Olja Crni, Nina Koljeraj & ja :)

http://pubs.acs.org/journal/acsodf Article

Quantification of a Neurological Protein in a Single Cell Without

Amplification
Donggyu Lee, Youngsik Woo, Ji-seon Lim, Ikbum Park, Sang Ki Park,* and Joon Won Park*
Cite This: ACS Omega 2022, 7, 20165−20171 Read Online

ACCESS Metrics & More Article Recommendations *

sı Supporting Information
See https://pubs.acs.org/sharingguidelines for options on how to legitimately share published articles.

ABSTRACT: Proteins are key biomolecules that not only play

various roles in the living body but also are used as biomarkers. If
these proteins can be quantified at the level of a single cell,
understanding the role of proteins will be deepened and diagnosing
Downloaded via UNIV OF RIJEKA on October 6, 2022 at 09:00:00 (UTC).

diseases and abnormality will be further upgraded. In this study, we

quantified a neurological protein in a single cell using atomic force
microscopy (AFM). After capturing specifically disrupted-in-
schizophrenia 1 (DISC1) in a single cell onto a microspot
immobilizing the corresponding antibody on the surface, force
mapping with AFM was followed to visualize individual DISC1.
Although a large variation of the number of DISC1 in a cell was
observed, the average number is 4.38 × 103, and the number agrees
with the ensemble-averaged value. The current AFM approach for the quantitative analysis of proteins in a single cell should be
useful to study molecular behavior of proteins in depth and to follow physiological change of individual cells in response to external
stimuli.

■ INTRODUCTION
Proteins are utmost important to biological processes,
providing structural supports, transporting molecules, control-
ling cell growth and adhesion, regulating cell signaling, and
catalyzing biochemical reactions.1,2 Therefore, accurate protein
quantification is essential for studying cellular mechanisms,
elaborating diagnostics, and pursuing drug discovery and
developments.3 A lot of methods and tools have been
developed, and examples are gel electrophoresis, immunoassay,
chromatography, and mass spectrometry.4−6 However, these
methods require a large number of cells because of the limited
sensitivity and show ensemble-averaged results.7 For this
reason, new methods enabling quantification of a specific
protein in a single cell are highly desirable and anticipated.
Atomic force microscopy (AFM) has been used to study
molecular interactions of ligand−receptor, DNA−DNA, and
antigen−antibody at the single-molecule level.8−20 Further-
more, AFM force mapping can show the target molecule
distribution on a sample surface by recording the force−
distance (FD) curve at a high resolution.21 Recently, we
demonstrated that such AFM analysis quantifies specific DNA
and miRNA of a low copy number without labeling or
amplification.22−24
In this study, we employed force-based AFM to quantify a
specific protein in a single cell. Previously, Roy et al.25
visualized prostate-specific antigen captured on the surface,
and because they utilized a conventional microarrayer to
generate the capture spot, the observed limit of detection
(LOD) was a few femtomoles of concentration. In order to
© 2022 The Authors. Published by
American Chemical Society
20165
enhance LOD that is good for the single-cell analysis, we
adopted the FluidFM technology to fabricate capture antibody
spots of a few micrometers in diameter, and the combined
approach was able to quantify the target protein in a single
cell.26
The target protein is disrupted-in-schizophrenia 1 (DISC1),
and it is a major susceptibility factor for schizophrenia. It was
first identified as a gene disrupted by the translocation in
chromosome 1 and discovered from a pedigree in which many
family members suffered from major psychosis.27 DISC1
participates in neuro-developmental processes including neuro-
genesis, neuronal migration, neurite outgrowth, dendritic spine
maturation, and adult neurogenesis,28−36 and it regulates
microtubule-based motor activities, cAMP signaling, tran-
scription factor activities, and mitochondrial functional-
ities.37−44
■ RESULTS
Capture Antibody Spot Fabrication and AFM Force
Mapping of Captured DISC1. The FluidFM technology was
used to fabricate capture antibody spots, in which a
Received: April 1, 2022
Accepted: May 25, 2022
Published: June 2, 2022
https://doi.org/10.1021/acsomega.2c02009
ACS Omega 2022, 7, 20165−20171
ACS Omega http://pubs.acs.org/journal/acsodf Article

Figure 1. Experimental scheme for the analysis of DISC1 protein with AFM. For the quantification of DISC1 protein, a single cell was lysed and
DISC1 proteins were bound to a capture antibody spot. The capture antibody/DISC1 immune complex was detected by observing specific force−
distance curves upon the approach and retraction of the detection antibody tip. Bound DISC1 proteins show themselves as clusters on the adhesion
force map. Scale bar, 2.0 μm.

