Physiological and Molecular Plant Pathology 119 (2022) 101834

Contents lists available at ScienceDirect

Physiological and Molecular Plant Pathology

journal homepage: www.elsevier.com/locate/pmpp

A epsB mutant of Ralstonia solanacearum as novel biocontrol agent of

tobacco bacterial wilt via activating salicylic acid signalling
Shili Li, Liang Yang, Yuao Ran, Wei Ding *
Laboratory of Natural Products Pesticides, College of Plant Protection, Southwest University, Chongqing, 400715, China

A R T I C L E I N F O A B S T R A C T

Keywords: Extracellular polysaccharide (EPS) is the most important virulence factor of R. solanacearum and promotes rapid
Ralstonia solanacearum systemic colonization and induces plant wilting symptoms. In this study, biological control mechanism and effect
Bacterial wilt of EPS biosynthesis genes mutants (ΔepsB, ΔepsC and ΔwecC) on bacterial wilt were evaluated. The expression
epsB mutant
level of virulence-associated genes, such as xpsR, epsE, vsrB, vsrC and phcA, were significantly decreased in the
Biocontrol
Salicylic acid signalling
Δeps strains. Furthermore, application of ΔepsB strain was observed to delay the development of wilt progress for
two days and the WT population in rhizosphere soil was significantly reduced by 46.77-fold after ΔepsB strain
treatment. If the ΔepsB was applied earlier than WT population, the control efficiencies of ΔepsB were 84.67%,
72.74%, 60.68%, 56.38% and 53.29% at 8, 10, 12, 14, and 16 d after inoculation, respectively. What ‘s more, the
ΔepsB mutant significantly induced the expression of plant defence associated genes involved in salicylic acid
pathway, but did not affect the expression of genes associated with the jasmonic acid and ethylene pathways.
Compared with plant inoculated with WT treatment, the expression of PR1a/c, PR2 and NPR1 was induced 4.5-
fold, 6.9-fold and 2.2-fold, respectively, in the plant colonized by ΔepsB mutant. Meanwhile, application of ΔepsB
strain in tobacco rhizosphere significantly induced the accumulation of salicylic acid, with increases of 1.58-fold
compared with the control. Taken together, the results suggested that the ΔepsB mutant suppressed bacterial wilt
disease by activating salicylic acid signalling and has the potential to be used as biocontrol agents for controlling
bacterial wilt caused by R. solanacearum.

1. Introduction phytopathogenic bacteria, such as Pseudomonas syringae, Erwinia amy­

Bacterial wilt is a lethal systemic vascular disease caused by Ralstonia
solanacearum, one of the most devastating plant bacterial pathogens,
which heavily infects more than 250 plant species [1,2]. Recently, to­
bacco bacterial wilt has been widely observed in the southern of China
and has caused serious economic losses [3,4]. Streptomycin and
thiodiazole-copper are used for controlling bacterial wilt in China, but
exert few positive effects in the field [5,6]. The breeding of cultivars
resistant to bacterial wilt is the most effective method for disease con­
trol. However, in many crops, cultivars that are resistant for bacterial
wilt are negatively correlated with quality and yield [7]. Consequently,
development of new biocontrol strategies is evidently needed.
Avirulent mutants of R. solanacearum have been evaluated as alter­
native biocontrol strategies for controlling bacterial wilt [8,9]. Certain
The Δhrp mutants have demonstrated biological activity against bacte­
rial wilt [10]. What is more, Δhrp mutants had been shown to signifi­
cantly reduce and abolish disease symptoms caused by other
lovora and Xanthomonas campestris [11]. In addition, the high protective
effect of ΔhrpG against bacterial wilt is associated with the upregulated
genes involved in the biosynthesis and signalling of abscisic acid (ABA)
[8]. Meanwhile, the ΔphcA mutant is considered to serve as a potential
biocontrol agent of tomato bacterial wilt by stimulating gene expression
of the salicylic acid pathway [12]. The phenotypic conversion (PC)
mutants of R. solanacearum show highly suppressive effects against
bacterial wilt in many eggplant cultivars [13]. Moreover, a type III
secretion system mutant of Acidovorax citrulli, AAC00-1ΔhrcC could
signifianctly reduce the bacterial fruit blotch seedling transmission [14].
Similary, Freeman [15] found that the avirulent mutant strains 4/4 of
Fusarium oxysporum was able to significantly reduce mortality of
watermelon seedings cause by wild strain. Therefore, construction of
avirulent mutants of R. solanacearum are considered as new, effective
strategies for controlling bacterial wilt.
Extracellular polysaccharide (EPS) is a key virulence factor of
R. solanacearum that is produced in massive amounts in planta, thereby

* Corresponding author. Laboratory of Natural Products Pesticides, College of Plant Protection, Southwest University, 400716, BeiBei Chongqing, China.
E-mail address: dwing818@163.com (W. Ding).

https://doi.org/10.1016/j.pmpp.2022.101834
Received 9 February 2022; Received in revised form 29 March 2022; Accepted 5 April 2022
Available online 8 April 2022
0885-5765/© 2022 Elsevier Ltd. All rights reserved.
S. Li et al. Physiological and Molecular Plant Pathology 119 (2022) 101834

