Eur J Plant Pathol

https://doi.org/10.1007/s10658-018-01660-4

Differential development of wilt and stem rot diseases

in grafted bell pepper (Capsicum annuum, L.)
César Guigón-López

Accepted: 5 December 2018

# Koninklijke Nederlandse Planteziektenkundige Vereniging 2019

Abstract In bell pepper production, diseases caused by goal of reducing the use of chemicals, environmen-
soil-borne pathogens are a serious problem. The use of tal pollution and the costs of control in the produc-
chemicals remains the main method for the control of tion of sweet bell pepper.
soil-borne pathogens, with poor results in many cases.
However, grafting has been proposed as an alternative Keywords Grafting . Terrano . Phytophthora capsici .
which can also improve control. The present study Rhizoctonia solani . Fusarium solani
analyses and compares the development of diseases
caused by soil-borne pathogens in grafted and non-
grafted sweet bell pepper plants. Plots of cultivars
Introduction
Fascinato and Janette non-grafted and grafted on
Terrano rootstock were established on a farm man-
Bell pepper (Capsicum annuum L.) is among the world’s
aged under the shaded greenhouse system.
most popular vegetables belonging to the Solanaceae
Phytophthora capsici and Rhizoctonia solani AG4
family. It is one of the most important vegetable crops
were identified causing wilt. Fusarium solani was
in North American countries and, in European countries,
identified causing stem rot. Terrano resisted wilt by
it is one of the five most important vegetable crops
reducing the apparent infection rate and the final
(Lucier and Lin 2001). Generally, these fruits are grown
incidence in the Fascinato variety by 92% and
in high-value production systems such as glasshouses
89%, respectively, and in the Janette variety by
(Bosland et al. 2012; Jovicich et al. 2005).
99% and 98%, respectively. However, Terrano was
In northern Mexico, sweet bell pepper is a high-tech
not resistant to stem rot. Compared to non-grafted
export product, mainly to the United States (SIAP-
plants, Terrano had a higher apparent infection rate
SAGARPA 2017). Unfortunately, bell pepper is strong-
and final incidence, which in Fascinato were 56%
ly affected by soil-borne fungi and nematodes. Crops
and 60%, respectively, and in Janette were 97% and
damage accentuated by intensive production systems
99%, respectively. Terrano also affected the spatial
also generates significant losses.
patterns of both wilt and stem rot. These results
The filamentous oomycete Phytophthora capsici
show that it is necessary to supplement the use of
causes devastating diseases to bell pepper worldwide
Terrano with other strategies. This complicates the
and is responsible for $1 billion in losses in worldwide
vegetable production every year (Lamour et al. 2012).
This fungus causes root and crown rot as well as the aerial
C. Guigón-López (*)
Centro de Investigación para los Recursos Naturales point Salices, blight of leaves, fruit, and stems (Ristaino and Johnston
Chihuahua, Mexico 1999). Symptoms vary considerably according to the
e-mail: c.guigon@cirena.org host, the infected plant part and environmental conditions.