Figure 2. AFM image of a capture spot and representative force maps. (a) Optical microscopy image of a capture antibody spot. Scale bar, 5.0 μm.
(b) AFM height image of the etched square box. Scale bar, 5.0 μm. (c) AFM height image of a capture antibody spot. Numbered small squares are
the areas where AFM force mapping was performed. Scale bar, 5.0 μm. (d) Force maps of three colored positions in the immune complex spot.
Colored pixels show that specific unbinding events were observed more than twice out of five measurements (100 × 100 pixels, 400 × 400 nm2).
Five qualified clusters in the maps are evident.

microchanneled cantilever equipped with a pyramidal tip of
600 nm aperture was employed.26 The microchannel was filled
with the capture antibody solution, and the solution was
spotted onto a glass slide coated with a 27-acid dendron45 and
finally activated with N-hydroxysuccinimide (NHS). The
typical spot diameter was in the range of 7−20 μm. To locate
the antibody spot effectively for the force mapping with AFM,
a glass slide marked by multiple micron-sized square boxes
through the photolithographic etching was used (Figure S1),
and positional coordinates of the spot were recorded after the
spotting.
20166
After allowing DISC1 to be captured on the spot, thus-
formed immune complexes were chemically cross-linked to
avoid sporadic detachment during AFM examination.46 FD
curves were collected on the capture spot at a resolution of 3.0
or 4.0 nm, and the specific unbinding events were recorded
when the detection antibody on the AFM tip binds with
DISC1/capture antibody immune complexes (Figure 1). The
selected detection antibody binds to an epitope free after the
formation of the immune complex in the capture spot. The FD
curves were recorded five times at each pixel at 3.0 nm
intervals across a selected area (60 nm × 60 nm) and marked
only when no less than 40% specific FD curves were observed
https://doi.org/10.1021/acsomega.2c02009
ACS Omega 2022, 7, 20165−20171
ACS Omega http://pubs.acs.org/journal/acsodf Article

(in other words, two times out of five measurements).

4.83 × 103

3.83 × 104
6.65 × 102
Gaussian fitting shows the most probable adhesion force of

mean

mean
44.0 ± 12.8 pN and the stretching distance of 7.6 ± 2.6 nm

0
(Figure S2). The adhesion force value is similar to the ones
observed from other antigen−antibody pairs.15
The cluster radius (Rc) was measured by ellipse fitting to

4
identify the hydrodynamic radius of the target protein.47 Three

1.06 × 10
spot 10
clusters were identified from three different locations, and the
average cluster radius was 7.8 ± 0.4 nm (Figure S3). Based on
the value, we were able to determine the optimized pixel size
(4 nm) in which DISC1 shows itself as a cluster in the force

3
map (with a too large pixel, the scanning is speedy but may

6.9 × 10
spot 9
miss DISC1 on the surface, and with a too small pixel, DISC1
will show up as an evident cluster, but the time efficiency is
deteriorated). Therefore, we examined the selected area (400
nm × 400 nm) at each 4 nm (100 × 100 pixels). We counted

3
1.99 × 10
clusters at three representative locations in a spot and

spot 8
calculated the total number of the bound protein in the entire
spot by assuming uniform distribution and homogeneity.
As a control, NDEL1 (another neurological protein exists in
the same cell) was allowed to the surface and FD curves were

3
1.79 × 10
number of DISC1 in a single cell or 10 cells
collected. Because the specific FD curve was not observed at all

spot 7
(Figure S4), it is confirmed that the current AFM analysis is
specific to DISC1.

The samples corresponding to 10 cells were prepared through serial dilution of the lysed solution of 4 × 105 sorted cells.
Quantitative Analysis of DISC1 Protein in a Single
Cell. As a first step, DISC1 proteins obtained from lysed

3
8.83 × 10
HEK293 cells were analyzed. We prepared 4 × 105 sorted cells
spot 6
through the cell culture, and fractionation, lysis, and serial
dilution made lysed samples corresponding to 10 cells. Each
sample was allowed to react with the antibody in the spot of 20
μm. AFM force mapping was performed at three representative
3
3.43 × 10

locations in two independently prepared immune complex

spot 5

spots. The observed cluster numbers were 19 and 20, and the
values correspond to 3.73 × 104 and 3.93 × 104, respectively.
Therefore, the average number of DISC1 in a cell was 3.83 ×
103.
3
4.97 × 10

As the next step, we analyzed DISC1 protein in a single

spot 4

isolated HEK293 cell (Figure 2). Proteins extracted from the

single cell were allowed to react on the antibody spots (7−14
μm). AFM force mapping was performed at three representa-
tive locations of 10 independently prepared immune complex
3
1.93 × 10

spots. The total observed cluster numbers in the individual

spot 3

spots were 2, 3, 5, 7, 7, 13, 14, 15, 18, and 18. The total
Table 1. Number of DISC1 in a Single Cell or 10 Cells

number of captured DISC1 in each spot was calculated by

considering the size of the corresponding spot, and the
numbers are 1.47 × 103, 1.79 × 103, 1.93 × 103, 1.99 × 103,
3

3.93 × 104

3.43 × 103, 4.97 × 103, 6.38 × 103, 6.9 × 103, 8.83 × 103, and
1.47 × 10
spot 2

spot 2

1.06 × 104 (Table 1, Figure 3). The mean value is 4.38 ± 3.08
0

× 103 (the standard error of the mean is 0.98 × 103). The

value is close to the one from the diluted lysis sample (3.83 ×
103). However, we observed that the copy number of each
3

3.73 × 104
1.33 × 103
6.38 × 10

single cell varies noticeably.