Table 1 2.3. Effect of Δeps mutants on virulence associated gene expression

Primers for virulence associated genes expression in R. solanacearum.
Primers Name Primer sequence (5’>3′ ) Reference R. solanacearum and Δeps mutants were inoculated overnight in B
medium. After centrifugation at 8000 for 5 min, bacteria were resus­
xpsR_F AGATCGACATAGCGCTGCTT [25]
xpsR_R TTACTTTGCGGACCTGCTCT pensed in M63 medium (OD600 adjusted to 0.2) [22]. Next, bacterial
epsE_F CTGGATAAAGCCACGCAAAG [25] suspensions were transferred in tubes and at 180 rpm for 4–5 h at 30 ◦ C.
epsE_R CAGTGGTACATCGCCATCAC The samples were harvested by centrifuging at 5000 for 10 min at 4 ◦ C,
phcA_F TTGTAGGTCTCGCACACCAG [25] and the supernatants were removed. Then, RNA was extracted by using
phcA_R GCTCGCTCGATCAGTACCTC
hrpB_F AATACGCAAATGCGGTTTTC [25]
TRNzol reagent (Tiangen Biotech Co. Ltd, Beijing, China) and treated
hrpB_R CTTCTTCCGCTTCTTCATCG with RNase-free DNase I (Tiangen Biotech Co. Ltd, Beijing, China) to
hrpG_F GTCTTCACGGTCTGCGAACT [25] remove genomic DNA contaminations. RNA degradation and contami­
hrpG_R ATTGACCTCCAATCCATCCA nation were checked on 1% agarose gels and RNA concentration and
flhC_F CTTCCTGAACATCTACCGTTTC [25]
purity were monitored using the Nanovue UV-Vs spectrophotometer.
flhC_R GAGTGATCGACAGCACCTCTT
vsrC_F ACCACCCTCTCGCCTTATCT This study Then, 1 μg of purified RNA was reverse transcribed into cDNA using the
vsrC_R ACAGCCAGACATCCAGCAG iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA). Quantitative
vsrB_F GCGGCACAATCCGTTATTCC This study real-time analysis was according to Yang et al. [20]. The primer se­
vsrB_R GCCCGAGTTTGGTCAAGAGA quences are listed in Table 1.
serC_F CCCACCTACGCCATCTATGT [25]
serC_R TTGAGGAAGAACGGCACATT
2.4. Control efficiency of Δeps mutants on tobacco bacterial wilt

promoting rapid systemic colonization and inducing plant wilting
symptoms [1]. Under high cell density conditions, the global tran­
scriptional regulator PhcA activates the expression of XpsR, which
directly activates the transcription of the eps operon to produce EPS
[16]. The two-component regulatory system VsrA/VsrD is also required
to fully activate xpsR transcription, and consequently EPS synthesis
[17]. The production of EPS I, which mainly contains EPS, requires the
transcriptional expression of the 18-kb eps gene cluster that includes
epsAPBCDEF [16]. EPS mutants of R. solanacearum rarely wilt or kill
plants, even when bacteria directly infect the xylem [18]. However,
whether EPS deleted strains could be used as biocontrol agents for
controlling bacterial wilt has not been determined.
In this study, EPS biosynthesis genes mutants (ΔepsB, ΔepsC and
ΔwecC) were utilized to elucidate the mechanism by which Δeps mutants
inhibit tobacco bacterial wilt. We evaluated the biocontrol activity of the
Δeps mutants on bacterial wilt in a greenhouse experiment, and
expression of virulence-associated genes and plant defence genes was
measured using RT-PCR. Finally, we determined the content of free
salicylic acid (SA) and jasmonic acid (JA) in tobacco plants after inoc­
ulation with ΔepsB strain.
2. Materials and methods
2.1. Bacterial strains and growth conditions
The plant pathogen R. solanacearum CQPS-1 (phylotype I, race 1,
biovar 3) [19] and the Δeps strains (ΔepsB, ΔepsC and ΔwecC) of
R. solanacearum [20] utilized in this study were all provided by the
Laboratory of Natural Products Pesticides, Southwest University,
Chongqing, China (accession number NZ_CP016914.1). R. solanacearum
and mutants were grown in nutrient-rich medium (B medium) at 30 ◦ C
[21].
2.2. Pathogenicity test
The plant used in this study was tobacco (Nicotiana tabacum Yun­
yan87) and tomato (Solanum Lycopersicum cv. Ailsa Craig, AC++).
Three-weeks-old tobacco and tomato seedling was used to tested the
virulence of the Δeps strains. Plant growth and pot experiment were
conducted in climate room at 28 ◦ C with a 14 h/10 h light/dark cycle.
The pathogenicity of the wild-type and mutant strains were tested
using tobacco and tomato plants. 10 mL wild-type and mutant strains (1
× 108 CFU/mL) were added to plant rhizosphere and wilt symptoms
were investigated every day after inoculation. Individual treatments
contained 10 plants for each independent experiment.
The control efficiency of Δeps mutants on tobacco bacterial wilt was
evaluated by the naturalistic soil infiltration assay as described in a
previous study with minor modifications [23]. Briefly, six-week-old to­
bacco plants (Yunyan 87) were pre-inoculated with Δeps mutants of
R. solanacearum (bacterial density, 1 × 108 CFU/mL, 10 mL/pot)
without wounding roots. After 3 days of pre-inoculation, individual
plants were inoculated by pouring 10 mL R. solanacearum CQPS-1 sus­
pension (1 × 108 CFU/mL) into the soil. All plants were placed in a
climate cabin at 28 ◦ C with a 14/10 h light/dark cycle. Bacterial wilt
symptoms were scored daily using a disease index scale from 0 to 4 (0,
no symptoms appeared; 1, 1–25% of leaves wilted; 2, 26–50% of leaves
wilted; 3, 51–75% of leaves wilted; 4, 76–100% of leaves wilted). In­
dividual treatments contained 16 plants for each independent experi­
ment, and the assay was repeated three times. The disease index was
calculated as a weighted average.
To measure the bacterial population in the rhizosphere soil, we
collected eight tobacco roots 7 d after inoculation with R. solanacearum
CQPS-1. The soil was gently shaken from the roots, and to measure the
bacterial population, the remaining soil adhering closely to roots was
considered rhizosphere soil. One gram of soil was diluted into 9 mL of
sterilized water and incubated in a shaker with 170 rpm at 30 ◦ C for 30
min, and cultured in the room temperature for 20 min. Next, the soil
suspension was serially diluted serial dilutions and the bacterial sus­
pension was spread on SMSA medium as described previously [24]. The
wild-type CQPS-1 and Δeps mutants were distinguished by colony
morphology.
2.5. Effect of Δeps mutants on the expression of plant defence associated
genes
To evaluate the effect of Δeps mutants on plant defence gene
expression, six-week-old tobacco plants (Yunyan 87) were pre-
inoculated with Δeps mutants (ΔepsB, ΔepsC and ΔwecC) without
wounding roots. After 24 h pre-inoculation, individual plants were
inoculated by pouring 10 mL R. solanacearum CQPS-1 suspension (1 ×
108 CFU/mL) into the soil. After incubation for 6 h, 0.2 g leaves were
collected for each sample in a microtube and placed into liquid nitrogen.
These samples were utilized for RNA extraction. Eight samples were
collected for each treatment.
Total RNA isolation and quantitative real-time PCR (qRT-PCR) were
performed as previously described with minor modifications [25]. The
total RNA of collected bacterial cells and tobacco leaves was extracted
by using Trizol reagent according to the manufacturer’s instructions
(Tiangen Biotech Co. Ltd, Beijing, China) and was subsequently treated
with RNase-free DNase I (Tiangen Biotech Co. Ltd, Beijing, China) to
remove contaminated genomic DNA.