Rhizoctonia solani is a globally distributed, soil-
borne plant pathogen which develops a necrotrophic
lifestyle (González et al. 2006). R. solani is typically a
pathogen of pepper seedlings, causing damping-off, but
it can also cause wilting and death in mature plants. The
fungus is dispersed mainly via sclerotia, contaminated
plant material or soil particles spread by wind, water or
during agricultural practices such as tillage and seed
transportation. The fungus can remain in the soil as a
saprophyte for long periods (González et al. 2006).
Fusarium wilt is the most important soil-borne dis-
ease caused by Fusarium spp. in pepper plants. F. solani
is reported to cause great losses in pepper production in
different countries in the world (Jarvis et al. 1994a;
Sundaramoorthy et al. 2012). F. solani can also affect
the internal parts of the pepper fruit (Yang et al. 2009).
Because of this economic impact of soil-borne path-
ogens, it is critical to have effective control strategies
(Ristaino and Johnston 1999; Lamour et al. 2012).
However, treatment of these sweet pepper soil-borne
pathogens is difficult. In many countries, many farmers
continue to use soil fumigants with increasing costs
(Slusarski and Pietr 2009). Chemical control methods
may not be feasible or economical, as some fungi have
developed resistance to chemicals. Additionally, it is
very difficult to control pathogens in the field once they
have become established, as chemical control and cul-
tural strategies are difficult to implement under
pathogen-favorable conditions.
In addition, synthetic fungicides usually take long
periods of time to be degraded completely, causing heavy
toxicity to humans and domestic animals (Arias et al.
2008). Hence, agronomic controls are good alternatives
against these diseases (Martin 2003). Genetic resistance
or tolerance is often at the center of integrated manage-
ment programmes against soil-borne pathogens.
However, susceptible crop species possess low-to-
moderate levels of genetic resistance (Gisbert et al. 2010).
Where neither genetic resistance nor fungicide man-
agement appear to be efficient, grafting can provide a
suitable tool for integrated management of the main soil-
borne diseases of pepper (Morra and Bilotto 2006;
Martínez-Ballesta et al. 2010; Louws et al. 2010).
Grafting is an environmentally friendly alternative
method for preventing soil-borne diseases in continuous
cropping systems. Peppers are generally grafted onto
rootstocks that are of the same species as the scions
(C. annuum L.) that have resistance to Phytophthora
blight (Jang et al. 2012).
Eur J Plant Pathol
The advantages of grafting are unquestionable.
However, in addition to the above-mentioned advan-
tages, some research has shown that rootstocks resistant
to P. capsici are most promising because they are more
stable and do not affect the plant development or yield of
the commercial varieties (Gisbert et al. 2010). In contrast,
a rootstock line resistant to other soil-borne fungi has
been shown to be more complicated, as the pathogens
show different interactions with different scions (Morra
and Bilotto 2006). Currently, in Mexico the Terrano
rootstock (Syngenta Seeds) is being used as an alterna-
tive for the control of wilt caused by P. capsici. This is
due to their resistance to this fungus and to nematodes, in
addition to their excellent affinity for the main pepper
varieties to which they provide a vigorous root system
and enable balanced vegetative development, favoring a
healthy plant structure (Chávez-Mendoza et al. 2013;
Sánchez et al. 2015). However, information on epidemi-
ological aspects of wilt and other diseases in bell pepper
plants grafted onto Terrano is lacking.
In plant disease epidemiology, characterization of
disease incidence or severity over time is of high impor-
tance for evaluating control treatments (Madden and
Hughes 1995). For example, the analysis of the progress
curve of the disease allows quantification, usually using
least-squares regression analysis (nonlinear or linear) to
estimate parameters, determination of predicted values
for disease, and a comparison of epidemics. Similarly in
spatial analysis, the magnitude of overdispersion, can be
determined and used to analyze treatments effects prop-
erly (Madden and Hughes 1995). The variance-to-mean
ratio (V/M) is routinely calculated to measure aggrega-
tion and test for overdispersion. When there can be no
more than ‘n’ possible individuals in a quadrat,
Morisita’s index is used.
Given the little information available in Mexico, the
objective of this work was to determine the efficiency of
Terrano rootstock in the control of the diseases caused
by soil-borne pathogens in bell pepper plants through
the analysis of the temporal and spatial development of
the diseases.
Methodology
Experimental plot
This work was carried out on a farm in Delicias,
Chihuahua, Mexico in a 1-ha shaded greenhouse system
Eur J Plant Pathol
(38% shade) with white plastic covering an under-
ground drip irrigation system. The soil had a loamy
sandy-clayey texture (29.84% clay, 12.08% silt, and
57.36% sand), inorganic N at 50.17 ppm, P at
64.14 ppm, cation exchange capacity of 32.5 me/
100 g, an electrical conductivity of 0.84 ds/m, organic
matter of 1.68%, and pH of 7.72. The selected plot had a
history of serious problems due to diseases caused by
soil-borne fungi, ensuring enough disease pressure. The
bell pepper cultivars used were Fascinato and Janette
(Syngenta, Co., Houston, TX, USA), and the rootstock
was “Terrano” (Syngenta, Co. Houston. TX, USA). The
height of grafting was 1.5 cm above the first true leaf.
Rows of 90 m in length and thirty-three thousand plants
per hectare were established. There was a 1.5-m distance
between rows and 30 cm between plants for “Terrano”
rootstock and 20 cm for non-grafted plants. The exper-
imental design consisted of randomized complete
blocks with four treatments and four blocks.
Treatments were: (1) Fascinato/Terrano; (2) Janette/
Terrano; (3) non-grafted Fascinato; and (4) non-grafted
Janette. Cultivars without rootstock (non-grafted plants)
served as controls for the Terrano effects. In the second
growing season, only two treatments with the bell pep-
per cultivars Fascinato/Terrano and Janette/Terrano
were established in the same plots.
Sample and microorganism identification
In each block and each growing season, soil and root
samples of diseased plants were collected for the isola-
tion and identification of plant pathogenic fungi. The
identification considered morphological characteristics
and analysis of the complete sequences of internal tran-
scribed spacer 1, the 5.8S ribosomal RNA gene, and
internal transcribed spacer 2. Pure cultures of detected
fungi on potato dextrose agar (PDA) medium were used
to isolate DNA, using a Zymo Fungal/Bacterial 2r DNA
Miniprep kit™ (Zymo Research Corp Irvine, CA
92614, U.S.A.). The quality and quantity of DNA were
verified by agarose gel electrophoresis. The DNA was
used as a template for PCR. The primers utilized were
ITS1 Fw 5´ TCCGTAGGTGAACCTGCGG 3′ and
ITS4 Rv 5´ TCCTCCGCTTATTGATATGC 3′ (Osorio
et al. 2007). The PCRs were performed under the fol-
lowing conditions: one cycle of 95 °C for 10 min;
35 cycles of denaturation at 95 °C for 10 s, annealing
at 56 °C for 50 s and extension at 72 °C for 30 s; and a
final extension for 15 min at 72 °C. Each reaction
contained the following amounts of each component:
1 μL of DNA, 2 μL of primer mix, 22.5 μL of master
mix, and 24.5 μL nuclease-free water necessary to reach
a volume of 50 μL. The amplified products were veri-
fied by agarose gel electrophoresis. They were then
purified using the PureLink PCR Purification Kit™
(Zymo) and sent for sequencing to the Unity of
Synthesis and Sequencing of Biotechnology Institute,
National Autonomous University of Mexico,
Cuernavaca, Morelos, Mexico. Sequence analysis was
performed using BioEdit. BLAST was performed using
the NCBI database. The sequences data were submitted
to GenBank NCBI. In order to identify the AG subgroup
of the R. solani, Molecular Evolutionary Genetics
Analysis version 7.0 (MEGA7) software were used to
build a phylogenetic tree for ITS regions with 60
R. solani sequences of different AG subgroups obtained
from GenBank. The phylogenetic tree was constructed
according to the neighbor-joining algorithm.
Disease progress curves analysis (temporal analysis)
Diseased plants in each block were recorded weekly
from the establishment (March) until the end (October)
of the crop season. Different sample points were distrib-
uted in the blocks. At each sample point, 30 plants
distributed along the three rows were evaluated.
Incidence was determined as the percentage of diseased
plants. Incidence data were transformed by ln(1/(1-x)),
and regression was used to determine the apparent in-
fection rate. The temporal analysis of disease was car-
ried out for two crop seasons.
Spatial distribution of diseased plants (spatial analysis)
The spatial distribution of diseased plants was deter-
mined by means of indices that stimulated the degree
of aggregation:
Relative variance (variance/mean ratio; González et al.
2014)
The relative variance is determined by:
 