spot 1

spot 1
0

For comparison, we quantified DISC1 in DISC1 knockdown

HEK293 cells. A lysis sample corresponding to 10 cells and a
sample of a single cell were allowed to react on antibody spots
(8−11 μm). For the former, the cluster numbers were 3 and 0,
knockdown single cell

and the average number of captured DISC1 was 6.65 × 102

knockdown 10 cellsa
wild-type single cell

wild-type 10 cellsa

(Table 1). It is clear that the copy number of DISC1 is

reduced from 3.83 × 104 to 6.65 × 102. For the latter, because
the observed cluster numbers were all 0, the number of
captured DISC1 was also 0 (Table 1, Figure 3). It is interesting
to observe the different outcomes for the knockdown samples.
When the knockdown cells were prepared, the transfection was
a

20167 https://doi.org/10.1021/acsomega.2c02009
ACS Omega 2022, 7, 20165−20171
ACS Omega http://pubs.acs.org/journal/acsodf
Figure 3. Number of DISC1 in a single cell. Both wild-type cells and
knockdown cells were examined. The bars represent the SEM for each
case (two tailed t-test, ***p < 0.001 and **p < 0.01).
not complete in general; it is likely that a few cells still contain
DISC1. This must be the reason why we observed non-zero
DISC1 in the diluted sample. However, in the case of singly
isolated knockdown cells, the transfection was confirmed
through use of fluorescence microscopy. As a result, AFM
analysis showed that DISC1 in each single cell was 0.
■
DISCUSSION
We were able to quantify a specific protein in a single cell using
AFM. Although various proteins exist in cells, the target DISC1
was quantified through the sandwich antibody pairs, the
capture antibody on a solid substrate, and the detection
antibody on an AFM tip. The specificity could be reconfirmed
through the specific force−distance curves recorded during the
AFM measurement.
Although the averaged number in a single cell matches with
the value from the ensemble average, it is noted that the
individual copy number (1.47 × 103 to 1.06 × 104) from the
single cell deviates from each other considerably. While it is
tempting to say that the variation represents the cell-to-cell
variation and the standard error of the mean (SEM) values is
low for the diluted samples, it may be too early to conclude
definitely. While it is clear that the current AFM approach is
sensitive enough to quantify a protein biomarker in a single cell
and the approach is attractive for study of the cell-to-cell
variation, re-confirmation with samples with the known
variation is highly required to be accepted in the science
community.
We showed previously that the LOD of a similar approach
for DNA detection is a single copy. In principle, such an LOD
can be realized for the protein analysis. However, it is observed
that the frequency of non-specific binding is higher for the
proteins. Although we isolate nucleic acids from cells or tissues
and because they share the same framework (sugar and
phosphate backbone), it is easier to find a condition for the
specific hybridization and contingent washing by taking
advantage of the well-defined melting temperature. For
proteins, each sample contains polypeptides of various
structures, sizes, and isoelectric points, and post-modified
peptides coexist. This is the reason why we have not been able
to achieve the LOD of the single copy. Although AFM itself is
sensitive enough to quantify a specific protein in a single cell,
we need other components to combine with AFM to increase
the capability. Use of antibodies of higher specificity, surfaces
providing least non-specific binding, and a right washing
protocol are examples that are currently in the list. In the
20168
Article
future, when we understand better on these topics, AFM force
mapping for the quantification of protein biomarkers can move
forward for further enhanced LOD.
■ METHODS
Conjugation of the Detection Antibody to AFM Tips.
AFM tips (DPN Probe Type B, NanoInk) were coated with a
27-acid dendron (custom synthesis, VRND NanobioOrganics)
as previously described.21 For brief, silicon nitride probes were
oxidized in a 10% nitric acid solution at 80 °C for 20 min. The
probes were silanized in a toluene solution containing N-(3-
(triethoxysilyl)-propyl)-O-poly(ethylene oxide) urethane (Gel-
est) [1.0% (v/v)] for 4 h. To immobilize the 27-acid dendron
molecule, the silylated probes were immersed in a
dimethylformamide (DMF)/dichloromethane (DCM) (1:3,
