Science of the Total Environment 840 (2022) 156727

Contents lists available at ScienceDirect

Science of the Total Environment

journal homepage: www.elsevier.com/locate/scitotenv

Polystyrene microplastics-induced cardiotoxicity in chickens via the

ROS-driven NF-κB-NLRP3-GSDMD and AMPK-PGC-1α axes
Yue Zhang, Kai Yin, Dongxu Wang, Yu Wang, Hongmin Lu, Hongjing Zhao , Mingwei Xing
⁎ ⁎
College of Wildlife and Protected Area, Northeast Forestry University, Harbin 150040, Heilongjiang, PR China

H I G H L I G H T S G R A P H I C A L A B S T R A C T

• PS-MPs exposure triggered oxidative

stress and ROS overload in myocardium.
• PS-MPs induced cardiac pyroptosis and in-
flammation by the NF-κB-NLRP3-GSDMD
axis.
• PS-MPs caused abnormal mitochondrial
and energy metabolism by the AMPK-
PGC-1α axis.
• PS-MPs elicited cardiotoxicity in chickens
may depend on the driving effect of ROS.

A R T I C L E I N F O A B S T R A C T

Editor: Henner Hollert Microplastics (MPs) pollution is getting increasingly prominent, and its dangers have attracted widespread attention.
The heart is the central hub of the organism's survival, and the mechanism of MPs-induced heart injury in chickens is
Keywords: unknown. Here, we investigated the effects of 5 μm polystyrene microplastics (PS-MPs) on the heart and primary car-
Microplastic
diomyocytes of chickens at varied concentrations. We observed that PS-MPs caused severe pathological damage and
Cardiotoxicity
ultrastructural changes in heart, induced myocardial pyroptosis, inflammatory cell infiltration and mitochondrial le-
Reactive oxygen species
NF-κB-NLRP3-GSDMD axis
sions. PS-MPs evoked abnormal antioxidant enzyme content and ROS overproduction. Detailed mechanistic investiga-
AMPK-PGC-1α pathway tion indicated that PS-MPs triggered pyroptosis via NF-κB-NLRP3-GSDMD axis and exacerbated myocardial
Chickens inflammation (NLRP3, Caspase-1, IL-1β, IL-18, ASC, GSDMD, NF-κB, COX-2, iNOS and IL-6 overexpression). Addition-
ally, PS-MPs induced mitochondrial damage (TFAM, OPA1, MFN1 and MFN2 down-expression, DRP1 and Fis1 over-
expression) and energy metabolism disorders (HK2, PKM2, PDHX and LDH up-regulation) by inhibiting AMPK-PGC-
1α pathway. Interestingly, NAC alleviated these aberrant manifestations in vitro. We suggested that PS-MPs driven al-
terations in NF-κB-NLRP3-GSDMD and AMPK-PGC-1α pathways via ROS overload, which in turn triggered oxidative
stress, myocardial pyroptosis, inflammation, mitochondrial and energy metabolism dysfunction. This provided theo-
retical bases for protecting chickens from toxic injury by MPs.

1. Introduction (MPs) have smaller particle size (size < 5 mm), stronger adsorption capacity
and greater difficulty in degradation, thus posing a serious pollution and
With the increasing amount of “white waste”, its harm has gotten a lot threat to the environment (Xu et al., 2020; Yin et al., 2021a). MPs have
of focus. However, compared with the “white plastic”, microplastics been detected in the worldwide environment (Schwabl et al., 2019; C. Li
et al., 2020). According to statistics, approximately 700 species of marine
⁎ Corresponding authors. organisms have been contaminated with MPs (Wright et al., 2013; Avio
E-mail addresses: zhaohongjing@nefu.edu.cn (H. Zhao), xingmingwei@nefu.edu.cn et al., 2015). As research continues, experts have discovered that the accu-
(M. Xing). mulation of MPs on the organism can have irreversible toxic effects on

http://dx.doi.org/10.1016/j.scitotenv.2022.156727
Received 1 April 2022; Received in revised form 23 May 2022; Accepted 12 June 2022
Available online 14 June 2022
0048-9697/© 2022 Published by Elsevier B.V.
Y. Zhang et al.
human and animal bodies (Wright and Kelly, 2017). Polystyrene
microplastics (PS-MPs) have been reported to accumulate in fish, rats,
chickens and humans through the transmission of the food chain, causing
severe damage to various organs, such as liver necrosis, dysbiosis of intesti-
nal flora and nephritis (Lu et al., 2016; Y.L. Wang et al., 2021; Banerjee and
Shelver, 2021). Also, PS-MPs of 3–12 μm in the concentration range of
0.5 mg/L to 100 mg/L could break the blood-brain barrier, lead to cranial
neruritis (Prüst et al., 2020), as well as to cause sperm cell atrophy, abscis-
sion and apoptosis at all levels through the blood-testis barrier, thereby
inducing reproductive toxicity (Hou et al., 2021). It is worth mentioning
that the myocardium may also be a target organ for environmental expo-
sure to MPs. In a study of developmental toxicity in zebrafish embryos,
Pitt et al. found that the toxicity of PS-MPs migrated to the heart, triggering
a decrease in heart rate in the offspring (Pitt et al., 2018). Meanwhile,
recent studies have confirmed that PS-MPs promoted myocardial apoptosis
further aggravating its fibrosis (Z. Li et al., 2020). The health of waterfowl
and birds is also at risk from MPs, mainly in the form of intestinal damage
and impaired embryonic development (Banerjee and Shelver, 2021; L.
Wang et al., 2021). Nevertheless, the effects of MPs accumulation on myo-
cardial injury in avian or bird and their potential molecular mechanisms
have not been clarified.
Reactive oxygen species (ROS) plays an important role in regulating the
physiological functions of the body (Yang et al., 2019). Available evidence
has shown that ROS is one of the key causes of myocardial cell cycle arrest
(Pei et al., 2020), and triggering ROS can cause lipid peroxidation, leading
to disruption of cell membrane structure and cell death (Paulus and
Tschöpe, 2013). Pyroptosis, also named “inflammatory cell necrosis”, is a
recently discovered new form of programmed cell death (Shi et al., 2017;
Q. Liu et al., 2022; Gu et al., 2022). Reportedly, the increased production
of ROS upregulated NF-κB expression (X.J. Liu et al., 2022), which in
turn facilitated the activation of NLRP3 inflammasome (Jing et al., 2022),
IL-1β, IL-18 precursor and Caspase-1. Activated Caspase-1, on the one
hand, cleaved gasdermin-D (GSDMD) to form a peptide containing the
active region of GSDMD-N, induced cell membrane perforation rupture,
released its contents, and triggered pyroptosis (Sun et al., 2019), on the
other hand, cleaved IL-1β and IL-18 precursors, and distributed them extra-
cellularly, recruiting inflammatory cells to aggregate and amplify the
inflammatory response (Dai et al., 2021).
It is well known that the process of cell death is accompanied by al-
terations in mitochondrial homeostasis (Horng, 2014). Recent reports
have confirmed that exposure to environmental pollutants stimulated
strong alterations in the AMPK-PGC-1α pathway and induced mitochon-
drial dysfunction (Yang et al., 1987; Cai et al., 2021). And previously,
experimental data by Li et al. simultaneously suggested that ROS-
AMPK-PGC-1α may be a regulatory site involved in MPs-induced glyco-
lytic metabolism (Li et al., 2021). Alterations in mitochondrial homeo-
stasis may affect normal organismal metabolism (Coppi et al., 2021).
Therefore, we have reason to suspect that the AMPK-PGC-1α pathway
plays a key role in PS-MPs induced myocardial mitochondrial energy
metabolism.
Cell death is an essential physiological process in the organism
(Lin et al., 2016). Past studies on myocardial injury have generally focused
on apoptosis (Kung et al., 2011), whereas the role of pyroptosis as a new
mode of cell death and related pathways crosstalk in cardiac diseases has
not been extensively studied, and the specific mechanisms of MPs to induce
this cardiotoxicity is not clear. Considering that the effects of PS-MPs
exposure in the field/natural environment on chickens have not been
mentioned. Thus, we chose PS-MPs (5 μm), the most widely applied in
environmental pollution studies and constructed experimental models of
chickens exposed to different concentrations of PS-MPs for 42 days. More
importantly, we further evaluated the cardiotoxicity of PS-MPs by culturing
primary chicken embryo cardiomyocytes in vitro. We hypothesized that PS-
MPs would induce chickens cardiotoxicity via ROS-driven NF-κB-NLRP3-
GSDMD and AMPK-PGC-1α axis systems, possibly involving programmed
impairment of oxidative stress, pyroptosis, inflammation, mitochondria
and energy metabolism. This work provided richer theoretical data for a
2
Science of the Total Environment 840 (2022) 156727
comprehensive investigation of the detailed damage mechanisms of PS-
MPs exposure in chickens.
2. Materials and methods
2.1. Animals and experimental design
All procedures of the current experiments were approved and super-
vised by the Animal Protection and Utilization Committee of Northeastern
Forestry University, and the animal experiments strictly complied with the
“Guide to Animal Welfare Standards in China” and the “Regulations on the
Management of Laboratory Animals (2017)”.
PS-MPs (5 μm) purchased from Tesulang Chemical Company, China.
Sixty one-day-old chicks (a hatchery in Harbin, Heilongjiang Province,
China) were randomly divided into four groups (15 chicks per group).
Control group (Con): drinking normal water with neither PS-MPs, low-
dose group (L-MPS): drinking water containing 1 mg/L PS-MPs, which
was determined based on previous reports, as an environment-related
concentration (Sun et al., 2021a; Sun et al., 2021b). Medium-dose group
(M-MPS): drinking water containing 10 mg/L PS-MPs, and high-dose
group (H-MPS): drinking water containing 100 mg/L PS-MPs. PS-MPs
was dissolved in ultrapure water and placed in an ultrasonic shaker for
2 h, 1 h and 30 min, followed by multiple resuspensions between each treat-
ment. All chickens were kept in a well-ventilated space with free food and
drinking water. The temperature of the site was 33 °C, the humidity was
65 %, and the light was about 16 h/day. After 7 days of adaptation, the
temperature was reduced by 1 °C every 3 days, the humidity was reduced
by 5 % per week, and the final temperature was controlled at 22 °C, the
humidity was maintained at 55 %. After 42 days, all chickens were eutha-
nized, fresh heart samples were extracted, some of the tissue was placed
in 4 % paraformaldehyde fixative, and the other part was divided and
labeled, then placed in a − 80 °C refrigerator for subsequent use.
2.2. Histopathological observation of the heart
Hearts were placed in tissue fixative for 24 h. Dehydrated in graded
ethanol and dewaxed in xylene as described by previous experience and
the experimental manipulations of Chen et al. (Chen et al., 2022), 5 μm
sections were made, followed by hematoxylin eosin (H&E) staining and
placed under light microscopy for observation.
2.3. Transmission electron microscopy (TEM) observation
For the examination of the ultrastructure of the heart tissue, we used the
previous experimental method. 1 mm3 sections of the heart were manipu-
lated following the experimental procedure of Zhao et al. (2021). The
micrographs were obtained at 80 kV using a transmission electron micro-
scope (GEM1200ES, Japan).
2.4. Cardiomyocyte culture and related treatment
Extraction and culture of primary chickens embryonic myocardial cells
according to relevant literature guidance and our appropriate improve-
ments (Yang et al., 2017). We chose 12 or 13-day-old sterile chickens
embryos for extraction. Heart tissue (Lower third of the heart tip) was re-
moved from intact chickens embryos, digested with 0.1 % Collagenase 1II
(Biosharp, China), and cardiomyocytes were cultured in DMEM/F12
(Gibco, China) supplemented with 10 % fetal bovine serum (FBS, Biological
Industries) and 1 % penicillin-streptomycin (Beyotime) at in a humidified
incubator with 5 % CO2 at 37 °C for 48 h. When cardiomyocyte fusion
reaches 80 %, the growth medium was removed and DEMF/F12 containing
2 % FBS, 1 % penicillin-streptomycin medium was added prior to PS-MPs
and/or antioxidant 0.5 mM NAC (Beyotime) treatment (Gao et al., 2018).
Y. Zhang et al. Science of the Total Environment 840 (2022) 156727

