TOXICOLOGICAL SCIENCES 103(2), 371–381 (2008)
doi:10.1093/toxsci/kfn040
Advance Access publication February 27, 2008
Evaluation of Putative Biomarkers of Nephrotoxicity after Exposure to
Ochratoxin A In Vivo and In Vitro
Eva Rached,* Dana Hoffmann,* Kai Blumbach,† Klaus Weber,† Wolfgang Dekant,* and Angela Mally*,1
*Department of Toxicology, University of Würzburg, Würzburg D-97078, Germany; and †RCC Ltd, CH-4414 Füllinsdorf/CH-4452 Itingen, Switzerland
Received January 18, 2008; accepted February 20, 2008
The kidney is one of the main targets of xenobiotic-induced
toxicity, but early detection of renal damage is difficult. Recently,
several novel biomarkers of nephrotoxicity have been identified by
transcription profiling, including kidney injury molecule-1 (Kim-1),
lipocalin-2, tissue inhibitor of metalloproteinases-1 (Timp-1),
clusterin, osteopontin (OPN), and vimentin, and suggested as
sensitive endpoints for acute kidney injury in vivo. However, it is
not known if these cellular marker molecules may also be useful to
predict chronic nephrotoxicity or to detect nephrotoxic effects
in vitro. In this study, a panel of new biomarkers of renal toxicity
was assessed via quantitative real-time PCR, immunohistochem-
istry, and immunoblotting in rats treated with the nephrotoxin
ochratoxin A (OTA) for up to 90 days and in rat proximal tubule
cells (NRK-52E) treated with OTA in vitro. Repeated adminis-
tration of OTA to male F344/N rats for 14, 28, or 90 days resulted
in a dose- and time-dependent increase in the expression of Kim-1,
Timp-1, lipocalin-2, OPN, clusterin, and vimentin. Changes in
gene expression were found to correlate with the progressive
histopathological alterations and preceded effects on traditional
clinical parameters indicative of impaired kidney function.
Induction of Kim-1 messenger RNA expression was the earliest
and most prominent response observed, supporting the use of this
marker as sensitive indicator of chronic kidney injury. In contrast,
no significant increase in the expression of putative marker genes
and proteins were evident in NRK-52E cells after exposure to
OTA for up to 48 h, suggesting that they may not be suitable
endpoints for sensitive detection of nephrotoxic effects in vitro.
Key Words: ochratoxin A; kidney; nephrotoxicity; biomarker;
in vitro toxicity testing.
The kidney is one of the primary sites of xenobiotic-induced
toxicity (Hart and Kinter, 2005). The organ-specific toxicity is
in part attributable to the high blood flow rate, which causes
delivery of high concentrations of xenobiotics to the kidneys.
The proximal tubule epithelium is particularly vulnerable to
nephrotoxic injury, as these cells express a variety of trans-
porters, which enable active uptake and intracellular accumu-
lation of toxic parent compounds or metabolites. In addition,
1
To whom correspondence should be addressed at Department of
Toxicology, University of Würzburg, Versbacher Str. 9, 97078 Würzburg,
Germany. Fax: þ49-931-20148865. E-mail: mally@toxi.uni-wuerzburg.de.
Ó The Author 2008. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved.
For Permissions, please email: journals.permissions@oxfordjournals.org
Downloaded from https://academic.oup.com/toxsci/article/103/2/371/1615994 by guest on 17 April 2023
proximal tubular epithelial cells are highly metabolically active
and can bioactivate relatively nontoxic compounds into
reactive intermediates, which may cause toxicity via damage
to cellular macromolecules (Hart and Kinter, 2005).
Chemical injury may induce cell death within the renal
proximal tubule epithelium, subsequently leading to cell
dedifferentiation, migration, proliferation, and finally rediffer-
entiation to restore a fully functional epithelial barrier
(Bonventre, 2003). However, due to its functional reserve,
minor effects on kidney function are difficult to detect. Thus,
traditional markers of nephrotoxicity such as increased blood
urea nitrogen (BUN) or serum creatinine are rather insensitive
and only indicate damage when 70
80% of the renal epithelial
mass has been lost. Release of the brush border enzyme
c-glutamyl transferase (c-GT) or the lysosomal enzyme
N-acetyl-b-D-glucosaminidase (NAG) from damaged renal
cells into the urine is presently regarded as sensitive indicators
of tubule injury. In addition, the urinary concentration of some
proteins normally excluded from filtration or reabsorbed by the
tubules may serve as indicator of kidney function. For example,
increased excretion of albumin and b2-microglobulin is
indicative of dysfunction of the proximal tubules due to in-
hibition of endocytotic protein uptake or cellular damage (Hart
and Kinter, 2005). However, detection of enzymes and other
proteins can be difficult due to their instability and highly
variable levels in urine.
Therefore, there is a strong need for the identification and
validation of more sensitive and reliable biomarkers, which
may be used for improved prediction of kidney injury during
drug development and chemical safety testing. Recently,
several candidate gene-based markers for kidney injury have
been identified using toxicogenomics approaches. Because
changes in messemger RNA (mRNA) expression are consid-
ered to be one of the earliest events, which may occur in
response to cellular stress and/or tissue damage, it has been
speculated that these biomarkers might help to predict adverse
effects before damage is indicated by the current gold standard,
that is, clinical chemistry and histopathology. In various mod-
els of acute kidney injury, elevations in the expression of kidney
injury molecule-1 (Kim-1), osteopontin (OPN), lipocalin-2/
NGAL, tissue inhibitor of metalloproteinases-1 (Timp-1),
372 RACHED ET AL.
clusterin, vimentin and heme oxygenase 1 (HO-1) have been
reported to detect injury before the onset of major histopath-
ological changes (Amin et al., 2004; Davis et al., 2004;
Thukral et al., 2005). From these studies, it appears that Kim-1
and lipocalin-2/NGAL may be the most promising candidates
for new biomarkers, because their mRNA expression has been
shown to increase dramatically following acute kidney injury
(Kharasch et al., 2006; Mishra et al., 2003). Furthermore, it
was demonstrated that Kim-1 and lipocalin-2/NGAL are
specifically induced at the target site of toxicity in both animal
models and various human renal diseases involving acute
injury of the proximal tubule epithelium (Ding et al., 2007;
Han et al., 2002; Ichimura et al., 2004; Mishra et al., 2003,
2004). Similarly, target site specific changes in the expression
of clusterin and OPN have been observed in response to
a variety of models of renal injury (Gobe et al., 1995; Iguchi
et al., 2004; Rosenberg and Silkensen, 1995; Witzgall et al.,
1994; Xie et al., 2001b). Interestingly, several of these
candidate nephrotoxicity markers have been shown to be
secreted into urine, suggesting that they may also serve as
early, noninvasive biomarkers of nephrotoxicity (Hidaka et al.,
2002; Ichimura et al., 2004; Khan et al., 2002; Mishra et al.,
2003; Vaidya et al., 2006; Xie et al., 2001b).
However, the ability of these putative biomarkers of
nephrotoxicity to indicate or even predict mild histopatholog-
ical changes following long-term exposure to nephrotoxicants
still needs to be evaluated. In this study, we investigated the
expression of both new and traditional biomarkers of
nephrotoxicity in rats treated with low doses of ochratoxin A
(OTA) for up to 90 days. The principal goal was to determine if
changes in the expression of the newly identified biomarkers
correlate with the progressive damage to the kidney as
evidenced by histopathology and might even precede tradi-
tional endpoints of nephrotoxicity.
Because development of reliable in vitro test systems may
contribute to reduction of animal experiments required for drug
and chemical safety assessment, an ancillary aim of this study
was to determine if these novel kidney biomarkers might also
serve as sensitive endpoints for in vitro toxicity testing.
Although primary kidney epithelial cells may more adequately
reflect the in vivo situation than cell lines, they are more
difficult to handle and are therefore not as convenient for
routine use in large screening assays. We therefore investigated
the effects of subtoxic concentrations of OTA on novel kidney
biomarkers in a stable, well-characterized rat cell line derived
from the proximal tubule epithelium (NRK-52E) (de Larco and
Todaro, 1978).
MATERIAL AND METHODS
Material. OTA was purchased from Axxora (Grünberg, Germany) and
from Prof. Peter Mantle, Imperial College of Sciences, London, UK. Primary
antibodies used were goat anti-albumin (M-13; Santa Cruz, Heidelberg,
Germany), mouse anti-b2-microglobulin (MorphoSys AbD, Düsseldorf,
Germany), goat anti-clusterin b (M-18; Santa Cruz), goat anti-Kim-1
(Immunology Consultants Laboratory, Newberg, OR), goat anti-lipocalin-2/
NGAL (R&D Systems, Wiesbaden-Nordenstadt, Germany), goat anti-OPN
(P-18; Santa Cruz), mouse anti-OPN (AKm2A1; Santa Cruz), rabbit anti-Timp-1
(Acris Antibodies, Hiddenhausen, Germany), and mouse anti-vimentin (V9;
Santa Cruz). Unless otherwise indicated, all other chemicals were from Roth
(Karlsruhe, Germany).
Animal experiment. Tissue and urine samples for the study were taken
from a previous animal experiment with OTA, in which male F344 rats had
been treated with 0, 21, 70, or 210 lg/kg bw OTA for 14, 28, or 90 days
(Rached et al., 2007). Briefly, animals were administered OTA dissolved in
corn oil by gavage, 5 days/week. For urine collection, rats were transferred to
metabolic cages 48 h prior to necropsy. During urine collection (20 h), animals
Downloaded from https://academic.oup.com/toxsci/article/103/2/371/1615994 by guest on 17 April 2023
were fasted but allowed free access to drinking water. An aliquot of urine was
immediately used for clinical chemistry analyses. The remaining urine was
stored at
20°C until further analysis. After urine collection, blood samples
were drawn from the retro-orbital plexus under light isoflurane anesthesia.
Blood and urine samples were transferred on ice to RCC Ltd. (Füllinsdorf,
Switzerland) for clinical biochemistry and urine analyses. Animals were killed
by CO2 asphyxiation and blood withdrawal by cardiac puncture. Kidneys were
removed, weighed, and cut longitudinally. One half of the right kidney was
fixed in 10% neutral buffered formalin and subsequently embedded in paraffin.
The remaining parts of the kidneys were aliquoted, flash frozen in liquid
nitrogen, and stored at
80°C.
Cells and treatment. NRK-52E cells were acquired from the European
Collection of Cell Cultures and cultured under standard cell culture conditions
(37°C, 5% CO2) in Dulbecco’s modified Eagle medium (high glucose) with
10% fetal calf serum, 2mM glutamine, nonessential amino acids and penicillin/
streptomycin (PAA Laboratories, Cölbe, Germany). For subcultivation, 1.5 3
105 cells were seeded into 75-cm2 cell culture flasks and grown to
subconfluency.
For treatment, cells were seeded into 21-cm2 cell culture dishes at a density
of 1.5 3 105 and allowed to grow to 90–100% confluency. OTA (stored at