S2 =X ¼ Σ Xi−X 2=n−X
where:
S2 = variance, ̅=
X mean, Xi = individual numbers in
i-th quadrant, and n = individual numbers in the sample.

A variance/mean (V/M) value less than 1 indicates a
uniform distribution, a value equal to 1 indicates a
random distribution and, a value greater than 1indicates
an aggregate distribution. The statistical significance of
the V/M ratio was determined by the Xi2 test:
  2 
X i2 ¼ 1=Xn Σ Xi−X
Morisita’s index (Zarco-Espinosa et al. 2010)
The Morisita’s index is determined by:
Iδ ¼ q Σni ðni−1Þ=NðN−1Þ
where:
Iδ = spatial distribution index, q = quadrant number,
ni = individual numbers in the i-th quadrant, and N =
total number of individuals in all q quadrants.
Iδ values less than, equal to or greater than 1 indicate
a uniform, random or aggregate distribution,
respectively.
The values of two different treatments were compared
by David and Moore’s index (I) (Dale et al., 2002):
 
I ¼ S2 =X −1
Considering X1 and X2 the means and S21 and S22
the variances of the samples of “n” size of the two
populations, were calculated the “W” statist as follows:
   
W ¼ −1=2 Ln S2 1 =X1 = S2 2 =X2 :
Statistical significance (population 1 is different from
population 2) (P < 0.05) is considered when W is out of
range − 2.5/√(n-1), +2.5/√(n-1).
Reduction of plant population
Although this study was not established to estimate crop
losses, an estimation of the reduction of plants attributed
to wilt and stem rot was made in the second growing
season. During each weekly sampling, once the plants
showed irreversible damage, they were removed from
the soil. The calculation was made based on the initial
and final quantity of plants per treatment. Of the remain-
ing plants at the end of the growing season, those that
were infected (diseased plants) were quantified. This
analysis assumes that the other factors involved in the
Eur J Plant Pathol
crop (including other diseases) affected each block in
the same way.
Results
The diseases detected affecting bell pepper were wilt
and stem rot. Wilt was characterized by root and crown
rot of plants. Stem rot showed the development of soft,
dark brown or black necrotic lesions on the stems.
Salmon-white cottony-like mycelia were also present
on the surface of stem lesions. Both diseases restrict
the upward movement of water, resulting in wilting of
the plants (Fig. 1). From plants affected by wilt, two
microorganisms were identified (Table 1).
a) P. capsici (GenBank accession number:
MF093754). This Oomycete presented compact
colonies with abundant aerial and cenocitic hyphae,
cottony and softly radiated. Hyaline mycelium,
branched, with swellings and vesicles, piriform
sporangia, with prominent papilla, deciduous.
b) A sterile mycelium, typical of R. solani (GenBank
accession number: MF093753) was also isolated.
Phylogenetic analysis of ITS region (Fig. 2) indi-
cated that it is R. solani AG4. These pathogens,
P. capsici and R. solani, were often present together
in the same plant and were isolated with the same
frequency.
From stem rot, in grafted or non-grafted plants, one
microorganism was identified (Table 1): Fusarium
solani (GenBank accession number: MF093752). This
fungus presented cotton-colored mycelium, septate,
cream-colored. Unicellular, ovoid, kidney-shaped
microconidia, produced in individual conidiophores or
in pairs and lengths. Macroconidia in the form of a
canoe or a half moon, with 1–4 septa. Globose
chlamydospores.
Analysis of bell pepper wilt
Temporal analysis
Wilt affected the plants in the different combinations
studied, although grafted plants greatly exhibited re-
duced incidence. The disease was observed 35 days
after transplanting (dat) (Fig. 3) and, in non-grafted
Eur J Plant Pathol