v/v) solution containing the 27-acid dendron (1.0 mM), 27
mM 1,3-dicyclohexylcarbodiimide (DCC), and 0.90 mM 4-
dimethylaminopyridine (DMAP) for 12 h. The dendron-
modified probes were immersed in a DCM solution containing
trifluoroacetic acid (1.0 M) for 12 h to remove the protecting
group at the apex of the immobilized dendron. The
deprotected probes were immersed in an acetonitrile solution
containing bis-N-succinimidyl(pentaethylene glycol) ester
(BS[PEG]5) (25 mM) and diisopropylethylamine (DIPEA)
(1.0 mM) for 4 h. After the reaction, the probes were dipped in
a stirred DMF solution for 30 min, washed gently with
methanol, and kept under vacuum (30−40 mTorr). The
activated probes were dipped in a buffer solution [1× PBS (pH
8.5), 0.01% Tween 20, and 0.5% glycerol] dissolving the
detection antibody (B-2, anti-DISC1 mouse monoclonal
antibody, Santa Cruz) (33 nM) for 2 h and then washed
thoroughly with PBST buffer [PBS (pH 7.4) with 0.05%
Tween 20] and PBS buffer (pH 7.4) sequentially. After being
washed, the probes were stored at 4 °C in PBS buffer (pH 7.4).
Fabrication of Capture Antibody Spots onto Etched
Slides. Etched slides were prepared by employing inductively
coupled plasma (ICP) as previously described.18 The slides
were coated with a 27-acid dendron and activated by
disuccinimidyl carbonate. A microchanneled pyramidal tip of
600 nm aperture (FluidFM nanosyringe, Cytosurge AG) was
employed for dispensing the detection antibody solution onto
the patterned slides. The capture antibody (ABN46, anti-
DISC1 rabbit polyclonal antibody, Millipore) solution (30
μM) was prepared with a spotting buffer [1× PBS (pH 8.5),
12.5% glycerol]. After injecting the solution (8 μL) into the
reservoir of the FluidFM probe, it was mounted on an atomic
force microscope (FlexAFM, Nanosurf) and was connected to
a pressure controller (FluidFM microfluidics control system,
Cytosurge AG). The cantilever was approached and contacted
onto the surface, and an overpressure of +1000 mbar was
applied for 30 s to fill the whole hollow cantilever. A specific
set point of 200 mV was applied when the cantilever
approached the sample surface. To control the droplet size,
two parameters were adjusted, applied pressure and contact
time of the cantilever onto the sample surface. After
completion of the spotting, the slides were incubated in a
humid chamber (80% humidity) at room temperature for 3 h.
Subsequently, the slides were washed with PBST buffer and
deionized water (18 MΩ·cm, Milli-Q purification system,
Millipore). The washed slides were placed in a blocking
solution containing 50 mM ethanolamine in PBS (pH 8.5) for
1 h with gentle shaking. Then, the slides were washed with
PBST buffer and deionized water.
https://doi.org/10.1021/acsomega.2c02009
ACS Omega 2022, 7, 20165−20171
ACS Omega
http://pubs.acs.org/journal/acsodf
Antibodies and Plasmids. For developing a stable cell
line to over-express hDISC1, the hDISC1 cDNA sequence was
cloned into pcDNA5/TO-MYC (Invitrogen). The DISC1
shRNA construct was designed by cloning the core sequence
(AAGGAAAATACTATGAAGTAC) combined with TTCAA-
GAGA as the loop sequence into the pLentiLox3.7 vector as
described previously.48,49 The core sequence of control-
scrambled shRNA was CTACCGTTGTATAGGTG.
Cell Culture and Transfection. HEK293 cells were
cultured in DMEM (HyClone) supplemented with 10% (v/
v) fetal bovine serum (FBS, Gibco) and 1% penicillin/
streptomycin (Gibco). All cells were transfected by using
transfection reagent Lipofectamine 2000 (Thermo Fisher
Scientific).
Preparation of Cell Lysates. For 10 cell lysates, HEK293
cells or DISC1 knockdown cells were re-suspended in DMEM
containing 1% FBS, followed by cell counting, and 1.0 × 104
cells were seeded in each well of a 24-well plate. After 12 h,
cells were lysed in 100 μL of 1× ELB lysis buffer (50 mM Tris
pH 8.0, 250 mM NaCl, 5 mM EDTA, 0.1% NP-40)
supplemented with 2 mM NaPPi, 10 mM NaF, 2 mM
Na3VO4, 1 mM DTT, and protease inhibitor cocktail (Roche)
with sonication. Cell lysates were further diluted in PBS buffer
(pH 7.4). For a single cell lysate, HEK293 cells or DISC1
knockdown cells were re-suspended in DMEM containing 1%
FBS, diluted to 5 cells/mL, and seeded 100 μL per each well of
a 96-well plate. After 12 h, each well in which a single cell exists
was subjected to cell lysis with 10 μL of 1× ELB supplemented