2
S. Li et al. Physiological and Molecular Plant Pathology 119 (2022) 101834

Table 2
Primers for plant defense associated genes.
Gene Accession no. Forward primer (5′ to 3′ ) Reverse primer (5′ to 3′ )

NtPR1a/c X05959 AACCTTTGACCTGGGACGAC GCACATCCAACACGAACCGA

NtPR2 M60460 TGATGCCCTTTTGGATTCTATG AGTTCCTGCCCCGCTTT
NtPR1b X66942 AACCCATCCATACTATTCCTTG GCCGCTAACCTATTGTCCC
NtPDF1.2 NM_123809.3 GCGCCGGTATTTTTATATTATTGTAACAACAA GCGCCACACAACACATACATCTATACATTG
NtEFE26 Z29529 CGGACGCTGGTGGCATAAT CAACAAGAGCTGGTGCTGGATA
NtACC AB012857 GACAAAGGGACATTACAAGAAGT GAGAAGGATTATGCCACCAG
NtNPR1 U76707 GGCGAGGAGTCCGTTCTTTAA TCAACCAGGAATGCCACAGC

Fig. 1. The pathogenicity and toxicity of ΔepsB mutant on young tobacco and tomato seedlings. (A–C) Diease symptoms of WT and ΔepsB mutant strain on tobacco
plants. (D–F) Diease symptoms of WT and ΔepsB mutant strain on tomato plants.

After extracting total RNA from samples, first-strand cDNA was
synthesized using the iScript gDNA clear cDNA synthesis kit (Bio-Rad,
Hercules, CA, USA) according to the manufacturer’s instructions. RT-
PCR was performed on C1000 Thermal Cycler (Bio-Rad, Hercules, CA,
USA). The primers for the tested genes were designed using the primer
program from NCBI and synthesized by BGI Technologies (Shenzhen,
Guangzhou, China) (Table 2). All quantitative real-time PCR (qRT-PCR)
analyses were performed in 96-well plates in a 20-μL reaction system.
Three technical replicate reactions were used for each sample.
2.6. Analysis of plant salicylic acid and jasmonic acid
To determine the content of free salicylic acid (SA) and jasmonic acid
(JA), six-week-old tobacco plants (Yunyan 87) were inoculated with
ΔepsB strain (1 × 108 CFU/mL, 10 mL/pot) in rhizosphere. Then, we
collected tobacco leaves 1, 3 and 5 d after inoculation with ΔepsB strain.
SA and JA were detected in 50 mg of fresh tobacco crude leaf extracts.
And high-performance liquid chromatography–mass spectrometry was
used for the quantification of SA and JA, as previously described [26].

2.7. Statistical analysis

SPSS version 17.0 was used for the statistical analyses. And the data
analyzed using one-way analysis of variance (ANOVA), Duncan’s mul­
tiple range tests with a p value of 0.05, and independent sample t-tests
with p values of 0.05 and 0.01.

