1479 6805 Joe 21 0449

Journal of L Cui et
al. 254:2 65–76

Endocrinology
RESEARCH
Dapagliflozin partially restores reproductive

function in MC4R KO obese female mice
Ling Cui1,2, Chunlu Tan1, Lili Huang1, Weihao Wang1, Zhengxiang Huang 1, Fang Geng1, Mengjun Wu2, Xiaolin Chen3,
Michael Cowley4, Ferdinand Roelfsema5 and Chen Chen 1
1Schoolof Biomedical Science, University of Queensland, St Lucia, Brisbane, Queensland, Australia
2Department of Reproduction and Infertility, Chengdu Women’s and Children’s Central Hospital, School of Medicine, University of Electronic Science and
Technology of China, Chengdu, China
3Endocrinology Department, Renmin Hospital of Wuhan University, Wuchang District, Wuhan, Hubei Province, China
4Department of Physiology, Monash University, Clayton, Victoria, Australia
5Endocrinology and Metabolism, Leiden University, Leiden, Netherlands
Correspondence should be addressed to C Chen: chen.chen@uq.edu.au
Abstract
Obese women often have certain degree of reproductive dysfunction with infertility. Key Words
Although the clinical impact of obesity on female infertility has been extensively studied, f SGLT2 inhibitor
the effective and targeted treatment is still lacking. Melanocortin-4-receptor knock-out f infertility
(MC4R KO) mouse is an over-eating obese model with hyperphagia, hyperinsulinemia, f obesity
reduced growth hormone (GH), and insulin resistance. Dapagliflozin improved the f ovulation
metabolic and hormonal parameters in MC4R KO mice. MC4R KO female mice were f luteinizing hormone
treated with dapagliflozin for 14 weeks from 14-week age. Age-matched WT littermates
and non-treated MC4R KO mice were used as control groups. Food intake was measured
daily. Body weight was measured twice a week. Estrous cycles, GH, and luteinizing
hormone (LH) profiles were measured. Selected tissues were collected at the end of
experiments for gene expression profiles and hematoxylin–eosin staining. Regularity and
mode of hormonal profiles were restored by the dapagliflozin treatment. Estrous cycle
was partially normalized, number of CL was significantly increased, and the expression
of Kiss1 and Gnrh1 in the hypothalamus and LH in the pituitary was markedly increased
by the dapagliflozin treatment. It is conclsuded that dapagliflozin may recover LH and GH
profiles partially through modification of relevant gene expression in the hypothalamus
and pituitary, and result in an improved ovulation rate in obese mouse model.
Journal of Endocrinology
Dapagliflozin may therefore improve fertility in obese patients. (2022) 254, 65–76
Introduction
Infertility is a common clinical disorder among the obese Genetic defects in the brain α-melanocyte-stimulating
population. Obesity itself has become a global epidemic, hormone–melanocortin receptor (melanocortin 4
affecting 23% of women of the reproductive age with an receptor, MC4R) signaling led to hyperphagia and obesity
increased rate of infertility (Broughton & Moley 2017). (Vaisse et al. 2000). MC4R KO mouse line was reported to
Although the clinical impact of obesity on female infertility have irregular reproductive cycles and fewer ovulations
has been a topic for extensively epidemic studies, the (Sandrock et al. 2009). Reproductive hormone disturbances
effective and targeted treatment is still under elucidation.
https://joe.bioscientifica.com © 2022 Society for Endocrinology

https://doi.org/10.1530/JOE-21-0449 Published by Bioscientifica Ltd.
Printed in Great Britain Downloaded from Bioscientifica.com at 03/30/2023 03:22:27AM
via University of Minnesota
Journal of L Cui et al. 254:2 66
Endocrinology
were also reported to cause progressive infertility in MC4R gonadotropins (LH and FSH) and sexual steroids in the
KO mice (Chen et al. 2017). ovary (Branavan et al. 2019) and to regulate reproductive
The mechanisms of infertility induced by obesity functions (Meczekalski et al. 2016). Hypothalamic
may be related to insulin resistance and persistent gonadotropin-releasing hormone (GnRH), encoded
hyperinsulinemia (Silvestris et al. 2019). Obesity and by the GnRH 1 gene, is regulated by kisspeptin in both
hyperinsulinemia significantly reduced pulsatile growth animal models and humans (Murphy 2005). Kisspeptin
hormone (GH) secretion in male mice (Tan et al. 2016). acts directly on the GnRH neuron through the kisspeptin
GH was also demonstrated to have multiple specific effects receptor to release GnRH into the portal circulation, which
in female reproductive physiology, such as promotion of in turn stimulates the synthesis and secretion of LH and
steroidogenesis, enhancement of gonadotropin sensitivity, FSH from the anterior pituitary gland (Skorupskaite et al.
as well as the development of follicles during the initiation 2014).
of puberty (Abir et al. 2008). As a co-gonadotropin, GH Therefore, the main aim of this study was to determine
acted in synergy with gonadotropins, follicle-stimulating the effects of SGLT2i dapagliflozin on ovulation, pituitary
hormone (FSH), and luteinizing hormone (LH), on GH and LH secretion, and hypothalamic kisspeptin–GnRH
reproductive tissue to promote granulosa and theca cell expression in female obese MC4RKO mice. The results
expansion and granulosa cell differentiation to luteal cells supported dapagliflozin as a new therapeutic drug in the
(Childs 2000, Ipsa et al. 2019). Follicular GH concentration treatment of female obese infertility.
was positively associated with human oocyte maturity
and subsequent fertilized oocytes cleavage, while deficient
GH caused morphological dysfunction of the cleaved
Materials and methods
embryos (Mendoza et al. 1999). An early rise in the GH
concentration in small antral follicles was beneficial for Animal
oocyte quality in synergy with FSH and LH (Mendoza
et al. 1999), probably by increasing the sensitivity of the MC4R KO and WT mice on C57BL6/J background were
ovary to gonadotrophins and reducing the incidence of obtained from heterozygous breeding pairs and genotyped
apoptosis in preovulatory ovarian follicles (Danilovich before using (Tan et al. 2016). Mice were pair-housed in a
et al. 2000). GH also facilitated ovulation by increasing 12-h light:12-h darkness cycle (light on at 8:00 h and off
tissue plasminogen activator synthesis (Politis et al. 1990). at 20:00 h). Room temperature was maintained at 22 ± 2°C
GH secretion profiles in female mice are a subject without and room humidity was maintained at 35 ± 4% at the
careful investigation and the link of GH to obesity-caused animal facility of the Institute for Bioengineering and
infertility is unknown. Nanotechnology, the University of Queensland. Mice
Disordered insulin and GH profiles were partially had free access to chow diet (Specialty Feeds, Glen Forrest,
normalized by dapagliflozin treatment in male MC4R KO WA, Australia) and water. All experiments and procedures
obese mice (Huang et al. 2020). Dapagliflozin, a sodium- were approved by the Animal Ethics Committee of the
glucose cotransporter-2 inhibitor (SGLT2i), is an anti- University of Queensland.
hyperglycemic agent in the treatment of type 2 diabetes
(Akinci 2019, Dhillon 2019, Wiviott et al. 2019) by promoting
Experiment design
urinary glucose excretion (Scheen & Paquot 2014). SGLT2i
increased insulin sensitivity via reduced glucotoxicity, Dapagliflozin treatment in female MC4R KO mice
lipotoxicity, oxidative stress, chronic inflammation, Ten-week-old MC4RKO mice which were randomly
improved β-cell function, normalized caloric deposition, assigned to two groups (n = 5) and a group of WT mice
and maintained a better weight control (Yaribeygi et al. (n = 5) were fed under the same feeding conditions. All
2020). Evidence regarding SGLT2i in the treatment of mice were trained by human handling for blood collection
obese reproductive dysfunction is still limited. SGLT2i was from 10-week-old for 4 weeks. By 8 weeks of age, MC4RKO
reported to improve anthropometric parameters and body mice gained significantly more weight than WT mice. The
composition in human, whereas reproductive hormone estrous cycles of the mice were checked by vaginal cytology
profiles were not analyzed yet (Zinman et al. 2015, Javed examination. The cycles in 11–13-week MC4R KO mice
et al. 2019, 2020). were close to normal with 4–5-day regular estrous cycles.
In the hypothalamus, KISS1 gene encodes kisspeptin However, MC4R KO mice exhibited irregular estrous cycles
to regulate the synthesis and secretion of pituitary from 16 weeks of age with longer estrous cycles. We then