Fig. 1 Bell pepper plants affected by wilt (a) and root rot of plants infected with P. capsici and R. solani (b). Bell pepper stem rot (c) and
necrotic lesions with salmon-white cottony-like mycelia of F. solani (d)

plants, presented high apparent infection rates (“r”) 85 Spatial analysis

dat. In plants grafted on Terrano, the “r” was much
lower; therefore, at the end of the crop cycle the inci-
dence of diseased plants was very low. In the Fascinato
variety, the use of Terrano rootstock represented reduc-
tions of 92% in “r” and 89% in the final incidence of
diseased plants. In the Janette variety, the use of Terrano
reduced “r” by 99% and final incidence by 98%.
When non-grafted, wilted plants grew in aggregates. This
spatial distribution exhibited variable aggregation rates
during the growth cycle (Table 2). In grafted plants, the
spatial distribution was unchanged throughout the cycle,
except in two cases. In Janette/Terrano, the spatial distri-
bution of wilted plats was random (V/M = 1.27, Iδ = 1.6,

Table 1 Microorganism identified in diseased bell pepper plants

Disease/Organism Sequences producing significant alignments Score* Query cover (%) E value Ident (%)

Wilt/Phytophthora capsici Phytophthora capsici strain UACH-GAQ62 737 99 0.0 90

GenBank: KM288418.1
Wilt/Rhizoctonia solani Rhizoctonia solani isolate: HG-I 78-23R-3 1206 95 0.0 100
GenBank: AB000007.1
Stem rot/Fusarium solani Fusarium solani strain DI12 883 93 0.0 99
GenBank: KF918580.1

*Similarity values (score, query cover, E value and ident) according to the comparison by Blast (NCBI) of nucleotide sequences to sequence
databases and calculation of statistical significance

Fig. 2 Phylogenetic tree of Rhizoctonia solani. The R. solani of
this work is identified as Rhizoctonia solani Delicias Mexico. The
optimal tree with the sum of branch length = 0.96023389 is shown.
The evolutionary history was inferred using the Neighbor-Joining
Xi2 P > 0.05) in both cropping seasons. On the contrary,
in Fascinato/Terrano, during the first cropping season, the
distribution was aggregated (V/M = 2.22, Iδ = 2.35, Xi2
P < 0.01). In the second growing season, the distribution
was random (V/M = 0.125, Xi2 P > 0.01).
The comparison between treatments indicated that the
spatial distribution of wilted plants was different in all
treatments (Table 3). When plants were grafted on
Terrano rootstock, spatial distribution rates were un-
changed throughout the cycle; hence, the comparison
between treatments was made only once. In non-grafted
plants, since the aggregation indices of wilted plants were
variable during the growing cycle, the spatial distribution
was different during the first three dates of the epidemics
(Table 4). The distribution was similar for most of the
crop cycle but again differed for the last two dates.
Analysis of bell pepper stem rot
Temporal analysis
According to the disease progress curves, the use of
a rootstock did not control stem rot. Disease
Eur J Plant Pathol
method. The bootstrap values (1000 replicates) are shown next to
the branches. The analysis involved 31 nucleotide sequences.
Evolutionary analyses were conducted in Molecular Evolutionary
Genetics Analysis version 7.0 (MEGA7)
incidence was higher in grafted plants. The onset
of the epidemic was delayed approximately 100 days
with respect to that observed for wilt (Fig. 3). The
first diseased plants were observed 131 dat, and the
epidemics were characterized by a larger apparent
infection rate (“r”) in the grafted plants. These “r”
values were higher than in the case of the wilt; and,
consequently, at the end of the cycle the incidence
of diseased plants was also higher. Compared to the
non-grafted plants, Fascinato/Terrano resulted in a
56% increase in “r” and a 60% increase in the final
incidence of stem rot. For Janette/Terrano, there was
a 97% increase in “r” and a 99% final incidence.
The “r” of Fascinato was 50% less than that of
Janette, and the final incidence was also 39% less.
In the first growing season, the stem rot incidence
was four times higher in the non-grafted Fascinato
cultivar than in ungrafted Janette. However, in for
Janette/Terrano, stem rot incidence was more than
two times higher than in Fascinato/Terrano. In the
second growing season, the disease progress curves
of Fascinato/Terrano and Janette/Terrano were
identical.
Eur J Plant Pathol

Fig. 3 Progress curves of wilt Wilt and Stem Rot Incidence First Crop Season
(W) and stem rot (SR) in 100
Wilt r Stem rot r F/T W
ungrafted (UG) or grafted bell 90 F/T = 0.0256 R2= 0.7638 J/T W
F/T = 0.0029 R2= 0.8319
pepper plants. Cultivars Fascinato 80 J/T= 0.0008 R2= 0.7145 J/T= 0.0509 R2= 0.9551 F UG W
F UG= 0.0366 R2= 0.9689 F UG= 0.0112 R2= 0.9225
(F) and Janette (J) plants were 70 J UG W