3. Results

3.1. Pathogenicity of the Δeps mutants of R. solanacearum

Fig. 2. Expression of some virulence-associated genes of R. solanacearum
(CQPS-1, Δeps mutants and complemented ΔepsB (epsB-comp)). SerC was used
as the reference gene to normalize the gene expression using the ΔΔCq method.
Each bar represents the mean ± SE of three replications. Different letters
indicate significant differences between different treatments according to one-
way ANOVA with Duncan test (P < 0.05).
The colony morphology of the Δepsmutants were different from the
wild type on B medium (Fig. S1A), forming red and small colonies with
less mucoid compared with wild strain (Fig. S1B). In addition, we
observed that the Δeps mutants (epsB, epsC and wecC) significantly
decreased the pathogenicity of R. solanacearum on tobacco compared to

3
S. Li et al.
WT (Fig. S1C). Furthermore, we evaluated pathogenicity and toxicity of
ΔepsB mutant on young tobacco and tomato seedlings with wounded
and healthy roots. The results showed that wild type strain represented
strong pathogenic activity on seedlings. And all tobacco and tomato
seedlings died at 9 d in WT strain treatment (Fig. 1A, D). However,
ΔepsB mutant showed virulence on young seedlings with wounded and
healthy roots (Fig. 1B, C, E, F).
3.2. Expression of virulence-associated genes in Δeps mutants and wild
type
Previous experiments have shown that Δeps mutants (epsB, epsC and
wecC) significantly decreased the pathogenicity of R. solanacearum on
tobacco. Furthermore, we investigated the expression of several
virulence-associated genes in R. solanacearum CQPS-1 and Δeps strains.
As shown in Fig. 2, the expression of virulence-associated genes was
differentially down-regulated in Δeps strains, whereas the expression of
hrpB, hrpG and filC were not significant difference among
R. solanacearum CQPS-1, epsB-comp and Δeps strains. In addition, the
expression of xpsR, epsE, phcA, vsrC, and vsrB were significantly down­
regulated in Δeps strains showing a 2.3–15.6-fold compared with
4
Physiological and Molecular Plant Pathology 119 (2022) 101834
Fig. 3. Control effect of Δeps mutants
(ΔepsB, ΔepsC, ΔwecC) against tobacco bac­
terial wilt. (A) The disease index of tobacco
wilt pre-treated with ΔepsB, ΔepsC, or ΔwecC
mutant bacterial suspension. WT means only
infected with CQPS-1, and ΔepsB, ΔepsC and
ΔwecC indicates pre-inoculation with ΔepsB,
ΔepsC and ΔwecC strains, respectively. Error
bars indicate the standard errors. (B) Control
efficiency of the Δeps mutants pre-treatment
on tobacco bacterial wilt. Each value in­
dicates the mean ± SE. Different letters
within each column indicate significant dif­
ferences between treatments according to
one-way ANOVA with Duncan test. The dpi
means days post inoculation with
R. solanacearum (CQPS-1). (C) Disease
symptoms of representative tobacco seed­
lings inoculated with R. solanacearum under
different treatments.
R. solanacearum CQPS-1 and epsB-comp strain (Fig. 2).
3.3. Biocontrol of Δeps mutants against tobacco bacterial wilt
To investigate the biocontrol efficiency of Δeps mutants (ΔepsB,
ΔepsC and ΔwecC) against tobacco bacterial wilt, we performed a pot
experiment in a greenhouse. We found that ΔepsB strain significantly
reduced the disease index of tobacco bacterial wilt (Fig. 3A). After
inoculation for 18 d, the disease index of the ΔepsB strain pre-
inoculation treatment was observed to be 1.87, which was signifi­
cantly lower than the disease index of plants infected with CQPS-1 with
3.98. Furthermore, the ΔepsB strain treatment exhibited significantly
control efficiencies which were higher significantly higher than ΔepsC
and ΔwecC strains treatment, reaching values of 84.67%, 72.74%,
60.68%, 56.38% and 53.29% at 8, 10, 12, 14 and 16 d after inoculation,
respectively. The control efficiency of the ΔepsC pre-treatment was
65.45%, 60.18%, 51.73%, 48.32% and 42.06%, respectively, on the
same days after inoculation (Fig. 3B).
To evaluate the bacterial population of WT and Δeps mutants in the
rhizosphere soil of tobacco, we analyzed the number of different col­
onies of monospheres to distinguish WT and Δeps mutants. As shown in
S. Li et al.
Fig. 4. Population sizes of R. solanacearum strains in the rhizosphere soil of
tobacco. Six-week-old tobacco plants were pre-inoculated with Δeps mutants of
R. solanacearum (bacterial density, 1 × 108 CFU/mL, 10 mL/pot) without
wounding roots. The soil was gently shaken from the roots 7 d after inoculation.
One gram of soil was diluted into 9 mL of sterilized water and the soil sus­
pension was serially diluted serial dilutions and the bacterial suspension was
spread on SMSA medium. Colony counts were normalized to CFU/g soil. Each
bar represents the mean ± SE of three replications. ** indicate significant dif­
ferences between different treatments according to Student’s t-test (P < 0.01).
Fig. 5. Effect of Δeps mutants (ΔepsB, ΔepsC, ΔwecC) pretreatment on
expression of tobacco defence genes. We used mock-inoculation with sterile
water (CK) as the control treatment. Defence genes represent salicylic acid