2.5. Cardiomyocyte viability analysis
Counting Kit-8 (CCK-8) assay was used to detect the effect of different
action times (4 h, 12 h, 24 h, and 48 h) and concentrations of NAC
(0.2 mM, 0.5 mM, 1 mM, 2 mM and 2.5 mM) and PS-MPs (0 mg/mL,
0.01 mg/mL, 0.05 mg/mL, 0.1 mg/mL, 0.25 mg/mL, 0.5 mg/mL,
1 mg/mL, 1.5 mg/mL, 2 mg/mL, and 2.5 mg/mL) on the survival of cardio-
myocytes. The absorbance at 450 nm was measured by an enzyme marker
according to the manufacturer's instructions.
2.6. Flow cytometry
1:200) for 1 h. Nuclei were stained with 4′, 6-diamidino-2-phenylindole
(DAPI) (Beyotime) for 5 min (Miao et al., 2022a). Finally, images were
captured by a fluorescence microscope (Shang Guang Optical Microscope,
China). Correlation quantitative analysis using Image J.
2.9. Detection of antioxidant function
Selection of relevant kits to measured T-AOC, CAT, GSH, SOD and MDC
levels in heart tissues, and the operating rules strictly follow the instructions
of the kit (Jiancheng Bioengineering Institute, Nanjing, China).

2.10. Detection of ROS accumulation in cardiomyocytes

We selected Annexin V-FITC/PI Apoptosis Detection Kit (Beyotime)
to measure the damage of cardiomyocytes treated with different concentra-
tions of PS-MPs. Cells in each group were digested with 0.1 % collagenase,
centrifuged at 1500 rpm/min for 5 min, 5 × 105 cardiomyocytes were
collected, and carefully washed twice with PBS. According to the reagent
instructions, add 500 μL Binding buffer to resuspend the cells, add 5 μL
Annexin V-FITC and 10 μL Propidium Iodide to each tube, and mix well.
Incubate at room temperature for 15 min in the dark, and then perform
the next detection and analysis by CytoFLEX flow cytometry and CytExpert
software (Beckman Coulier Life Sciences, China).
2.7. Immunohistochemistry (IHC)
Paraffin-embedded heart tissue sections were deparaffinized, hydrated,
and stained with NLRP3 (WanLeiBio, 1:200) and GSDMD antibody
(Bost Detection of antioxidant function er Biological Technology, 1:200).
Staining was visualized by standard peroxidase immunoassays and
counterstaining with Gill II hematoxylin. Pictures were obtained using a
light microscope (Olympus, Tokyo, Japan). The IHC expression level of
the target protein was quantitatively analyzed by Image J software.
2.8. Immunofluorescence (IF)
The primary cardiomyocytes were treated with PS-MPs for 24 h, fixed
with 4 % paraformaldehyde and then blocked with a solution containing
5 % BSA and 0.01 % Triton-X 100. Cardiomyocytes were washed with
PBS after staining with primary antibodies against NLRP3 and GSDMD at
4 °C overnight (Xu et al., 2021) and were then further incubated with
Alexa Fluro 488 or FITC-conjugated goat anti-rabbit IgG (WanLeiBio,
We used the ROS assay kit (Nanjing Jiancheng Bioengineering Institute)
to examine its accumulation (Chi et al., 2021). The cardiomyocytes were
placed in medium containing DCFH-DA and incubated in a 5 % CO2 incuba-
tor at 37 °C for 30 min. The images were captured by using fluorescence
microscopy and quantified by using Image J.
2.11. Intracellular mitochondrial activity assay in cardiac myocytes
The cell culture medium was removed and replaced with a culture
medium containing 100 nM of Mito-Tracker Green (Beyotime) working
solution (Miao et al., 2022b), and the cardiomyocytes were stained in an
incubator at 37 °C and 5 % CO2 humidity for 30 min. The absorbance of mi-
tochondrial staining of cardiomyocytes was then quantified using Image J
software.
2.12. Primer designs and real-time quantitative PCR (qRT-PCR)
Similar to previous methods, total RNA from cardiac muscle tissue and
cells was obtained by TRIzol extraction (Liu et al., 2022), after which we
reverse transcribed them according to the manufacturer's instructions
(Yeasen Biotechnology, China). Meanwhile, we searched the NCBI website
(https://www.ncbi.nlm.nih.gov/) for the upstream and downstream
primer sequences of the desired mRNAs, as shown in Table 1. qRT-PCR
assays of mRNA were performed using the Applied Biosystems™ 7500
(Thermo Fisher Scientific, USA) and SYBR Green Master Mix (Roche,
Switzerland). β-Actin was used as the internal reference gene to complete
data normalization according to the 2−ΔΔCt method (Y. Wang et al., 2021).