Incidence (%)
J UG= 0.0865 R = 0.9571 J UG= 0.0006 R = 0.3750
grafted on Terrano (T) rootstock. 60 F/T SR
The ¨r¨ value represents the 50 J/T SR
apparent infection rate (u/u/day) F UG SR
40
J UG SR
and was calculated by regression 30
of transformated data by (ln 1 (1- 20
x). R2 is determination coefficient 10
and represents the fit of the model 0

36
43
50
57
64
71
78
85
89
95
100
116
123
131
138
146
152
160
174
188
Days after transplant

Wilt and Stem Rot Incidence Second Crop Season

100

Wilt r Stem rot r

80
F/T = 0.0035 R2= 0.9285 F/T = 0.3907 R2= 0.9651
Incidence (%)

J/T= 0.0008 R2= 0.9202 J/T= 0.3784 R2= 0.9446 J/T W

60 F/T W
J/T SR
40
F/T SR

20

0
50 58 65 72 79 86 92 99 103 117 131 145 172 188 208 222
Days after transplant

Spatial analysis

The spatial distribution of diseased plants varied slightly

between cultivars (Table 5). For Janette, the diseased
plants were initially distributed in aggregates and from
Table 2 Spatial distribution indices of ungrafted bell pepper August thereafter in a regular pattern. For Fascinato, the
wilted plants
distribution of diseased plants was always regular.
Date Fascinato Janette

V/M Iδ V/M Iδ Reduction of plant population

June 26 2.30 ** 1.2363 6.94 ** 1.3493 During the second cropping cycle, the loss of plants due
July 2 2.84 ** 1.3004 5.99 ** 1.2839 to stem rot was higher than the loss due to wilt (Fig. 4).
July 7 2.94 ** 1.2590 6.00 ** 1.2720 The losses of plants due to wilt were minimal, ranging
July 23 3.42 ** 1.2549 5.42 ** 1.2107 from 1 to 3%, while losses of plants due to stem rot
July 30 4.16 ** 1.2931 5.09 ** 1.2146 ranged from 65% in cultivar Janette to 71% in
August 7 4.19 ** 1.2745 5.55 ** 1.2032 Fascinato. Of the plants that remained in the plots,
August 13 4.02 ** 1.2467 5.37 ** 1.1917 28% of Janette were infected as well as 24% of
August 21 4.28 ** 1.2527 4.90 ** 1.1638 Fascinato.
August 27 4.37 ** 1.2566 5.02 ** 1.1677
September 4 4.56 ** 1.2589 3.39 ** 1.0926
September 18 4.95 ** 1.2400 2.92 ** 1.0719 Discussion
October 2 5.29 ** 1.2439 2.18 ** 1.0407

** = Significant Xi2 P < 0.01. V/M = Variance/Mean Ratio. Iδ = In this work, an experimental field was selected in
Morisita Spatial Distribution Index which continuous bell pepper and tomato cropping in
 Eur J Plant Pathol

Table 3 Statistical comparison of spatial distribution of wilted plants in the treatments

Treatment I* Comparison W** Significance***

1 (Fascinato/Terrano) 1.2214 IT1 vs IT2 −0.7498 Different

2 (Janette/Terrano) 0.2726 IT1 vs IT3 0.8499 Different
3 (Ungrafted Fascinato) 6.6854 IT1 vs IT4 1.4432 Different
4 (Ungrafted Janette) 21.8996 IT2 vs IT3 1.5998 Different
– – IT2 vs IT4 2.1931 Different

* David y Moore Index. ** W statist. ***P < 0.05; Interval − 0.2649 to +0.2649. IT = David and Moore Index of traetment

