Professional Documents
Culture Documents
Impaired Renal HCO3 Excretion in Cystic Fibrosis.12
Impaired Renal HCO3 Excretion in Cystic Fibrosis.12
org
1
Department of Biomedicine, Physiology and Biophysics, Aarhus University, Aarhus, Denmark
2
Department of Infectious Diseases, Aarhus University Hospital, Aarhus, Denmark
3
Department of Physiology, University of Regensburg, Regensburg, Germany
ABSTRACT
Background Patients with cystic fibrosis (CF) do not respond with increased urinary HCO32 excretion after
stimulation with secretin and often present with metabolic alkalosis.
Methods By combining RT-PCR, immunohistochemistry, isolated tubule perfusion, in vitro cell studies, and
in vivo studies in different mouse models, we elucidated the mechanism of secretin-induced urinary
HCO32 excretion. For CF patients and CF mice, we developed a HCO3- drinking test to assess the role
of the cystic fibrosis transmembrane conductance regulator (CFTR) in urinary HCO3-excretion and applied
it in the patients before and after treatment with the novel CFTR modulator drug, lumacaftor-ivacaftor.
Results b-Intercalated cells express basolateral secretin receptors and apical CFTR and pendrin. In vivo
application of secretin induced a marked urinary alkalization, an effect absent in mice lacking pendrin or
CFTR. In perfused cortical collecting ducts, secretin stimulated pendrin-dependent Cl2/HCO32 exchange.
In collecting ducts in CFTR knockout mice, baseline pendrin activity was significantly lower and not re-
sponsive to secretin. Notably, patients with CF (F508del/F508del) and CF mice showed a greatly atten-
uated or absent urinary HCO32-excreting ability. In patients, treatment with the CFTR modulator drug
lumacaftor-ivacaftor increased the renal ability to excrete HCO32.
Conclusions These results define the mechanism of secretin-induced urinary HCO32 excretion, explain
metabolic alkalosis in patients with CF, and suggest feasibility of an in vivo human CF urine test to validate
drug efficacy.
In 1902, Bayliss and Starling1 discovered the first The results were only published in abstract format
hormone secretin and therewith established the but conveyed the remarkable finding that secretin
hormone concept of organ function regulation. elicits clear increases in urinary HCO32 excretion in
Today, the action of secretin is well understood in normal test persons, an effect that was completely
gastrointestinal physiology, where it acts as the
main activator of exocrine pancreatic bicarbonate
(HCO32) secretion.2 Secretin has also been report- Received January 13, 2020. Accepted April 13, 2020.
ed to elicit other physiologic effects, e.g., in the car-
K.K. and J.L. shared senior authorship.
diovascular system.3–5 Its key physiologic role in
the activation of pancreatic HCO32-rich fluid se- P.B. and S.L.S. shared first authorship.
cretion was used to study exocrine pancreas insuf- Published online ahead of print. Publication date available at
ficiency in patients with cystic fibrosis (CF).6 This www.jasn.org.
has contributed substantially to defining a major Correspondence: Prof. Jens Leipziger, Department of Biomedicine,
gastrointestinal phenotype in CF. At that time, re- Physiology, Aarhus University, Høegh-Guldbergsgade 10, Bldg.
1115, 8000 Aarhus C, Denmark. Email: leip@biomed.au.dk
searchers also collected urine samples in secretin-
treated children with CF and healthy controls. Copyright © 2020 by the American Society of Nephrology
substantial secretin receptor (SCTR) mRNA expression is pre- tion with secretin and often present with metabolic alkalosis. Based
sent in rat connecting tubules (CNTs) and cortical collecting on studies with several knockout (KO) mouse models, patients with
ducts (CCDs). 1 2 Moreover, cell type–specific RNA- CF, and cell studies, this paper defines the role of CFTR in renal
sequencing data from rat CNTs/CCDs show that SCTR HCO3- excretion. Secretin-induced renal HCO3- excretion occurs in
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 04/27/2023
(Eppendorf). Supernatant was aspirated, 1 ml fresh incubation 5.5% nonidet P-40, 5% glycerol, 1 mM EDTA, and 1% protease
solution was added, and incubation was continued in 5-minute inhibitor mixture (Roche, Mannheim, Germany). Proteins
intervals, with removal of tubule-containing supernatant in were separated by 7% SDS-PAGE and transferred to a polyvi-
between. Tubules were washed twice in incubation solution nylidene difluoride membrane (GE Healthcare Europe GmbH,
with 0.5 mg/ml albumin (sorting solution) and put on ice. Munich, Germany) using a wet transfer unit (Bio-Rad). Mem-
Downloaded from http://journals.lww.com/jasn by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW
Tubules were sorted to yield proximal tubule (PT), thick ascend- branes were incubated with primary rabbit anti-pendrin IgG
ing limb (TAL), distal convoluted tubule (DCT), CNT/CCD, (generous gift from Carsten Wagner, University of Zurich22)
and medullary collecting duct (MCD) samples according to and rabbit anti–b-actin (1:10,000, A2066; Sigma-Aldrich).
their appearance in phase-contrast microscopy, as published Proteins were visualized using horseradish peroxidase–
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 04/27/2023
previously.21 PTs were long and highly convoluted with a conjugated secondary antibody and enhanced chemilumines-
smooth appearance; TALs were long, thin, and straight with cence detection, and analyzed using ImageJ.
a smooth appearance; DCTs and CNT/CCDs were identified
together by the branching points where separate CNTs merge Immunohistochemistry
and by a composite appearance, resulting from the presence of Mouse kidneys were fixed by perfusion with 4% paraformal-
intercalated cells. The transition between DCT and CNT/CCD dehyde and postfixed in 0.5 mol/L sucrose and 4% parafor-
was apparent as an abrupt change in diameter and transition maldehyde solution. Cryosections of 5 mm were incubated in
from slightly convoluted to straight tubule, and DCTs were cut 0.1% SDS for 5 minutes, washed with PBS, and blocked with
from the CNTs/CCDs at this transition. MCDs were identified 5% BSA and 0.04% Triton X-100 in PBS for 30 minutes. Sec-
as long, straight segments with the composite appearance tions were incubated with primary antibodies against CFTR
caused by intercalated cells, connected to CNT/CCD branch- (rabbit IgG, ACL-006; Alomone Labs), SCTR (rabbit IgG;
ing points at the proximal part and with a progressive narrow- epitope, AA 170–220; bs-0089R; Bioss, Woburn, MA), and
ing toward the distal part. A total of 25 PT, 75 TAL, 50 DCT, pendrin E-20 (goat IgG; Santa Cruz Biotechnology) in 0.5%
50 CNT/CCD, and 50 MCD segments were gathered per sample. BSA and 0.04% Triton X-100 overnight at 4°C, and with anti-rabbit
In unpublished experiments by M. Bleich and N. Himmerkus Alexa Fluor 488 IgG or anti-goat Alexa Fluor 546 (Invitrogen) for
(University of Kiel, Germany), tubules gathered in this ratio 1 hour at 37°C. Sections were counterstained with HOE33342
produced comparable actin band densities in Western blots. (Sigma-Aldrich). Immunofluorescence was detected using an
mRNA was isolated from tubule samples with RNeasy Micro Axio Observer microscope equipped with ApoTome.2 and
Kits (Qiagen), cDNA was generated with Superscript III (Invitro- ZEN 2.6 (Zeiss, Oberkochen, Germany).
