxilla; Den, dentary; EN, entopterygoid; BRs,
branchiostegal rays; OP, opercle; HMB, hyomandibular bone; CHB, ceratohyal bone; CB5, ceratobranchial 5. Cartilages
are labeled as follows: EP, ethmoid plate; TR, trabeculae; MC, Meckel’s Cartilage; PQ, palatoquadrate; HM,
hyomandibular region of the hyosymplectic cartilage; CH, ceratohyal cartilage.

staining also is detected in the axial skeleton
at positions where the anterior vertebrae form
(Fig. 1D). Very little bone staining is detected in
low acid double stained larvae (Fig. 2D
F).
PCR genotyping of tissues is possible after
acid-free staining
An important use of color skeletal staining with
zebrafish is to classify skeletal phenotypes in
mutational analyses (Walker 2006). It is extremely
useful in such studies to identify the screened
animals genotypically, as might be done with
PCR-based approaches; however, the acid in the
traditional protocols precludes preparation of un-
degraded DNA. To illustrate that PCR genotyping
is possible with tissues obtained from our acid-free
protocol, we PCR amplified DNA using primers
specific to the furinA gene (Walker 2006). PCR
products are detected from tissues processed by the

26 Biotechnic & Histochemistry 2007, 82(1): 23
28


Biotech Histochem Downloaded from informahealthcare.com by Brown University on 03/20/13
Fig. 3. PCR genotyping is possible after acid-free stain-
ing. FurinA DNA was amplified from unstained, acid-free
and low acid stained larvae using gene specific primers
(5?CTGTTGAGGTGATTCCTGAAGT3?/5?CTGTCCAATG
GATGGGCTGTG3?).
acid-free and low acid double stain protocols as
well as an unstained control (Fig. 3).
For personal use only.
Discussion
Our acid-free double staining protocol has several
advantages over traditional acid staining methods.
As a simultaneous cartilage and bone stain, it has
allowed us to expand our skeletal mutagenesis
screen to include new classes of skeletal mutants
that would not have been detectable with a
cartilage screen alone. Furthermore, our method
is advantageous for analysis of mutant facial
phenotypes and the generation of mapping panels,
because we do not have to bisect tissues into heads
and tails nor process the samples individually for
cartilage and PCR, respectively. In our acid-free
method, an entire batch of larvae can be stained
together, then individuals sorted by their skeletal
phenotypes for PCR genotyping.
The method used to fix tissue is critical for
obtaining optimal cartilage and bone staining
simultaneously. Fixation by paraformaldehyde af-
fects the amount of MgCl2 required to differentiate
the cartilage stain and is required for optimal
cartilage staining and storage of specimens. On
the other hand, paraformaldehyde fixation nega-
tively affects bone staining by alizarin red. We have
limited the fixation period to 2 h, because overnight
fixation results in significant reduction in bone
staining. It also is possible to fix tissues for 1 h in
2% PFA, rather than 4% PFA for 2 h, to optimize
bone staining, but storage of samples is compro-
mised somewhat with this lighter fixation. With
lighter fixation, a lower MgCl2 concentration
(10
20 mM) is needed for alcian blue staining.
We also have tested fixing larvae in 95% ethanol
rather than paraformaldehyde. With ethanol fixa-
tion, the bones stain very well with alizarin red, but
the cartilage stains only lightly with alcian blue,
and storage of samples is greatly compromised.
It is possible to combine our acid-free staining
protocol with other staining protocols, but mod-
ifications may be needed, as we have observed in
combination with alizarin red vital staining. Ali-
zarin red, used as a vital stain in live zebrafish
larvae, is a very sensitive method for detecting bone
(Kimmel et al. 2003, 2005). In this method, alizarin
red stained bone fluoresces bright red, producing
beautiful images of bones by z series confocal
analysis, but under white light the bone is only
lightly stained. Subsequent fixation of larvae for the
acid-free double stain quenches the bone fluores-
cence, but enables one to view both cartilage and
bone stained under white light. In this combination