Endocrinology
decided to commence SGLT2i treatment at the age of 14 et al. 2017). All cycle stage data were carefully recorded with
weeks just before estrous cycle changes. The 14-week-old each mouse during the experiments.
female MC4R KO mice were treated with dapagliflozin
(AstraZeneca, Göteborg, Sweden) (Fig. 1A) dissolved in Characterization of metabolic profiles in MC4R KO
drinking water at a dose of 1 mg/kg/day for 14 weeks. Age- mice
matched WT littermates and non-treatment MC4R KO Glucose tolerance test (GTT) was performed at 25 weeks of
mice with normal drinking water were used as two control age. Briefly, mouse was oral gavage of glucose (2 g/kg) after
groups. Food intake was measured daily. Body weight was 12 h of overnight fasting, due to normal night-time eating
measured twice a week. Estrous cycles, GH, and LH profiles behavior of mouse. A tail-tip blood sample was collected
were measured as detailed below. At the end of treatment, immediately prior to the injection and at 30, 60, 90, and
mice were killed following an intraperitoneal injection 120 min after the injection. Blood glucose was determined
of sodium pentobarbital (32.5 mg/mL, 100 mL per MC4R using the Start-Strip Xpress glucometer (Waltham, MA,
KO mouse weight 40–50 g, 45 mL per WT mouse weight USA).
20–25 g) under fed state with food during the day between
Serial blood collection for GH and LH measurement
8:00 and 10:00 h. Because the blood volume of mice is
Blood samples were collected for pulsatile GH and LH
limited, we will let the mice rest for 2 weeks after each
secretion profiles according to the early established
sequential blood collection for GH or LH while the therapy
method (Steyn et al. 2013). Briefly, all mice were trained
was continued. Tissues were either snap-frozen for gene
for 2 weeks before the experiment. The procedure began at
expression measurement or fixed in 4% paraformaldehyde
9:00 h and ended at 15:00 h. During the procedure, 4 μL of
for hematoxylin–eosin (H&E) staining (Fig. 1B).
whole blood was collected from the tail tip of each mouse
with a 10-min interval. For each sample, 4μL of whole
Assessment of estrous cycles of mice blood was added into 116 μL of 0.01 M PBS supplemented
In mice, the estrous cycle is a continuum of approximately with 0.05% Tween 20. Samples were mixed by vortex, snap-
4–5 days with proestrus occurring at 12–24 h the estrus frozen by dry ice and stored at −80°C for measurement of
lasting for 1–2 days, and diestrus for 2–3 days. A vaginal GH (Steyn et al. 2011), and LH ELISA (Steyn et al. 2013) by
cytology method was used to determine the stage of the in-house ELISA kits. To minimize handling related stress,
estrous cycle from 8 to 28 weeks of age (Chen et al. 2017). all mice were trained for 4 weeks to adapt to the blood
Vaginal cytology smears were stained with Wright’s collection process. All mice we would rest for 2 weeks
staining (Chen et al. 2017). Daily vaginal smears from each before the next collection of blood samples. Intra- and
mouse were taken between 8:00 h and 10:00 h. Changes in Inter-assay variations for LH and GH assays of the tested
the vaginal epithelium characteristic at different estrous kits were smaller than 10 and 15%, respectively (Steyn et al.
cycle stages were assessed by vaginal cytology characters 2011, 2013).
as follows: predominant nucleated epithelial cells at the
proestrus stage; predominant cornified epithelial cells at Ovary histology
the estrus stage; predominant multinucleated leukocytes Ovaries were collected from mice at the diestrus stage at
and a few cornified epithelial cells at the metestrus stage; the termination time of the experiments. The collected
and predominant leukocytes at the diestrus stage (Chen tissues were fixed in paraformaldehyde for at least 24 h
Figure 1
Experimental design. (A) Chemical structure of
compound. (B) Experimental protocol for
dapagliflozin treatment in female MC4R KO mice.