gen, Darmstadt, Germany) and Superase (Invitrogen). End-point FRT cells grown on glass coverslips were fixed with 4%
RT-PCR was performed with HOT FIREPol DNA polymerase paraformaldehyde. After washing, the cells were permeabi-
(Solis Biodyne, Tartu, Estonia) and primers against SCTR (for- lized with 0.3% (v/v, PBS) Triton X-100 and blocked with
ward, CTCCAACGCTTCCATCTGGT; reverse, GAACTTCCA 5% (w/v, PBS) BSA for 1 hour at 37°C. The cells were incubated
GCTGCACCTCA) and CFTR (forward, GGGACGAGCCAA overnight with primary antibodies (1:100) against rabbit anti-
AAGCATTG; reverse, CTCCAGAAAAAGCATCGCCG). PCR CFTR (rabbit IgG, ACL-006) and anti-pendrin (rabbit IgG,
products were run on 2% agarose gels for 20 minutes at 150 V NBP1-60106; Novus Biologicals). Binding of the primary an-
on ice; bands were sequenced to verify amplification of the tibody was visualized by incubation with appropriate second-
correct targets. ary antibodies conjugated with Alexa Fluor 488 or Alexa Fluor
546 (1:300, Molecular Probes; Invitrogen). Nuclei were stained
Pendrin mRNA Knockdown in Fischer Rat Thyroid Cells with HOE33342 (0.1 g/ml PBS; AppliChem, Darmstadt, Germany).
Fischer rat thyroid (FRT) epithelial cells, stably coexpressing Glass coverslips were mounted on glass slides with fluorescent
human CFTR and F508del (FRT-F508del) were used (gener- mounting medium (DakoCytomation, Hamburg, Germany)
ously supplied by L. J. Galietta from the Telethon Institute of and examined with an Axio Observer microscope equipped
Genetics and Medicine, Pozzuoli, Italy). Cells were cultured in with ApoTome.2 and ZEN 2.6.
F-12 Coon media (Sigma-Aldrich) with 10% FBS, 600 mg/ml
zeocin (Invitrogen), 800 mg/ml G418 (Sigma-Aldrich), and In Vivo Urine pH Measurements
penicillin-streptomycin (Gibco) at 37°C in a humidified incu- Anesthesia was introduced with an intraperitoneal (i.p.) injec-
bator in 5% (v/v) carbon dioxide (CO2). Cells were transfected tion of 10 ml/g body wt of a ketamine-xylazine mix (10 mg/ml
with small interfering RNA (siRNA) for Slc26a4 (59-GGAAAU ketamine and 1 mg/ml xylazine). An intravenous access was
UGAGAUUCAAGUGtt, Silencer, Ambion; Life Technologies, obtained by cannulation of one tail vein and the mice were kept
Darmstadt, Germany) using Lipofectamine 3000 (Thermo under anesthesia by a continuous rate infusion corresponding
Fisher Scientific) and investigated after 72 hours. to half of the induction dose per hour (on average, 125 ml 0.9%
saline per hour) via a syringe pump (Model 33 Twin Syringe
Western Blotting Pump; Harvard Apparatus). Mice were placed on a water-
Protein was isolated from cells using a sample buffer containing heated plate (37°C). Bladder catheterization was introduced
25 mM Tris-hydrochloride, 150 mM NaCl, 100 mM dithiothreitol, and urine was collected every 5 minutes. Urinary pH (pHu)
was measured continuously throughout the experiment by cells. Tubules were perfused with a Na1-free solution to bypass
placement of a micro pH electrode (pH-200; Unisense, Aarhus, any possible effects of the Na1-dependent Cl2/HCO32 ex-
Denmark) and a reference electrode placed into the outflow of changer SLC4A827 on the Cl2 removal maneuver. The luminal
the catheter . Following a 30 minute control period, mice were fluid was then accordingly switched to a Cl2- and Na1-free
i.p. injected with 100 ml saline containing either secretin solution following the described Cl2 removal maneuver. To
Downloaded from http://journals.lww.com/jasn by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW
(400 pg/g body wt) or just saline. assess pendrin activity, we performed a maneuver previously
described.28–30 In short, luminal Cl2 was removed, which re-
Urine HCO32 Concentration Measurements verses the direction of pendrin-driven HCO32/Cl2 exchange,
The urine was collected and pooled in 30-minute intervals, leading to cellular HCO32 uptake. This increases intracellular
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 04/27/2023
allowing measurement of mean HCO 3 2 concentration [HCO32] and subsequently pH. The initial alkalization rate
([HCO32]) in the time periods 0–30, 30–60, and 60–90 minutes. reflects pendrin activity. Experimental solutions were as fol-
In a few experiments with too low urine output, urine was pooled lows: The control contained 118mM NaCl, 1 mM MgSO4,
to allow analysis of [HCO32] before and after secretin appli- 1.3 mM Ca-gluconate, 5 mM D-glucose, 0.4 mM KH2PO4,
cation (0–30 minutes and 30–90 minutes). Measurements were 1.6 mM K2HPO4, 25 mM NaHCO3, and 5 mM HEPES. The
performed by a Corning 960 analyzer23 calibrated to small vol- Na1-free solution contained 125 mM N-methyl-D-glucamine
ume samples in the pendrin mice series and by a custom-built (NMDG), 105 mM hydrochloride, 1 mM MgSO4, 1.3 mM
infrared CO2 sensor–based system in the rest of the experimen- Ca-gluconate, 5 mM D-glucose, 0.4 mM H2PO4, 1.6 mM
tal series.24 In urine samples from human participants, the K 2 HPO 4 , 24 mM choline-HCO 3 , and 5 mM HEPES.
same principle was applied, but the system was redesigned us- Cl 2 - and Na 1 -free solution contained 117 mM NMDG,
ing a GM70 Carbon Dioxide Meter (Vaisala, Helsinki, Finland) 89 mM D-gluconic acid, 1 mM MgSO4, 4 mM Ca-gluconate,
and 5 ml sample sizes. 5 mM D-glucose, 0.4 mM KH2PO4, 1.6 mM K2HPO4, 24 mM
choline-HCO3, and 5 mM HEPES. All solutions were titrated
Tubule Perfusion of the CCD to pH 7.40 and gassed at 37°C with 95% oxygen (O2)/5% CO2.