with 2 mM NaPPi, 10 mM NaF, 2 mM Na3VO4, 1 mM DTT,
and protease inhibitor cocktail.
Formation of the Immune Complex on the Capture
Antibody Spot. An eight-well gasket slide kit (Agilent
Technologies) was used to incubate 40 μL of the cell lysate
solution on a capture antibody-spotted slide at 25 °C for 2 h
using a hybridization oven (Agilent Technologies). After the
reaction, the slides were washed with a PBST solution and
subsequently a PBS solution (pH 7.4). For the cross-linking,
the slides were incubated with a PBS solution (pH 8.5)
containing dimethyl pimelimidate−2HCl (DMP) (20 mM) at
room temperature for 1 h. Subsequently, the reaction was
quenched by dipping the slides in a Tris solution (20 mM, pH
7.4) for 30 min at room temperature. After the reaction, the
slides were washed with a PBST solution and subsequently a
PBS solution (pH 7.4), and the slides were stored at 4 °C in a
PBS solution (pH 7.4).
AFM Force Measurements and Data Analysis. AFM
force mapping experiments were performed using a Nano-
Wizard 3 atomic force microscope (JPK Instrument). The
spring constant of the AFM probes was calibrated using the
thermal fluctuation method, and the measured spring constant
value ranged from 0.03 to 0.04 N/m. All experiments were
performed in PBS buffer (pH 7.4) at room temperature. The
adhesion force map of a single target protein molecule was
obtained within 60 × 60 nm2 (20 × 20 pixels). The
quantitative analysis map was obtained within 400 × 400
nm2 (100 × 100 pixels). Five FD curves were recorded for
each pixel with an approach/retraction speed of 3.0 μm/s, a z-
length of 250 nm, and a maximum applied force of 200 pN.
For each adhesion force map (100 × 100 pixels) from an
immune complex spot, 50,000 FD curves were analyzed by
JPK data processing software. Adhesion force and stretching
distance values were measured by determination of the
maximum value for each FD curve.
20169
■
Article
ASSOCIATED CONTENT
*
sı Supporting Information
The Supporting Information is available free of charge at
https://pubs.acs.org/doi/10.1021/acsomega.2c02009.
Schematic diagram of the etched slide glass; unbinding
events for adhesion between captured DISC1 and the
detection antibody; observation of the captured-DISC1
cluster; and force maps obtained at three positions in a
spot with NDEL1 protein (PDF)
■
AUTHOR INFORMATION
Corresponding Authors
Sang Ki Park − Department of Life Sciences, Pohang
University of Science and Technology, Pohang 37673,
Republic of Korea; Email: skpark@postech.ac.kr
Joon Won Park − Department of Chemistry, Pohang
University of Science and Technology, Pohang 37673,
Republic of Korea; Institute of Convergence Science, Yonsei
University, Seoul 03722, Republic of Korea; orcid.org/
0000-0003-1432-3161; Email: jwpark@postech.ac.kr
Authors
Donggyu Lee − Department of Life Sciences, Pohang
University of Science and Technology, Pohang 37673,
Republic of Korea
Youngsik Woo − Department of Life Sciences, Pohang
University of Science and Technology, Pohang 37673,
Republic of Korea; orcid.org/0000-0002-8308-8532
Ji-seon Lim − Department of Chemistry, Pohang University of
Science and Technology, Pohang 37673, Republic of Korea
Ikbum Park − Analysis and Assessment Research Center,
Research Institute of Industrial Science and Technology,
Pohang 37673, Republic of Korea
Complete contact information is available at:
https://pubs.acs.org/10.1021/acsomega.2c02009
Notes
The authors declare no competing financial interest.
■ ACKNOWLEDGMENTS
Acknowledges grants from the National Research Foundation
of Korea (NRF-2020R1C1C1007055, 2020M3E5E2039894,
and 2021R1A2C3010639).
■
REFERENCES
(1) Kim, M.-S.; Pinto, S. M.; Getnet, D.; Nirujogi, R. S.; Manda, S.
S.; Chaerkady, R.; Madugundu, A. K.; Kelkar, D. S.; Isserlin, R.; Jain,
S.; Thomas, J. K.; Muthusamy, B.; Leal-Rojas, P.; Kumar, P.;
Sahasrabuddhe, N. A.; Balakrishnan, L.; Advani, J.; George, B.;
Renuse, S.; Selvan, L. D. N.; Patil, A. H.; Nanjappa, V.;
Radhakrishnan, A.; Prasad, S.; Subbannayya, T.; Raju, R.; Kumar,
M.; Sreenivasamurthy, S. K.; Marimuthu, A.; Sathe, G. J.; Chavan, S.;
Datta, K. K.; Subbannayya, Y.; Sahu, A.; Yelamanchi, S. D.; Jayaram,
S.; Rajagopalan, P.; Sharma, J.; Murthy, K. R.; Syed, N.; Goel, R.;
Khan, A. A.; Ahmad, S.; Dey, G.; Mudgal, K.; Chatterjee, A.; Huang,
T.-C.; Zhong, J.; Wu, X.; Shaw, P. G.; Freed, D.; Zahari, M. S.;
Mukherjee, K. K.; Shankar, S.; Mahadevan, A.; Lam, H.; Mitchell, C.