previous years increased the incidence of diseases relat- therefore the control strategy must be different for these
ed to soilborne pathogens. These conditions allowed for different host–pathogen interactions (Jang et al. 2013).
an evaluation of the Terrano rootstock. The results con- In determining how plant diseases can best be man-
firm the advantages of grafting for protecting against aged, understanding how disease levels increase over
some soil-borne diseases. “Terrano” appeared to be time and comparisons between patterns of disease prog-
good rootstock due to resistance shown to P. capsici ress for different cultivars or management strategies can
and R. solani. Our results show a larger reduction of help (Arneson 2001; Madden et al. 2007). In this work,
wilting than that reported previously (Sánchez et al. disease progress curves were different between grafted
2015), similar to the effect of “Terrano” on the cultivar and non-grafted plants. Assuming environmental factors
Fiume, which provides complete control of the wilt were the same for all plant/rootstock combinations,
(Gilardi et al. 2013). differences in progress over time can be attributed to
However, although bell pepper plants grafted on resistance/susceptibility of plants to soil-borne fungi.
Terrano showed high resistance to P. capsici and The resistance to wilt is complex and related to poly-
R. solani, these plants also showed high susceptibility genic Capsicum annum-P. capsici interactions (Castro-
to F. solani. This indicates that susceptibility of grafted Rocha et al. 2012). Several work has related resistance
bell pepper to soil-borne plant pathogens is variable, to the synthesis and accumulation of β-1,3-glucanases,
the phytoalexin capsidiol, a basic PR-1 protein, a class II
chitinase and a sesquiterpene cyclase (Jin and Kook
Table 4 Statistical comparison of spatial distribution of wilted 1994; García et al. 1998 and Veloso and Díaz 2012).
plants in ungrafted Fascinato and ungrafted Janette With regard to stem rot caused by F. solani, there are no
Date IF IJ W Significance*
reports about resistance in Terrano. However, systemic
resistance of pepper to Fusarium diseases, induced by
June 26 6.68 21.89 0.5932 Different bacteria, is related to the enhanced activities of peroxi-
July 2 8.33 19.08 0.4139 Different dases, polyphenol oxidases, phenylalanine ammonia-
July 7 8.87 19.05 0.3822 Different
July 23 10.20 17.08 0.2574 Not different
July 30 12.78 15.98 0.1117 Not different
Table 5 Spatial distribution of bell pepper stem rot in plants
August 7 12.89 17.45 0.1512 Not different grafted on Terrano
August 13 12.41 17.11 0.1605 Not different
August 21 13.28 15.34 0.0722 Not different Treatment V/M Significance Distribution
August 27 13.52 15.85 0.0791 Not different
July August July August July August
September 4 14.10 10.51 −0.1468 Not different
September 18 15.36 8.82 −0.2770 Different Janette 1.6769 0.1932 * * Agregated Regular
October 2 16.63 6.33 −0.4825 Different Fascinato 0.7882 0.2147 * * Regular Regular

IF = David and Moore Index of Fascinato. IJ = David and Moore * = Significant (P < 0.05%) according to X2 test. V/M = Variance/
Index of Janette. W = W statist. *P < 0.05; Interval − 0.2649 to Mean Ratio. Only show data of July and August. After august
+0.2649 spatial distribution was regular
Eur J Plant Pathol
100
90
Initial
80
Final
70
Diseased
Plants (%)
60
50
40
30
20
10
0 (Fletcher 1994; Jarvis et al. 1994b). To understand the
Janette/Terrano Facinato/Terrano
Fig. 4 Set of plants in the experimental plots at the beginning
(initial) and at the end (final) of the second crop cycle. The
difference between initial set and final set represents the loss of
plants and is attributed to stem rot disease. Diseased plants refers to
the percentage of plants that are diseased from the total of plants
that remained until the end of the cycle
lyase, β-1,3-glucanase, chitinase and phenolics in-
volved in the synthesis of phytoalexins
(Sundaramoorthy et al. 2012). Nevertheless, in the
development of stem rot, the insensitivity of
F. solani to the action of defence-related proteins
from the pepper plant may be involved (Van Loon
et al. 2006). It is known that F. solani f.sp. eumartii
produces a serine protease of the subtilisin family
that degrades pathogenesis-related proteins of potato
(Olivieri et al. 2002).
Thus, the differences in diseases progress over time
confirm the efficiency of the Terrano rootstock to con-
trol wilt. However, these differences also show that in
grafted plants the apparent infection rate of stem rot was
increased in such a way that this disease was not con-
trolled and other measures that complement its use are
needed. The disease progress curves also show that the
critical period of stem rot begins about 130 days after
transplanting, when the apparent infection rate of the
disease increases.
Spatial patterns are often analysed to draw inference
about the spread of the disease (Arneson 2001; Barnes
et al. 2005). Our results show that use of Terrano affect-
ed the spatial patterns of both wilt and stem rot. The
main pattern of wilt was in aggregation but in grafted
plants it was random, possibly due to the low incidence
of the disease. The distribution of the shoot rot for most
of the cropping cycle was regular. F. solani produces
conidia in large numbers that are transmitted passively
(Cerkauskas 2001); thus, it is possible that conidia are
dispersed onto clothing or on workers’ hands. In this
work, the important increment of disease incidence was
observed when worker activity increased, as pepper
growth requires increasing amounts of cultural practices
and during harvest. Therefore, it is important that the
management of the disease considers this mechanism of
dispersion.
The susceptibility of grafted plants to stem rot was
noticeable. These results are important since F. solani
has been reported in pepper in commercial greenhouses
where it causes serious losses in fruit yield and plants
magnitude of the problem of stem rot, the loss of plants
due to disease was quantified during the second
cropping cycle. Wilt damage was not significant after
July, but thereafter, stem rot became important. Once the
plants showed severe damage, they were removed from
the soil. Since wilt showed very low levels, the loss of
plants was attributed mainly to stem rot. Hence, it was
noteworthy that this disease can be as destructive as wilt
and use of Terrano is not enough and therefore it is
requires a more efficient management system for its
control. In this attempt, it will be necessary to take into
account other factors such as amendments to soil fertil-
ity and farming practices which may have significant
impacts on the temporal and spatial components of
epidemics (Liu et al. 2008).
Conclusions
Grafting on Terrano rootstock could constitute a better
tool for the integrated management of the wilt of pepper,
but would be insufficient for the management of stem
rot. Therefore, it is necessary to supplement grafting on
Terrano rootstock with chemicals, although production
costs would remain high. This also complicates the goal
of reducing the use of chemicals and environmental
pollution during the production of sweet bell pepper.
References
Arias, E. M., López, P. E., Martínez, C. E., Simal, G. J., Mejuto, J.
C., & García, R. L. (2008). The mobility and degradation of
pesticides in soils and the pollution of groundwater resources.
Agriculture, Ecosystems and Environment, 123, 247–260.
Arneson, P.A. (2001). Plant disease epidemiology: Temporal as-
pects. The Plant Health Instructor. On-line https://doi.
org/10.1094/PHI-A-2001-0524-01. (Revised 2011).
Barnes, C. W., Kinkel, L. L., & Groth, J. V. (2005). Spatial and
temporal dynamics of Puccinia andropogonis on Comandra
umbellata and Andropogon gerardii in a native prairie.
Canadian Journal of Botany, 83, 1159–1173.