Printed in Great Britain
Downloaded from Bioscientifica.com at 03/30/2023 03:22:27AM
Endocrinology
and embedded in paraffin wax. Ovary was then serially and were analyzed by the chi-square test or Fisher’s exact
sectioned at 7 μm thickness along the longitudinal plane. test methods. The quantitative parameters of GH and LH
Total 96 sections were collected in each ovary and stained secretion and clearance associated with observed hormone
with H&E. Sections were imaged with an Aperio ScanScope concentration profiles were determined by deconvolution
XT slide scanner (Aperio Technologies, Vista, CA, USA). analysis following established parameters (Steyn et al. 2011,
Follicle and CL number was counted in every fourth 2013).
section of an ovary to represent ovulation rate in the mouse
(Myers et al. 2004). Regressing and involuting CL was not
counted. Primary follicles were not counted too. Based on
Results
manual counting, results were inaccurate for follicle size
less than 100 μm. Dapagliflozin improved glucose tolerance
Gene expression measurement Mice were treated with dapagliflozin starting from the 14th
The total RNAs from the hypothalamus, pituitary, and week after birth. MC4R KO mice had increased random
ovary were extracted and purified by PureLink RNA blood glucose (measured in 9:00–10:00 h, with food and
Mini Kit (Thermo Fisher Scientific). One μg RNA was water ad libitum) and impaired GTT, compared to that in
synthesized into cDNA by High-Capacity cDNA RT Kit control WT littermates. Dapagliflozin treatment for 8
(Applied Biosystems). For quantitative PCR (qPCR), cDNA weeks returned random blood glucose level to normal (Fig.
was amplified using SsoAdvanced™ Universal SYBR® Green 2A) and significantly improved GTT in MC4R KO mice (Fig.
Supermix (Bio-Rad) and quantified by QuantStudio 6 Flex 2B), MC4RKO mice had a 4-fold increase in fasting and a
Real-Time PCR System (Thermo Fisher Scientific). Primer 20-fold increase in fed insulin levels than those in WT
pairs were shown in Table 1. The fold change of target gene mice. Dapagliflozin treatment reduced approximately to
expression compared to the housekeeping gene (beta- 70% of both fasting and fed insulin levels in non-treated
actin) was achieved by the 2−ΔΔCT method. Hypothalamus MC4RKO mice. This information was previously reported
was bisected in the coronal plane immediately anterior too (Huang et al. 2020). Impaired GTT was totally recovered
to the pituitary stalk. The anterior dissection contained after 8 weeks of treatment of dapagliflozin (Fig. 2B). The
the complete rostral periventricular region of the third weekly body weight gain was also significantly less in the
ventricle, and the posterior dissection contained the entire treatment group compared to that in the non-treatment
arcuate nucleus (Quennell et al. 2011). control group, while there was no difference in daily food
intake (Fig. 2C and D). Such reduced weekly weight gain did
not produce a significant reduction of total body weight
Statistical analysis compared to non-treated MC4R KO mice but did indicate
Data were presented as means ± s.e.m. Statistical analysis a progressively reduced body weight with Dapagliflozin
was performed using GraphPad Prism 8 software. One-way treatment.
ANOVA and Student’s t-test were used for the comparison
of digital data among groups. The P < 0.05 was considered
Dapagliflozin partially recovered GH secretion in
statistically significant. Independent sample t-tests were
MC4R KO mice
used for continuous variable data. Nominal variables
were reported in the form of frequencies with percentages It was reported that dapagliflozin recovered pulsatile GH
secretion in MC4R KO male mice (Huang et al. 2020). In
MC4R KO female mice, the GH levels were close or below
Table 1 Sequences of PCR primers.
the detectable level of the GH ELISA assay in this study
Gene Primer Sequence (5’–3’) (Fig. 3A and B). Ten weeks of dapagliflozin treatment
Kiss1 Kiss1-F CTCTGTGTCGCCACCTATGG from 14-week age markedly increased the amount of GH
Kiss1-R AGGCTTGCTCTCTGCATACC secretion in MC4R KO mice, showing clearly in total, mean,
GnRH1 GnRH1-F AGCACTGGTCCTATGGGTTG
pulsatile and basal GH secretions compared to that in non-
GnRH1-R GGGGTTCTGCCATTTGATCCA
LHb LHb-F CTGAGCCCAAGTGTGGTGT treated MC4R KO mice (Fig. 3A and B). Deconvolutional
LHb-R CACAGATGCTGGTGGTGAAG analysis of GH data from WT, non-treated MC4RKO, and
FSHb FSHb-F GCCATAGCTGTGAATTGACCA MC4RKO treated with dapagliflozin mice demonstrated
FSHb-R AGATCCCTAGTGTAGCAGTAGC
that mean pulse mass and pulsatile secretion of GH

Endocrinology
Figure 2
Random glucose level, glucose tolerance, body
weight, and daily food intake in WT, MC4R KO
and dapagliflozin-treated MC4R KO female mice.
(A) Random blood glucose levels at 0, 4, and 8
weeks after dapagliflozin administration, n = 5.
(B) Glucose tolerance test (GTT) and the area
under the curve. Data were presented as means
± s.e.m., n = 5. *P < 0.05, between WT and MC4R
KO group; #P < 0.05, between MC4R KO groups
with and without dapagliflozin treatment for 8
weeks. (C) Body weight gain through the
experiment for 10 weeks n = 5. *P < 0.05,
between WT and MC4R KO group; #P < 0.05,
between MC4R KO groups with and without
dapagliflozin treatment for 1–10 weeks. (D) Daily
food intake through the experiment. *P < 0.05
between WT and MC4R KO group. ‘ns’ between
MC4R KO groups with and without dapagliflozin
treatment for 8 weeks. A full colour version of
this figure is available at https://doi.org/10.1530/J
OE-21-0449.
were partially recovered by dapagliflozin treatment in 2017). At the age of 23–25 weeks, MC4R KO female mice
MC4RKO mice. Secretion MODE, approximate entropy remained in persistent estrus phase without cycles, and
(reflecting regularity), total secretion and basal secretion had a significant decreased LH secretion (Chen et al. 2017).
in dapagliflozin treated MC4R KO group, however, were To assess the function of the reproductive cycles of the
significantly recovered showing no statistical difference to mouse, vaginal cytology assay was performed for 14 days
that in WT littermates (Fig. 3A and B). The blood sample during 23–25-week age respectively to reflect estrous cycles
collection for GH profile analysis was not allocated in any after the dapagliflozin treatment. By 23-week, MC4R KO
particular period of estrous cycles, because the preliminary mice did not show proestrus period, with persistent estrus
experiments excluded any influence of estrous cycles on and very few diestrus compared to that in WT littermates.
GH profiles. Dapagliflozin treatment for 10 weeks completely recovered
estrous cycles in MC4R KO mice to the pattern of WT
littermates (Fig. 4A).
Dapagliflozin recovered normal estrous cycle and
Pulsatile LH secretion profiles were assessed during
partially LH secretion profile
diestrus at three groups at 24 weeks of age. Ten weeks
In our previous report, reproductive ability declined of dapagliflozin treatment restored the pulsatile LH
progressively in obese MC4R KO female mice (Chen et al. secretion (Fig. 4B). The group data on LH secretion rate