Mice were euthanized by cervical dislocation. The kidneys Calibration of the BCECF-AM signal was performed using
were removed, placed, and sliced in ice-cold (4°C) control nigericin in the presence of high potassium ion concentra-
solution (see below). The CCDs were isolated from the cortex tion.31 The calibration solution contained 95 mM potassium
with ultrafine forceps. The dissected CCDs were transferred to chloride, 15 mM NaCl, 0.4 mM NaH2PO4, 1.6 mM Na2HPO4,
a tissue chamber and perfused with a concentric pipette sys- 5 mM glucose, 1 mM magnesium chloride (MgCl2), 1.3 mM
tem25 with control solution at 37°C. CCDs were mechanically Ca-gluconate, 25 mM HEPES, and 20 mM NMDG, supple-
stabilized near the bath bottom with an additional holding pi- mented with 2 mM nigericin. The calibration solutions were
pette. The perfusion chamber was mounted on an inverted titrated to pH 6.5, 7.0, and 7.5 at 37°C.
fluorescence microscope (Axiovert 100 TV; Zeiss). The setup pHi measurements in FRT cells were performed in great
comprises an inverted microscope with a 633 C-Apochromat similarity to that described above. Cells were incubated in
1.2NA water objective, a monochromator (Polychrome IV; Till ringer solution containing 145 mM NaCl, 0.4 mM KH2PO4,
Photonics, Planegg, Germany) and a charge-coupled device 1.6 mM K2HPO4, 5 mM glucose, 1 mM MgCl2, 1.3 mM Ca-
camera (MicroMax, 5 MHz; Princeton Instruments, Trenton, gluconate, and 5 mM probenecid, supplemented with 1 mM
NJ). Image acquisition and data analysis were performed with BCECF-AM and 0.01% pluronic (Life Technologies) for
Metamorph/Metafluor (Universal Imaging, West Chester, PA). 60 minutes at room temperature. For pHi measurements,
cells were mounted in a cell chamber and perfused with
Intracellular pH Measurements HCO32 /CO2 buffered solution containing 120 mM NaCl,
Intracellular pH (pHi) was measured with the ratiometric fluores- 0.4 mM KH 2PO4, 1.6 mM K2HPO4, 5 mM glucose, 1 mM
cent dye 29,79-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein, MgSO4, 1.5 mM Ca-gluconate, and 25 mM NaHCO3 gassed
acetoxymethyl ester (BCECF-AM; Invitrogen). CCDs were in- with 95% O2/5% CO2. Pendrin activity was measured by
cubated with 2 mM luminal BCECF-AM in control solution for the initial slope of pH i increase after applying Cl 2 -free
10 minutes at 37°C during continuous luminal and bath per- HCO32 /CO2-containing solution containing 115 mM Na-
fusion. The pHi was measured every 2 seconds as the emission gluconate, 0.4 mM KH2PO4, 1.6 mM K2HPO4, 5 mM glucose,
ratio at 490 nm/436 nm excitation. The excitation duration was 1 mM MgSO4, 8 mM Ca-gluconate, and 30 mM NaHCO3
10 milliseconds at 436 nm and 25 milliseconds at 490 nm, and a gassed with 95% O2/5% CO2. For pHi calibration, cells were
binning factor of four was used for image storage. A 500 nm superfused with a buffer of pH 6.5, 7.5, and 8.5 containing
beam splitter and a 520–560 nm band pass filter were used to 105 mM potassium chloride, 1 mM MgCl2, 30 mM HEPES,
collect the emitted light. Luminal BCECF-AM loading in CCDs supplemented with 5 mM nigericin. Very similar optical pa-
led to selective dye loading into the intercalated cells.26 The rameters and the same analyzing software was used as de-
experiments were carried out after a stable, sound fluorescence scribed above with a high-speed polychromator system
signal was achieved and the fluorescence of the entire tubule and a CoolSnap HQ camera (Visitron Systems, Puchheim,
was recorded and used for data analysis of single intercalated Germany).
CFTR is expressed in the CCD, which was reported to be pri- saline volume (100 ml) containing either 400 pg/g body wt
marily expressed in b-ICs.32 secretin or saline. A photographic image of the setup is shown
We next performed immunohistochemistry to localize in Figure 2A. In Figure 2B, two original pHu traces are shown,
SCTR and CFTR in native mouse kidney. Basolateral SCTR one with injection of 400 pg/g body wt secretin and one with
staining was found in pendrin-positive cells and also in control. Within a few minutes after application of secretin,
Downloaded from http://journals.lww.com/jasn by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW
other cellular regions of CCD cells (Figure 1A). CFTR staining an acute and robust urinary alkalization occurred. Maximal
decorated the luminal membrane of pendrin-positive cells urine alkalization was observed between 20 and 30 minutes
(Figure 1, B and C). No CFTR staining was found in the cortex after secretin application. Subsequently, we studied the
of CFTR KO mice (Supplemental Figure 4). Control staining dose dependency of this secretin effect. An increase of
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 04/27/2023
without primary antibodies is shown in Supplemental pHu was observed with a dose of 4 pg/g body wt. Higher
Figure 5. These results show basolateral SCTR localization in doses of 40, 200, and 400 pg/g body wt secretin (i.p.) caused
b-ICs and CFTR localization in the same membrane domain increasing pHu alkalizations. At the highest used dose of 400
as pendrin. pg/g body wt, the peak pHu increase amounted to approxi-
mately 0.38 pH units (Figure 2C). In all ensuing experiments,
Secretin Induces an Acute Urinary Alkalization the dose of 400 pg/g body wt was used. These results show that
pHu in anesthetized pendrin WT mice was monitored for a secretin causes an acute and dose-dependent urinary
30-minute baseline period before i.p. application of an equal alkalization.
A B C
Pendrin + DAPI Pendrin + DAPI Pendrin + DAPI
50µm 20µm
50µm 20µm
50µm 20µm
Figure 1. The secretin receptor and CFTR is present in pendrin-positive cells in the cortex of WT mice. (A) Immunohistochemical
localization of pendrin (red, upper panel), the SCTR (green, middle panel), and double staining (lower panel) in the cortex of WT mice.
(B) Immunohistochemical localization of pendrin (red, upper panel), CFTR (green, middle panel), and double staining (lower panel) in
the cortex of WT mice. (C) Higher magnification of the indicated area in (B) showing apical colocalization of CFTR and pendrin in the
apical membrane. DAPI, 49,6-diamidino-2-phenylindole.
A B C
7.2 WT 0.8
Secretin 0.6
Downloaded from http://journals.lww.com/jasn by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW
7.0
ΔpHUrine
pHUrine
0.4
6.8
0.2
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 04/27/2023
6.6 0.0
0 30 60 90 4 40 200 400
Time (minutes) Secretin dose (pg/g BW)
Figure 2. Secretin stimulates acute urine alkalization in mice. (A) Photographic image of the in vivo experimental setup. (B) Two
original pHu traces are shown, indicating a prompt urine alkalization after application of 400 pg/g body wt (i.p.) secretin (red) and no
effect in the control injected mouse (black). (C) Dose response relationship of the secretin effect on pHu, (n54–7).