Table 1
The primers used in the present study.
Gene Serial number Forward (5′–3′) Reverse (5′–3′)

NLRP3 XM_046918111.1 GCTCCTTGCGTGCTCTAAGACC TTGTGCTTCCAGATGCCGTCAG

Caspase-1 XM_040687588.2 GTGCTGCCGTGGAGACAACATAG AGGAGACAGTATCAGGCGTGGAAG
IL-1β XM_046931582.1 GAGGAGGTTTTTGAGCCCGT GCACGAAGCACTTCTGGTTG
IL-18 XM_015297948.4 CTGAAGGTGCGGTGGTTTTG TCTCGAAGCGACTGAAACAA
NF-κB NM_001396038.1 GCAGATAGCCAAGTTCAGGAT CATTTGCTTCCCTGCATTCT
IκB-α NM_001001472.3 GGAGTAGCCCTGGTAGGTCA CCTGCGTAGGTATTGCAGCTT
TNF-α MF000729.1 CTTCCTGCTGGGGTGCATAG AAGAACCAACGTGGGCATTG
COX-2 MN013407.1 TGTCCTTTCACTGCTTTCCAT TTCCATTGCTGTGTTTGAGGT
iNOS NM_204961.2 CCTGGAGGTCCTGGAAGAGT CCTGGGTTTCAGAAGTGGC
IL-6 NM_204628.2 AAGTTCACCGTGTGCGAGAA TCAGGCATTTCTCCTCGTCG
AMPK XM_046922941.1 ACCATCTGTCTCGCCCTCATCC AATGCCACTTCGCTCTTCTTACACC
PGC-1α NM_001006457.2 TGTACTTGGTTCCAAGAAAAGGA CAGACTGGTCGCTGTACCAC
TFAM NM_204100.2 GCAGCTGTTCAGGGGCTG TCAGGAAGCGGAAATAGGCG
OPA1 NM_001396172.1 AGAAGCCCTCCATCAAGAAAA ACAATGCTCCCCCAAAAGGT
DRP1 BM486811.1 TACGTCACAAGAGTCTGCGG CTCCTGTTACTGAGGCACCG
MFN1 NM_001396185.1 CAGGAGACAGAAGGCCCAAG GCTGCAGCTACGTTTATGGC
MFN2 XM_040689233.2 TGAAGCGCAATGTCCCTGTT CATTGATGTACGCAGCCAGC
Fis1 XM_040657193.2 GTCGTGACGTCATTTCACCG ACATCGTCAAACTCCGGGTC
HK2 NM_204212.2 TGCGAGATCCGATTCGTGAG TTTCAACCCTCATCCTCCGC
PKM2 NM_205469.2 CAGCAGGAGACACCGAACTC GAGGCGGGCAACATTCATTC
PDHX NM_001031187.2 GCTGGAGATGCACTGTGTGA ACCAATTAGGGAGCCCAAGC
LDH NM_205284.2 CATCACTTCCAGCACAAACG CGGTGTTTAGGAAAGCCACT
β-actin NM_205518.2 CCGCTCTATGAAGGCTACGC CTCTCGGCTGTGGTGGTGAA

3
Y. Zhang et al. Science of the Total Environment 840 (2022) 156727

Table 2
The antibodies used in the present study.
Antibody name Dilution ratio kDa Resource Item number

β-Actin 1:2000 42 Abclonal Technology, China AC038

Tubulin 1:500 56 WanLei Biotechnology, China WL01931
p-IκB-α 1:350 35 WanLei Biotechnology, China WL02495
IκB-α 1:350 35 WanLei Biotechnology, China WL01936
NF-κB 1:500 65 WanLei Biotechnology, China WL01273b
IL-1β 1:350 35 WanLei Biotechnology, China WL02257
IL-18 1:350 22 WanLei Biotechnology, China WL01127
NLRP3 1:500 106 WanLei Biotechnology, China WL02635
Pro-Caspase-1 1:350 45 WanLei Biotechnology, China WL03325
Cleaved-caspase-1 1:350 20 WanLei Biotechnology, China WL03325
ASC 1:350 22 WanLei Biotechnology, China WL02462
GSDMD 1:1000 53 Boster Biotechnology, China M02842
iNOS 1:500 130 WanLei Biotechnology, China WL0992a
TNF-α 1:1000 26 Proteintech Group, USA 60291-1-Ig
COX-2 1:1000 68 WanLei Biotechnology, China WL01750
OPA1 1:1000 83 Abclonal Technology, China A9833
MFN1 1:1000 84 Boster Biotechnology, China M02172-1
MFN2 1:1000 86 Proteintech Group, USA 12186-1-AP
DRP1 1:500 80 WanLei Biotechnology, China WL03028
LDH 1:1000 35 WanLei Biotechnology, China WL03271
HK2 1:500 102 WanLei Biotechnology, China WL02454
PKM2 1:350 58 WanLei Biotechnology, China WL03290

Fig. 1. Effects of PS-MPs on myocardial tissue. Chickens were given drinking water with and/or without PS-MPs at different concentrations for 42 days. A: Body weight, heart
weight, and heart/body mass index of chickens. B: Histopathological sections of myocardium. Green arrows: inflammatory cell infiltration. Red arrows: nucleolysis. Blue
arrows: cell expansion or rupture. C: Myocardial injury area. D: Ultrastructural observation of myocardium. Green arrows: mitochondrial damage (swelling or ridge
breakage). Red arrows: loose arrangement of myofilaments. Blue arrows: bubble-like protrusions. Yellow arrows: nuclear solidification. Bar graphs indicate mean ± SD
(n = 3). **P < 0.01 and ***P < 0.001.

4
Y. Zhang et al. Science of the Total Environment 840 (2022) 156727

2.13. Western blotting (WB) 3. Results

After extraction of total proteins from myocardial tissues and cells
according to the method of Miao et al. (2022c), protein separation was
performed using 8 %–15 % SDS-PAGE gels, followed by transfer of target
proteins to polyvinylidene difluoride (PVDF) membranes, which by trans-
fer technique and then overnight incubation of the membranes with the
antibodies shown in Table 2. After proper washing, the membranes were
incubated with HRP-conjugated secondary antibodies (1:10,000, Biosharp,
BL003A) for 90 min (Gong et al., 2022). The protein strip images were
acquired on the ImageQuant LAS 4000 System using the ECL chemilumi-
nescence kit (Biosharp). Finally, the optical density (OD) of the protein
bands was analyzed using Image J software. Data are presented as target
protein (OD)/β-actin or tubulin (OD).
2.14. Statistical analysis
All data were analyzed with one or/and two-way ANOVA in IBM SPSS
software (version 23, SPSS Inc., Chicago, IL, USA). Bar charts were
consisted of mean ± standard deviation (SD) of the data, which were
replicates of at least three biological samples (n ≥ 3). P values < 0.05
were considered statistically significant, *P < 0.05, **P < 0.01 and
***P < 0.001 compared to the Con group.
3.1. Changes in body weight, heart weight and organ index of chickens after
PS-MPs exposure
After 42 days of exposure to different concentrations of PS-MPs,
chickens heart tissues were collected and weighed. There was no distinct
effect of PS-MPs on body weight, myocardial weight, and heart/body
weight index of chickens (P > 0.05) (Fig. 1A).
3.2. PS-MPs promotes myocardial inflammatory injury in chickens
To assess the effect of PS-MPs on cardiac pathological morphology, H&E
staining was used to observe the damage. The myocardial cells in the Con
group showed normal physiological structural and morphology with no
obvious damage conditions. The L-MPS group showed a small amount of in-
flammatory cell infiltration and cell swelling, while the M-MPS and H-MPS
group had more obvious abnormal morphology of cardiomyocytes, such as
inflammatory cell infiltration, nucleolysis and disorganized myofilament
arrangement (Fig. 1B). Quantitative analysis showed that the degree of
myocardial injury was significantly higher in M-MPS (P < 0.01) and H-
MPS (P < 0.001) compared to Con, when there was no difference in L-
MPS (P > 0.05) (Fig. 1C). It suggested that PS-MPs exposure triggered
inflammation in the chickens myocardium.