pathway (PR1a/c, PR2), jasmonic acid pathway (PR1b, PDF1.2), ethylene
pathway (EFF26, ACC) and systemic acquired resistance gene (NRP1). Each bar
represents the mean ± SE of three replications. Different letters indicate sig­
nificant differences between different treatments according to one-way ANOVA
with Duncan test (P < 0.05).
Fig. 4, the pathogen population in rhizosphere soil treated with ΔepsB
strain pre-inoculation treatment was the lowest, being significantly
reduced by 46.77-fold compared with WT bacteria. Moreover, the
populations of ΔepsB strain were 0.44 × 107 CFU/g, reaching nearly
7.08-fold higher than pathogen population in rhizospheres soil (P <
0.01) (Fig. 4). However, the bacterial densities of the ΔepsC and ΔwecC
pre-inoculation treatments were all lower than pathogen population.
3.4. Effect of ΔepsB mutant on defence-associate gene expression in
tobacco
To investigate the effect of the ΔepsB mutant on defence gene
5
Physiological and Molecular Plant Pathology 119 (2022) 101834
expression in tobacco, we collected tobacco leaves 4 d after inoculation
with R. solanacearum CQPS-1. We found that the pre-inoculation ΔepsB
strain induced the expression of genes involved in the salicylic acid
pathway, including PR1a/c, PR2 and NPR1 (Fig. 5). Compared with WT
bacteria, the expression of PR1a/c, PR2 and NRP1 in the ΔepsB strain
treatment increased 4.5-fold, 6.9-fold and 2.2-fold, respectively.
3.5. SA levels accumulation in tobacco induced by ΔepsB mutant
Previous experiments have shown that ΔepsB mutant significantly
activated the defence gene expression in tobacco, we determined
whether the endogenous levels were affected after ΔepsB strain inocu­
lation. As shown in Fig. 6, SA levels increased dramatically 1 d and 3
d after ΔepsB strain inoculation, showing enhancements of 0.06 and
0.09 μg/g FW compared with control (P < 0.05) (Fig. 6). Especially, SA
levels increased markedly to a high level at 5 d in ΔepsB strain treatment,
with increases of 1.58-fold compared with the control (P < 0.01)
(Fig. 6A). Whereas, the mount of JA was no significant change after
ΔepsB strain inoculation (Fig. 6B). These findings suggest that ΔepsB
strain promote the accumulation of salicylic acid in tobacco.
4. Discussion
Discovering new biocontrol agents is considered to be a new and
efficient method for controlling bacterial wilt [27]. Use of avirulent
mutants of pathogens employed as alternative biocontrol agents have
been studied for decades [28]. The effect of the avirulent mutants on
ecological competition and induction of plant systemic resistance were
also investigated [12]. In previous study, we constructed three Δeps
mutants (yang et al., 2021), which confirmed that these mutant strains
were avirulent to the plant (Fig. 1). Therefore, we did research into the
effect and mechanism of mutants on tobacco bacterial wilt.
Certain avirulent mutants of R. solanacearum were demonstrated for
controlling bacterial wilt by competing with the pathogen and activating
host plant resistance [11]. In previous study, we constructed three Δeps
mutants (ΔepsB, ΔepsC and ΔwecC) which showed non-pathogenicity on
tobacco, exhibited significantly reduced biofilm formation and induced
swimming activity [20]. In this study, we further found that the
pre-application of Δeps mutants significantly inhibited bacterial density
in the rhizosphere soil and reduced the disease index of tobacco bacte­
rial wilt. Indeed, one of the main biocontrol mechanisms is that mutant
strains can effectively compete with pathogenic bacteria and reduce the
colonization and proliferation of pathogenic bacteria in plants. Trigalet
et al. [29] demonstrated that P. solanacearum avirulent strain GMI1299
could colonize tomato plants and prevent the proliferation of pathogenic
bacteria. In addition, Δhrp mutants of P. solanacearum could control
bacterial wilt by excluding the pathogen from colonizing parts of the
plant [30]. To a certain extent, the number of pathogenic bacteria and
the early occupation of ecological niche in rhizospheres are the key to
pathogen infection. Chen et al. [12] found that pre-inoculation of the
ΔphcA mutant R. solanacearum three days earlier than pathogen can
inhibit the populations of the pathogen more effectively than inocula­
tion with the pathogen at the same time. As well, Yang et al. [31] found
that Δhrp mutant could not inhibit R. solanacearum growth directly, but
could be colonized in plant and prevented virutent strain reproduction
after pre-inoculation. Similarly, in this study, we found that the path­
ogen population in rhizosphere soil treated with ΔepsB mutant
pre-inoculation treatment was significantly reduced compared with WT
bacteria. Moreover, the populations of ΔepsB mutant were nearly
7.08-fold higher than pathogen population in rhizospheres. Taken
together, avirulent mutant strain of R. solanacearum reduced the number
of pathogenic bacteria and infection by locus and spatial competition.
The accumulation of EPS in the vascular system requires efficient
colonization and the ensuing collapse of the water flow, which can cause
wilting symptoms and eventually plant death [32]. And the eps operon