20°C) was freshly dissolved in ethanol (99%) and diluted with cell culture
medium to reach the desired concentrations (final concentration of ethanol in
medium did not exceed 0.36%).
Cytotoxicity (MTT assay). Cells were seeded into 96-well plates at
a density 3.5 3 103/well, allowed to grow for 48 h and subsequently treated
with OTA for 24 and 48 h. Cytotoxicity was evaluated using the MTT-based
in vitro toxicology assay kit (Sigma-Aldrich, Taufkirchen, Germany) according
to the manufacturer’s instructions. Each assay was performed in three
independent experiments carried out in triplicate.
RNA isolation. RNA was isolated from NRK cells using the RNeasy Mini
Kit (Qiagen, Hilden, Germany) including DNase-digestion according to the
manufacturer’s instructions. For tissue samples, RNA was isolated from
aliquots of frozen kidney using the TRIR total RNA isolation reagent (ABgene,
Hamburg, Germany) and further purified using the RNeasy Mini Kit including
DNase treatment. Isolated RNA was quantified by measuring the absorbance at
260 nm. RNA integrity was controlled by electrophoresis on a 1.2%
formaldehyde agarose gel. Purified RNA samples were stored at
80°C until use.
Complimentary DNA synthesis and quantitative realtime PCR. Compli-
mentary DNA (cDNA) was synthesized from 1 lg RNA using the first Strand
Synthesis Kit (ABgene, Hamburg, Germany), diluted 1:5 with H2O and stored at

20°C. Quantitative real-time PCR was performed using the ABI Prism 7000
Sequence Detection System (Applied Biosystems, Darmstadt, Germany) in 25-ll
reactions containing 23 mastermix with SYBR Green I (Abgene, Hamburg,
Germany), 2.5 ll of cDNA and 70nM of each primer. Amplification was carried
out using the following temperature profile: 15 min enzyme activation at 95°C,
followed by 40 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 30 s. Primer
sequences are shown in Table 1. PCR product formation was determined by
measuring the fluorescence signal emitted by the incorporation of SYBR Green I
 EVALUATION OF PUTATIVE BIOMARKERS OF NEPHROTOXICITY AFTER EXPOSURE TO OCHRATOXIN A 373

into double stranded DNA. Using standard curves, amplification efficiencies of

(Bolbrinker et al., 2006)

(Depreter et al., 2002)

both endogenous reference gene and target genes were assessed. Product

(Amin et al., 2004)

(Amin et al., 2004)

(Chen et al., 2006)

(Luhe et al., 2003)

specificity was examined by melting curve analysis and electrophoresis on a 5%

Reference
polyacrylamide gel.
Gene expression changes relative to untreated controls were determined by
the 2
DDCt method (see ‘‘Critical factors for Successful Real-time PCR,’’
Qiagen). Samples were amplified in duplicate and normalized against b-actin.
Results are presented as mean fold change in mRNA expression of 5 animals

—
per dose group compared with control animals respectively treated cells
compared with untreated cells determined by three independent in vitro

CAGTCCGTAAGCCAAGCTATCA
AGACAGGTGGGACCTGAACCA
experiments.

AAGGTCAAGACGTGCCAGAG
CAAAGCTCAGAGAGCCCATC

CCTCTGGCGAAGAAACTCTG

GCAGATGAGGCTTCCAATGT
ACGTCCATGGCCTGTTGAG
Protein preparation. To prepare urinary proteins, urine was centrifuged at
Reverse primer 5#–3#

GGCCGCGATGAGAAACT

GCGGCAGTGGCCATCTC
15,800 3 g and 4°C for 15 min to pellet cells and cell debris. The supernatant
was diluted with water to adjust for differences in creatinine concentrations.