Endocrinology
Figure 3
GH secretion in WT control, MC4R KO, and
dapagliflozin treated MC4R KO female mice for
10 weeks. (A) Representative GH secretion curve
for 6 h with 10 min interval between sequential
samples. (B) Deconvolution analysis revealed the
significant difference in total, mean pulse mass,
basal, pulsatile secretion of GH, and approximate
entropy and mode of GH secretion. *P < 0.05,
between WT group and MC4R KO group; #P <
0.05, between MC4R KO groups with and without
dapagliflozin treatment for 1–10 weeks, **P <
0.05, between WT group and MC4R KO with
dapagliflozin treatment. A full colour version of
this figure is available at https://doi.org/10.1530/J
OE-21-0449.
illustrated in Fig. 4C. Deconvolutional analysis of data 25-week-old MC4R KO mice had very few CL all through
demonstrated that total, pulsatile, mean pulse secretion the ovary. Dapagliflozin treatment significantly increased
of LH, Approximate entropy and Mode of LH secretion this total CL number in MC4R KO mice (P < 0.05) (Fig. 5C,
were fully recovered in MC4R KO mice by dapagliflozin D, and E).
treatment. The basal secretion of LH in MC4RKO mice was
not changed by dapagliflozin treatment (Fig. 4D).
Dapagliflozin increased expression of hypothalamus–

Dapagliflozin partially restored ovulation pituitary genes of reproductive hormones
Compared with WT mice, increased numbers of antral Expression of KISS1 in hypothalamus showed no difference
and preovulatory follicles were observed in ovaries from between MC4R KO mice and WT littermates. Expression
MC4R KO mice, which were significantly decreased by of Gnrh1 was increased in MC4R KO mice. Dapagliflozin
10-week dapagliflozin treatment. However, this decrease treatment for 10 weeks markedly increased the expression
was only partial and numbers were still higher than that of KISS1 and GnRH1 in MC4R KO mice (Fig. 6A). In the
in WT mice (Fig. 5A). Corpora lutea (CL) numbers were anterior pituitary, GnRH increases LH and FSH synthesis
quantified as a marker of recent ovulation. The CL numbers and secretion. The LHbeta (LHb) gene expression was
in MC4R KO were significantly reduced compared to that decreased in the anterior pituitary of MC4R KO mice, and
in same age WT littermates. Dapagliflozin treatment for dapagliflozin treatment partially recovered it. The FSHbeta
10 weeks significantly increased the number of CL but (FSHb) gene expression was decreased too in the anterior
still less than that in WT littermates (P < 0.05) (Fig. 5B). pituitary of MC4R KO mice, but dapagliflozin treatment
Histological sections of ovaries revealed that ovaries in did not change it (Fig. 6B).

Endocrinology
Figure 4
Estrous cycle and LH secretion in WT, MC4R KO, and dapagliflozin-treated MC4R KO female mice for 10 weeks. (A) Estrous cycles in mice (P, proestrus; E,
estrus; M, metestrus; D, diestrus) for continuous 15 days at the end of 10 weeks treatment (8–10 weeks) were shown for each group in right panels.
Percentage of time spent in each stage (P, proestrus; E, estrus; M, metestrus; D, diestrus) was shown in left panel. Data are mean ± s.e.m., *P < 0.01
between WT and MC4R KO group; #P < 0.05, between MC4R KO groups with and without dapagliflozin treatment for 1–10 weeks, ‘ns’ between WT group
and MC4R KO groups with dapagliflozin treatment. (B) Representative profiles of pulsatile LH secretion in WT, MC4R KO, and dapagliflozin-treated MC4R
KO female mice. (C) LH secretion rate of each group, n = 4 in each group. (D) Dapagliflozin restored pulsatile secretion of LH in female MC4RKO mice.
Deconvolution analysis revealed the significant difference in total, mean pulse mass, basal, pulsatile secretion of LH, and approximate entropy and mode
of LH secretion. *P < 0.05, between WT group and MC4R KO group; #P < 0.05, between female MC4RKO mice and dapagliflozin-treated MC4R KO female
mice. ##P < 0.05, between WT and dapagliflozin treated MC4R KO female mice. n = 4 in each group. A full colour version of this figure is available at https
://doi.org/10.1530/JOE-21-0449.

Endocrinology
Figure 5
Follicles and corpora lutea development in
ovaries from WT, MC4R KO, and dapagliflozin-
treated MC4R KO female mice. (A) The number of
developing follicles at all stages in WT and MC4R
KO mice. *P < 0.05, between WT group and MC4R
KO group; #P < 0.05, between female MC4RKO
mice and dapagliflozin-treated MC4R KO female
mice. ##P < 0.05, between WT and dapagliflozin
treated MC4R KO female mice. n = 5 in each
group. (B). Number of corpora lutea in whole
ovary was calculated by sequential cuttings. Data
are presented as mean ± s.e.m., n = 5 in each
group; *P < 0.05, between WT and MC4R KO
mice; #P < 0.05, between MC4R KO and
dapagliflozin-treated MC4R KO mice. ##P < 0.05
between WT and dapagliflozin-treated MC4R KO
mice. (C) Representative image of H&E-stained
ovary frozen section in WT mice clearly showed
CL (arrow headed). Scale bar: 700 μm. (D)
Representative image of H&E-stained ovary
frozen section in MC4R KO mice showed no CL.
(E) Representative image of H&E-stained ovary
frozen section in dapagliflozin-treated MC4R KO
mice showed recovery of CL (arrow headed). A
full colour version of this figure is available at
https://doi.org/10.1530/JOE-21-0449.
Discussion impaired glucose tolerance was observed in MC4R KO