Fig. 2. Effect of PS-MPs on myocardial tissue antioxidant enzymes, cardiomyocyte growth and ROS production. A: Expression of MDA, GSH, SOD, CAT and T-AOC in vivo. B:
ROS accumulation in chickens primary cardiomyocytes. C: The influence of different concentrations of PS-MPs on the viability of primary cardiomyocytes at
12 h, 24 h and 48 h, respectively. D: Analysis of the average optical density generated by ROS. Six independent samples (n = 6) for A (GSH) and C, three independent samples
(n = 3) performed in triplicate for others. *P < 0.05, **P < 0.01 and ***P < 0.001.

5
Y. Zhang et al.
Fig. 3. PS-MPs stimulation induces pyroptosis in vivo. A: IHC observation and quantitative analysis of NLRP3 and GSDMD by different concentrations of PS-MPs. B: Pyroptosis
marker mRNA levels (NLRP3, Caspase-1, IL-1β and IL-18). C: Pyroptosis marker protein levels (NLRP3, Caspase-1, IL-1β, IL-18, ASC and GSDMD). Bar graphs indicate
mean ± SD (n = 3). *P < 0.05, **P < 0.01 and ***P < 0.001.
3.3. PS-MPs enhances myocardial pyroptosis and mitochondrial damage in
chickens
Further observation of ultrastructural changes in cardiomyocytes by
TEM. We found that the organelle structure of the Con group was relatively
intact. In the L-MPS group, the arrangement of muscle filaments was loose,
the mitochondria were slightly enlarged, and a small amount of bubble-like
protrusions were observed before the plasma membrane ruptured,
which was formed by pyroptosis cells, also called “pyroptosis body”. In
the M-MPS group, the myocardial fibers were obviously broken, the mito-
chondrial ridge was also slightly deformed and broken, and the “pyroptosis
body” increased. The above state was more obvious and accompanied by
nuclear pyknosis in the H-MPS group (Fig. 1D).
3.4. PS-MPs inhibits cardiomyocyte growth
To further verify the effect of PS-MPs on myocardium, chickens embry-
onic primary cardiomyocytes were used as in vitro study subjects. CCK8
data confirmed that cardiomyocytes pretreated with 0.2–1.0 mM NAC for
4 h did not affect the viability of normal cells (Fig. S1A). As Fig. 2C showed,
6
Science of the Total Environment 840 (2022) 156727
the toxic effect time of 12 h did not show striking changes, after 24 h and 48 h
of action we observed that the cell viability presented significant inhibition at
the node of 0.25 mg/mL concentration. Cell survival rate was 85 %–75 %,
80 %–70 %, 70 %–65 %, 60 %–50 %, 50 %–40 %, 40 %–20 % at 0.25, 0.5,
1.0, 1.5, 2.0 and 2.5 mg/mL PS-MPs, respectively. Allowing in vitro survival
time and sensitivity of primary cardiomyocytes. We chose the 0.25 mg/mL of
PS-MPs at 24 h as the lowest concentration, and 2 and 4 fold the medium and
high concentration groups to set as low dose, respectively. Briefly, four
groups were divided in vitro: Con (without PS-MPS), L-PS (0.25 mg/mL
PS-MPS), M-PS (0.5 mg/mL PS-MPS), H-PS (1 mg/mL PS-MPS).
Microscopic observation showed that the cells in the Con group were
normal in morphology and structure, with tight junctions between cells,
accompanied by extension of pseudopodia. The PS-MPs-treated groups
exhibited abnormal cell morphology, including: decreased growth density,
reduced cell junctional pseudopodia, and vacuolation of cells. Among them,
cell vacuolation (yellow mark) was more obvious (Fig. S1B). Further flow
cytometry analysis revealed that with respect to the Con, the PS-MPs
groups with different concentrations exhibited an inhibitory effect on
cardiomyocytes. NAC treatment largely rescued cardiomyocyte injury
invoked by PS-MPs (Fig. S1C).
Y. Zhang et al. Science of the Total Environment 840 (2022) 156727

Fig. 4. PS-MPs induces pyroptosis in vitro. Primary cardiomyocytes were given cultures containing and/or not containing different concentrations of PS-MPs stimulated for
24 h. A and C: The IF expression levels of NLRP3 and GSDMD in primary cardiomyocytes. B and D: Mean optical density analysis of NLRP3 and GSDMD. E: Effect of different
concentrations of PS-MPs (0, 0.25, 0.5, 1.0 mg/mL PS-MPs) with or without 0.5 mM NAC on the growth state of cardiomyocytes. F: Pyroptosis marker mRNA levels
(consistent with myocardial tissue). G: Pyroptosis marker protein levels (consistent with myocardial tissue). Data are expressed as the mean ± SD (n = 3). *P < 0.05,
**P < 0.01 and ***P < 0.001.