Downloaded from https://academic.oup.com/toxsci/article/103/2/371/1615994 by guest on 17 April 2023

Urine was subsequently diluted in 63 sample buffer (12% sodium dodecyl
sulfate [SDS], 50% glycerol, 25% 2-mercaptoethanol, 0.0125% bromphenol
blue, 250mM Tris, pH 6.8). To concentrate urinary proteins, 300 ll of urine
normalized on creatinine were mixed with an equal volume of 20% ice-cold
trichloroacetic acid and incubated on ice for 15 min. Proteins were pelleted by
centrifugation at 15,800 3 g and 4°C for 15 min. The supernatant was removed
Sequence of Forward and Reverse Primers for Real-Time PCR

and the pellet was washed two times with 300 ll of ice-cold ethanol (99%).
After complete removal of ethanol, the pellet was dissolved in 50 ll of 13
sample buffer (2% SDS, 10% glycerol, 5% 2-mercaptoethanol, 0.002%
ATCAAGATGACTAAGATGCTCAAAGG

bromphenol blue, 62.5mM Tris–HCl, pH 6.8), and pH was adjusted to 6.8 with
1M Tris, pH 8.8. Samples were stored at
20°C until use.
TCTGGGCCTCAAGGATAACAAC

CCAGCACACAAGCAGACGTTT
GATGCTCCAGAGGGAGGAAG
CGCAGAGAAACCCGACTAAG

Immunoblotting. Ten microliters of concentrated urinary proteins in

GGGAAATCGTGCGTGACATT
AAAGCAGCTGGTGTCAATGT
CACTACGGGCCTCTGAGCTT
Forward primer 5#–3#

CTAAGACCGCCTTCCTGCT

sample buffer or 20 ll of urine sample normalized on creatinine were separated

by SDS–polyacrylamide gel electrophoresis (PAGE) and transferred onto
nitrocellulose membranes at 100 V and 4°C for 1 h using transfer buffer (25mM
Tris, 192mM glycine, 20% methanol). For the detection of albumin, clusterin,
TABLE 1

Kim-1, and lipocalin-2/NGAL, membranes were blocked in 5% nonfat, dry

milk in TBST buffer (50mM Tris–HCl, 150mM NaCl, pH 7.4, 0.1% Tween-
20) for 2 h at room temperature (RT) and subsequently incubated with primary
antibody diluted in blocking buffer overnight at 4°C. After extensive washing
with TBST, membranes were incubated with horse radish peroxidase (HRP)-
conjugated secondary antibody (donkey anti-goat; Santa Cruz) at a dilution of
1:5000 in blocking buffer for 1 h at RT. Following repeated wash steps,
membranes were developed using the enhanced chemiluminescence (ECL)
NM_001007604
Accession no.

western blotting detection system (GE Healthcare, Freiburg, Germany) and

NM_053819
NM_130741

NM_031140

NM_012580
NM_031144

exposed to hyperfilm (GE Healthcare). For detection of b2-microglobulin,

AF035963

membranes were blocked in 5% milk in phosphate-buffered saline (PBS) for

M99252

M64723

2 h at RT and incubated with primary antibody in blocking buffer with 0.1%

Tween-20 overnight at 4°C. After washing with 5% milk/PBST, membranes
were incubated with secondary antibody (goat anti-mouse, Santa Cruz; 1:5000)
for 1 h at RT. Membranes were extensively washed with 5% milk/PBST,
Secreted phosphoprotein 1 (osteopontin)

PBST, and PBS before proteins were detected using ECL detection system (see
Tissue inhibitor of metallopeptidase 1

above). To detect urinary OPN, proteins were blotted onto either nitrocellulose
or polyvinylidene fluoride membrane, blocked in 5% milk in TBST, and
incubated with a goat anti-OPN antibody in 1% milk in TBST. Densitometry
was performed using the Bio-Rad Gel Doc 2000 system. Changes in protein
Kidney injury molecule-1
Gene title

expression in response to treatment are presented as relative to controls.

Heme oxygenase-1

Ribosomal protein,

Immunohistochemistry. Kidney sections (5 lm) were prepared from

formalin fixed, paraffin embedded tissue blocks and mounted onto glass slides.
Sections were deparaffinized, rehydrated, and washed in PBS. Heat-induced
Lipocalin-2

large, P1
Vimentin
Clusterin

antigen retrieval was achieved by 4 min autoclaving in 10mM citrate buffer, pH

b-Actin

6.0. For detection of Timp-1 and lipocalin-2/NGAL, sections were treated with
0.1% trypsin for 3 min at 37°C. After washing the sections in PBS and H2O,
endogenous peroxidase was blocked by incubation with 3% H2O2 in PBS for
15 min. Sections were subsequently blocked with 10% goat serum or 5%
Gene symbol

Havr1/Kim-1

donkey serum for 1.5 h, followed by 0.001% avidin in PBS for 15 min and
0.001% biotin for 15 min, with several washes in PBS in between. Then,
Timp-1

Hmox

Rplp1
Spp1
Lcn2

sections were incubated with 2.5–5 lg/ml primary antibody diluted in 1% BSA
Actb
Vim
Clu

in PBS for 1 h at RT. After three wash steps, sections were incubated with
374 RACHED ET AL.

biotinylated secondary antibody (goat anti-mouse, goat anti-rabbit, or donkey TABLE 2

anti-goat, Santa Cruz), diluted 1:100 in PBS for 1 h at RT and subsequently Summary of Histopathological Observations in Kidneys of Male
washed with PBS. Following 30 min incubation with Streptavidin–HRP
F344/N Rats Treated with 0, 21, 70, or 210 mg/kg bw OTA for 14,
(Becton Dickinson, Heidelberg, Germany), peroxidase activity was visualized
using 3,3#-diaminobenzidine tetrahydrochloride (Becton Dickinson) for 1–5 min. 28, or 90 Days
The sections were counterstained with hematoxylin, dehydrated and mounted
in Eukitt mounting medium (Sigma-Aldrich, Taufkirchen, Germany). OTA (lg/kg bw)
Histopathological Interval
Statistical analysis. Data are expressed as mean ± SD. Statistical analysis
change (days) 0 21 70 210
was performed by ANOVA and Dunnett’s test. Values significantly different
from control are indicated as *p < 0.05, **p < 0.01, and ***p < 0.001.
Tubular basophilia 14 þ (3/5) þ (4/5) þ (2/5) þþ (5/5)
28 þ (1/5) þ (2/5) þ (2/5) þþþ (5/5)
90 þ (2/5) þ (5/5) þþ (5/5) þþþ (5/5)
Tubular degeneration 14


/þ (1/5) þþþþ (5/5)
RESULTS


þ (5/5) þþ (5/5)

Downloaded from https://academic.oup.com/toxsci/article/103/2/371/1615994 by guest on 17 April 2023

In Vivo Study
General observations. As previously reported, OTA treat-
ment resulted in histopathological changes, consisting of cell
degeneration, basophilia, and karyomegaly in the S3 segment
of the proximal tubule epithelium (PST), depending on dose
and treatment time (Rached et al., 2007). Routine analysis of
clinical chemistry parameters in blood and urine showed no
effects on urinary volume, protein, glucose, or creatinine. In
addition, no changes in serum urea (BUN) levels were
observed throughout the study. In high-dose animals, urinary
NAG activity was significantly increased after 28 and 90 days
(1.7-fold and 1.3-fold, respectively), and elevated serum
creatinine levels (1.2-fold) were observed after 90 days. At
the same time, the activity of c-GT was significantly decreased
in urine of both mid-dose and high-dose animals to 60% and
20% of controls, respectively, possibly indicating loss of brush
border or functional changes within the proximal tubule epi-
thelium. Based on the histopathological observations (Table 2),
a no-observed-effect-level (NOEL) of 21 lg/kg bw OTA was
established.
Changes in the expression of putative biomarkers of
nephrotoxicity in kidneys of OTA-treated rats. Repeated
administration of 70 or 210 lg/kg bw OTA to male rats
resulted in a dose- and time-dependent increase in the
expression of genes suggested as candidate biomarkers of
renal injury (Fig. 1). Changes in the expression of Kim-1,
lipocalin-2, Timp-1, OPN, and clusterin were found to correlate
with the progressive histopathological alterations observed in
kidneys of OTA-treated animals (Table 2) and preceded
changes of clinical parameters indicative of impaired kidney
function. In contrast to the mid and high dose, no alterations in
gene expression were evident in kidneys of rats treated with 21
lg/kg bw OTA, consistent with the NOEL in this study.
Kim-1, lipocalin-2/NGAL, and Timp-1 were among the
most upregulated genes (about 10-fold increase in both mid
and high dose). Induction of Kim-1 gene expression was one of
the earliest responses of the kidney following OTA treatment,
evident as early as 28 days in four of five animals exposed to
70 lg/kg bw OTA and after 14 days in all high-dose animals,
where only subtle histopathological changes were observed.
28
90