J.; Shankar, S. K.; Satishchandra, P.; Schroeder, J. T.; Sirdeshmukh,
R.; Maitra, A.; Leach, S. D.; Drake, C. G.; Halushka, M. K.; Prasad, T.
S. K.; Hruban, R. H.; Kerr, C. L.; Bader, G. D.; Iacobuzio-Donahue,
C. A.; Gowda, H.; Pandey, A. A draft map of the human proteome.
Nature 2014, 509, 575−581.
https://doi.org/10.1021/acsomega.2c02009
ACS Omega 2022, 7, 20165−20171
ACS Omega http://pubs.acs.org/journal/acsodf
(2) Harper, J. W.; Bennett, E. J. Proteome complexity and the forces
that drive proteome imbalance. Nature 2016, 537, 328−338.
(3) Hanash, S. Disease proteomics. Nature 2003, 422, 226−232.
(4) Magdeldin, S.; Enany, S.; Yoshida, Y.; Xu, B.; Zhang, Y.;
Zureena, Z.; Lokamani, I.; Yaoita, E.; Yamamoto, T. Basics and recent
advances of two dimensional- polyacrylamide gel electrophoresis. Clin.
Proteomics 2014, 11, 16.
(5) Telford, W. G.; Hawley, T.; Subach, F.; Verkhusha, V.; Hawley,
R. G. Flow cytometry of fluorescent proteins. Methods 2012, 57, 318−
330.
(6) Spitzer, M. H.; Nolan, G. P. Mass cytometry: single cells, many
features. Cell 2016, 165, 780−791.
(7) Junker, J. P.; van Oudenaarden, A. Every cell is special: genome-
wide studies add a new dimension to single-cell biology. Cell 2014,
157, 8−11.
(8) Florin, E.-L.; Moy, V. T.; Gaub, H. E. Adhesion forces between
individual ligand-receptor pairs. Science 1994, 264, 415−417.
(9) Fritz, J.; Katopodis, A. G.; Kolbinger, F.; Anselmetti, D. Force-
mediated kinetics of single P-selectin/ligand complexes observed by
atomic force microscopy. Proc. Natl. Acad. Sci. U.S.A. 1998, 95,
12283−12288.
(10) Moy, V. T.; Florin, E.-L.; Gaub, H. E. Intermolecular forces and
energies between ligands and receptors. Science 1994, 266, 257−259.
(11) Rief, M.; Clausen-Schaumann, H.; Gaub, H. E. Sequence-
dependent mechanics of single DNA molecules. Nat. Struct. Mol. Biol.
1999, 6, 346−349.
(12) Strunz, T.; Oroszlan, K.; Schäfer, R.; Güntherodt, H.-J.
Dynamic force spectroscopy of single DNA molecules. Proc. Natl.
Acad. Sci. U.S.A. 1999, 96, 11277−11282.
(13) Lee, G. U.; Chrisey, L. A.; Colton, R. J. Direct measurement of
the forces between complementary strands of DNA. Science 1994,
266, 771−773.
(14) Hinterdorfer, P.; Baumgartner, W.; Gruber, H. J.; Schilcher, K.;
Schindler, H. Detection and localization of individual antibody-
antigen recognition events by atomic force microscopy. Proc. Natl.
Acad. Sci. U.S.A. 1996, 93, 3477−3481.
(15) Allen, S.; Chen, X.; Davies, J.; Davies, M. C.; Dawkes, A. C.;
Edwards, J. C.; Roberts, C. J.; Sefton, J.; Tendler, S. J. B.; Williams, P.
M. Detection of Antigen−Antibody Binding Events with the Atomic
Force Microscope. Biochemistry 1997, 36, 7457−7463.
(16) Kienberger, F.; Kada, G.; Mueller, H.; Hinterdorfer, P. Single
Molecule Studies of Antibody-Antigen Interaction Strength Versus
Intra-molecular Antigen Stability. J. Mol. Biol. 2005, 347, 597−606.
(17) Mori, T.; Sugiyama, S.; Byrne, M.; Johnson, C. H.; Uchihashi,
T.; Ando, T. Revealing circadian mechanisms of integration and
resilience by visualizing clock proteins working in real time. Nat.
Commun. 2018, 9, 3245.
(18) Rico, F.; Russek, A.; González, L.; Grubmüller, H.; Scheuring,
S. Heterogeneous and rate-dependent streptavidin-biotin unbinding
revealed by high-speed force spectroscopy and atomistic simulations.
Proc. Natl. Acad. Sci. U.S.A. 2019, 116, 6594−6601.
(19) Husale, S.; Persson, H. H. J.; Sahin, O. DNA nanomechanics
allows direct digital detection of complementary DNA and microRNA
targets. Nature 2009, 462, 1075−1078.
(20) Lei, H.; Guo, Y.; Hu, X.; Hu, C.; Hu, X.; Li, H. Reversible
unfolding and folding of the metalloprotein ferredoxin revealed by
single-molecule atomic force microscopy. J. Am. Chem. Soc. 2017, 139,
1538−1544.
(21) Dufrêne, Y. F.; Martínez-Martín, D.; Medalsy, I.; Alsteens, D.;
Müller, D. J. Multiparametric imaging of biological systems by force-
distance curve-based AFM. Nat. Methods 2013, 10, 847−854.
(22) Lee, Y.; Kim, Y.; Lee, D.; Roy, D.; Park, J. W. Quantification of
fewer than ten copies of a DNA biomarker without amplification or
labeling. J. Am. Chem. Soc. 2016, 138, 7075−7081.
(23) Mishra, S.; Lee, Y.; Park, J. W. Direct quantification of trace
amounts of a chronic myeloid leukemia biomarker using locked
nucleic acid capture probes. Anal. Chem. 2018, 90, 12824−12831.
(24) Koo, H.; Park, I.; Lee, Y.; Kim, H. J.; Jung, J. H.; Lee, J. H.;