7
Y. Zhang et al.
3.5. PS-MPs causes myocardial oxidative stress and ROS overload
PS-MPs dramatically increased the activity of MDA and inhibited the
expression of GSH, SOD, CAT and T-AOC compared to the Con (P < 0.05
to P < 0.001). Particularly, the above altered antioxidant enzyme activity
was overall dependent on the elevated dose of PS-MPS exposure. In addi-
tion, we also measured the content of ROS in cardiac myocytes. Unlike
the in vivo data, the in vitro experiments showed that even though the
PS-MPs treatments showed a progressive enhancement in ROS fluorescence
intensity (Fig. 2B), the quantitative analysis implied that there was no note-
worthy difference between the L-PS and M-PS versus the Con (P > 0.05),
and only the H-PS was statistically significant (P < 0.001). As we presumed,
adding NAC prominently reduced the activity of ROS (P < 0.05) (Fig. 2D).
Taken together, PS-MPs exposure induced oxidative stress and ROS
overload, while NAC was effective in treating the excessive accumulation
of ROS.
3.6. PS-MPS triggers NF-κB-NLRP3-GSDMD axis heterotopia in vivo and in vitro
NLRP3 inflammasome and GSDMD are the “star factors” in the
pyroptotic pathway. IHC results of cardiac tissues revealed that the expres-
sion of NLRP3 and GSDMD were sequentially raised than Con (P < 0.05 to
P < 0.001) (Fig. 3A). To further validate the occurrence of pyroptosis, we
examined the qRT-PCR and WB levels of markers of the NLRP3
inflammasome-dependent pyroptotic pathway (Fig. 3B–C). Consistently,
the expression levels of NLRP3, Caspase-1, IL-1β, IL-18, ASC and GSDMD
were increased in a concentration-dependent manner (Fig. 3B–C). It is
suggested that PS-MPs induced myocardial pyroptosis in a concentration-
dependent manner. Subsequently, we detected the levels of markers in
the NF-κB inflammation pathway. As the shown in Fig. 5. The IHC level
of NF-κB was elevated in the PS-MPs treated group, more pronounced in
H-MPS (P < 0.001) and M-MPS (P < 0.01), while P values < 0.05 of L-
MPS rather than Con (Fig. 5A). Coherently, the nuclear accumulation of
NF-κB displayed markedly higher in the PS-MPs groups (P < 0.001).
Furthermore, the mRNA and protein expression of pro-inflammatory
factors TNF-α, iNOS, COX-2, and IL-6 were also clearly upregulated
and IκB-α was significantly downregulated than the Con (P < 0.05 to
P < 0.001) (Fig. 5B–C).
IF and qRT-PCR showed conspicuous shifts in the levels of all the above
factors at H-PS compared to the Con, while there was no significant differ-
ence at L-PS and M-PS (P > 0.05) (Figs. 4A–F and 5C). Therefore, we
assayed the protein expression of pyroptosis and inflammatory markers
under the effect of H-PS. In contrast to the Con, H-PS remarkably enhanced
the levels of NLRP3, pro-Caspase-1, Cleaved-Caspase-1, IL-1β, IL-18, ASC
and GSDMD, augmented the NF-κB (nuclear), TNF-α, iNOS, COX-2, and
IL-6 and greatly decreased IκB-α (P < 0.05 to P < 0.001) (Fig. 4F). Meaning-
fully, NAC rescued the onset of pyroptosis and inflammation in vitro
(Figs. 4A-D, F and 5E). Overall, we concluded that PS-MPs triggered
myocardial pyroptosis and amplify the inflammation in chickens via initiat-
ing the NF-κB-NLRP3-GSDMD axis in vivo and in vitro.
3.7. PS-MPS induces mitochondrial and energy metabolism dysfunction in vivo
and in vitro
To determine the specific molecular mechanisms by PS-MPs exposure
affects myocardial mitochondrial function and impaired energy metabo-
lism, we examined the mRNA and protein levels of AMPK-PGC-1α pathway
and its downstream markers of mitochondrial fusion and division as well as
energy metabolism markers in myocardium. As shown in Figs. 6A and 7A,
PS-MPs treatment dramatically inhibited AMPK-PGC-1α pathway, induced
the TFAM, OPA1, MFN1 and MFN2 mRNA levels were down-regulated and
DRP1, Fis1, HK2, PKM2, PDHX and LDH were up-regulated, while AMPK,
PGC-1α, OPA1, DRP1, MFN1, MFN2, HK2, PKM2 and LDH protein
levels were approximately the same as mRNA (Figs. 6C and 7C).
There were equally substantiated by IHC analysis of OPA1, DRP1 and
HK2 (Figs. 6B and 7B).
8
Science of the Total Environment 840 (2022) 156727
Then, the expression status of mitochondrial and energy metabolic fac-
tors in cardiomyocytes were tested by Mito-Tracker Green and mRNA levels
(Fig. 8A–D). As expected, there was a significant effect of mitochondrial
green fluorescence and AMPK-PGC-1α pathway expression only at H-PS
(P < 0.05 to P < 0.001). Further WB analysis showed that compared with
the Con, AMPK, PGC-1α, OPA1, MFN1 and MFN2 were decreased, DRP1,
HK2, PKM2 and LDH were increased in PS-MPs treated cardiomyocytes
(Fig. 8E). Vitally, NAC treatment also restored these abnormal expressions
(Fig. 8E). Collectively, we demonstrated that PS-MPs might cause mito-
chondrial damage and impaired energy metabolism in the myocardium
by inhibiting the AMPK-PGC-1α pathway.
4. Discussion
MPs have been shown to be “the primary instigator” of global
environmental pollution. The size of MPS particles can influence their
inter-transfer between ecological environments (soil, water and air) (Yang
et al., 2021; Yin et al., 2021b). Evidence suggests that MPs reached ecosys-
tems through multiple pathways, and notably, which are far more prevalent
in terrestrial than in aquatic ecosystems (Rillig et al., 2021; Nizzetto et al.,
2016). Currently, the information about toxic damage of MPs is generally
focused on aquatic ecosystems, and its prominent impact in agroforestry
ecosystems has been overlooked. Hence, it is extremely necessary to
study typical species in terrestrial ecosystems. 3–12 μm PS-MPs was usually
considered to be able to penetrate the blood barrier to reach the various
organ tissues of the body (Wei et al., 2021; Shan et al., 2022; Dimitriadi
et al., 2021). Herein, we applied chickens as the research object and focused
on the specific mechanism of myocardial toxic damage influenced by MPs
through in vitro and in vivo validation. We demonstrated for the first
time that MPs induced myocardial pyroptosis in chickens via triggering
ROS overload, accompanied through amplified inflammation, imbalanced
of mitochondrial homeostasis and abnormal energy metabolism. Specifi-
cally, the addition of NAC effectively declined the accumulation of ROS,
which in turn alleviated myocardial pyroptosis and the consequent
inflammatory response by driving the NF-κB-NLRP3-GSDMD axis, and im-
proved mitochondrial dysfunction and energy metabolism abnormalities
via regulating the AMPK-PGC-1α pathway.
Early reported point to MPs exposure led to the excessive accumulation
of ROS and oxidative stress in the organism (An et al., 2021). Our experi-
mental results showed that PS-MPs stimulation strongly altered the activi-
ties of GSH, CAT, MDA and T-AOC in myocardial tissue, suggesting the
remarkable increased in oxidative stress. Besides, fluorescence staining of
cardiac myocytes demonstrated that ROS accumulation was more pro-
nounced in the PS-MPs treatment. External stimuli mediated the activation
of NLRP3 by driving ROS, NLRP3 would be converted into a polymer com-
plex through the junction protein ASC, also known as Caspase-1-dependent
NLRP3 inflammasome (Qiu et al., 2019). As mentioned before, activation of
Caspase-1 cleaved GSDMD was a key “executioner” in the occurrence of
pyroptosis. Consequently, our experimental resulted also supported that
PS-MPs treatment altered the expression of pyroptosis markers to varying
degrees. More noteworthy, pyroptosis is an important factor in promoting
the inflammatory response (Dai et al., 2021). Stimulants also drove down-
stream inflammatory factor expression through triggered ROS activation
of NF-κB typical inflammatory signaling molecules, promoting the secre-
tion of pro-inflammatory factors, such as TNF-α, iNOS, COX2, and IL-6
(L. Zhao et al., 2021; Park et al., 2019). Similarly, our data indicated that
PS-MPs induced NLRP3 inflammasome-mediated typical myocardial
pyroptotic pathway and amplified myocardial inflammatory damage by
indirectly activating the NF-κB inflammatory pathway. Concretely, the
PS-MPs treated overexpressed NLRP3, Caspase-1, IL-1β, IL-18, ASC
and GSDMD, upregulated NF-κB, TNF-α, COX2, iNOS, IL-6 and decreased
IκB-α expression. It is worth mentioning that the NAC treatment reversed
the above situation to a great extent.
Actually, the AMPK-PGC-1α pathway is an essential sensor for the reg-
ulation of energy metabolism in the body (Zmijewski et al., 2010), whereas
numerous scientific studies have demonstrated that the overproduction of
Y. Zhang et al. Science of the Total Environment 840 (2022) 156727

Fig. 5. PS-MPs stimulation leads to inflammatory response in vivo and in vitro. A: IHC observation and quantitative analysis of NF-κB in vivo. B and D: Analysis of mRNA
levels of NF-κB, IκB-α, TNF-α, COX-2, iNOS and IL-6. C and E: Analysis of protein levels of NF-κB, IκB-α, TNF-α, COX-2 and iNOS. Data are expressed as the mean ± SD
(n = 3). *P < 0.05, **P < 0.01 and ***P < 0.001.

ROS obviously modulates the alteration of the AMPK-PGC-1α pathway Nevertheless, these were urgent need for data to confirm whether the
(Li et al., 2021), which will affect mitochondrial function by stimulating ROS-AMPK-PGC-1α axis triggers alterations in both of these mechanisms
downstream mitochondrial fusion-related factors (Cai et al., 2021). in microplastic-induced myocardial injury in chickens. Our work showed

9
Y. Zhang et al. Science of the Total Environment 840 (2022) 156727

Fig. 6. Effects of PS-MPs exposure on mitochondrial dynamics in vivo. A: Detection of mRNA expression of AMPK, PGC-1α, TFAM, OPA1, DRP1, MFN1, MFN2 and Fis1. B:
IHC observation and quantitative analysis of OPA1 and DRP1. C: Detection of protein expression of AMPK, PGC-1α, OPA1, DRP1, MFN1 and MFN2. Data are expressed as the
mean ± SD (n = 3). *P < 0.05, **P < 0.01 and ***P < 0.001.