þþ(þ) (5/5) þ (5/5)
Nuclear enlargement 14


þ (5/5)
28

þ (5/5) þþþ (5/5)
90

þþ (5/5) þþþþ (5/5)
Cell proliferation 14


þ (5/5)
28

þ (5/5) þþþ (5/5)
90

þþþ (5/5) þþþþ (5/5)
Note. Abbrevations:
, lesion not observed; þ, minimal, þþ mild, þþþ
moderate, and þþþþ high severity of lesion (Rached et al., 2007).
Furthermore, the degree of Kim-1 mRNA increase in the
individual animals correlated well with the extent of tissue
damage in the kidney. Expression levels of OPN and clusterin
were also markedly increased ( fivefold) following treatment
with 210 lg/kg bw OTA for 28 days. However, alterations in
lipocalin-2/NGAL, OPN, Timp-1, and clusterin gene expres-
sion were only detectable after 90 days in mid-dose animals. In
this study, only minor changes (> twofold) in HO-1 and
vimentin gene expression were detected. Moreover, HO-1 was
not consistently upregulated throughout the study and no
changes in vimentin gene expression were evident in mid-dose
animals (70 lg/kg bw OTA) as compared with controls.
Results obtained by quantitative realtime PCR were sub-
sequently confirmed by immunohistochemistry (Fig. 2). Con-
sistent with gene expression analyses, Kim-1 was detected as
early as after 14 days in kidneys of high-dose animals (no shown)
and after 90 days in both mid- and high-dose animals (Fig. 2a).
Kim-1 was undetectable in proximal tubules located in the outer
stripe of the outer medulla (OSOM) and medullary rays of
control kidneys, but it occurred in epithelial cells of S3 tubules
that were affected by OTA toxicity as seen by cell degeneration
and regeneration. Kim-1 was located in the cytoplasm or at the
apical side of flattened, dedifferentiated cells.
Vimentin was not detected in renal tubular epithelial cells of
control animals or rats exposed to 21 lg/kg bw OTA. In
contrast, positive staining of proximal straight tubules, the
target sites of OTA toxicity, was observed in kidneys of rats
exposed to 70 and 210 lg/kg bw OTA for 90 days, with a clear
increase relative to dose. Interestingly, changes in vimentin
protein expression were detectable at lower doses than required
to induce significant changes in gene expression. Vimentin
 EVALUATION OF PUTATIVE BIOMARKERS OF NEPHROTOXICITY AFTER EXPOSURE TO OCHRATOXIN A
FIG. 1. Changes in mRNA expression of putative biomarkers of
nephrotoxicity in kidneys of male rats repeatedly dosed with 0, 21, 70, or
210 lg/kg bw OTA for 14(a), 28(b), or 90(b) days. Data are presented as mean
fold change ± SD compared with control animals (n ¼ 5). Statistical analysis
was performed by ANOVA and Dunnett’s test (*p < 0.05, **p < 0.01,
***p < 0.001).
expression was predominantly observed in flattened cells that
lacked a brush border—characteristics of dedifferentiated cells
(Fig. 2b). Clusterin was constitutively expressed in distal
convoluted tubules, localized at the apical side of the cells (not
shown), whereas proximal tubules located within the OSOM
were not labeled by the antibody. However, repeated
administration of 70 or 210 lg/kg bw OTA for 90 days
resulted in a dose-dependent increase in clusterin expression in
375
proximal tubule cells located in the OSOM and medullary rays.
Affected tubules showed clear signs of degeneration and
regeneration (Fig. 2c). Expression of OPN was evident in
proximal tubular epithelial cells of both treated and untreated
animals, where positive OPN staining was observed both in
small vesicular structures and at the brush border. Treatment
with 70 or 210 lg/kg bw OTA for 90 days resulted in strong
apical staining of OPN in epithelial cells within the OSOM that
showed signs of regeneration, such as flattened epithelium and
loss of brush border. In addition, several strongly affected
tubules showed high amounts of vesicular OPN, indicating
increased OPN expression at this site, consistent with the
Downloaded from https://academic.oup.com/toxsci/article/103/2/371/1615994 by guest on 17 April 2023
increase in OPN mRNA levels (Fig. 2d).
Timp-1 was detected in proximal tubules of both kidney
cortex and OSOM. In cortical tubules, the protein was
expressed in vesicular structures. In addition, protein droplets
and debris in tubular lumina were strongly stained, in line with
reports by Eddy and Giachelli (1995) obtained in proteinuric
animals. Interestingly, Timp-1 was exclusively detected at cell-
cell contacts and at the apical side of the cells located within the
OSOM (Fig. 2e). Due to the high basal expression of Timp-1,
clear changes of Timp-1 protein expression in response to OTA
exposure were not evident, except for single epithelial cells of
affected tubules, which contained many positively stained
vesicles that did not occur in control kidneys (Fig. 2e). Using
a specific antibody against rat-lipocalin-2/NGAL, the protein
was exclusively detected at the apical side of some proximal
tubules in the cortex and in the deep OSOM of all animals.
However no treatment-related effects on lipocalin-2/NGAL
expression were observed at the target site of OTA toxicity
(Fig. 2f).
Urinary biomarkers for tubular toxicity. Changes in the
levels of urinary proteins were studied by SDS–PAGE and
western blot as previously described (Hidaka et al., 2002;
Ichimura et al., 1998; Khan et al., 2002; Mishra et al., 2004).
Coomassie-staining of separated urinary proteins on poly-
acrylamide gels showed a clear dose-dependent increase in the
amount of a 70 kDa protein that was subsequently confirmed to
be albumin. Quantification of urinary albumin by immuno-
blotting showed a statistically significant increase (3-fold
relative to control) in urine of rats treated with 210 lg/kg bw
OTA as early as 14 days after start of treatment (Fig. 3a).
Albuminuria can result from both impaired glomerular
filtration and decreased protein uptake by the proximal tubule
epithelium. Therefore, tubular uptake of low molecular weight
proteins was studied by measuring the urinary concentration of
b2-microglobulin (12 kDa). As expected from the histopath-
ological observations, both microalbuminuria and an elevated
excretion of b2-microglobulin were evident in high-dose
animals (Fig. 3b), indicating impaired proximal tubular function
rather than altered glomerular filtration (Hart and Kinter, 2005).
Similar effects were observed at the later time-points, although
some changes were not found to be statistically significant due
376 RACHED ET AL.

Downloaded from https://academic.oup.com/toxsci/article/103/2/371/1615994 by guest on 17 April 2023

FIG. 2. Expression of Kim-1 (a), vimentin (b), clusterin (c), OPN (d), Timp-1 (e), and lipocalin-2/NGAL (f) in kidneys of male F344/N rats treated with 0, 21,
70, or 210 lg/kg bw OTA for 90 days. (a) Treatment with up to 210 lg/kg bw OTA resulted in marked Kim-1 induction in tubules with cellular degeneration (thin
arrow, /) and regeneration (thick arrow, fx1). Kim-1 was detected at the apical side or in the cytoplasm of flattened, dedifferentiated cells. (b) Vimentin is not
expressed in tubules of control animals and rats exposed to 21 lg/kg bw OTA. Treatment with the two higher doses resulted in a dose-dependent increase in protein
expression, predominantly in flattened epithelial cells of proximal tubules located in the OSOM. (c) In controls and rats exposed to 21 lg/kg bw OTA, clusterin is
not detected in proximal tubules located in the OSOM. In contrast, clusterin expression is observed after 90 days of treatment with 70 or 210 lg/kg bw OTA in
proximal straight tubules showing marked signs of OTA toxicity, like cell degeneration and regeneration. (d) OPN is constitutively expressed in epithelia of
proximal tubules, where it is found in small vesicular structures and along the brush border. Repeated administration of 70 or 210 lg/kg bw OTA resulted in
increased expression of OPN in regenerating proximal tubule epithelial cells. In these cells, OPN was found in vesicles or at the apical (luminal) side. (e) In
proximal tubules in the OSOM, Timp-1 is normally expressed at cell-cell contacts and at the apical side of the cells. OTA treatment did not have a marked effect
on Timp-1 expression, except for some vesicular staining in single epithelial cells of affected proximal straight tubules (arrowhead). (f) Lipocalin-2/NGAL is found
at the apical side of proximal tubules in the deep OSOM. No OTA-mediated effects were observed at the target site of OTA toxicity. Original magnification 2003.
 EVALUATION OF PUTATIVE BIOMARKERS OF NEPHROTOXICITY AFTER EXPOSURE TO OCHRATOXIN A 377