female mice. Dapagliflozin, the SGLT2 inhibitor in this
MC4R KO obese mice were reported to have hyperphagia experiment, improved glucose tolerance and attenuated
with clear metabolic dysfunction, hyperinsulinemia, body weight gain. These improvements occurred
and reduced GH pulsatile secretion (Huang et al. 2020). independent of changes of food intake in MC4R KO female
Female MC4R KO obese mice had a reduced LH secretion mice. Improvement of glucose metabolism occurred with a
and ovulatory dysfunction (Chen et al. 2017). This study recovery of GH secretion in the dapagliflozin treated MC4R
demonstrated further that dapagliflozin restored estrous KO female mice, similar to that in MC4R KO male mice
cycle and ovulation in MC4R KO mice by recovering (Huang et al. 2020).
pulsatile secretion profiles of LH through action on Obese women were at high risk of disrupted metabolism
hypothalamus–pituitary reproductive hormone synthesis. and diabetes (Goodman et al. 2015). GH decline and
Dapagliflozin also improved metabolic function and GH anovulatory infertility were reported in obese patients
pulsatile secretion in female MC4R KO mice. with poor outcomes of in vitro fertilization (Kumbak et al.
On metabolism function, same as in early study in this 2012, Snider & Wood 2019). Obesity also disturbed the
laboratory on MC4R KO male mice (Huang et al. 2020), feedback regulation of gonadotrophin secretion (Metwally
Figure 6
Gene expression relevant to function of
reproductive hypothalamus–pituitary–ovary axis.
(A) Dapagliflozin treatment increased expression
of KISS1 and GnRH1. (B) Dapagliflozin treatment
increased expression of LHb but not FSHb. Gene
expression fold change was obtained by qPCR.
Results were given as mean ± s.e.m. *P < 0.05,
between WT group and MC4R KO group; #P <
0.05, between MC4R KO group and dapagliflozin-
treated MC4R KO group. ##P < 0.05, WT and
dapagliflozin-treated MC4R KO female mice (n = 5
in each group). A full colour version of this figure
is available at https://doi.org/10.1530/JOE-21
-0449.

Endocrinology
et al. 2007). Previous studies showed that female MC4R mice (Huang et al. 2020). In this experiment, GH pulsatile
KO obese mice had pathological change in ovarian profile was recovered by dapagliflozin in female MC4R
morphology, reproductive dysfunction, anovulatory KO mice too with significant improvement of ovulation.
infertility, with significant reduced LH secretion (Sandrock It is therefore suggested that recovery of GH profile may
et al. 2009). Dapagliflozin (SGLT2 inhibitor) improved improve follicular development as well as the hormone
metabolism activity, caloric deposition, body weight, synthesis and secretion of pituitary gonadotrophs and
GH pulsatile profiles, and insulin sensitivity in MC4R KO hypothalamic GnRH neurons.
mice (Huang et al. 2020). It was unknown yet whether GnRH neurons in the hypothalamus are considered as
dapagliflozin improved reproductive dysfunction in MC4R the only master regulator in governing the hypothalamic-
KO female mice. Energy metabolism and female fertility pituitary-ovarian (HPO) axis for a long time, until the
are intimately and closely connected and reciprocally discovery of kisspeptin coded by Kiss1 gene. Kisspeptin
regulated. Specifically, overweight and obese women activates the HPO axis by directly stimulating GnRH
with reproductive dysfunction often exhibit metabolic neurons via kisspeptin receptor. Recent data indicated
dysfunction with hypercholesterolemia and elevated that kisspeptin played a role in transducing metabolic
non-esterified fatty acid concentration, hyperglycemia, information into the hypothalamic–pituitary–gonadal
and insulin resistance (Lebovitz 2006). In this study, the axis (Harter et al. 2018). Metabolic imbalance affected both
random blood glucose levels and GTT tests were abnormal reproductive function and hypothalamic kisspeptin levels,
in obese MC4R KO mice and partially normalized by suggesting that kisspeptin neurons mediated the effects
dapagliflozin treatment. Dapagliflozin (SGLT2i) directly of metabolism on reproductive function (Wu et al. 2009,
reduced blood glucose, indirectly improved insulin De Bond & Smith 2014). Kisspeptin activated kisspeptin
sensitivity, and diminished caloric deposition and body receptor in the hypothalamus to release GnRH (Harter et al.
weight. With dapagliflozin-increased insulin sensitivity, 2018). Manipulation of kisspeptin signaling may regulate
hyperinsulinemia was normalized (Huang et al. 2020). GnRH and LH pulsatile profiles (Skorupskaite et al. 2014).
Hyperinsulinemia occurs often in obesity and prediabetes In current experiment, compared to WT littermates,
with insulin resistance. Recent studies demonstrated the expression of KISS1 was slightly (without statistical
an essential role of normal level of blood insulin in significance) downregulated in MC4R KO female mice.
maintaining normal folliculogenesis, including successful Dapagliflozin treatment, however, significantly increased
oocyte development, ovulation, blastocyst proliferation, the expression level of KISS1 in MC4R KO mice. This is
progesterone synthesis and fertility (Sekulovski et al. 2020). the first-time showing the evidence that SGLT2i enhances
Insulin is a predominant long-acting adiposity signal to the expression of the Kiss1 gene. Whether reduction of
initiate appetite stimulation through acting on the insulin hyperglycemia influences Kiss1 expression in neurons is
receptor in hypothalamus. Insulin receptor is widely not known yet, which warrants further investigation.
distributed not only hypothalamus but also throughout Compelling evidences have demonstrated that
CNS (Corp et al. 1986). The pathological mechanism of kisspeptin is critically important to activate GnRH neurons
hyperinsulinemia on reproductive system is still unclear. to release GnRH in rodents and non-rodent mammals
The link of GH to reproductive function has been well (Matsuda et al. 2019). MC4R KO mice, in this study,
documented. GH stimulated antral follicle development showed disrupted estrous cycle, reduced fertility, and
and improved oocyte quality and sensitivity of ovary to slightly decreased hypothalamus KISS1 mRNA expression.
gonadotrophins (Mendoza et al. 1999, Danilovich et al. Dapagliflozin treatment for 10 weeks, markedly increased
2000). GH was also demonstrated to play a major role in the expression of KISS1 and GnRH1 in MC4R KO mice (Fig.
primordial follicular growth and progression in several 6A). Accumulating evidence suggests that the kisspeptin
animal models, evidenced by the recruitment of primordial neurons in the anterior hypothalamus regulate ovulation
follicles into the growing, gonadotrophin-sensitive pool by controlling surge-mode GnRH/LH secretion (Gottsch
(Bachelot et al. 2002, Martins et al. 2014, Serafim et al. et al. 2004, Harter et al. 2018). Kisspeptin neurons in the
2015). However, comparisons of GH profiles at different ARC also regulate follicular growth by controlling pulsatile
stages of ovulation in female mice were still unavailable till mode of GnRH/gonadotropin secretion. Unlike KISS1,
this experiment. Previous studies in this laboratory showed higher expression of Gnrh1 was found in MC4R KO mice.
that dapagliflozin reduced hyperinsulinemia and restored The decreased secretion of GH and LH might activate
pituitary GH secretion profiles in obese male MC4R KO GnRH mRNA expression through a feedback effect on