that PS-MPs treatment visibly reduced the expression levels of AMPK and
PGC-1α with ROS overaccumulation, triggering abnormal levels of mito-
chondrial fusion and fission factors TFAM, OPA1, DRP1, MFN1, MFN2
and Fis1, and inducing the overexpression of energy metabolism kinases
HK2, PKM2, PDHX and LDH. Equally, the addition of NAC could rescue
the above abnormal expression. Accordingly, this report provided prelimi-
nary data to support our view that PS-MPs induced mitochondrial and en-
ergy metabolism dysfunction in chickens myocardium through the
AMPK-PGC-1α axis. Explanatorily, in vivo experiments, we observed a
certain dose-dependence of the overall myocardial toxicity affected by PS-
MPs exposure, but this trend was not verified in vitro experiments, which
was probably influenced with the duration of PS-MPs action.
In summary, we discovered for the first time the potential mechanism of
MPs induced cardiotoxicity in chickens. Firstly, PS-MPs triggered NF-κB-
NLRP3-GSDMD axis overexpression by driving ROS overaccumulation,
launching myocardial pyroptosis and amplifying inflammatory responses in

10
Y. Zhang et al. Science of the Total Environment 840 (2022) 156727

Fig. 7. Effects of PS-MPs exposure on energy metabolism in vivo. A: Detection of mRNA expression of HK2, PKM2, PDHX and LDH. B: IHC observation and quantitative
analysis of HK2. C: Detection of protein expression of HK2, PKM2, and LDH. Data are expressed as the mean ± SD (n = 3). *P < 0.05, **P < 0.01 and ***P < 0.001.

chickens. Secondly, PS-MPs overtly stimulated the dysfunction of mitochon- IκB-α Nuclear factor-κB alpha
dria and energy metabolism in chickens myocardium via regulating the ex- TNF-α Tumor necrosis factor-α
pression of AMPK-PGC-1α pathway through the overproduction of ROS. COX-2 Cyclooxygenase-2
Moreover, the NAC greatly reversed the above damage in chickens myocar- iNOS Inducible nitric oxide synthase
dium. Emphatically, ROS driven crosstalk of NF-κB-NLRP3-GSDMD and AMPK AMP-activated protein kinase
AMPK-PGC-1α pathways are critical in PS-MPs induced chicken heart injury. PGC-1α PPARγ coactivator-1α
This information fills a gap in the mechanism of MPs damage to myocardium TFAM Recombinant transcription factor A, mitochondrial
in chickens in terrestrial ecosystems and provides direction for protecting OPA1 Optic atrophy type 1
chickens from MPs poisoning. DRP1 Dynamin-related protein 1
MFN1 Mitofusin 1
MFN2 Mitofusin 2
Abbreviations Fis1 Mitochondrial fission 1
HK2 Hexokinase 2
MPs Microplastics PKM2 Pyruvate kinase isozyme type M2
PS-MPs Polystyrene microplastics PDHX Recombinant pyruvate dehydrogenase complex component X
GSH Glutathione LDH Lactate dehydrogenase
SOD Superoxide dismutase NAC N-Acetyl-L-cysteine
CAT Catalase
MDA Malondialdehyde Supplementary data to this article can be found online at https://doi.
T-AOC Total antioxidant capacity org/10.1016/j.scitotenv.2022.156727.
ROS Reactive oxygen species
NLRP3 Recombinant NLR family, pyrin domain containing protein 3 CRediT authorship contribution statement
Caspase-1 Cysteinyl aspartate specific proteinase-1
IL-1β Interleukin-1β Yue Zhang: Conceptualization, Methodology, Writing-Original draft,
IL-6 Interleukin-6 Writing-review. Kai Yin: Investigation, Formal analysis. Dongxu Wang:
IL-18 Interleukin-18 Investigation, Resources. Yu Wang: Software, Formal analysis. Hongmin
ASC Apoptosis-associated speck-like protein containing Lu: Resources, Data review. Hongjing Zhao: Supervision, Project adminis-
GSDMD Gasdermin D tration. Mingwei Xing: Supervision, Project administration, Funding
NF-κB Nuclear factor factor-κB acquisition.

11
Y. Zhang et al. Science of the Total Environment 840 (2022) 156727

Fig. 8. Effects of PS-MPs exposure on mitochondrial dynamics and energy metabolism in vitro. A: Effect of PS-MPs with and without NAC on mitochondria of cardiomyocytes.
B: Mitochondrial mean optical density analysis. C and D: Relative mRNA expression level of AMPK, PGC-1α, TFAM, OPA1, DRP1, MFN1, MFN2, Fis1, HK2, PKM2, PDHX and
LDH. E: Relative protein expression levels of AMPK, PGC-1α, OPA1, DRP1, MFN1, MFN2, HK2, PKM2 and LDH. Data are expressed as the mean ± SD (n = 3). *P < 0.05,
**P < 0.01 and ***P < 0.001.

Declaration of competing interest References

The authors declare that they have no known competing financial inter-
ests or personal relationships that could have appeared to influence the
work reported in this paper.
Acknowledgments
This study acknowledges the support of the Natural Science Foundation
of Heilongjiang Province of China (ZD2020C005).
An, R., Wang, X., Yang, L., Zhang, J., Wang, N., Xu, F., Hou, Y., Zhang, H., Zhang, L., 2021. Poly-
styrene microplastics cause granulosa cells apoptosis and fibrosis in ovary through oxida-
tive stress in rats. Toxicology 449, 152665. https://doi.org/10.1016/j.tox.2020.152665.
Avio, C.G., Gorbi, S., Milan, M., Benedetti, M., Fattorini, D., d'Errico, G., Pauletto, M.,
Bargelloni, L., Regoli, F., 2015. Pollutants bioavailability and toxicological risk from
microplastics to marine mussels. Environ. Pollut. 198, 211–222. https://doi.org/10.
1016/j.envpol.2014.12.021.
Banerjee, A., Shelver, W.L., 2021. Micro- and nanoplastic-mediated pathophysiological
changes in rodents, rabbits, and chickens: a review. J. Food Prot. 84, 1480–1495.
https://doi.org/10.4315/jfp-21-117.