Downloaded from https://academic.oup.com/toxsci/article/103/2/371/1615994 by guest on 17 April 2023

FIG. 3. Expression of albumin (a), b2-microglobulin (b), Kim-1 (c), and clusterin (d) in concentrated urine of male F344/N rats treated repeatedly with 0, 21,
70, or 210 lg/kg bw OTA for 14, 28, or 90 days. Densitometry data are presented as fold change of protein expression in control animals. Statistical analysis was
performed by ANOVA and Dunnett’s test (*p < 0.05, **p < 0.01, ***p < 0.001).

to the high variability in urinary protein levels. Administration of
70 lg/kg bw OTA resulted in minor changes in albumin
excretion and had no effect on urinary b2-microglobulin levels
throughout the study.
Several studies indicate that increased secretion of Kim-1,
lipocalin-2/NGAL, clusterin, and OPN into urine may occur in
response to tubule cellular injury (Hidaka et al., 2002; Ichimura
et al., 1998; Khan et al., 2002; Mishra et al., 2004). Because all
these marker genes were found to be upregulated in kidneys of
OTA-treated rats as compared with controls, we were in-
terested to determine if urinary concentrations were also altered
in response to OTA treatment. Consistent with both the induc-
tion of mRNA expression and the positive immunolabeling of
Kim-1 in kidneys of high-dose rats, a significant increase in
Kim-1 excretion was detected as early as after 14 days in urine
of these animals. After 90 days, elevated levels of Kim-1 were
also found in mid-dose rats (Fig. 3c). In contrast to urine of
male Wistar and Sprague Dawley rats, lipocalin-2/NGAL was
undetectable in urine of male F344 rats (data not shown). In
addition, OPN could not be detected in urine of different rat
strains using commercially available antibodies. Clusterin was
present in urine of both controls and OTA-treated animals.
However, no treatment-related effect on urinary clusterin levels
was observed (Fig. 3d).
378 RACHED ET AL.

TABLE 3
Changes in Gene Expression of Putative Biomarkers of
Nephrotoxicity in NRK-52E Cells after Treatment with OTA for
24 or 48 h

Fold deregulation

OTA (lM)

Gene title Interval (h) 10 20 30

Lipocalin-2 24 0.8 ± 0.1 0.5 ± 0.1 0.5 ± 0.1

48 0.8 ± 0.1 0.4 ± 0.1 0.3 ± 0.1

Downloaded from https://academic.oup.com/toxsci/article/103/2/371/1615994 by guest on 17 April 2023