containing epsB is involved in the production and extracellular secretion
S. Li et al.
of EPS I [1]. In previous study, we found that the epsB-deletion mutant
ΔepsB produced less EPS [20] and the expression of xpsR and epsE genes
were significant down-regulation in ΔepsB strains. These results are
consistent with findings reported previously from Hayashi et al. [33]. In
addition, the expression level of fliC was no significant difference among
strains (Fig. 2). And Hayashi et al. [33] observed a significantly greater
expression level of fliC in ΔepsB than in the strain OE1-1. However, we
found that ΔepsB strain exhibited significantly greater swimming
motility than WT strain, which consistent with the report of Hayashi
et al. [33]. So, we speculate that ΔepsB mutant of R. solanacearum
CQPS-1 affect flagellar motility-related genes. Additionally, the
vsrB/vsrC two-component regulatory systems upregulate the expression
of the eps operon [34]. And these two-component systems regulate xpsR
and affect EPS I production [1]. In this research, the RT-PCR results
showed that eletion of epsB led to significantly reduced expression levels
of vsrB and vsrC. Therefore, the deficiency of epsB may be induce a
negative feedback effect of the vsrB and vsrC expression. However,
Hayashi et al. [33] determined that the expression of vsrB and vsrC were
not affected by the ΔepsB strain base on transcriptome analysis. This
difference in results may be related to the measurement method. Thus,
whether epsB can positively vsrB/vsrC remains to be further studied.
Furthermore, the decreased expressions of the virulence-associated
genes in the Δeps mutants suggest that EPS I or its intermediate prod­
uct of the EPS biosynthesis pathway act as a signalling molecule in a
feedback loop of gene expression. Similarly, Hayashi et al. [33]
demonstrated that EPS I is associated with the feedback loop in the
quorum sensing of R. solanacearum strain.
On the other hand, EPS could activates the defence response against
R. solanacearum in wilt-resistant tomato [35]) and eggplant plants [36].
As well, we observed that the ΔepsB mutant induced the expression of
defense resistance genes and accumulation of salicylic acid (Figs. 5 and
6). A previous study found that the ΔphcA mutant of R. solanacearum
produced less EPS but still significantly induced the expression of
defence pathway genes [12]. Additionally, a recent study showed that
heat-killed virulent R. solanacearum GMI1000 induced a higher level of
protection than Escherichia coli when inoculating Arabidopsis roots with
R. solanacearum [8]. These results indicated that pathogen surface
components could be recognized by plants and could induced plant
system resistance. LPS is identified as a cell surface component that
elicits plant defence responses [37,38]; Wang et al., 2020). Cell-surface
pattern-recognition receptors, as the first layer of the plant immune
surveillance system, recognize conserved molecular features of microbes
such as bacterial flagellin to activate PTI [24,39]. Furthermore, plant
intracellular nucleotide-binding domain and leucine-rich repeat
(NLR)-containing receptors can recognize individual T3Es and cause ETI
[40]. Previous studies have shown that whether increasing or decreasing
EPS production could activate plant system resistance. And we speculate
that plants might recognize the LPS or flagellin of mutant bacteria
without the protection of surrounding biofilm formation provided by
EPS. However, whether Δeps mutants change the structure of EPS or LPS
6
Physiological and Molecular Plant Pathology 119 (2022) 101834
Fig. 6. Effect of ΔepsB mutant on endoge­
nous levels of free SA and JA in tobacco
plants.
Six-week-old tobacco plants were inoculated
with ΔepsB mutant (1 × 108 CFU/mL, 10
mL/pot). SA and JA were detected in fresh
tobacco crude leaf extracts 1, 3 and 5 d after
inoculation. Each bar represents the mean
± SE of three replications. * and ** indicate
significant differences between different
treatments according to Student’s t-test (P <
0.05 and P < 0.01).
and whether these compounds could be recognized by plants warrant
further research.
Inducing host plant resistance by avirulent mutants is considered as
main mechanism for controlling bacterial wilt. Ethylene (ET), salicylic
acid (SA) jasmonic acid (JA) are critical components of plant systemic
responses of plants response to pathogen invasion [41]. Recent study
demonstrated that the ΔhrpG mutant upregulated genes involved in the
biosynthesis and signalling of abscisic acid (ABA) in Arabidopsis, acti­
vated the plant defence system and exhibited a strong protection effect
against bacterial wilt [8]. Meanwhile, the ΔPhcA mutant of
R. solanacearum induced salicylic acid gene expression [12]. These re­
sults indicated that the primary mechanism by which avirulent mutants
control bacterial wilt is associated with inducing plant defence resis­
tance. In this study, ΔepsB strain significantly induced the expression of
PR-1a/c, PR2 and NPR1, which is associated with the salicylic acid
pathway, without affecting the expression of genes involved in jasmonic