The Secretin-Induced Urine Alkalization Is Absent in CCD HCO32 secretion via this pathway. To study this directly,
Pendrin and CFTR KO Mice we used the isolated perfused CCD and pHi measurements of
We anticipated that pendrin and CFTR KO mice do not re- b-ICs. These cells can be identified after luminal loading with
spond to secretin with an acute urine alkalization. We studied BCECF-AM and rapidly removing luminal chloride in the pres-
the effect of secretin on pHu, urine [HCO32 ], and urine ence of luminal HCO32 (see Figure 4A and Methods section for
HCO32 excretion in six different mouse groups: pendrin, details). Fast removal of luminal Cl2 causes the reversal of the
CFTRG, and CFTRTS WT and KO mice. Figure 3, A–C, shows apical anion exchanger pendrin. In b-ICs, this leads to a
that secretin-treated WTanimals responded with a significant, pendrin-dependent33 cellular uptake of HCO32 and a marked in-
transient urinary alkalization compared with vehicle-treated tracellular alkalization (Figure 4, B and C).34 We therefore take the
animals. Secretin-treated WT mice had significantly higher initial alkalization rate after luminal Cl2 removal as the activity
urine [HCO32] compared with vehicle-treated mice (Figure 3, measure of the pendrin transport rate. First, we performed time
D–F). Urine HCO32 excretion rate was increased in secretin- control experiments, where the functional activity of pendrin was
treated WT mice as compared with those treated with vehicle tested twice as shown in Figure 4B. In these time control experi-
(Supplemental Figure 6). No significant secretin-induced in- ments, the second luminal zero Cl2 removal maneuver showed a
creases in pHu, urine [HCO32], or urinary HCO32 excretion slightly increased functional activity of pendrin (n55 tubules,
were observed in any KO mice models compared with vehicle- 5 mice, 25 cells; Figure 4, B and D). Thereafter, using the same
treated ones (Figure 3, A–F, Supplemental Figure 6). Both CFTR protocol, we tested the effect of basolateral secretin addition
KO mice models had significantly lower baseline urine [HCO32] (10 nM for 10 minutes). As shown in Figure 4C, secretin markedly
compared with WTmice (Figure 3, H and I). In pendrin KO mice, increased the initial intracellular alkalization rate, an effect that
secretin induced a urinary acidification starting after some 20 min- was significantly larger when compared with the time controls
utes postinjection (Figure 3A). A urinary acidification was absent (n55 tubules, 5 mice, 28 cells). In Figure 4D, the summary of all
in WT mice. A concurrent activation of hydrogen ion secretion experiments is shown. Interestingly, in CCDs isolated form
would cause an underestimation of the activated HCO32 excre- CFTRG KO mice, basal pendrin function was significantly lower
tion observed in WTs. These results illustrate the absolute pendrin (n510 tubules, 5 mice, 51–53 cells; Figure 4F) and could not be
and CFTR dependence of secretin-induced renal HCO32 excre- activated by secretin (n55 tubules, 5 mice, 23–28 cells; Figure 4E).
tion and that loss of CFTR causes lower resting urine [HCO32]. These results provide proof of principle that secretin directly stim-
An in-depth description of the results from the three different ulates b-IC–mediated HCO32 secretion. In the absence of CFTR,
mouse models can be found in the Supplemental Results. pendrin function is reduced and cannot be activated with secretin.
Secretin Stimulates HCO32 Secretion in b-ICs of the cAMP-Dependent Activation of Pendrin Requires
Isolated Perfused CCD Functional CFTR in the FRT Cell Model
The above evidence indicates that the action of secretin occurs To study the role of CFTR on pendrin function and expression,
via binding to the basolateral SCTR in b-ICs and activates we applied the FRT cell model.35 Heterologous expression of
A B C
7.5 Pendrin WT 7.5 CFTRG WT 7.5 CFTRTS WT
Secretin Secretin Secretin
7.0
7.0 7.0
pHUrine
pHUrine
pHUrine
6.5
Downloaded from http://journals.lww.com/jasn by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW
6.5 6.5
6.0
Secretin Secretin
7.0 Secretin
7.0 7.0
pHUrine
pHUrine
pHUrine
6.5
6.5 6.5
6.0
[HCO3-]U mmol/L
[HCO3-]U mmol/L
1.5
* 4
** 3
2 **
1.0 ***
2
1
0.5 1
0.0 0 0
4
1.5 2
3
1.0
2
1
0.5 1
0.0 0 0
30 60 90 30 60 90 30 60 90
Time (minutes) Time (minutes) Time (minutes)
pHUrine
pHUrine
6.5 6.5
6.5
6.0 6.0
5.5 6.0 5.5
4 2.5 * 1.5 **
[HCO3-]U mmol/L
[HCO3-]U mmol/L
[HCO3-]U mmol/L
3 2.0
1.0
1.5
2
1.0 0.5
1 0.5
0 0.0 0.0
WT KO WT KO WT KO
Figure 3. The secretin-stimulated urine alkalization is absent in mice lacking pendrin and dramatically reduced in global and tubule-
specific CFTR KO mice. (A–C) Summary pHu curves of control (black) and secretin-injected mice (400 pg/g body wt, i.p.; red) in
(A) pendrin WT and KO mice, (B) global CFTR (CFTRG) WT and KO mice, and (C) CFTRTS WT and KO mice. n56–7 in all experimental
series. Peak difference between vehicle- and secretin-treated mice was tested with t test. (D–F) Urine [HCO32] is significantly higher in
WT CFTR led to a marked upregulation of pendrin mRNA, and complete absence to increase pHu, urine [HCO32], and
protein expression, and apical staining, which were inhibitable HCO32 excretion in CFTR KO mice. In additional experi-
by siRNA for pendrin (Figure 5, A–D, Supplemental Figure 7). ments, mixed venous blood samples taken from anesthetized
In contrast, expression of mutated DF508 CFTR did not trigger mice 1 hour after the same oral NaHCO3 challenge showed
an increase of pendrin mRNA and protein expression or stain- that CFTR KOs displayed a significant increase of blood pH
ing. Functional testing of the apical Cl 2 /HCO32 activity and blood [HCO32], where WT animals did not (Supplemental
Downloaded from http://journals.lww.com/jasn by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW
showed relatively low intracellular alkalization rates in parental Figure 9, A and B). Similar experiments were performed in pen-
FRT cells with or without stimulation of IBMX/forskolin. In drin KOs that confirm their complete inability to acutely increase
cells that expressed WT CFTR, the cytosolic elevation of cAMP urine pH (Supplemental Figure 9, C–E). These results indicate
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 04/27/2023
with IBMX/forskolin triggered a marked activation of apical that intact CFTR and pendrin function is necessary to permit the
membrane Cl2/HCO32 activity, likely reporting augmented acute HCO32 excretion response in mice and likely reflect that
pendrin function (Figure 5, E and F). This increased functional both KO models have dysfunctional b-ICs.