Osteopontin 24 0.8 ± 0.2 0.7 ± 0.2 0.7 ± 0.2
48 0.8 ± 0.4 1.3 ± 0.8 2.7 ± 1.3
Clusterin 24 1.5 ± 0.5 2.0 ± 1.1 1.6 ± 0.9
48 1.7 ± 0.4 1.8 ± 0.5 0.8 ± 0.4
FIG. 4. Cell viability of NRK-52E cells treated 24 or 48 h with various Vimentin 24 1.1 ± 0.1 1.3 ± 0.1 1.0 ± 0.1
concentrations of OTA. Statistical analysis was performed by ANOVA and 48 1.2 ± 0.1 1.3 ± 0.1 1.4 ± 0.1
Dunnett’s test (*p < 0.05, **p < 0.01). Timp-1 24 0.9 ± 0.1 0.9 ± 0.5 0.5 ± 0.2
48 1.0 ± 0.1 1.1 ± 0.4 0.8 ± 0.2
Heme oxygenase-1 24 1.1 ± 0.1 1.7 ± 0.2 3.9 ± 1.0
Expression of putative biomarkers in OTA-treated NRK-52E 48 1.4 ± 0.1 2.3 ± 0.5 5.0 ± 2.6
cells. A small decrease in cell viability (20–30%) was
observed in NRK cells after treatment with OTA at concen- Note. Data are presented as mean fold change ± SD compared with controls
(3 independent experiments).
trations up to 30 lM (Fig. 4). Based on these results, 3
treatment concentrations (10, 20, 30 lM), ranging from
noncytotoxic to weakly cytotoxic were chosen for determina- expression of the majority of the selected candidate biomarkers
tion of gene expression of putative marker genes. In contrast to in kidneys of rats following treatment with OTA in the absence
modulation of marker gene expression in vivo, treatment of of effects on traditional clinical chemistry markers of nephro-
NRK-52E cells with up to 30 lM OTA for 24 or 48h did not toxicity. Moreover, both the time-course and the degree of the
result in marked changes in the mRNA expression of candidate response correlated well with the severity of tissue injury.
kidney biomarkers (Table 3) with the exception of HO-1, Changes in the expression of Kim-1 were one of the earliest
which was slightly induced in response to OTA treatment. and most prominent effects observed in kidneys of animals
Kim-1, which was found to be the most sensitive marker for treated with 70 or 210 lg/kg bw OTA, occurring at time-points
nephrotoxicity in vivo, was expressed at low to undetectable at which only minor histopathological changes in the form of
levels in vitro, and no increase in Kim-1 mRNA was observed single tubular degeneration/regeneration were evident. Al-
after treatment with OTA. Similarly, expression of lipocalin-2 though the specific functions of Kim-1 are still unknown,
and Timp-1 was not significantly affected by OTA exposure. upregulation of this gene is thought to be associated with
Inconsistent changes in both mRNA and protein expression of proliferation/regeneration and repair in response to toxicity or
putative biomarkers were also observed following treatment disease (Ichimura et al., 1998), consistent with the histopath-
with a variety of other nephrotoxins that target the proximal ological alterations observed following treatment with OTA.
tubule epithelium, including cisplatin, cadmium chloride, and Similarly, lipocalin-2/NGAL, OPN, vimentin, Timp-1, and
potassium bromate (data not shown). clusterin are proposed to be involved in the process of
regeneration (Gobe et al., 1995; Huang et al., 2001; Iguchi
et al., 2004; Mishra et al., 2003; Wallin et al., 1992; Witzgall
DISCUSSION et al., 1994; Xie et al., 2001a). However, significant alterations
in mRNA levels of these putative biomarkers occurred at later
In recent years, several putative biomarkers have been time-points as compared with Kim-1, indicating that they might
identified by gene expression analysis in various models of not be as sensitive to detect minor kidney damage.
drug-induced nephrotoxicity (Amin et al., 2004; Davis et al., Changes in marker gene expression were subsequently
2004; Kharasch et al., 2006; Thukral et al., 2005). Although confirmed by immunohistochemistry. In accordance with other
these novel markers have been demonstrated to be sensitive, studies, Kim-1 occurred in dedifferentiated proximal tubule
specific markers of acute renal tubular injury, their potential to epithelial cells (Ichimura et al., 1998, 2004), which confirms
detect subtle changes in the kidney following long-term a role for this protein in proliferation and tissue repair.
exposure to nephrotoxic agents has not been investigated so Induction of vimentin protein was a sensitive indicator of cell
far. In this study, we observed upregulation of mRNA dedifferentiation and tubular regeneration following OTA
 EVALUATION OF PUTATIVE BIOMARKERS OF NEPHROTOXICITY AFTER EXPOSURE TO OCHRATOXIN A
exposure. Similarly, immunolabeling of OPN demonstrated
increased expression of OPN at sites of proximal tubular
regeneration. OPN protein was found in intracellular vesicles
and at the apical side of epithelial cells within affected tubules,
supporting the hypothesis that this protein takes part in tissue
repair (Persy et al., 1999). Consistent with other studies (Gobe
et al., 1995; Witzgall et al., 1994), increased expression of
clusterin occurred in tubules showing clear signs of cell death
and regeneration. The strong clusterin immunolabeling in
flattened, regenerating cells is in line with studies indicating
a role for clusterin in promoting cell–cell and cell–substratum
interactions, thereby facilitating tissue remodeling after damage
(Rosenberg and Silkensen, 1995). In contrast, only small
changes in protein expression of Timp-1 and no changes in
lipocalin-2/NGAL protein expression were observed in kidneys
of OTA-treated rats. Increased mRNA and protein expression
of Timp-1 was reported during the development of interstitial
fibrosis (Ahmed et al., 2007; Eddy and Giachelli, 1995).
However, because Timp-1 protein was not detected in the
tubulointerstitial space of OTA-treated rats, it might have
another role in OTA-mediated progressive nephrotoxicity.
Timp-1 possesses both anti-apoptotic and growth-stimulating
properties (Lambert et al., 2004), and overexpression of this
protein has been associated with a high proliferation rate and
poor prognosis in malignant tissues (Kallakury et al., 2001;
Miyata et al., 2004). Therefore, Timp-1 induction by OTA
might be related to the induction of proximal tubular cell
proliferation (Rached et al., 2007).
Although routine urinalysis after repeated administration of
up to 210 lg/kg bw OTA for 90 days did not indicate an
increase in total protein (Rached et al., 2007), western blot
analysis of urinary proteins demonstrated a small, but
statistically significant increase in urinary albumin and
b2-microglobulin levels in high-dose animals. Microalbuminuria
together with low molecular weight proteinuria is a character-
istic sign of a disrupted protein uptake into the proximal
tubules (Birn and Christensen, 2006; Hart and Kinter, 2005),
which has been shown to occur in OK cells treated with OTA
(Gekle et al., 1994). In high-dose animals, this effect preceded
changes in parameters of routine urinalysis, like NAG and
serum creatinine. However, in mid-dose rats, changes in gene
expression of putative biomarkers were found to be more
sensitive and reliable than effects on these urinary markers.
Both Kim-1 and lipocalin-2/NGAL have been demonstrated
to be excreted into urine in response to kidney injury (Mishra
et al., 2004; Vaidya et al., 2006). Kim-1 detection in urine is in
line with other studies, in which a correlation between
induction of Kim-1 gene and protein expression and an
increased urinary Kim-1 excretion had been observed (Ichimura
et al., 2004; Vaidya et al., 2006; Zhou et al., 2008).
Surprisingly, lipocalin-2/NGAL, which was easily identified
in urine of other rat strains, was not present in urine of
untreated or OTA-treated Fischer rats. Similarly, OPN and
clusterin have previously been used as urinary markers of
379
nephrotoxicity (Aulitzky et al., 1992; Eti et al., 1993; Hidaka
et al., 2002; Khan et al., 2002). However, in this study, OPN
was not detectable in urine of both control and treated animals,
and no treatment-related changes in urinary clusterin were
evident by immunoblotting.
In summary, modulation of the expression of several
candidate biomarkers of nephrotoxicity by low doses of OTA
in vivo is consistent with findings with other nephrotoxins and
supports their use as biomarkers of kidney injury. In this
model, Kim-1 was the most sensitive marker of tissue injury
and mirrored well the progression of kidney damage, which is
also in accordance with a recent subchronic study with
Downloaded from https://academic.oup.com/toxsci/article/103/2/371/1615994 by guest on 17 April 2023
cadmium chloride (Prozialeck et al., 2007). However, it should
be emphasized that none of the putative biomarkers was