acid and ethylene pathways. Different mutants could activate different
plant defence pathways, and the mechanism of the ΔepsB mutant
regulating the plant defence pathway in tobacco is worthy of future
study.
In this study, we found a novel biocontrol agent, the ΔepsB mutant,
which effectively reduced R. solanacearum colonization in the tobacco
rhizosphere, and suppressed bacterial wilt disease by activated the
robust expression of resistance genes in tobacco. ΔepsB mutant dis­
played activating host plant systemic resistance by salicylic acid
signalling.
Author statement
Li Shili and Yang Liang: Data curation, Ding Wei and Li Shili:
Funding acquisition, Yang Liang and Ran Yuao: Investigation, Li Shili
and Yang Liang: Methodology, Ding Wei: Supervision, Shili Li and Liang
Yang: Writing – original draft, Li Shili and Ding Wei: Writing – review
and editing.
Declaration of competing interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Acknowledgments
This work was supported by the science and technology projects of
Sichuan Company of China Tobacco Corporation (SCYC201908) and by
the China Postdoctoral Science Foundation (2019M653320), Natural
Science Foundation of Chongqing (cstc2019jcyj-bshX0114).
S. Li et al.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.pmpp.2022.101834.
References
[1] S. Genin, T.P. Denny, Pathogenomics of the Ralstonia solanacearum species
complex, Annu. Rev. Phytopathol. 50 (1) (2012) 67–89.
[2] J. Mansfield, S. Genin, S. Magori, V. Citovsky, M. Sriariyanum, P. Ronald, M. Dow,
V. Verdier, S.V. Beer, M.A. Machado, I. Toth, G. Salmond, G.D. Foster, Top 10 plant
pathogenic bacteria in molecular plant pathology, Mol. Plant Pathol. 13 (6) (2012)
614–629.
[3] G.F. Jiang, Z. Wei, J. Xu, H.L. Chen, Y. Zhang, X.M. She, A.P. Macho, W. Ding, B.
S. Liao, Bacterial wilt in China: history, current status, and future perspectives,
Front. Plant Sci. 8 (2017) 1549.
[4] Y. Liu, D.S. Wu, Q.P. Liu, S.T. Zhang, Y.M. Tang, G.F. Jiang, S.L. Li, W. Ding, The
sequevar distribution of Ralstonia solanacearum in tobacco-growing zones of China
is structured by elevation, Eur. J. Plant Pathol. 147 (3) (2017) 541–551.
[5] P. Li, L. Shi, M.N. Gao, X. Yang, W. Xue, L.H. Jin, D.Y. Hu, B.A. Song, Antibacterial
activities against rice bacterial leaf blight and tomato bacterial wilt of 2-mercapto-
5-substituted-1,3,4-oxadiazole/thiadiazole derivatives, Bioorg. Med. Chem. Lett 25
(3) (2015) 481–484.
[6] W.M. Xu, F.F. Han, M. He, D.Y. Hu, J. He, S. Yang, B.A. Song, Inhibition of tobacco
bacterial wilt with sulfone derivatives containing an 1,3,4-oxadiazole moiety,
J. Agric. Food Chem. 60 (4) (2012) 1036–1041.
[7] Yuliar, Y.A. Nion, K. Toyota, Recent trends in control methods for bacterial wilt
diseases caused by Ralstonia solanacearum, Microb. Environ. 30 (1) (2015) 1–11.
[8] D.X. Feng, C. Tasset, M. Hanemian, X. Barlet, J. Hu, D. Trémousaygue,
L. Deslandes, Y. Marco, Biological control of bacterial wilt in Arabidopsis thaliana
involves abscissic acid signalling, New Phytol. 194 (4) (2012) 1035–1045.
[9] Z. Wei, T. Yang, V.-P. Friman, Y. Xu, Q. Shen, A. Jousset, Trophic network
architecture of root-associated bacterial communities determines pathogen
invasion and plant health, Nat. Commun. 6 (2015) 8413.
[10] C. Etchebar, D. Trigalet-Demery, F. van Gijsegem, J. Vasse, A. Trigalet, Xylem
colonization by an HrcV mutant of Ralstonia solanacearum is a key factor for the
efficient biological control of tomato bacterial wilt, Mol. Plant Microbe Interact. 11
(9) (1998) 869–877.
[11] M. Hanemian, B. Zhou, L. Deslandes, Y. Marco, D. Tremousaygue, Hrp mutant
bacteria as biocontrol agents: toward a sustainable approach in the fight against
plant pathogenic bacteria, Plant Signal. Behav. 8 (10) (2013).
[12] D. Chen, C. Li, K. Wu, G. Xun, S. Yuan, Q. Shen, B. Shen, A phcA-marker-free
mutant of Ralstonia solanacearum as potential biocontrol agent of tomato bacterial
wilt, Biol. Control 80 (2015) 96–102.
[13] H. Nakahara, T. Mori, N. Sadakari, H. Matsusaki, N. Matsuzoe, Selection of
effective non-pathogenic Ralstonia solanacearum as biocontrol agents against
bacterial wilt in eggplant, J. Plant Dis. Prot. 123 (3) (2016) 119–124.
[14] K.L. Johnson, G.V. Minsavage, J.B. Jones, Efficacy of a nonpathogenic acidovorax
citrulli strain as a biocontrol seed treatment for bacterial fruit blotch of cucurbits,
Plant Dis. 95 (6) (2011) 697–704.
[15] S. Freeman, A. Zveibil, H. Vintal, M. Maymon, Isolation of nonpathogenic mutants
of fusarium oxysporum f. sp. melonis for biological control of fusarium wilt in
cucurbits, Phytopathology 92 (2) (2002) 164–168.
[16] J. Huang, B.F. Carney, T.P. Denny, A.K. Weissinger, M.A. Schell, A complex
network regulates expression of eps and other virulence genes of Pseudomonas
solanacearum, J. Bacteriol. 177 (5) (1995) 1259–1267.
[17] J. Huang, W. Yindeeyoungyeon, R.P. Garg, T.P. Denny, M.A. Schell, Joint
transcriptional control of xpsR, the unusual signal integrator of the Ralstonia
solanacearum virulence gene regulatory network, by a response regulator and a
LysR-type transcriptional activator, J. Bacteriol. 180 (10) (1998) 2736–2743.