activation could not be observed when FRT cells expressed
DF508 CFTR (Figure 5C). Blocking CFTR with inh172 preven- The CF Urine Test: Human Patients with CF Have a
ted the functional upregulation of Cl2/HCO32 activity in cells Markedly Reduced Ability To Excrete a Defined Oral
expressing WT CFTR (Figure 5C). Furthermore, siRNA knock- HCO32 Load and Show a Significant Improvement after
down of pendrin markedly reduced the IBMX/forskolin 4 weeks Treatment with Lumacoftor-Ivacaftor
induced Cl2/HCO32 activity (Figure 5G), indicating the ma- Intrigued by the above mouse data we questioned whether
jority of the Cl2/HCO32 exchange in this cell model is pendrin humans that suffer from CF may have a reduced ability to
dependent. These results indicate that WT CFTR facilitates excrete HCO32 with their urine. An HCO32 drinking test
functional and molecular expression of pendrin in the was developed. A schematic outline is shown in Supplemental
FRT cell model, aligning well with our data in the isolated Figure 3. Nine adult patients with CF who were homozygous
perfused CCD that showed reduced pendrin function when for the DF508 mutation, aged 20–45 years old and of both sexes,
CFTR is absent. were included in the study. The urine HCO32 excretion in fasting
participants was measured before and for 3 hours (hourly) after
Plasma Secretin Is Elevated in Mice Challenged with an the oral challenge. The control group consisted of similarly aged,
Acute Oral HCO32 Load healthy adult volunteers of both sexes. We found that patients with
In mice receiving a gavage load of 4 mmol NaHCO 3 /kg CF have a markedly lower baseline urine [HCO32] before the start
body wt, we measured a significantly higher plasma of the drinking test (Figure 7B). The oral NaHCO3 drinking test
[HCO 3 2 ] when compared with mice receiving a control led to a large increase in urine [HCO32] in control subjects and
gavage (26.760.42 versus 23.460.49 mM, P,0.001, n58–9; this increase was greatly reduced in the patients with CF, reaching
Figure 6B). Interestingly, significantly elevated plasma secretin only about 40% of the response in healthy volunteers (Figure 7D).
levels were measured in the HCO32-loaded mice as compared In addition, the cumulated HCO32 excretion was significantly
with the controls (14.861.1 versus 11.060.9 ng/ml, P50.02, lower in patients with CF, reaching only about 60% of the re-
n58–9; Figure 6C). Plotting all measured data pairs of the sponse in healthy volunteers (Figure 7E). To investigate whether
plasma secretin concentration as a function of plasma the decreased urinary HCO32 excretion could be due to a
[HCO32] indicated a correlation that was significantly differ- compromised intestinal HCO32 absorption, venous acid-
ent from zero (Supplemental Figure 8). These results show base status was analyzed before and 1 hour after the NaHCO3
that an acute plasma alkalosis stimulates an increase in plasma challenge in a subset of healthy controls and patients with
secretin levels. CF. Both patients with CF and healthy controls had a similar
and significantly increased plasma [HCO32] 1 hour after the
CFTR KO Mice Are Unable To Increase Urine HCO32 challenge, indicating the observed differences are unlikely
Excretion after an Oral Challenge to be caused my malabsorption of HCO32 (Supplemental
We subsequently challenged awake CFTR WT and KO mice Figure 10). A subgroup of patients with CF was started on
with an oral load of 2.24 mmol NaHCO3/kg body wt and CFTR-modulating therapy with lumacaftor-ivacaftor treatment
measured their ability to increase urinary HCO32 excretion and, on their first control visit 4 weeks later, the same oral
in the following 3 hours. Figure 6, D–F, shows the remarkable NaHCO3 drinking test was repeated. In Figure 8, D–F, the
WT mice after stimulation with secretin as compared with controls. This effect is absent in KO mice. Urine [HCO32] in control mice
(black) and secretin-treated mice (red) in (D) pendrin WT and KO mice, (E) CFTRG WT and KO mice, and (F) CFTRTS WT and KO mice.
n56–7 in all experimental series. Differences between vehicle- and secretin-treated mice were tested by two-way ANOVA with
Bonferroni multiple comparison test. (G–I) Baseline urine [HCO32] is higher in CFTR WT mice. Baseline pHU and urine [HCO32] in
(G) pendrin WT and KO mice, (H) CFTRG WT and KO mice, and (I) CFTRTS WT and KO mice. n512–14 in all experimental series.
Difference in pHU and urine [HCO32] between genotypes was tested with t tests. *P,0.05, **P,0.01, ***P,0.001.
0.5 p=0.40
0.5
pH units/min
pH units/min
Downloaded from http://journals.lww.com/jasn by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW
0.3 0.3
0.1 0.1
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 04/27/2023
-0.3 -0.3
B Time control Time Secretin Time Secretin
8.0 control control
0 Cl-
7.8 0 Cl-
F Alkalization rates
β-IC pHi
7.6 0.8
8min ***
7.4
0.6
pH units/min
100sec
7.2
0.4
Secretin
C 8.0 0 Cl-
Secretin 10nM 0.2
7.8 0 Cl-
β-IC pHi
7.6 0.0
WT CFTRG KO
8min
7.4
100sec
7.2
Figure 4. Secretin stimulates pendrin-mediated HCO32 transport in isolated mouse CCD. (A) Fluorescence image of an isolated
perfused CCD loaded with luminal BCECF-AM. Multiple intercalated cells protruding into the lumen can be identified. Most of the
intercalated cells in the CCD show functional pendrin positivity (prompt intracellular alkalization after luminal chloride removal, data not
shown). (B) A time control experiment showing an original pHi recording of a single pendrin-positive cell after a first removal of luminal
chloride followed by a second removal of luminal chloride 10 minutes later. (C) A secretin stimulation experiment showing an original
pHi recording of a single pendrin-positive cell. Luminal chloride was removed twice, first without stimulation and second after stim-
ulation with 10 nM basolateral secretin for 10 minutes. Note the markedly faster alkalization effect in this experiment after secretin
stimulation. (D and E) Summary of the entire experimental series. Secretin stimulated a significantly faster intracellular alkalization
rate as compared with time controls, indicating activation of pendrin-mediated HCO32 secretin (n55 tubules, n523–28 cells,
t test). (F) Note the significantly lower baseline functional pendrin activity in CFTRG KO CCDs (n510 tubules, n551–53 cells, t test).
**P,0.01, ***P,0.001.
results of three patients with CF before and after lumacaftor- enigmatic. Here we show that secretin elicits a marked urinary
ivacaftor treatment are shown. In all patients, the challenged alkalization, increasing urinary [HCO32] and renal HCO32
urinary HCO32 excretion after treatment was increased, al- excretion rates in anesthetized mice. This effect is present in
though to a variable degree. After treatment, the peak urine multiple mouse models, corroborating data from older studies
[HCO32 ] measured after 2 hours nearly doubled. These data in healthy humans,8 thus proving mice to be a reliable animal
suggest that lumacaftor-ivacaftor treatment improved the model to study the molecular mechanism of the secretin effect
kidneys’ ability to acutely activate urinary HCO32 excretion in the kidney. Importantly, we identified that the secretin effect
after an oral challenge. is completely absent in mice lacking the apical Cl2/HCO32
exchanger pendrin, which in the kidney is exclusively expressed
in the apical membrane of b-ICs of the CCD and mediates
DISCUSSION HCO 3 2 secretion and Cl2 absorption. 13,36–39 Moreover,
we have shown that the secretin effect on pHu is dramatically
The mechanism underlying secretin-induced urinary HCO32 diminished in mice with either global or renal tubule–specific
excretion and postprandial urinary alkalization remains KO of CFTR. The effect on urinary [HCO32] and on renal
Pendrin/GADPH
Pendrin/β-actin
#
500 bp 1.0 1.0
Downloaded from http://journals.lww.com/jasn by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW
FT NA
FT NA
r
sc
sc
sc
sc
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 04/27/2023
R
+
+
si
si
tC TR
tC TR
R
+
+
100 bp
F
R
R
tC
tC
C
FT
FT
dF
dF
w
w
w
w
B wtCFTR wtCFTR dFCFTR D
+ scr +siRNA + scr Pendrin CFTR merged
[kDa]
220
FRT wtCFTR
Pendrin 120
100
80
β-actin 50
40
E
FRT wtCFTR
FRT wtCFTR
siSLC26A4
8 0 Cl-
7.6
+IF
Control
7.2
FRT dFCFTR
6.8
2 min
F Alkalization rates G
0.020 0.020
+IF
# FRT wtCFTR+ scr *
0.016 Control 0.016
0 Cl-
0.012 0.012
ΔpHi/s
ΔpHi/s
8
0.008 7,6 0.008
*
scr
0.004 7,2 0.004
siRNA
0.000 6,8 0.000
1 min
Scr siRNA
l
R
a
FT
FT
nt
2
in R
re
17
tC
FC
R FT
Pa
+w
h.