significantly altered before the onset of histopathological
changes, indicating that they may represent diagnostic, but
not necessarily predictive markers of nephrotoxicity.
A second aim of this study was to investigate the potential
use of these markers as predictive tools for toxicity testing
in vitro, which may allow rapid screening of large numbers of
compounds. Therefore, mRNA expression of Kim-1, lipocalin-
2/NGAL, OPN, clusterin, vimentin, Timp-1, and HO-1 was
studied in NRK-52E cells, a well-established kidney cell line
for in vitro toxicity assays (Lash et al., 2002; Leussink et al.,
2002; Prozialeck et al., 2006), following exposure to OTA.
However, treatment resulted in only minor alterations in gene
expression. Consistent with the results from the animal
experiment, a slight induction of HO-1 mRNA expression
was observed in cell cultured treated with OTA. In contrast,
Kim-1, lipocalin-2, and Timp-1, which were the most sensitive
markers for toxicity in vivo, were not significantly affected by
treatment. Similar effects were also observed with other model
nephrotoxins (CdCl2, KBrO3, and cisplatin). Overall, de-
termination of cell viability appeared to be the most sensitive
endpoint of toxicity in our in vitro model.
A possible explanation for the weak effects in vitro
compared with the situation in vivo might be that, in contrast
to the kidney, some of the marker genes were already
expressed at relatively high levels in NRK cells. This is
supported by the fact that expression of lipocalin-2/NGAL,
vimentin, and clusterin was recently reported to increase during
isolation and cultivation of proximal tubular cells (Weiland
et al., 2007). It is therefore plausible to speculate that an
additional increase in response to injury is no longer possible.
Similarly, exposure of NRK-52E cells to OTA and other
nephrotoxins did not lead to upregulation of Kim-1. Like most
of the other marker genes studied here, Kim-1 is thought to be
induced in the course of tissue regeneration (Ichimura et al.,
1998; van Timmeren et al., 2007). Results from a number of
studies suggest that, in contrast to the situation in vivo,
regenerative proliferation may not occur in monolayers of
cultured kidney cells in response to a continuous nephrotoxic
insult, but only after removal of the toxin (Huang et al., 2001;
Kamp et al., 2005; Kays and Schnellmann, 1995; Kays et al.,
380 RACHED ET AL.
1993; Wiegele et al., 1998; Witzgall et al., 1994). Therefore it
appears likely that the signaling pathways resulting in the ex-
pression of Kim-1 and other markers for regeneration were not
turned on under the experimental conditions of this study,
which were chosen to mimic progressive nephrotoxic effects.
These results are in line with a recent comparative study on
gene expression in rat liver and primary hepatocytes in
response to peroxisome proliferators. In this study, changes
in the expression of genes related to b-oxidation were found to
be induced both in vivo and in vitro. In contrast, genes
associated with cell proliferation and apoptosis were exclu-
sively altered in vivo (Tamura et al., 2006), which may be due
to the lack of nonparenchymal cells, for example, Kupffer cells,
which are thought to play an important role in the toxicity of
peroxisome proliferators. Thus, interactions of target cells with
surrounding cells, matrix components, or extracellular factors,
as well as toxicokinetics, which are critical determinants in the
overall response to a toxic compound, may not be adequately
reflected by cell culture models. Although complete replace-
ment of animal studies, therefore, may not be feasible, in vitro
assays may still be valuable tools for rapid screening of
compounds for their potential to cause nephrotoxicity. This
may serve to reduce the need for animal testing, particularly
within pharmaceutical industries, because potent nephrotoxins
may be excluded from further development and only those
candidates showing no effects in vitro may need to be tested
in vivo (Prieto et al., 2006). However, although the new -omics
derived markers show good potential as sensitive indicators of
nephrotoxicity in vivo, results from this study do not support
their use as reliable endpoints of toxicity in vitro.
SUPPLEMENTARY DATA
Supplementary data are available online at http://toxsci.
oxfordjournals.org/.
FUNDING
RCC, Ltd, Itingen, Switzerland.
ACKNOWLEDGMENTS
We would like to thank Ursula Tatsch, Theresa Ehrlich, and
Elisabeth Rüb-Spiegel for excellent technical assistance.
REFERENCES
Ahmed, A. K., Haylor, J. L., El Nahas, A. M., and Johnson, T. S. (2007).
Localization of matrix metalloproteinases and their inhibitors in experimental
progressive kidney scarring. Kidney Int. 71, 755–763.
Amin, R. P., Vickers, A. E., Sistare, F., Thompson, K. L., Roman, R. J.,
Lawton, M., Kramer, J., Hamadeh, H. K., Collins, J., Grissom, S., et al.
(2004). Identification of putative gene based markers of renal toxicity.
Environ. Health Perspect. 112, 465–479.
Aulitzky, W. K., Schlegel, P. N., Wu, D. F., Cheng, C. Y., Chen, C. L.,
Li, P. S., Goldstein, M., Reidenberg, M., and Bardin, C. W. (1992).
Measurement of urinary clusterin as an index of nephrotoxicity. Proc. Soc.
Exp. Biol. Med. 199, 93–96.
Birn, H., and Christensen, E. I. (2006). Renal albumin absorption in physiology
and pathology. Kidney Int. 69, 440–449.
Bolbrinker, J., Markovic, S., Wehland, M., Melenhorst, W. B., van Goor, H.,
and Kreutz, R. (2006). Expression and response to angiotensin-converting
enzyme inhibition of matrix metalloproteinases 2 and 9 in renal glomerular
damage in young transgenic rats with renin-dependent hypertension.
J. Pharmacol. Exp. Ther. 316, 8–16.
Bonventre, J. V. (2003). Dedifferentiation and proliferation of surviving epithe-
Downloaded from https://academic.oup.com/toxsci/article/103/2/371/1615994 by guest on 17 April 2023
lial cells in acute renal failure. J. Am. Soc. Nephrol. 14(Suppl. 1), S55–S61.
Chen, Z., Chen, J., Weng, T., Jin, N., and Liu, L. (2006). Identification of rat
lung–prominent genes by a parallel DNA microarray hybridization. BMC
Genomics 7, 47.
Davis, J. W., 2nd., Goodsaid, F. M., Bral, C. M., Obert, L. A., Mandakas, G.,
Garner, C. E., 2nd., Collins, N. D., Smith, R. J., and Rosenblum, I. Y.
(2004). Quantitative gene expression analysis in a nonhuman primate model
of antibiotic-induced nephrotoxicity. Toxicol. Appl. Pharmacol. 200, 16–26.
de Larco, J. E., and Todaro, G. J. (1978). Epithelioid and fibroblastic rat kidney
cell clones: Epidermal growth factor (EGF) receptors and the effect of mouse
sarcoma virus transformation. J. Cell. Physiol. 94, 335–342.
Depreter, M., Vandesompele, J., Espeel, M., Speleman, F., and Roels, F.
(2002). Modulation of the peroxisomal gene expression pattern by
dehydroepiandrosterone and vitamin D: Therapeutic implications.
J. Endocrinol. 175, 779–792.
Ding, H., He, Y., Li, K., Yang, J., Li, X., Lu, R., and Gao, W. (2007). Urinary
neutrophil gelatinase-associated lipocalin (NGAL) is an early biomarker for
renal tubulointerstitial injury in IgA nephropathy. Clin. Immunol. 123,
227–234.
Eddy, A. A., and Giachelli, C. M. (1995). Renal expression of genes that
promote interstitial inflammation and fibrosis in rats with protein-overload
proteinuria. Kidney Int. 47, 1546–1557.
Eti, S., Cheng, C. Y., Marshall, A., and Reidenberg, M. M. (1993). Urinary
clusterin in chronic nephrotoxicity in the rat. Proc. Soc. Exp. Biol. Med. 202,
487–490.
Gekle, M., Mildenberger, S., Freudinger, R., and Silbernagl, S. (1994). The
mycotoxin ochratoxin-A impairs protein uptake in cells derived from the
proximal tubule of the kidney (opossum kidney cells). J. Pharmacol. Exp.
Ther. 271, 1–6.
Gobe, G. C., Buttyan, R., Wyburn, K. R., Etheridge, M. R., and Smith, P. J.
(1995). Clusterin expression and apoptosis in tissue remodeling associated
with renal regeneration. Kidney Int. 47, 411–420.
Han, W. K., Bailly, V., Abichandani, R., Thadhani, R., and Bonventre, J. V.
(2002). Kidney Injury Molecule-1 (KIM-1): A novel biomarker for human
renal proximal tubule injury. Kidney Int. 62, 237–244.
Hart, S. E., and Kinter, L. B. (2005). Assessing renal effects of toxicants in
vivo. In Toxicology of the Kidney (J. B. Tarloff and L. H. Lash, Eds.), pp.
81–147. CRC Press, Boca Raton, FL.
Hidaka, S., Kranzlin, B., Gretz, N., and Witzgall, R. (2002). Urinary clusterin
levels in the rat correlate with the severity of tubular damage and may help to dif-