[18] E. Saile, J.A. McGarvey, M.A. Schell, T.P. Denny, Role of extracellular
polysaccharide and endoglucanase in root invasion and colonization of tomato
plants by Ralstonia solanacearum, Phytopathology 87 (12) (1997) 1264–1271.
[19] Y. Liu, Y.M. Tang, X.Y. Qin, L. Yang, G.F. Jiang, S.L. Li, W. Ding, Genome
sequencing of Ralstonia solanacearum CQPS-1, a phylotype I strain collected from a
highland area with continuous cropping of tobacco, Front. Microbiol. 8 (2017)
974.
Physiological and Molecular Plant Pathology 119 (2022) 101834
[20] L. Yang, Z.L. Wei, S.L. Li, R. Xiao, Q.Q. Xu, Y.A. Ran, W. Ding, Plant secondary
metabolite, daphnetin reduces extracellular polysaccharides production and
virulence factors of Ralstonia solanacearum, Pestic. Biochem. Physiol. 179 (2021).
[21] T. Yoshimochi, Y. Zhang, A. Kiba, Y. Hikichi, K. Ohnishi, Expression of hrpG and
activation of response regulator HrpG are controlled by distinct signal cascadesin
Ralstonia solanacearum, J. Gen. Plant Pathol. 75 (2009) 196–204.
[22] A.N. Tsoligkas, J. Bowen, M. Winn, R.J. Goss, T.W. Overton, M.J. Simmons,
Characterisation of spin coated engineered Escherichia coli biofilms using atomic
force microscopy, Colloids Surf. B Biointerfaces 89 (2012) 152–160.
[23] L. Yang, L.T. Wu, X.Y. Yao, S.Y. Zhao, J. Wang, S.L. Li, W. Ding,
Hydroxycoumarins: new, effective plant-derived compounds reduce Ralstonia
pseudosolanacearum populations and control tobacco bacterial wilt, Microbiol. Res.
215 (2018) 15–21.
[24] Z. Wei, X.M. Yang, S.X. Yin, Q.R. Shen, W. Ran, Y.C. Xu, Efficacy of Bacillus-
fortified organic fertiliser in controlling bacterial wilt of tomato in the field, Appl.
Soil Ecol. 48 (2) (2011) 152–159.
[25] D.S. Wu, W. Ding, Y. Zhang, X.J. Liu, L. Yang, Oleanolic acid Induces the type III
secretion system of Ralstonia solanacearum, Front. Microbiol. 6 (2015) 1466.
[26] X. Pan, R. Welti, X. Wang, Quantitative analysis of major plant hormones in crude
plant extracts by high-performance liquid chromatography-mass spectrometry,
Nat. Protoc. 5 (6) (2010) 986–992.
[27] M.J. Kwak, H.G. Kong, K. Choi, S.K. Kwon, J.Y. Song, J. Lee, P.A. Lee, S.Y. Choi,
M. Seo, H.J. Lee, Rhizosphere microbiome structure alters to enable wilt resistance
in tomato, Nat. Biotechnol. 36 (11) (2018) 1100–1109.
[28] A. Trigalet, D. Demery, Invasiveness in tomato plants of Tn5-induced avirulent
mutants of Pseudomonas-Solanacearum, Physiol. Mol. Plant Pathol. 28 (3) (1986)
423–430.
[29] A. Trigalet, D. Trigalet-Demery, Use of avirulent mutants of Pseudomonas
solanacearum for the biological control of bacterial wilt of tomato plants, Physiol.
Mol. Plant Pathol. 36 (1) (1990) 27–38.
[30] P. Frey, P. Prior, C. Marie, A. Kotoujansky, A. Trigalet, Hrp mutants of Pseudomonas
solanacearum as potential biocontrol agents of tomato bacterial wilt, Appl. Environ.
Microbiol. 60 (9) (1994) 3175.
[31] Y.H. Yang, J.P. Liu, C.R. Yang, H.Z. Gong, D.X. Feng, B.Y. Xie, Control of
Solanaceae vegetable bacterial wilt with avirulent hrp- mutants, J. Plant Prot. 35
(5) (2008) 433–437.
[32] T.M. Lowe-Power, D. Khokhani, C. Allen, How Ralstonia solanacearum exploits and
thrives in the flowing plant xylem environment, Trends Microbiol. 26 (11) (2018)
929–942.
[33] K. Hayashi, W. Senuma, K.j. Kai, K. Kiba, K. Ohnishi, Y. Hikichi, Major
exopolysaccharide, EPS I is associated with the feedback loop in the quorum
sensing of Ralstonia solanacearum strain OE1-1, Mol. Plant Pathol. 20 (12) (2019)
1740–1747.
[34] R.P. Garg, J. Huang, W. Yindeeyoungyeon, T.P. Denny, M.A. Schell,
Multicomponent transcriptional regulation at the complex promoter of the
exopolysaccharide I biosynthetic operon of Ralstonia solanacearum, J. Bacteriol.
182 (2000) 6659–6666.
[35] A. Milling, L. Babujee, C. Allen, Ralstonia solanacearum extracellular
polysaccharide is a specific elicitor of defense responses in wilt-resistant tomato
plants, PLoS One 6 (1) (2011), e15853.
[36] A. Prakasha, I.D. Grice, K.V. Kumar, M. Sadashiva, H. Shankar, S. Umesha,
Extracellular polysaccharide from Ralstonia solanacearum; A strong inducer of
eggplant defense against bacterial wilt, Biol. Control 110 (2017) 107–116.
[37] S.F. Beyer, A. Beesley, P.F.W. Rohmann, H. Schultheiss, U. Conrath, C.J.
G. Langenbach, The Arabidopsis non-host defence-associated coumarin scopoletin
protects soybean from Asian soybean rust, Plant J. 99 (3) (2019) 397–413.
[38] A. Mithofer, Suppression of plant defence in rhizobia-legume symbiosis, Trends
Plant Sci. 7 (10) (2002) 440–444.
[39] J.F. Huang, Z. Wei, J. Hu, C.L. Yang, Y.A. Gu, X.L. Mei, Q.R. Shen, Y.C. Xu, K. Riaz,
Chryseobacterium nankingense sp nov WR21 effectively suppresses Ralstonia
solanacearum growth via intensive root exudates competition, BioControl 62 (4)
(2017) 567–577.
[40] S. Boukaew, S. Chuenchit, V. Petcharat, Evaluation of Streptomyces spp. for
biological control of Sclerotium root and stem rot and Ralstonia wilt of chili pepper,
BioControl 56 (3) (2011) 365–374.
[41] A. Block, E. Schmelz, P.J. O’Donnell, J.B. Jones, H.J. Klee, Systemic acquired
tolerance to virulent bacterial pathogens in tomato, Plant Physiol. 138 (3) (2005)
1481–1490.