12
Y. Zhang et al.
Cai, J., Guan, H., Jiao, X., Yang, J., Chen, X., Zhang, H., Zheng, Y., Zhu, Y., Liu, Q.,
Zhang, Z., 2021. NLRP3 inflammasome mediated pyroptosis is involved in cadmium
exposure-induced neuroinflammation through the IL-1beta/IkB-alpha-NF-kappaB-
NLRP3 feedback loop in swine. Toxicology 453, 152720. https://doi.org/10.1016/
j.tox.2021.152720.
Chen, X., Bi, M., Yang, J., Cai, J., Zhang, H., Zhu, Y., Zheng, Y., Liu, Q., Shi, G., Zhang, Z.,
2022. Cadmium exposure triggers oxidative stress, necroptosis, Th1/Th2 imbalance
and promotes inflammation through the TNF-alpha/NF-kappaB pathway in swine small
intestine. J. Hazard. Mater. 421, 126704. https://doi.org/10.1016/j.jhazmat.2021.
126704.
Chi, Q., Hu, X., Liu, Z., Han, Y., Tao, D., Xu, S., Li, S., 2021. H2S exposure induces cell death in
the broiler thymus via the ROS-initiated JNK/MST1/FOXO1 pathway. Ecotoxicol. Envi-
ron. Saf. 222, 112488. https://doi.org/10.1016/j.ecoenv.2021.112488.
Coppi, L., Ligorio, S., Mitro, N., Caruso, D., De Fabiani, E., Crestani, M., 2021. PGC1s and be-
yond: disentangling the complex regulation of mitochondrial and cellular metabolism.
Int. J. Mol. Sci. 22. https://doi.org/10.3390/ijms22136913.
Dai, X.-Y., Li, X.-W., Zhu, S.-Y., Li, M.-Z., Zhao, Y., Talukder, M., Li, Y.-H., Li, J.-L., 2021. Ly-
copene ameliorates Di(2-ethylhexyl) phthalate-induced pyroptosis in spleen via suppres-
sion of classic Caspase-1/NLRP3 pathway. J. Agric. Food Chem. 69, 1291–1299. https://
doi.org/10.1021/acs.jafc.0c06534.
Dimitriadi, A., Papaefthimiou, C., Genizegkini, E., Sampsonidis, I., Kalogiannis, S., Feidantsis,
K., Bobori, D.C., Kastrinaki, G., Koumoundouros, G., Lambropoulou, D.A., Kyzas, G.Z.,
Bikiaris, D.N., 2021. Adverse effects polystyrene microplastics exert on zebrafish heart -
molecular to individual level. J. Hazard. Mater. 416, 125969. https://doi.org/10.1016/
j.jhazmat.2021.125969.
Gao, X., Zheng, Y., Peng, L., Ruan, X., Ji, H., Qiu, Y., Liu, X., Teng, P., Guo, D., Jiang, S., 2018.
Maduramicin induces apoptosis in chicken myocardial cells via intrinsic and extrinsic
pathways. Toxicol. in Vitro 50, 190–200. https://doi.org/10.1016/j.tiv.2018.03.008.
Gong, Z.G., Zhao, Y., Wang, Z.Y., Fan, R.F., Liu, Z.P., Wang, L., 2022. Epigenetic regulator
BRD4 is involved in cadmium-induced acute kidney injury via contributing to lysosomal
dysfunction, autophagy blockade and oxidative stress. J. Hazard. Mater. 423, 127110.
https://doi.org/10.1016/j.jhazmat.2021.127110.
Gu, X., Wang, Y., He, Y., Zhao, B., Zhang, Q., Li, S., 2022. MiR-1656 targets GPX4 to trigger
pyroptosis in broilers kidney tissues by activating NLRP3 inflammasome under se defi-
ciency. J. Nutr. Biochem. 105, 109001. https://doi.org/10.1016/j.jnutbio.2022.109001.
Horng, T., 2014. Calcium signaling and mitochondrial destabilization in the triggering of the
NLRP3 inflammasome. Trends Immunol. 35, 253–261. https://doi.org/10.1016/j.it.
2014.02.007.
Hou, B., Wang, F., Liu, T., Wang, Z., 2021. Reproductive toxicity of polystyrene microplastics:
in vivo experimental study on testicular toxicity in mice. J. Hazard. Mater. 405, 124028.
https://doi.org/10.1016/j.jhazmat.2020.124028.
Jing, H., Wang, F., Gao, X.J., 2022. Lithium intoxication induced pyroptosis via ROS/NF-κB/
NLRP3 inflammasome regulatory networks in kidney of mice. Environ. Toxicol. https://
doi.org/10.1002/tox.23446.
Kung, G., Konstantinidis, K., Kitsis, R.N., 2011. Programmed necrosis, not apoptosis, in the
heart. Circ. Res. 108, 1017–1036. https://doi.org/10.1161/circresaha.110.225730.
Li, C., Busquets, R., Campos, L.C., 2020. Assessment of microplastics in freshwater systems: a
review. Sci. Total Environ. 707, 135578. https://doi.org/10.1016/j.scitotenv.2019.
135578.
Li, Z., Zhu, S., Liu, Q., Wei, J., Jin, Y., Wang, X., Zhang, L., 2020. Polystyrene microplastics
cause cardiac fibrosis by activating Wnt/beta-catenin signaling pathway and promoting
cardiomyocyte apoptosis in rats. Environ. Pollut. 265, 115025. https://doi.org/10.
1016/j.envpol.2020.115025.
Li, S., Ma, Y., Ye, S., Tang, S., Liang, N., Liang, Y., Xiao, F., 2021. Polystyrene microplastics
trigger hepatocyte apoptosis and abnormal glycolytic flux via ROS-driven calcium over-
load. J. Hazard. Mater. 417, 126025. https://doi.org/10.1016/j.jhazmat.2021.126025.
Lin, J., Kumari, S., Kim, C., Van, T.M., Wachsmuth, L., Polykratis, A., Pasparakis, M., 2016.
RIPK1 counteracts ZBP1-mediated necroptosis to inhibit inflammation. Nature 540,
124–128. https://doi.org/10.1038/nature20558.
Liu, Q., Du, P., Zhu, Y., Zhang, X., Cai, J., Zhang, Z., 2022. Thioredoxin reductase 3 suppres-
sion promotes colitis and carcinogenesis via activating pyroptosis and necrosis. Cell. Mol.
Life Sci. 79, 106. https://doi.org/10.1007/s00018-022-04155-y.
Liu, X.J., Wang, Y.Q., Shang, S.Q., Xu, S., Guo, M., 2022. TMT induces apoptosis and
necroptosis in mouse kidneys through oxidative stress-induced activation of the NLRP3
inflammasome. Ecotoxicol. Environ. Saf. 230, 113167. https://doi.org/10.1016/j.
ecoenv.2022.113167.
Liu, J.B., Li, Z.F., Lu, L., Wang, Z.Y., Wang, L., 2022. Glyphosate damages blood-testis barrier
via NOX1-triggered oxidative stress in rats: long-term exposure as a potential risk for
male reproductive health. Environ. Int. 159, 107038. https://doi.org/10.1016/j.envint.
2021.107038.
Lu, Y., Zhang, Y., Deng, Y., Jiang, W., Zhao, Y., Geng, J., Ding, L., Ren, H., 2016. Uptake and
accumulation of polystyrene microplastics in zebrafish (Danio rerio) and toxic effects in
liver. Environ. Sci. Technol. 50, 4054–4060. https://doi.org/10.1021/acs.est.6b00183.
Miao, Z., Miao, Z., Teng, X., Xu, S., 2022a. Chlorpyrifos triggers epithelioma papulosum
cyprini cell pyroptosis via miR-124-3p/CAPN1 axis. J. Hazard. Mater. 424, 127318.
https://doi.org/10.1016/j.jhazmat.2021.127318.
Miao, Z., Miao, Z., Wang, S., Wu, H., Xu, S., 2022b. Exposure to imidacloprid induce oxidative
stress, mitochondrial dysfunction, inflammation, apoptosis and mitophagy via NF-
kappaB/JNK pathway in grass carp hepatocytes. Fish Shellfish Immunol. 120, 674–685.
https://doi.org/10.1016/j.fsi.2021.12.017.
Miao, Z., Miao, Z., Shi, X., Wu, H., Yao, Y., Xu, S., 2022c. The antagonistic effect of selenium
on lead-induced apoptosis and necroptosis via P38/JNK/ERK pathway in chicken kidney.
Ecotoxicol. Environ. Saf. 231, 113176. https://doi.org/10.1016/j.ecoenv.2022.113176.
Nizzetto, L., Futter, M., Langaas, S., 2016. Are agricultural soils dumps for microplastics of
urban origin? Environ. Sci. Technol. 50, 10777–10779. https://doi.org/10.1021/acs.
est.6b04140.
13
Science of the Total Environment 840 (2022) 156727
Park, M.H., Gutiérrez-García, A.K., Choudhury, M., 2019. Mono-(2-ethylhexyl) phthalate
aggravates inflammatory response via sirtuin regulation and inflammasome activation
in RAW 264.7 cells. Chem. Res. Toxicol. 32, 935–942. https://doi.org/10.1021/acs.
chemrestox.9b00101.
Paulus, W.J., Tschöpe, C., 2013. A novel paradigm for heart failure with preserved ejection
fraction: comorbidities drive myocardial dysfunction and remodeling through coronary
microvascular endothelial inflammation. J. Am. Coll. Cardiol. 62, 263–271. https://doi.
org/10.1016/j.jacc.2013.02.092.
Pei, J., Wang, F., Pei, S., Bai, R., Cong, X., Nie, Y., Chen, X., 2020. Hydrogen sulfide promotes