ferentiate between glomerular and tubular injuries. Cell Tissue Res. 310, 289–296.
Huang, Q., Dunn, R. T., 2nd, Jayadev, S., DiSorbo, O., Pack, F. D., Farr, S. B.,
Stoll, R. E., and Blanchard, K. T. (2001). Assessment of cisplatin-induced
nephrotoxicity by microarray technology. Toxicol. Sci. 63, 196–207.
Ichimura, T., Bonventre, J. V., Bailly, V., Wei, H., Hession, C. A., Cate, R. L.,
and Sanicola, M. (1998). Kidney injury molecule-1 (KIM-1), a putative
epithelial cell adhesion molecule containing a novel immunoglobulin
 EVALUATION OF PUTATIVE BIOMARKERS OF NEPHROTOXICITY AFTER EXPOSURE TO OCHRATOXIN A
domain, is up-regulated in renal cells after injury. J. Biol. Chem. 273,
4135–4142.
Ichimura, T., Hung, C. C., Yang, S. A., Stevens, J. L., and Bonventre, J. V.
(2004). Kidney injury molecule-1: A tissue and urinary biomarker for
nephrotoxicant-induced renal injury. Am. J. Physiol. Renal Physiol. 286,
F552–F563.
Iguchi, S., Nishi, S., Ikegame, M., Hoshi, K., Yoshizawa, T., Kawashima, H.,
Arakawa, M., Ozawa, H., and Gejyo, F. (2004). Expression of osteopontin in
cisplatin-induced tubular injury. Nephron Exp. Nephrol. 97, e96–e105.
Kallakury, B. V., Karikehalli, S., Haholu, A., Sheehan, C. E., Azumi, N., and
Ross, J. S. (2001). Increased expression of matrix metalloproteinases 2 and 9
and tissue inhibitors of metalloproteinases 1 and 2 correlate with poor
prognostic variables in renal cell carcinoma. Clin. Cancer Res. 7,
3113–3119.
Kamp, H. G., Eisenbrand, G., Schlatter, J., Wurth, K., and Janzowski, C.
(2005). Ochratoxin A: Induction of (oxidative) DNA damage, cytotoxicity
and apoptosis in mammalian cell lines and primary cells. Toxicology 206,
413–425.
Kays, S. E., Berdanier, C. D., Swagler, A. R., Lock, E. A., and
Schnellmann, R. G. (1993). An in vitro model of renal proximal tubule
cell regeneration. J. Pharmacol. Toxicol. Methods 29, 211–215.
Kays, S. E., and Schnellmann, R. G. (1995). Regeneration of renal proximal
tubule cells in primary culture following toxicant injury: Response to growth
factors. Toxicol. Appl. Pharmacol. 132, 273–280.
Khan, S. R., Johnson, J. M., Peck, A. B., Cornelius, J. G., and Glenton, P. A.
(2002). Expression of osteopontin in rat kidneys: Induction during ethylene
glycol induced calcium oxalate nephrolithiasis. J. Urol. 168, 1173–1181.
Kharasch, E. D., Schroeder, J. L., Bammler, T., Beyer, R., and
Srinouanprachanh, S. (2006). Gene expression profiling of nephrotoxicity
from the sevoflurane degradation product fluoromethyl-2,2-difluoro-1-
(trifluoromethyl)vinyl ether (‘‘compound A’’) in rats. Toxicol. Sci. 90,
419–431.
Lambert, E., Dasse, E., Haye, B., and Petitfrere, E. (2004). TIMPs as
multifacial proteins. Crit. Rev. Oncol. Hematol. 49, 187–198.
Lash, L. H., Putt, D. A., Hueni, S. E., Cao, W., Xu, F., Kulidjian, S. J., and
Horwitz, J. P. (2002). Cellular energetics and glutathione status in NRK-52E
cells: Toxicological implications. Biochem. Pharmacol. 64, 1533–1546.
Leussink, B. T., Nagelkerke, J. F., van de Water, B., Slikkerveer, A., van der
Voet, G. B., Srinivasan, A., Bruijn, J. A., de Wolff, F. A., and de Heer, E.
(2002). Pathways of proximal tubular cell death in bismuth nephrotoxicity.
Toxicol. Appl. Pharmacol. 180, 100–109.
Luhe, A., Hildebrand, H., Bach, U., Dingermann, T., and Ahr, H. J. (2003). A
new approach to studying ochratoxin A (OTA)-induced nephrotoxicity:
Expression profiling in vivo and in vitro employing cDNA microarrays.
Toxicol. Sci. 73, 315–328.
Mishra, J., Ma, Q., Prada, A., Mitsnefes, M., Zahedi, K., Yang, J., Barasch, J.,
and Devarajan, P. (2003). Identification of neutrophil gelatinase-associated
lipocalin as a novel early urinary biomarker for ischemic renal injury. J. Am.
Soc. Nephrol. 14, 2534–2543.
Mishra, J., Mori, K., Ma, Q., Kelly, C., Barasch, J., and Devarajan, P. (2004).
Neutrophil gelatinase-associated lipocalin: A novel early urinary biomarker
for cisplatin nephrotoxicity. Am. J. Nephrol. 24, 307–315.
Miyata, Y., Kanda, S., Nomata, K., Hayashida, Y., and Kanetake, H. (2004).
Expression of metalloproteinase-2, metalloproteinase-9, and tissue inhibitor
of metalloproteinase-1 in transitional cell carcinoma of upper urinary tract:
Correlation with tumor stage and survival. Urology 63, 602–608.
Persy, V. P., Verstrepen, W. A., Ysebaert, D. K., De Greef, K. E., and De
Broe, M. E. (1999). Differences in osteopontin up-regulation between
proximal and distal tubules after renal ischemia/reperfusion. Kidney Int. 56,
601–611.
381
Prieto, P., Baird, A. W., Blaauboer, B. J., Castell Ripoll, J. V., Corvi, R.,
Dekant, W., Dietl, P., Gennari, A., Gribaldo, L., Griffin, J. L., et al. (2006).
The assessment of repeated dose toxicity in vitro: A proposed approach. The
report and recommendations of ECVAM workshop 56. Altern. Lab. Anim.
34, 315–341.
Prozialeck, W. C., Edwards, J. R., Lamar, P. C., and Smith, C. S. (2006).
Epithelial barrier characteristics and expression of cell adhesion molecules in
proximal tubule-derived cell lines commonly used for in vitro toxicity
studies. Toxicol. In Vitro 20, 942–953.
Prozialeck, W. C., Vaidya, V. S., Liu, J., Waalkes, M. P., Edwards, J. R.,
Lamar, P. C., Bernard, A. M., Dumont, X., and Bonventre, J. V. (2007).
Kidney injury molecule-1 is an early biomarker of cadmium nephrotoxicity.
Kidney Int. 72, 985–993.
Rached, E., Hard, G. C., Blumbach, K., Weber, K., Draheim, R., Lutz, W. K.,
Downloaded from https://academic.oup.com/toxsci/article/103/2/371/1615994 by guest on 17 April 2023
Ozden, S., Steger, U., Dekant, W., and Mally, A. (2007). Ochratoxin
A: 13-Week oral toxicity and cell proliferation in male F344/N rats. Toxicol.
Sci 97, 288–98.
Rosenberg, M. E., and Silkensen, J. (1995). Clusterin: Physiologic and
pathophysiologic considerations. Int. J. Biochem. Cell. Biol. 27, 633–645.
Tamura, K., Ono, A., Miyagishima, T., Nagao, T., and Urushidani, T. (2006).
Profiling of gene expression in rat liver and rat primary cultured hepatocytes
treated with peroxisome proliferators. J. Toxicol. Sci. 31, 471–490.
Thukral, S. K., Nordone, P. J., Hu, R., Sullivan, L., Galambos, E.,
Fitzpatrick, V. D., Healy, L., Bass, M. B., Cosenza, M. E., and
Afshari, C. A. (2005). Prediction of nephrotoxicant action and identification
of candidate toxicity-related biomarkers. Toxicol. Pathol. 33, 343–355.
Vaidya, V. S., Ramirez, V., Ichimura, T., Bobadilla, N. A., and
Bonventre, J. V. (2006). Urinary kidney injury molecule-1: A sensitive
quantitative biomarker for early detection of kidney tubular injury. Am. J.
Physiol. Renal Physiol. 290, F517–F529.
van Timmeren, M., van den Heuvel, M., Bailly, V., Bakker, S., van Goor, H.,
and Stegeman, C. (2007). Tubular kidney injury molecule-1 (KIM-1) in
human renal disease. J. Pathol. 212, 209–217.
Wallin, A., Zhang, G., Jones, T. W., Jaken, S., and Stevens, J. L. (1992).
Mechanism of the nephrogenic repair response. Studies on proliferation and
vimentin expression after 35S-1,2-dichlorovinyl-L-cysteine nephrotoxicity in
vivo and in cultured proximal tubule epithelial cells. Lab. Invest. 66,
474–484.
Weiland, C., Ahr, H. J., Vohr, H. W., and Ellinger-Ziegelbauer, H. (2007).
Characterization of primary rat proximal tubular cells by gene expression
analysis. Toxicol. In Vitro 21, 466–491.
Wiegele, G., Brandis, M., and Zimmerhackl, L. B. (1998). Apoptosis and
necrosis during ischaemia in renal tubular cells (LLC-PK1 and MDCK).
Nephrol. Dial. Transplant. 13, 1158–1167.
Witzgall, R., Brown, D., Schwarz, C., and Bonventre, J. V. (1994).
Localization of proliferating cell nuclear antigen, vimentin, c-Fos, and
clusterin in the postischemic kidney. Evidence for a heterogenous genetic
response among nephron segments, and a large pool of mitotically active and
dedifferentiated cells. J. Clin. Invest. 93, 2175–2188.
Xie, Y., Nishi, S., Iguchi, S., Imai, N., Sakatsume, M., Saito, A., Ikegame, M.,
Iino, N., Shimada, H., Ueno, M., Kawashima, H., et al. (2001a). Expression
of osteopontin in gentamicin-induced acute tubular necrosis and its recovery
process. Kidney Int. 59, 959–974.
Xie, Y., Sakatsume, M., Nishi, S., Narita, I., Arakawa, M., and Gejyo, F.
(2001b). Expression, roles, receptors, and regulation of osteopontin in the
kidney. Kidney Int. 60, 1645–1657.
Zhou, Y., Vaidya, V. S., Brown, R. P., Zhang, J., Rosenzweig, B. A.,
Thompson, K. L., Miller, T. J., Bonventre, J. V., and Goering, P. L. (2008).
Comparison of kidney injury molecule-1 and other nephrotoxicity
biomarkers in urine and kidney following acute exposure to gentamicin,
mercury, and chromium. Toxicol. Sci. 101, 159–170.