+d
FT wtC
+C +
Figure 5. cAMP-dependent activation of pendrin requires functional CFTR in the FRT cell model. (A) mRNA expression of pendrin and
glyceraldehyde 3-phosphate dehydrogenase (GADPH) in FRT cells transfected with WT CFTR1scr, WT CFTR1siRNA, or dFCFTR1scr.
(B) Protein abundance of pendrin and b-actin in FRT cells transfected with WT CFTR1scr, WT CFTR1siRNA, or dFCFTR1scr.
(C) Pendrin mRNA and protein abundance is greatly increased in FRT cells transfected with WT CFTR, can be downregulated with
A B C
32 25
*
[Secretin]P (ng/ml)
[HCO3-]P mmol/L
20
***
28
15
Downloaded from http://journals.lww.com/jasn by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW
10
24
5
20 0
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 04/27/2023
D E F
CFTR WT CFTR WT CFTR WT
400
7.5 10
pHUrine
300
200
6.5 5
100
5.5 0 0
H2O NaHCO3 H2O NaHCO3 H2O NaHCO3 H2O NaHCO3 H2O NaHCO3 H2O NaHCO3
Figure 6. An acute metabolic alkalosis increases plasma secretin. CFTR KO mice are unable to increase their urine HCO32 excretion
after an acute oral challenge. (A) Original image illustrating the oral fluid loading procedure. (B) Plasma [HCO32] in mice loaded with
either a control or a HCO32-containing gastric gavage after 30 minutes. Note the significant elevation of plasma [HCO32] ([HCO32]p) in
the base loaded mice, t test (n58–9). (C) Plasma secretin concentration in mice loaded with either a control or a HCO32-containing
gastric gavage. Note the significant elevation in the plasma concentration of secretin ([secretin]p) in the base loaded mice, t test
(n58–9). (D–F) pHu, [HCO32], and total HCO32 excretion in urine collected over a 3-hour period from awake mice subjected either to a
control gavage or a gavage containing 2.24 mmol NaHCO3/kg body wt. Note the absent HCO32 excretion in CFTR KO mice. One-way
ANOVA (n56–9). *P,0.05, ***P,0.001.
HCO32 excretion is completely abolished in both CF animal NaHCO 3 -enriched drinking water. 40 The SCTR is a
models, closely corroborating early data in children with CF Gas-coupled 7TM receptor that elicits its effect primarily
that were unable to increase renal HCO32 excretion after ap- via an increase of cAMP.11,41 In the FRT cell culture model,
plication of secretin.7 In the isolated perfused mouse CCD, the we studied the effect of increasing cellular cAMP concentra-
function of b-ICs was studied directly and secretin was shown tions with IMBX/forskolin. Parental FRT cells were unrespon-
to activate base secretion rates. Pendrin function was lower in sive to IBMX/forskolin. When WT CFTR was expressed in
CCDs lacking CFTR and could not be stimulated by secretin. In FRT cells, a marked expression of pendrin mRNA, protein,
the same mouse strain, renal pendrin protein expression was and apical staining was detected, which was paralleled by a
previously shown to be reduced in mice subjected to 3 days of marked IBMX/forskolin-stimulated upregulation of pendrin
siRNA for pendrin, and is almost absent in FRT cells transfected with dFCFTR. #P,0.001 versus WT CFTR1siRNA and dFCFTR1scr.
*P,0.01 versus dFCFTR1scr. One-way ANOVA with Bonferroni multiple comparisons test. (D) Pendrin colocalizes with CFTR at the
apical surface of WT CFTR-transfected FRT cells (upper panels), can be downregulated with siRNA for pendrin (middle panels), and is
absent in dFCFTR-transfected FRT cells (lower panels). (E) An original experiment showing marked functional upregulation of apical
Cl2/HCO32 function after IF stimulation in WT CFTR transfected FRT cells. (F) Effect of IF stimulation on apical Cl2/HCO32 exchange
activity in parental-, WT CFTR-, dFCFTR-transfected FRT cells and with preincubation with CFTR inhibitor 172. Note the absence of
IF-induced Cl 2 /HCO32 in cells with either no expression of CFTR, expression of dFCFTR, and in FRT WT CFTR cells treated with
CFTR inh. 172 (20 mM, 3 minutes preincubation). #P,0.0001, IF-treated FRT WT CFTR cells were significantly upregulated com-
pared with control and all other IF-treated groups. *P50.007, significant difference between control FRT WT CFTR cells with and
without CFTR inhibitor 172. One-way ANOVA with Bonferroni multiple comparisons test (n53–4 experiments; on average each
experiment included measurement of 150 single cells). (G) An original experiment and summary data showing significantly
downregulation of IF-stimulated Cl2 /HCO32 -exchange in WT CFTR transfected FRT cells by siRNA knockdown of pendrin.
*P,0.01, t test. dFCFTR, DF508 CFTR; IF, 100 mM IBMX and 2 mM forskolin; scr, scrambled siRNA; siRNA, siRNA for pendrin;
DpHi/s, the intracelluar pH increase per second.
NaHCO3 control
NaHCO3 CF pre-treatment
A B C H2O control
7.5 8.0 H2O CF
20
*
[HCO3-]Urine (mM)
7.5
7.0
15
*
Downloaded from http://journals.lww.com/jasn by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW
7.0
pHUrine
pHUrine
6.5
10 6.5
6.0
6.0
5.5 5
5.5
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 04/27/2023
5.0 0 5.0
Control CF pre-treatment Control CF pre-treatment 0 1 2 3
Time (hours)
D E F
NaHCO3 control 125 NaHCO3 control
50 H2O CF H2O CF **
75
40 10
* *
30 50
20 5
25
10
0 0 0
0 1 2 3 0 1 2 3
l
t
tro
en
m
at
C
tre
e-
pr
F
C
Figure 7. Patients with CF (DF508/DF508) have reduced urine [HCO32] and a markedly reduced ability to excrete an oral HCO32 load.