Bosland, P. W., Votava, E. J., & Votava, E. M. (2012). Peppers:
Vegetable and spice capsicums (Vol. 22). New York: Cabi.
CABI Publishing.
Castro-Rocha, A., Fernández-Pavia, S. P., & Osuna-Ávila, P.
(2012). Mecanismos de defensa del chile en el patosistema
Capsicum annuum-Phytophthora capsici. Revista Mexicana
de Fitopatología, 30, 49–65.
Cerkauskas, R.F. (2001). Fusarium stem and fruit rot of green-
house pepper. [Guelph]: Ontario, Ministry of Agriculture,
Food and Rural Affairs.
Chávez-Mendoza, C., Sánchez, E., Carvajal-Millán, E., Muñoz-
M á r q u e z , E . , & G u e v a r a - A g u i l a r, A . ( 2 0 1 3 ) .
Characterization of the nutraceutical quality and antioxidant
activity in bell pepper in response to grafting. Molecules,
2013, 15689–15703.
Dale, R. T. M., Dixon, P., e Fortin, M. J., Legendre, P., Myers D. E.
́ Review of Phytopathology, 33, 529–564.
and Rosenberg, M. S. (2002). Conceptual and mathematical
relationships among methods for spatial analysis. Ecography,
25, 558–577.
Fletcher, J. T. (1994). Fusarium stem and fruit rot of sweet peppers
in the glasshouse. Plant Patholology, 43, 225–227.
García, P. M. D., Egea, C., & Candela, M. E. (1998). Defence
response of pepper (Capsicum annuum) suspension cells to
Phytophthora capsici. Physiologia Plantarum, 103, 527–
533.
Gilardi, G., Baudino, M., Moizio, M., Pugliese, M., Garibaldi, A.,
& Gullino, M. L. (2013). Integrated management of
Phytophthora capsici on bell pepper by combining grafting
and compost treatment. Crop Protection, 53, 13–19.
Gisbert, C., Sánchez, T. P., Raigón, M. D., & Nuez, F. (2010).
Phytophthora capsici resistance evaluation in pepper hy-
brids: Agronomic performance and fruit quality of pepper
grafted plants. Journal of Food, Agriculture & Environment,
8, 116–121.
González, G. V., Portal, O. M. A., & Rubio, S. V. (2006). Review.
Biology and systematics of the form genus Rhizoctonia.
Spanish Journal of Agricultural Research, 4, 55–79.
González, S. M. G., Bautista, M. N., Romero, N. J., Rebollar, A.
A., Carrillo, S. J. L., & Hernández, F. L. M. (2014).
Population fluctuation and spatial distribution of Trioza
aguacate (Hemiptera: Triozidae) on avocado (Lauraceae) in
Michoacan, Mexico. Florida Entomologist, 97, 1783–1793.
Jang, Y., Yang, E., Cho, M., Um, Y., Ko, K., & Chun, C. (2012).
Effect of grafting on growth and incidence of Phytophthora
blight and bacterial wilt of pepper (Capsicum annuum L.).
Horticulture, Environment and Biotechnology, 53, 9–19.
Jarvis, W. R., Barrie, S. D., & Khosla, S. K. (1994a). Nectria
haematococca as a stem and fruit pathogen of sweet pepper
in the greenhouse. Plant Disease, 78, 926.
Jarvis, W. R., Khosla, S. K., & Barrie, S. D. (1994b). Fusarium
stem and fruit rot of sweet pepper in Ontario greenhouses.
Canadian Plant Disease Sum, 74, 131–134.
Jin, K. Y., & Kook, H. B. (1994). Differential accumulation of β-1,
3-glucanase and chitinase isoforms in pepper stems infected
by compatible and incompatible isolates of Phytophthora
capsici. Physiological and Molecular Plant Pathology, 45,
195–209.
Jovicich, E., VanSickle, J. J., Cantliffe, D. J., & Stoffella, P. J.
(2005). Greenhouse-grown colored peppers: A profitable
alternative for vegetable production in Florida?
HortTechnology, 15, 355–369.
Eur J Plant Pathol
Lamour, K. H., Stam, R., Jupe, J., & Huitema, E. (2012). The
oomycete broad-host-range pathogen Phytophthora capsici.
Molecular Plant Pathology, 13, 329–337.
Liu, B., Gumpertz, M. L., Hu, S., & Ristaino, J. B. (2008). Effect
of prior tillage and soil fertility amendments on dispersal of
Phytophthora capsici and infection of pepper. European
Journal of Plant Pathology, 120, 273–287.
Louws, J. F., Rivard, L. C., & Kubota, C. (2010). Grafting fruiting