Kim, Y.; Kim, J.-H.; Park, J. W. Visualization and quantification of
20170
Article
microRNA in a single cell using atomic force microscopy. J. Am.
Chem. Soc. 2016, 138, 11664−11671.
(25) Roy, D.; Kwon, S. H.; Kwak, J.-W.; Park, J. W. “Seeing and
Counting” Individual Antigens Captured on a Microarrayed Spot with
Force-Based Atomic Force Microscopy. Anal. Chem. 2010, 82, 5189−
5194.
(26) Grüter, R. R.; Vörös, J.; Zambelli, T. FluidFM as a lithography
tool in liquid: spatially controlled deposition of fluorescent nano-
particles. Nanoscale 2013, 5, 1097−1104.
(27) Millar, J. K.; Wilson-Annan, J. C.; Anderson, S.; Christie, S.;
Taylor, M. S.; Semple, C. A. M.; Devon, R. S.; Clair, D. M. S.; Muir,
W. J.; Blackwood, D. H. R.; Porteous, D. J. Disruption of two novel
genes by a translocation co-segregating with schizophrenia. Hum. Mol.
Genet. 2000, 9, 1415−1423.
(28) Mao, Y.; Ge, X.; Frank, C. L.; Madison, J. M.; Koehler, A. N.;
Doud, M. K.; Tassa, C.; Berry, E. M.; Soda, T.; Singh, K. K.; Biechele,
T.; Petryshen, T. L.; Moon, R. T.; Haggarty, S. J.; Tsai, L.-H.
Disrupted in Schizophrenia 1 Regulates Neuronal Progenitor
Proliferation via Modulation of GSK3β/β-Catenin Signaling. Cell
2009, 136, 1017−1031.
(29) Ye, F.; Kang, E.; Yu, C.; Qian, X.; Jacob, F.; Yu, C.; Mao, M.;
Poon, R. Y. C.; Kim, J.; Song, H.; Ming, G.-l.; Zhang, M. DISC1
regulates neurogenesis via modulating kinetochore attachment of
Ndel1/Nde1 during mitosis. Neuron 2017, 96, 1041−1054.
(30) Kamiya, A.; Kubo, K.-i.; Tomoda, T.; Takaki, M.; Youn, R.;
Ozeki, Y.; Sawamura, N.; Park, U.; Kudo, C.; Okawa, M.; Ross, C. A.;
Hatten, M. E.; Nakajima, K.; Sawa, A. A schizophrenia-associated
mutation of DISC1 perturbs cerebral cortex development. Nat. Cell
Biol. 2005, 7, 1167−1178.
(31) Young-Pearse, T. L.; Suth, S.; Luth, E. S.; Sawa, A.; Selkoe, D. J.
Biochemical and functional interaction of disrupted-in-schizophrenia
1 and amyloid precursor protein regulates neuronal migration during
mammalian cortical development. J. Neurosci. 2010, 30, 10431−
10440.
(32) Miyoshi, K.; Honda, A.; Baba, K.; Taniguchi, M.; Oono, K.;
Fujita, T.; Kuroda, S.; Katayama, T.; Tohyama, M. Disrupted-In-
Schizophrenia 1, a candidate gene for schizophrenia, participates in
neurite outgrowth. Mol. Psychiatr. 2003, 8, 685−694.
(33) Ozeki, Y.; Tomoda, T.; Kleiderlein, J.; Kamiya, A.; Bord, L.;
Fujii, K.; Okawa, M.; Yamada, N.; Hatten, M. E.; Snyder, S. H.; Ross,
C. A.; Sawa, A. Disrupted-in-Schizophrenia-1 (DISC-1): mutant
truncation prevents binding to NudE-like (NUDEL) and inhibits
neurite outgrowth. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 289−294.
(34) Hayashi-Takagi, A.; Takaki, M.; Graziane, N.; Seshadri, S.;
Murdoch, H.; Dunlop, A. J.; Makino, Y.; Seshadri, A. J.; Ishizuka, K.;
Srivastava, D. P.; Xie, Z.; Baraban, J. M.; Houslay, M. D.; Tomoda, T.;
Brandon, N. J.; Kamiya, A.; Yan, Z.; Penzes, P.; Sawa, A. Disrupted-in-
Schizophrenia 1 (DISC1) regulates spines of the glutamate synapse
via Rac1. Nat. Neurosci. 2010, 13, 327−332.
(35) Duan, X.; Chang, J. H.; Ge, S.; Faulkner, R L.; Kim, J. Y.;
Kitabatake, Y.; Liu, X. B.; Yang, C. H.; Jordan, J. D.; Ma, D. K.; Liu, C.
Y.; Ganesan, S.; Cheng, H. J.; Ming, G. L.; Lu, B.; Song, H. Disrupted-
In-Schizophrenia 1 regulates integration of newly generated neurons
in the adult brain. Cell 2007, 130, 1146−1158.
(36) Kim, J. Y.; Duan, X.; Liu, C. Y.; Jang, M.-H.; Guo, J. U.; Pow-
anpongkul, N.; Kang, E.; Song, H.; Ming, G.-l. DISC1 regulates new
neuron development in the adult brain via modulation of AKT-
mTOR signaling through KIAA1212. Neuron 2009, 63, 761−773.
(37) Taya, S.; Shinoda, T.; Tsuboi, D.; Asaki, J.; Nagai, K.; Hikita,
T.; Kuroda, S.; Kuroda, K.; Shimizu, M.; Hirotsune, S.; Iwamatsu, A.;
Kaibuchi, K. DISC1 Regulates the Transport of the NUDEL/LIS1/
14-3-3 Complex through Kinesin-1. J. Neurosci. 2007, 27, 15−26.
(38) Millar, J. K.; Pickard, B. S.; Mackie, S.; James, R.; Christie, S.;
Buchanan, S. R.; Malloy, M. P.; Chubb, J. E.; Huston, E.; Baillie, G. S.;
Thomson, P. A.; Hill, E. V.; Brandon, N. J.; Rain, J.-C.; Camargo, L.
M.; Whiting, P. J.; Houslay, M. D.; Blackwood, D. H. R.; Muir, W. J.;
Porteous, D. J. DISC1 and PDE4B are interacting genetic factors in
schizophrenia that regulate cAMP signaling. Science 2005, 310, 1187−
1191.
https://doi.org/10.1021/acsomega.2c02009
ACS Omega 2022, 7, 20165−20171
ACS Omega http://pubs.acs.org/journal/acsodf Article