(A and B) Baseline urine pH and [HCO32 ] in adult patients with CF (n59) and healthy controls (n510–11). Note the decreased urine
[HCO32 ] in patients with CF, t test. *P,0.05. (C, D, and F) Urine pH, urine [HCO32 ], and cumulated urinary HCO32 excretion as
response to a NaHCO3 drinking test (0.94 mmol NaHCO3/kg body wt) in fasting patients with CF (red, n59), healthy controls (blue,
n511), and a water drinking test in one fasting patient with CF (bright blue) and fasting healthy controls (black, n55). Note the
greatly reduced urinary [HCO32 ] and HCO32 excretion in patients with CF as compared with healthy controls. *P,0.05, **P,0.01
difference between healthy controls and patients with CF subjected to the oral NaHCO3 challenge, two-way ANOVA with
Bonferroni multiple comparisons test. (E) Area under the curve (AUC) of urinary [HCO32 ] in controls (n511) and patients with CF
(n59). **P,0.01, t test.
function. This functional and molecular upregulation of pen- Our results open the important question of the integrative
drin was strongly inhibited by mutated CFTR, siRNA for pen- physiologic role of this secretin-stimulated action in the kidney.
drin, and CFTR inhibitor 172. Others have shown functional We pursued this question by proposing that an acute blood
interaction between CFTR and the STAS domain of SLC26A6 alkalization may cause an increase of plasma secretin that
and DRA,42 and our study strongly implies this molecular in- drives renal HCO32 excretion and thus permits homeostatic
teraction might be at play for SLC26A4 as well. Altogether, this regulation of plasma HCO32. Indeed, after an acute metabolic
study provides a comprehensive explanation of the molecular alkalosis, we found a significant increase in plasma secretin.
mechanism of secretin-induced renal HCO32 excretion. Se- Based on these results we suggest the following physiologic
cretin leads to SCTR activation in the basolateral membrane concept: a primary increase of plasma HCO32 triggers an in-
of b-ICs of the collecting duct and activation of pendrin and crease of plasma secretin that drives renal HCO32 excretion
CFTR-dependent HCO32 secretion. This mechanism closely and thus permits homeostatic regulation of plasma HCO32.
mirrors the molecular mechanism of secretin-induced Secretin may originate from the hypothalamus because
NaHCO3 secretion in the pancreatic duct, both being defec- secretin-containing neurons are present in this neuroendo-
tive in patients with CF.2 Eventually, epithelial HCO32 secre- crine brain region.45 A secondary increase of secretin occurs
tion via a pendrin- and CFTR-dependent mechanism was also after a meal, where activation of gastric acid secretion is mir-
shown in respiratory epithelia and finds further support by rored by a transient blood alkalization, the so-called alkaline
our study.43,44 tide.46 During this digestive period, secretin is released from
A B C
NaHCO3 CF post-treatment NaHCO3 CF post-treatment NaHCO3 CF post-treatment
NaHCO3 CF pre-treatment NaHCO3 CF pre-treatment NaHCO3 CF pre-treatment
[HCO3-]Urine (mM)
Downloaded from http://journals.lww.com/jasn by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW
7.0 40 15
pHUrine
6.5
10
6.0 20
5.5 5
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 04/27/2023
5.0 0 0
0 1 2 3 0 1 2 3 0 1 2 3
Time (hours) Time (hours) Time (hours)
D E F G
NaHCO3 CF post-treatment NaHCO3 CF post-treatment NaHCO3 CF post-treatment 125
NaHCO3 CF pre-treatment NaHCO3 CF pre-treatment NaHCO3 CF pre-treatment
100
AUC [HCO3-]Urine
Subject 1 Subject 2 Subject 3 *
70 70 70 75
[HCO3-]Urine (mM)
[HCO3-]Urine (mM)
[HCO3-]Urine (mM)
60 60 60
50 50 50 50
40 40 40
30 30 30
20 20 20 25
10 10 10
0 0 0 0
0 1 2 3 0 1 2 3 0 1 2 3
t
en
en
m
tm
Time (hours) Time (hours) Time (hours)
at
ea
tre
-tr
e-
st
pr
po
F
F
C
C
Figure 8. Treatment with lumacaftor-ivacaftor improves the HCO32 excretion deficit. (A–C) pHu, urine [HCO32], and accumulated
urinary HCO32 excretion as response to a NaHCO3 drinking test in patients with CF before (red, n53) and after 4 weeks of lumacaftor-
ivacaftor treatment (black, n53), *P,0.05, paired t test. (D–F) Individual traces of the three lumacaftor-ivacaftor–treated participants
before and after treatment. Note the approximately 100% increase in urine [HCO32] in each participant. (G) Area under the curve (AUC)
of urinary [HCO32] in patients with CF before treatment (red, n53) and after 4 weeks of lumacaftor-ivacaftor treatment (black, n53).
*P,0.05, difference between patients with CF before and after treatment, paired t test.
duodenal S cells following the intraluminal acidification of often present with metabolic alkalosis and a renal cause of this,
the upper small intestine caused by emptying of the stom- namely a reduced ability to excrete HCO32, has been sugges-
ach. In parallel, this meal-induced blood alkalization could ted.40,47 Metabolic alkalosis has also been described in patients
also trigger secretin release from other sources, as suggested with pendred syndrome.48,49 It is also worth mentioning that
above, to drive renal HCO 3 2 excretion. These consider- patients with CF have been described with increased levels of
ations provide a plausible hypothesis of the urine compo- plasma secretin.50 The cause of this is not established but one
nent of the alkaline tide. The role of secretin would be to may suggest that metabolic alkalosis could trigger an increase
provide an adequate, acute signal to keep plasma HCO32 of plasma secretin levels. Taken together, our results provide
within tolerable ranges by facilitating renal HCO32 excretion. a mechanistic understanding that the loss of CFTR in the
Our results also imply that secretin serves a so-far-undiscovered kidney leads to reduced urinary HCO32 excretion because
role as a “homeostatic HCO32 hormone” that, analogously to b-IC function is compromised and this, in turn, explains the
other hormones, can regulate ion (here HCO32) and water ho- metabolic alkalosis in patients with CF. We also found that
meostasis by controlling the transport processes in the collecting mice and humans require functional CFTR to activate the
duct. A schematic illustration of the proposed mechanism is kidneys’ ability to acutely excrete a defined oral HCO32
shown in Figure 9. load. Patients with CF who are homozygous for the most
A major finding of this study is the inability of secretin- common mutation (DF508) have a greatly attenuated ability
induced renal HCO32 excretion in mice that either lack CFTR to acutely excrete HCO32 by their kidneys. Compared with
globally or specifically in the renal tubular system. These re- the findings in the mouse model, we still see some residual
sults closely match those from human patients with CF that function. We suggest that this is explained by the DF508 mu-
have been shown to be unresponsive in increasing their renal tation, which still produces CFTR protein, but with signifi-
HCO32 excretion after secretin application.7 Patients with CF cantly reduced function and apical membrane abundance.51
Ingestion of a meal performed and analyzed the experiments; Dr. Peder Berg, Dr. Søren
Jensen-Fangel, Dr. Majbritt Jeppesen, and Prof. Jens Leipziger
developed the CF urine test; Prof. Jens Leipziger drafted the man-
Secretin release uscript. All authors critically revised the manuscript for important
[HCO3-]p intellectual content and approved the final version.