Endocrinology
hypothalamic GnRH neurons. This hypothesis may need

Author contribution statement
to be established by future study. Nevertheless, results Ling Cui, Lili Huang, and Chen Chen designed the experiments. Ling Cui,
shown in this study demonstrated that dapagliflozin Chunlu Tan, Fang Geng, Weihao Wang and Lili Huang conducted the
activated kisspeptin neurons to stimulate GnRH secretion experiments and collected the data. Ling Cui, Mengjun Wu, Xiaolin Chen
and Chen Chen provided results analysis and discussion. Michael Cowley
in MC4R KO obese mice. The observations indicate that the provided MC4RKO mice. Ferdinand Roelfsema performed deconvolution
relationship between obesity, ovulation, and reproductive analysis. Ling Cui wrote the first draft the manuscript and Lili Huang
neuroendocrine system is a complexed, closely related and provided scientific discussion. Chen Chen revised and finalized the
manuscript. All authors approved the final article.
reciprocal one.
The ovulation and luteinization are initiated by the
large LH surge of secretion from the pituitary (Richards
& Pangas 2010). GnRH stimulates the expression LHb Acknowledgements
in the pituitary gland to maintain normal LH synthesis The authors thank AstraZeneca for providing dapagliflozin for this study.
This study is funded by a National Health and Medical Research Council
and secretion profiles, including LH surge (Fortin et al. grant (to C C) and the University of Queensland.
2013). This stimulation may be reduced under the obese
condition. Dapagliflozin treatment may recover the GnRH
and LH expression and secretion in MC4R KO obese mice.
References
The FSHb expression was also decreased in MC4R KO mice,
Abir R, Garor R, Felz C, Nitke S, Krissi H & Fisch B 2008 Growth hormone
but dapagliflozin treatment did not change it. Further
and its receptor in human ovaries from fetuses and adults. Fertility
study on molecular pathways employed by SGLT2 inhibitor and Sterility 90 (Supplement) 1333–1339. (https://doi.org/10.1016/j.
in regulating reproductive hormones would be warranted fertnstert.2007.08.011)
Akinci B 2019 Dapagliflozin and cardiovascular outcomes in type 2
to fully understand detail interaction between metabolic
diabetes. New England Journal of Medicine 380 1881. (https://doi.
and reproductive disorders. org/10.1056/NEJMc1902837)
Bachelot A, Monget P, Imbert-Bollore P, Coshigano K, Kopchick JJ, Kelly PA &
Binart N 2002 Growth hormone is required for ovarian follicular growth.
Endocrinology 143 4104–4112. (https://doi.org/10.1210/en.2002-220087)
Branavan U, Muneeswaran K, Wijesundera WSS, Senanayake A,
Conclusion Chandrasekharan NV & Wijeyaratne CN 2019 Association of Kiss1 and
GPR54 gene polymorphisms with polycystic ovary syndrome among
Dapagliflozin rescues anovulatory infertility in MC4R KO Sri Lankan women. BioMed Research International 2019 6235680.
(https://doi.org/10.1155/2019/6235680)
female mice by recovering secretion profiles of LH and GH, Broughton DE & Moley KH 2017 Obesity and female infertility: potential
as well as improving glucose metabolism. This study sheds mediators of obesity’s impact. Fertility and Sterility 107 840–847.
light on the potential therapeutic effect of SGLT2 inhibitor (https://doi.org/10.1016/j.fertnstert.2017.01.017)
Chen X, Huang L, Tan HY, Li H, Wan Y, Cowley M, Veldhuis JD & Chen C
on reproductive dysfunction in obese women. 2017 Deficient melanocortin-4 receptor causes abnormal reproductive
neuroendocrine profile in female mice. Reproduction 153 267–276.
(https://doi.org/10.1530/REP-16-0341)
Childs GV 2000 Growth hormone cells as co-gonadotropes: partners in
the regulation of the reproductive system. Trends in Endocrinology and
Declaration of interest Metabolism 11 168–175. (https://doi.org/10.1016/s1043-2760(00)00252-6)
The authors declare that there is no conflict of interest that could be Corp ES, Woods SC, Porte Jr D, Dorsa DM, Figlewicz DP & Baskin DG 1986
perceived as prejudicing the impartiality of the research reported. Localization of 125I-insulin binding sites in the rat hypothalamus by
quantitative autoradiography. Neuroscience Letters 70 17–22. (https://
doi.org/10.1016/0304-3940(86)90430-1)
Danilovich NA, Bartke A & Winters TA 2000 Ovarian follicle apoptosis in
bovine growth hormone transgenic mice. Biology of Reproduction 62
Funding 103–107. (https://doi.org/10.1095/biolreprod62.1.103)
This work was supported by the National Health and Medical Research De Bond JA & Smith JT 2014 Kisspeptin and energy balance in
Council grant (APP1113494, 2016-2021) and Yingcai Scheme (YC2021005) reproduction. Reproduction 147 R53–R63. (https://doi.org/10.1530/
by Chengdu Women’s and Children’s Central Hospital. REP-13-0509)
Dhillon S 2019 Dapagliflozin: a review in type 2 diabetes. Drugs 79
1135–1146. (https://doi.org/10.1007/s40265-019-01148-3)
Fortin J, Kumar V, Zhou X, Wang Y, Auwerx J, Schoonjans K, Boehm U,
Boerboom D & Bernard DJ 2013 NR5A2 regulates Lhb and Fshb
Statement of ethics transcription in gonadotrope-like cells in vitro, but is dispensable
All experiments and procedures were approved by the Ethics Committee for gonadotropin synthesis and fertility in vivo. PLoS ONE 8 e59058.
of the University of Queensland (approval number SBMS/500/18). (https://doi.org/10.1371/journal.pone.0059058)