cardiomyocyte proliferation and heart regeneration via ROS scavenging. Oxidative Med.
Cell. Longev. 2020, 1412696. https://doi.org/10.1155/2020/1412696.
Pitt, J.A., Kozal, J.S., Jayasundara, N., Massarsky, A., Trevisan, R., Geitner, N., Wiesner, M.,
Levin, E.D., Di Giulio, R.T., 2018. Uptake, tissue distribution, and toxicity of polystyrene
nanoparticles in developing zebrafish (Danio rerio). Aquat. Toxicol. 194, 185–194.
https://doi.org/10.1016/j.aquatox.2017.11.017.
Prüst, M., Meijer, J., Westerink, R.H.S., 2020. The plastic brain: neurotoxicity of micro-
and nanoplastics. Part. Fibre Toxicol. 17, 24. https://doi.org/10.1186/s12989-020-
00358-y.
Qiu, Z., He, Y., Ming, H., Lei, S., Leng, Y., Xia, Z.Y., 2019. Lipopolysaccharide (LPS) aggravates
high glucose- and Hypoxia/Reoxygenation-induced injury through activating ROS-
dependent NLRP3 inflammasome-mediated pyroptosis in H9C2 cardiomyocytes.
J. Diabetes Res. 2019, 8151836. https://doi.org/10.1155/2019/8151836.
Rillig, M.C., Ryo, M., Lehmann, A., 2021. Classifying human influences on terrestrial ecosys-
tems. Glob. Chang. Biol. 27, 2273–2278. https://doi.org/10.1111/gcb.15577.
Schwabl, P., Köppel, S., Königshofer, P., Bucsics, T., Trauner, M., Reiberger, T., Liebmann, B.,
2019. Detection of various microplastics in human stool: a prospective case series. Ann.
Intern. Med. 171, 453–457. https://doi.org/10.7326/m19-0618.
Shan, S., Zhang, Y., Zhao, H., Zeng, T., Zhao, X., 2022. Polystyrene nanoplastics penetrate
across the blood-brain barrier and induce activation of microglia in the brain of mice.
Chemosphere 298, 134261. https://doi.org/10.1016/j.chemosphere.2022.134261.
Shi, J., Gao, W., Shao, F., 2017. Pyroptosis: gasdermin-mediated programmed necrotic cell
death. Trends Biochem. Sci. 42, 245–254. https://doi.org/10.1016/j.tibs.2016.10.004.
Sun, L., Ma, W., Gao, W., Xing, Y., Chen, L., Xia, Z., Zhang, Z., Dai, Z., 2019. Propofol directly
induces caspase-1-dependent macrophage pyroptosis through the NLRP3-ASC inflamma-
some. Cell Death Dis. 10, 542. https://doi.org/10.1038/s41419-019-1761-4.
Sun, T., Zhan, J., Li, F., Ji, C., Wu, H., 2021. Effect of microplastics on aquatic biota: a
hormetic perspective. Environ. Pollut. (Barking, Essex : 1987) 285, 117206. https://
doi.org/10.1016/j.envpol.2021.117206.
Sun, T., Zhan, J., Li, F., Ji, C., Wu, H., 2021. Environmentally relevant concentrations of
microplastics influence the locomotor activity of aquatic biota. J. Hazard. Mater. 414,
125581. https://doi.org/10.1016/j.jhazmat.2021.125581.
Wang, Y.L., Lee, Y.H., Hsu, Y.H., Chiu, I.J., Huang, C.C., Huang, C.C., Chia, Z.C., Lee, C.P., Lin,
Y.F., Chiu, H.W., 2021. The kidney-related effects of polystyrene microplastics on human
kidney proximal tubular epithelial cells HK-2 and male C57BL/6 mice. Environ. Health
Perspect. 129, 57003. https://doi.org/10.1289/ehp7612.
Wang, L., Xue, N., Li, W., Wufuer, R., Zhang, D., 2021. Ecotoxicological effects of
microplastics on bird embryo development by hatching without eggshell. J. Visual.
Exp. https://doi.org/10.3791/61696.
Wang, Y., Zhao, H., Liu, Y., Li, J., Nie, X., Huang, P., Xing, M., 2021. Environmentally relevant
concentration of sulfamethoxazole-induced oxidative stress-cascaded damages in the in-
testine of grass carp and the therapeutic application of exogenous lycopene. Environ.
Pollut. (Barking, Essex: 1987) 274, 116597. https://doi.org/10.1016/j.envpol.2021.
116597.
Wei, Y., Zhou, Y., Long, C., Wu, H., Hong, Y., Fu, Y., Wang, J., Wu, Y., Shen, L., Wei, G., 2021.
Polystyrene microplastics disrupt the blood-testis barrier integrity through ROS-mediated
imbalance of mTORC1 and mTORC2. Environ. Pollut. (Barking, Essex: 1987) 289,
117904. https://doi.org/10.1016/j.envpol.2021.117904.
Wright, S.L., Kelly, F.J., 2017. Plastic and human health: a micro Issue? Environ. Sci. Technol.
51, 6634–6647. https://doi.org/10.1021/acs.est.7b00423.
Wright, S.L., Thompson, R.C., Galloway, T.S., 2013. The physical impacts of microplastics on
marine organisms: a review. Environ. Pollut. 178, 483–492. https://doi.org/10.1016/j.
envpol.2013.02.031.
Xu, S., Ma, J., Ji, R., Pan, K., Miao, A.J., 2020. Microplastics in aquatic environments: occur-
rence, accumulation, and biological effects. Sci. Total Environ. 703, 134699. https://doi.
org/10.1016/j.scitotenv.2019.134699.
Xu, S., Xiaojing, L., Xinyue, S., Wei, C., Honggui, L., Shiwen, X., 2021. Pig lung fibrosis is
active in the subacute CdCl(2) exposure model and exerts cumulative toxicity through
the M1/M2 imbalance. Ecotoxicol. Environ. Saf. 225, 112757. https://doi.org/10.
1016/j.ecoenv.2021.112757.
Yang, Q., Han, B., Xue, J., Lv, Y., Li, S., Liu, Y., Wu, P., Wang, X., Zhang, Z., 1987. Hexavalent
chromium induces mitochondrial dynamics disorder in rat liver by inhibiting AMPK/
PGC-1α signaling pathway, environmental pollution (Barking. Essex 265 (2020),
114855. https://doi.org/10.1016/j.envpol.2020.114855.
Yang, J., Hamid, S., Cai, J., Liu, Q., Xu, S., Zhang, Z., 2017. Selenium deficiency-induced thi-
oredoxin suppression and thioredoxin knock down disbalanced insulin responsiveness in
chicken cardiomyocytes through PI3K/Akt pathway inhibition. Cell. Signal. 38, 192–200.
https://doi.org/10.1016/j.cellsig.2017.07.012.
Yang, B., Chen, Y., Shi, J., 2019. Reactive oxygen species (ROS)-based nanomedicine. Chem.
Rev. 119, 4881–4985. https://doi.org/10.1021/acs.chemrev.8b00626.
Yang, L., Zhang, Y., Kang, S., Wang, Z., Wu, C., 2021. Microplastics in soil: a review on
methods, occurrence, sources, and potential risk. Sci. Total Environ. 780, 146546.
https://doi.org/10.1016/j.scitotenv.2021.146546.
Yin, K., Wang, D., Zhao, H., Wang, Y., Guo, M., Liu, Y., Li, B., Xing, M., 2021. Microplastics
pollution and risk assessment in water bodies of two nature reserves in Jilin Province:
correlation analysis with the degree of human activity. Sci. Total Environ. 799,
149390. https://doi.org/10.1016/j.scitotenv.2021.149390.
Y. Zhang et al.
Yin, K., Wang, Y., Zhao, H., Wang, D., Guo, M., Mu, M., Liu, Y., Nie, X., Li, B., Li, J., Xing, M.,
2021. A comparative review of microplastics and nanoplastics: toxicity hazards on diges-
tive, reproductive and nervous system. Sci. Total Environ. 774. https://doi.org/10.1016/
j.scitotenv.2021.145758.
Zhao, H., Wang, Y., Liu, Y., Yin, K., Wang, D., Li, B., Yu, H., Xing, M., 2021. ROS-induced hep-
atotoxicity under cypermethrin: involvement of the crosstalk between Nrf2/Keap1 and
NF-kappaB/ikappaB-alpha pathways regulated by proteasome. Environ. Sci. Technol.
55, 6171–6183. https://doi.org/10.1021/acs.est.1c00515.
14
Science of the Total Environment 840 (2022) 156727
Zhao, L., Shi, W., Hu, F., Song, X., Cheng, Z., Zhou, J., 2021. Prolonged oral ingestion of
microplastics induced inflammation in the liver tissues of C57BL/6J mice through polar-
ization of macrophages and increased infiltration of natural killer cells. Ecotoxicol. Envi-
ron. Saf. 227, 112882. https://doi.org/10.1016/j.ecoenv.2021.112882.
Zmijewski, J.W., Banerjee, S., Bae, H., Friggeri, A., Lazarowski, E.R., Abraham, E., 2010.
Exposure to hydrogen peroxide induces oxidation and activation of AMP-activated
protein Kinase*. J. Biol. Chem. 285, 33154–33164. https://doi.org/10.1074/jbc.
M110.143685.