Downloaded from http://journals.lww.com/jasn by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW
[Secretin]p
DISCLOSURES
CCD β-IC
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 04/27/2023
HCO3 -
[HCO3-]U
FUNDING
Figure 9. Secretin-release is stimulated by alkalosis and triggers
HCO3- secretion in the CCD. Schematic illustration of the pro- This work was supported by Det Frie Forskningsråd (Danish Council for
posed mechanism of secretin-induced urinary HCO32 excretion. Independent Research) grants DFF 6110-00131 and DFG 387509280-
Ingestion of a meal will cause a transient alkalosis. Ingestion of a SFB 1350.
meal itself and/or metabolic alkalosis stimulates secretin release.
This will increase plasma concentration of secretin ([secretin]p).
An increased plasma concentration of secretin will activate SUPPLEMENTAL MATERIAL
HCO32 secretion by b-ICs in the CCD. This will increase urine pH
and [HCO32] excretion and thereby help compensate metabolic This article contains the following supplemental material online at
alkalosis. This image was created with BioRender.com. http://jasn.asnjournals.org/lookup/suppl/doi:10.1681/ASN.2020010053/-/
DCSupplemental.
Supplemental Results.
Eventually, we found that treatment with the novel CFTR mod-
Supplemental Figure 1. Renal tubule-specific knockout of CFTR
ulator ivacaftor-lumacaftor increased the ability of patients
in mouse kidney.
with CF to acutely increase their urine HCO32 excretion.
Supplemental Figure 2. Schematic outline of the protocol for the
With these results, we propose that the acute urine HCO32
HCO32drinking test in humans.
excretion ability, similar to the sweat test, qualifies as a CF
Supplemental Figure 3. Representative gel images from RT-PCR
test to quantify functional CFTR losses and monitor drug
results probing for the SCTR and CFTR along the mouse renal tu-
effectiveness as a possible precision treatment measure for
bular system.
each patient with CF.
Supplemental Figure 4. Immunohistochemical localization of
CFTR and pendrin in CFTR KO mice.
Supplemental Figure 5. Control staining without primary
ACKNOWLEDGMENTS antibodies.
Supplemental Figure 6. Urinary HCO32 excretion rates from in
We would like to thank Prof. Hans Beat Hadorn, Munich for his vivo mouse experiments.
valuable hints and fruitful discussion. We also thank Sebastian Supplemental Figure 7. mRNA expression of pendrin and CFTR in
Frische for provision of the custom-built small volume HCO32 parental, WT CFTR- and deltaF508-transfected FRT cells.
measuring device. FRT epithelial cells, stably coexpressing human Supplemental Figure 8. Correlation of plasma secretin concen-
F508del (FRT-F508del) were a generous gift from L. J. Galietta tration plotted as a function of plasma HCO32 concentration.
(Telethon Institute of Genetics and Medicine, Pozzuoli, Italy). The Supplemental Figure 9. Mixed venous blood gas parameters in
pendrin antibody used for Western blotting was a generous gift from CFTR- and pendrin KO/WT mice 1 hour after control or NaHCO3
Carsten Wagner, University of Zurich. The floxed CFTR mouse was a gavage and urinary pH in pendrin WT/KO mice.
kind gift from Mitchel Drumm and Dr. Craig Hodges, Case Western Supplemental Figure 10. Venous blood gas parameters before and
Reserve University, Cleveland, Ohio. Expert technical assistance from 1 hour after a NaHCO3 challenge in healthy controls and CF patients
Karen Skjødt Sørensen, Yordanos Yehdego, and Ane Sørensen is prior CFTR modulator treatment.
greatly appreciated. Supplemental Table 1. Mice characteristics for the mice used in in
Dr. Peder Berg, Prof. Karl Kunzelmann, and Prof. Jens Leipziger vivo secretin experiments.
developed the project idea; Dr. Jesper Frank Andersen, Dr. Peder Supplemental Table 2. RT-PCR results probing for presence of
Berg, Dr. Ines Cabrita, Dr. Casper K. Larsen, Prof. Jens Leipziger, CFTR and secretin receptor mRNA along mouse renal tubular
Prof. Rainer Schreiber, Dr. Mads V. Sorensen, Dr. Samuel L. Svendsen system.
39–74, 2012 24. Trepiccione F, Iena F, Catalini L, Carpi F, Koed M, Frische S: Measure-
3. Gunnes P, Waldum H, Rasmussen K, Ostensen H, Burhol P: Cardio- ment of total CO2 in microliter samples of urine and other biological
vascular effects of secretin infusion in man. Scand J Clin Lab Invest 43: fluids using infrared detection of CO2. Pflugers Arch 469: 1267–1275,
637–642, 1983 2017
25. Greger R, Hampel W: A modified system for in vitro perfusion of iso-
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 04/27/2023
cystic fibrosis transmembrane conductance regulator (CFTR)-expressing 48. Kandasamy N, Fugazzola L, Evans M, Chatterjee K, Karet F: Life-threatening
airway serous cells. J Biol Chem 286: 41069–41082, 2011 metabolic alkalosis in Pendred syndrome. Eur J Endocrinol 165: 167–170, 2011
44. Kim D, Huang J, Billet A, Abu-Arish A, Goepp J, Matthes E, et al.: 49. Pela I, Bigozzi M, Bianchi B: Profound hypokalemia and hypochloremic
Pendrin mediates bicarbonate secretion and enhances cystic fibrosis metabolic alkalosis during thiazide therapy in a child with Pendred
transmembrane conductance regulator function in airway surface epi- syndrome. Clin Nephrol 69: 450–453, 2008
thelia. Am J Respir Cell Mol Biol 60: 705–716, 2019 50. Windstetter D, Schaefer F, Schärer K, Reiter K, Eife R, Harms H, et al.:
Downloaded from http://journals.lww.com/jasn by BhDMf5ePHKav1zEoum1tQfN4a+kJLhEZgbsIHo4XMi0hCywCX1AW
45. Chu J, Lee L, Lai C, Vaudry H, Chan Y, Yung W, et al.: Secretin as a Renal function and renotropic effects of secretin in cystic fibrosis.
neurohypophysial factor regulating body water homeostasis. Proc Natl Eur J Med Res 2: 431–436, 1997
Acad Sci U S A 106: 15961–15966, 2009 51. O’Sullivan B, Freedman S: Cystic fibrosis. Lancet 373: 1891–1904, 2009
46. Niv Y, Fraser G: The alkaline tide phenomenon. J Clin Gastroenterol
35: 5–8, 2002
nYQp/IlQrHD3i3D0OdRyi7TvSFl4Cf3VC4/OAVpDDa8K2+Ya6H515kE= on 04/27/2023
47. Al-Ghimlas F, Faughnan M, Tullis E: Metabolic alkalosis in adults with See related editorial, “No Zoom Required: Meeting at the b-Intercalated
stable cystic fibrosis. Open Respir Med J 6: 59–62, 2012 Cells,” on pages 1655–1657.