Endocrinology
Goodman NF, Cobin RH, Futterweit W, Glueck JS, Legro RS, Carmina E, Murphy KG 2005 Kisspeptins: regulators of metastasis and the
American Association of Clinical Endocrinologists (AACE), American hypothalamic-pituitary-gonadal axis. Journal of Neuroendocrinology 17
College of Endocrinology (ACE) & Androgen Excess and PCOS 519–525. (https://doi.org/10.1111/j.1365-2826.2005.01328.x)
Society 2015 American Association of Clinical Endocrinologists, Myers M, Britt KL, Wreford NG, Ebling FJ & Kerr JB 2004 Methods for
American College of Endocrinology, and Androgen Excess and Pcos quantifying follicular numbers within the mouse ovary. Reproduction
Society Disease State Clinical Review: guide to the best practices in 127 569–580. (https://doi.org/10.1530/rep.1.00095)
the evaluation and treatment of polycystic ovary syndrome – part 2. Politis I, Block E & Turner JD 1990 Effect of somatotropin on the
Endocrine Practice 21 1415–1426. (https://doi.org/10.4158/EP15748. plasminogen and plasmin system in the mammary gland: proposed
DSCPT2) mechanism of action for somatotropin on the mammary gland. Journal
Gottsch ML, Cunningham MJ, Smith JT, Popa SM, Acohido BV, of Dairy Science 73 1494–1499. (https://doi.org/10.3168/jds.S0022-
Crowley WF, Seminara S, Clifton DK & Steiner RA 2004 A role 0302(90)78816-9)
for kisspeptins in the regulation of gonadotropin secretion in the Quennell JH, Howell CS, Roa J, Augustine RA, Grattan DR & Anderson GM
mouse. Endocrinology 145 4073–4077. (https://doi.org/10.1210/ 2011 Leptin deficiency and diet-induced obesity reduce hypothalamic
en.2004-0431) kisspeptin expression in mice. Endocrinology 152 1541–1550. (https://
Harter CJL, Kavanagh GS & Smith JT 2018 The role of kisspeptin neurons in doi.org/10.1210/en.2010-1100)
reproduction and metabolism. Journal of Endocrinology 238 R173–R183. Richards JS & Pangas SA 2010 The ovary: basic biology and clinical
(https://doi.org/10.1530/JOE-18-0108) implications. Journal of Clinical Investigation 120 963–972. (https://doi.
Huang Z, Huang L, Wang C, Zhu S, Qi X, Chen Y, Zhang Y, Cowley MA, org/10.1172/JCI41350)
Veldhuis JD & Chen C 2020 Dapagliflozin restores insulin and growth Sandrock M, Schulz A, Merkwitz C, Schoneberg T, Spanel-Borowski K &
hormone secretion in obese mice. Journal of Endocrinology 245 1–12. Ricken A 2009 Reduction in corpora lutea number in obese melanocort
(https://doi.org/10.1530/JOE-19-0385) in-4-receptor-deficient mice. Reproductive Biology and Endocrinology 7
Ipsa E, Cruzat VF, Kagize JN, Yovich JL & Keane KN 2019 Growth 24. (https://doi.org/10.1186/1477-7827-7-24)
hormone and insulin-like growth factor action in reproductive Scheen AJ & Paquot N 2014 Metabolic effects of SGLT-2 inhibitors beyond
tissues. Frontiers in Endocrinology 10 777. (https://doi.org/10.3389/ increased glucosuria: a review of the clinical evidence. Diabetes and
fendo.2019.00777) Metabolism 40 (Supplement 1) S4–S11. (https://doi.org/10.1016/S1262-
Javed Z, Papageorgiou M, Deshmukh H, Rigby AS, Qamar U, Abbas J, 3636(14)72689-8)
Khan AY, Kilpatrick ES, Atkin SL & Sathyapalan T 2019 Effects of Sekulovski N, Whorton AE, Shi M, Hayashi K & MacLean 2nd JA 2020
empagliflozin on metabolic parameters in polycystic ovary syndrome: Periovulatory insulin signaling is essential for ovulation, granulosa
a randomized controlled study. Clinical Endocrinology 90 805–813. cell differentiation, and female fertility. FASEB Journal 34 2376–2391.
(https://doi.org/10.1111/cen.13968) (https://doi.org/10.1096/fj.201901791R)
Javed Z, Papageorgiou M, Madden LA, Rigby AS, Kilpatrick ES, Atkin SL Serafim MK, Duarte AB, Silva GM, Souza CE, Magalhaes-Padilha DM,
& Sathyapalan T 2020 The effects of empagliflozin vs metformin on Moura AA, Silva LD, Campello CC & Figueiredo JR 2015 Impact of
endothelial microparticles in overweight/obese women with polycystic growth hormone (GH) and follicle stimulating hormone (FSH) on in
ovary syndrome. Endocrine Connections 9 563–569. (https://doi. vitro canine preantral follicle development and estradiol production.
org/10.1530/EC-20-0173) Growth Hormone and IGF Research 25 85–89. (https://doi.org/10.1016/j.
Kumbak B, Oral E & Bukulmez O 2012 Female obesity and assisted ghir.2014.12.009)
reproductive technologies. Seminars in Reproductive Medicine 30 Silvestris E, Lovero D & Palmirotta R 2019 Nutrition and female fertility: an
507–516. (https://doi.org/10.1055/s-0032-1328879) interdependent correlation. Frontiers in Endocrinology 10 346. (https://
Lebovitz HE 2006 Insulin resistance – a common link between type 2 doi.org/10.3389/fendo.2019.00346)
diabetes and cardiovascular disease. Diabetes, Obesity and Metabolism 8 Skorupskaite K, George JT & Anderson RA 2014 The kisspeptin-GnRH
237–249. (https://doi.org/10.1111/j.1463-1326.2005.00521.x) pathway in human reproductive health and disease. Human Reproduction
Martins FS, Saraiva MV, Magalhaes-Padilha DM, Almeida AP, Celestino JJ, Update 20 485–500. (https://doi.org/10.1093/humupd/dmu009)
Padilha RT, Cunha RM, Silva JR, Campello CC & Figueiredo JR 2014 Snider AP & Wood JR 2019 Obesity induces ovarian inflammation and
Presence of growth hormone receptor (GH-R) mRNA and protein in reduces oocyte quality. Reproduction 158 R79–R90. (https://doi.
goat ovarian follicles and improvement of in vitro preantral follicle org/10.1530/REP-18-0583)
survival and development with GH. Theriogenology 82 27–35. (https:// Steyn FJ, Huang L, Ngo ST, Leong JW, Tan HY, Xie TY, Parlow AF,
doi.org/10.1016/j.theriogenology.2014.02.019) Veldhuis JD, Waters MJ & Chen C 2011 Development of a method for
Matsuda F, Ohkura S, Magata F, Munetomo A, Chen J, Sato M, Inoue N, the determination of pulsatile growth hormone secretion in mice.
Uenoyama Y & Tsukamura H 2019 Role of kisspeptin neurons as a Endocrinology 152 3165–3171. (https://doi.org/10.1210/en.2011-0253)
GnRH surge generator: comparative aspects in rodents and non-rodent Steyn FJ, Wan Y, Clarkson J, Veldhuis JD, Herbison AE & Chen C 2013
mammals. Journal of Obstetrics and Gynaecology Research 45 2318–2329. Development of a methodology for and assessment of pulsatile
(https://doi.org/10.1111/jog.14124) luteinizing hormone secretion in juvenile and adult male mice.
Meczekalski B, Katulski K, Podfigurna-Stopa A, Czyzyk A & Genazzani AD Endocrinology 154 4939–4945. (https://doi.org/10.1210/en.2013-1502)
2016 Spontaneous endogenous pulsatile release of kisspeptin is Tan HY, Steyn FJ, Huang L, Cowley M, Veldhuis JD & Chen C 2016
temporally coupled with luteinizing hormone in healthy women. Hyperphagia in male melanocortin 4 receptor deficient mice promotes
Fertility and Sterility 105 1345.e2–1350.e2. (https://doi.org/10.1016/j. growth independently of growth hormone. Journal of Physiology 594
fertnstert.2016.01.029) 7309–7326. (https://doi.org/10.1113/JP272770)
Mendoza C, Cremades N, Ruiz-Requena E, Martinez F, Ortega E, Bernabeu S Vaisse C, Clement K, Durand E, Hercberg S, Guy-Grand B & Froguel P 2000
& Tesarik J 1999 Relationship between fertilization results after Melanocortin-4 receptor mutations are a frequent and heterogeneous
intracytoplasmic sperm injection, and intrafollicular steroid, pituitary cause of morbid obesity. Journal of Clinical Investigation 106 253–262.
hormone and cytokine concentrations. Human Reproduction 14 (https://doi.org/10.1172/JCI9238)
628–635. (https://doi.org/10.1093/humrep/14.3.628) Wiviott SD, Raz I, Bonaca MP, Mosenzon O, Kato ET, Cahn A, Silverman MG,
Metwally M, Li TC & Ledger WL 2007 The impact of obesity on female Zelniker TA, Kuder JF, Murphy SA, et al. 2019 Dapagliflozin and
reproductive function. Obesity Reviews 8 515–523. (https://doi. cardiovascular outcomes in type 2 diabetes. New England Journal of
org/10.1111/j.1467-789X.2007.00406.x) Medicine 380 347–357. (https://doi.org/10.1056/NEJMoa1812389)