vegetables to manage soilborne pathogens, foliar pathogens,
arthropods and weeds. Scientia Horticulturae, 127, 127–146.
Lucier, G. and Lin, B.H. (2001). Sweet peppers: Saved by the bell.
Agricultural outlook. Economic Research Service/USDA,
pp. 12–15.
Madden, L. V., & Hughes, G. (1995). Plant disease incidence:
Distributions, heterogeneity, and temporal analysis. Annual
Madden, L. V., Hughes, G., & Van den Bosch, F. (2007). The study
of plant disease epidemics. The American Phytopathological
society. Minnesota: APS Press St. Paul.
Martin, N. F. (2003). Development of alternative strategies for
management of soilborne pathogens currently controlled
with methyl bromide. Annual Review of Phytopathology,
41, 325–350.
Martínez-Ballesta, M. C., Alcaraz-López, C., Muries, B., Mota-
Cadenas, C., & Carvajal, M. (2010). Physiological aspects of
rootstock–scion interactions. Scientia Horticulturae, 127,
112–118.
Morra, L., & Bilotto, M. (2006). Evaluation of new rootstocks for
resistance to soil-borne pathogens and productive behaviour
of pepper (Capsicum annuum L.). Journal of Horticultural
Science & Biotechnology, 81, 518–524.
Olivieri, F., Zanetti, M. E., Oliva, C. R., Covarrubias, A. A., &
Casalongue, C. A. (2002). Characterization of an extracellu-
lar serine protease of Fusarium eumartii and its action on
pathogenesis related proteins. European Journal of Plant
Pathology, 108, 63–72.
Osorio, S., de la Cámara, R., Monteserin, M. C., Granados, R.,
Oña, F., Rodriguez-Tudela, J. L., & Cuenca-Estrella, M.
(2007). Recurrent disseminated skin lesions due to
Metarrhizium anisopliae in an adult patient with acute mye-
logenous leukemia. Journal of Clinical Microbiology, 45,
651–655.
Ristaino, J. B., & Johnston, S. A. (1999). Ecologically based
approaches to management of Phytophthora blight on bell
pepper. Plant Disease, 83, 1080–1089.
Sánchez, C.E., Torres, G.A., Flores, C.M.A., Rangel, P.P. y
Márquez, Q.C. (2015). Uso de portainjerto sobre el
rendimiento, calidad del fruto y resistencia a Phytophthora
capsici Leonian en pimiento morrón. Revista Electrónica
Nova Scientia, 15, 227–244.
SI A P - SA G A R PA. ( 2 0 1 7) . S e r v i c i o d e I n f o r m a c i ó n
Agroalimentaria y Pesquera. Anuario de Estadísticas
Agrícolas. https://www.nube.siap.gob.mx. (Revised 2018).
Slusarski, C., & Pietr, J. S. (2009). Combined application of
dazomet and Trichoderma asperellum as an efficient alterna-
tive to methyl bromide in controlling the soil-borne disease
complex of bell pepper. Crop Protection, 28, 668–674.
Sundaramoorthy, S., Raguchander, T., Ragupathi, N., &
Samiyappan, R. (2012). Combinatorial effect of endophytic
and plant growth promoting rhizobacteria against wilt disease
Eur J Plant Pathol
of Capsicum annum L. caused by Fusarium solani.
Biological Control, 60, 59–67.
Van Loon, L. C., Rep, M., & Pieterse, C. M. J. (2006).
Significance of inducible defense-related proteins in infected
plants. Annual Review of Phytopathology, 44, 135–162.
Veloso, J., & Díaz, J. (2012). Fusarium oxysporum Fo47 confers
protection to pepper plants against Verticillium dahliae and
Phytophthora capsici, and induces the expression of defence
genes. Plant Pathology, 61, 281–288.
Yang, J., Kharbanda, P. D., Howard, R. J., & Mirza, M. (2009).
Identification and pathogenicity of Fusarium lactis, causal
agent of internal fruit rot of greenhouse sweet pepper in
Alberta. Canadian Journal of Plant Pathology, 31, 47–56.
Zarco-Espinosa, V. M., Valdez-Hernández, J. I., Ángeles-Pérez,
G., & Castillo-Acosta, O. (2010). Estructura y Diversidad de
la Vegetación Arbórea del Parque Estatal Agua Blanca,
Macuspana, Tabasco. Universidad y Ciencia, 26, 1–17.