(39) Sawamura, N.; Ando, T.; Maruyama, Y.; Fujimuro, M.;

Mochizuki, H.; Honjo, K.; Shimoda, M.; Toda, H.; Sawamura-
Yamamoto, T.; Makuch, L. A.; Hayashi, A.; Ishizuka, K.; Cascella, N.
G.; Kamiya, A.; Ishida, N.; Tomoda, T.; Hai, T.; Furukubo-Tokunaga,
K.; Sawa, A. Nuclear DISC1 regulates CRE-mediated gene tran-
scription and sleep homeostasis in the fruit fly. Mol. Psychiatr. 2008,
13, 1138−1148.
(40) Soda, T.; Frank, C.; Ishizuka, K.; Baccarella, A.; Park, Y.-U.;
Flood, Z.; Park, S. K.; Sawa, A.; Tsai, L.-H. DISC1-ATF4
transcriptional repression complex: dual regulation of the cAMP-
PDE4 cascade by DISC1. Mol. Psychiatr. 2013, 18, 898−908.
(41) Ogawa, F.; Malavasi, E. L. V.; Crummie, D. K.; Eykelenboom, J.
E.; Soares, D. C.; Mackie, S.; Porteous, D. J.; Millar, J. K. DISC1
complexes with TRAK1 and Miro1 to modulate anterograde axonal
mitochondrial trafficking. Hum. Mol. Genet. 2014, 23, 906−919.
(42) Park, C.; Lee, S.-A.; Hong, J.-H.; Suh, Y.; Park, S. J.; Suh, B. K.;
Woo, Y.; Choi, J.; Huh, J.-W.; Kim, Y.-M.; Park, S. K. Disrupted-in-
schizophrenia 1 (DISC1) and Syntaphilin collaborate to modulate
axonal mitochondrial anchoring. Mol. Brain 2016, 9, 69.
(43) Park, S. J.; Lee, S. B.; Suh, Y.; Kim, S.-J.; Lee, N.; Hong, J.-H.;
Park, C.; Woo, Y.; Ishizuka, K.; Kim, J.-H.; Berggren, P.-O.; Sawa, A.;
Park, S. K. DISC1 Modulates Neuronal Stress Responses by Gate-
Keeping ER-Mitochondria Ca 2+ Transfer through the MAM. Cell
Rep. 2017, 21, 2748−2759.
(44) Park, Y.-U.; Jeong, J.; Lee, H.; Mun, J. Y.; Kim, J.-H.; Lee, J. S.;
Nguyen, M. D.; Han, S. S.; Suh, P.-G.; Park, S. K. Disrupted-in-
schizophrenia 1 (DISC1) plays essential roles in mitochondria in
collaboration with Mitofilin. Proc. Natl. Acad. Sci. U.S.A. 2010, 107,
17785−17790.
(45) Hong, B. J.; Oh, S. J.; Youn, T. O.; Kwon, S. H.; Park, J. W.
Nanoscale-controlled spacing provides DNA microarrays with the
SNP discrimination efficiency in solution phase. Langmuir 2005, 21,
4257−4261.
(46) Schneider, C.; Newman, R. A.; Sutherland, D. R.; Asser, U.;
Greaves, M. F. A one-step purification of membrane proteins using a
high efficiency immunomatrix. J. Biol. Chem. 1982, 257, 10766−
10769. Recommended by ACS
(47) Lee, Y.; Kwon, S. H.; Kim, Y.; Lee, J.-B.; Park, J. W. Mapping of
surface-immobilized DNA with force-based atomic force microscopy.
Anal. Chem. 2013, 85, 4045−4050. Lifting the Veil: Characteristics, Clinical Significance, and
(48) Brummelkamp, T. R.; Bernards, R.; Agami, R. A system for Application of β-2-Microglobulin as Biomarkers and Its
stable expression of short interfering RNAs in mammalian cells. Detection with Biosensors
Science 2002, 296, 550−553. P. C. Sivanathan, Edward Y. Chang, et al.
(49) Park, S. J.; Jeong, J.; Park, Y.-U.; Park, K.-S.; Lee, H.; Lee, N.; JULY 18, 2022
Kim, S.-M.; Kuroda, K.; Nguyen, M. D.; Kaibuchi, K.; Park, S. K. ACS BIOMATERIALS SCIENCE & ENGINEERING READ
Disrupted-in-schizophrenia-1 (DISC1) regulates endoplasmic retic-
ulum calcium dynamics. Sci. Rep. 2015, 5, 8694. Specific Peptide from the Novel W-Tau Isoform Inhibits Tau
and Amyloid β Peptide Aggregation In Vitro
Raquel Cuadros, Jesús Avila, et al.
JUNE 13, 2022
ACS CHEMICAL NEUROSCIENCE READ

Quantitative Structural Proteomics Unveils the

Conformational Changes of Proteins under the Endoplasmic
Reticulum Stress
Kejun Yin, Ronghu Wu, et al.
SEPTEMBER 15, 2022
ANALYTICAL CHEMISTRY READ

Single-Cell Chemical Proteomics (SCCP) Interrogates the

Timing and Heterogeneity of Cancer Cell Commitment to
Death
Ákos Végvári, Roman A. Zubarev, et al.
JUNE 22, 2022
ANALYTICAL CHEMISTRY READ
Get More Suggestions >

20171 https://doi.org/10.1021/acsomega.2c02009
ACS Omega 2022, 7, 20165−20171