of staining techniques, it is advantageous to sepa-
rate the one step stain into a two step protocol by
first staining overnight with alcian blue, rinsing
briefly with water to remove excess stain, then
staining with alizarin red in 70% ethanol for 1 h.
The advantage of the two step protocol is that
alcian blue tends to precipitate in the presence of
both MgCl2 and alizarin red, and this precipitation
could cause staining problems in certain situations.
Another application in which it is advantageous
to separate alcian blue and alizarin red staining is
in cases of larger specimens such as adult zebra-
fish. With larger amounts of tissue, the one-step
method does not always stain the bones uniformly.
Larger tissues also require different processing
times and other modifications. Our acid-free mod-
ifications to the traditional two-color stain for adult
zebrafish described in van Eeden et al. (1996) are as
follows: fix overnight with 2% PFA in PBS, replace
the alcian blue stain used in the traditional protocol
with the acid-free alcian blue stain (Part A only),
and include 25
60 mM MgCl2 in the alcian blue
stain and ethanol washes. It also is advantageous to
add a small amount of glycerol (10% final concen-
tration) to the alizarin red staining solution to aid
subsequent destaining of tissues.
Acknowledgments
We thank Bonnie Ullmann for technical assistance.
Research support was provided by NIH grants
Acid-free double skeletal stain 27
 DE13834, HD22486 and NIH training grant
GM07413.
References
Brand M, Granato M, Nusslein-Volhard C (2002).
Keeping and raising zebrafish. In: Zebrafish, a Practical
Approach , Hames BD, Ed. Oxford University Press.
Oxford. pp. 7
37
Dingerkus G, Uhler LD (1977) Enzyme clearing of alcian
blue stained whole small vertebrates for demonstration
of cartilage. Stain Technol. 52: 229
232.
Kimmel CB, Ballard WW, Kimmel SR, Ullmann B,
Schilling TF (1995) Stages of embryonic development of
the zebrafish. Dev. Dyn. 203: 253
310.
Kimmel CB, Ullmann B, Walker C, Wilson C, Currey M,
Phillips PC, Bell MA, Postlethwait JH, Cresko WA
Biotech Histochem Downloaded from informahealthcare.com by Brown University on 03/20/13
(2005) Evolution and development of facial bone mor-
phology in threespine sticklebacks. Proc. Natl Acad. Sci.
USA 102: 5791
5796.
Kimmel CB, Ullmann B, Walker M, Miller CT, Crump
JG (2003) Endothelin 1-mediated regulation of pharyn-
geal bone development in zebrafish. Development 130:
1339
1351.
Kindblom LG, Angervall L (1975) Histochemical char-
acterization of mucosubstances in bone and soft tissue-
tumors. Cancer 36: 985
994.
Mallinger R, Geleff S, Bock P (1986) Histochemistry of
For personal use only.
glycosaminoglycans in cartilage ground substance. Al-
28 Biotechnic & Histochemistry 2007, 82(1): 23
28
cian-blue staining and lectin-binding affinities in semi-
thin Epon sections. Histochemistry 85: 121
127.
Maniatis T, Fritsch EF, Sambrook J (1989). Molecular
Cloning: a Laboratory Manual . 2nd ed. Cold Spring Harbor
Laboratory. Cold Spring Harbor, NY. p. B12.
Schofield BH, Williams BR, Doty SB (1975) Alcian blue
staining of cartilage for electron microscopy. Application
of the critical electrolyte concentration principle. Histo-
chem. J. 7: 139
149.
Scott JE (1996) Alcian blue. Now you see it, now you
don’t. Eur. J. Oral Sci. 104: 2
9.
Scott J E, Dorling J (1965) Differential staining of acid
glycosaminoglycans (mucopolysaccharides) by alcian
blue in salt solutions. Histochemie 5: 221
233.
van Eeden FJ, Granato M, Schach U, Brand M,
Furutani-Seiki M, Haffter P, Hammerschmidt M, Hei-
senberg CP, Jiang YJ, Kane DA, Kelsh RN, Mullins MC,
Odenthal J, Warga RM, Allende ML, Weinberg ES,
Nusslein-Volhard C (1996) Mutations affecting somite
formation and patterning in the zebrafish, Danio rerio .
Development 123: 153
164.
Walker MB, Miller CT, Talbot JC, Stock DW, Kimmel
CB (2006) Zebrafish furin mutants reveal intricacies in
regulating Endothelin1 signaling in craniofacial pattern-
ing. Dev. Biol. 295: 194
205.
Westerfield M (1993). The Zebrafish Book: a Guide for the
Laboratory Use of Zebrafish ( Brachydanio rerio) . University
of Oregon Press. Eugene, OR. pp. 1.1, 9.7, 10.16.