Endocrinology
Wu M, Dumalska I, Morozova E, van den Pol A & Alreja M 2009 sensitivity in diabetic milieu: a mechanistic review. Life Sciences 240
Melanin-concentrating hormone directly inhibits GnRH 117090. (https://doi.org/10.1016/j.lfs.2019.117090)
neurons and blocks kisspeptin activation, linking energy balance Zinman B, Wanner C, Lachin JM, Fitchett D, Bluhmki E, Hantel S,
to reproduction. PNAS 106 17217–17222. (https://doi.org/10.1073/ Mattheus M, Devins T, Johansen OE, Woerle HJ, et al. 2015
pnas.0908200106) Empagliflozin, cardiovascular outcomes, and mortality in type 2
Yaribeygi H, Sathyapalan T, Maleki M, Jamialahmadi T & Sahebkar A 2020 diabetes. New England Journal of Medicine 373 2117–2128. (https://doi.
Molecular mechanisms by which SGLT2 inhibitors can induce insulin org/10.1056/NEJMoa1504720)
Received in final form 9 April 2022

Accepted 16 May 2022
Accepted Manuscript published online 23 May 2022


1479 6805 Joe 21 0449

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

1479 6805 Joe 21 0449

Uploaded by

Copyright:

Available Formats

Journal of L Cui et

al. 254:2 65–76

Dapagliflozin partially restores reproductive

4Department of Physiology, Monash University, Clayton, Victoria, Australia

5Endocrinology and Metabolism, Leiden University, Leiden, Netherlands

Correspondence should be addressed to C Chen: chen.chen@uq.edu.au

https://joe.bioscientifica.com © 2022 Society for Endocrinology

https://joe.bioscientifica.com © 2022 Society for Endocrinology

https://joe.bioscientifica.com © 2022 Society for Endocrinology

https://joe.bioscientifica.com © 2022 Society for Endocrinology

https://joe.bioscientifica.com © 2022 Society for Endocrinology

Dapagliflozin increased expression of hypothalamus–

https://joe.bioscientifica.com © 2022 Society for Endocrinology

https://joe.bioscientifica.com © 2022 Society for Endocrinology

Discussion impaired glucose tolerance was observed in MC4R KO

https://joe.bioscientifica.com © 2022 Society for Endocrinology

https://joe.bioscientifica.com © 2022 Society for Endocrinology

hypothalamic GnRH neurons. This hypothesis may need

https://joe.bioscientifica.com © 2022 Society for Endocrinology

https://joe.bioscientifica.com © 2022 Society for Endocrinology

Received in final form 9 April 2022

https://joe.bioscientifica.com © 2022 Society for Endocrinology

You might also like