Cerebral Cortex Advance Access published September 24, 2016

Cerebral Cortex, 2016; 1–11

doi: 10.1093/cercor/bhw301
Original Article

ORIGINAL ARTICLE

Prefrontal Volume Mediates Effect of COMT

Downloaded from http://cercor.oxfordjournals.org/ at Health Sciences Library, Stony Brook University on September 24, 2016
Polymorphism on Interference Resolution Capacity
in Healthy Male Adults
Jiayuan Xu1, Wen Qin1, Qiaojun Li2,, Wei Li1, Feng Liu1, Bing Liu3,4,
Tianzi Jiang3,4, and Chunshui Yu1
1
Department of Radiology and Tianjin Key Laboratory of Functional Imaging, Tianjin Medical University
General Hospital, Tianjin 300052, P.R. China, 2College of Information Engineering, Tianjin University of
Commerce, Tianjin 300052, P.R. China, 3Brainnetome Center, Institute of Automation, Chinese Academy of
Sciences, Beijing 100190, P.R. China, and 4National Laboratory of Pattern Recognition, Institute of Automation,
Chinese Academy of Sciences, Beijing 100190, P.R. China
Address correspondence to Chunshui Yu, Department of Radiology and Tianjin Key Laboratory of Functional Imaging, Tianjin Medical University General
Hospital, No. 154, Anshan Road, Heping District, Tianjin 300052, P.R. China. Email: chunshuiyu@tijmu.edu.cn

The authors Jiayuan Xu and Wen Qin contributed equally to this work.

Abstract
There exist gender differences in the modulation of catechol-O-methyltransferase (COMT) Val158Met polymorphism on
cognitive performance; however, the underlying gene-anatomy-cognition pathways remain unknown. Here we hypothesize
that prefrontal volume may mediate the modulation of COMT Val158Met polymorphism on interference resolution capacity
in a gender-dependent manner. In 261 healthy young human subjects (143 males and 118 females), a 2-way analysis of
variance showed a COMT × gender interaction (P = 0.023) on interference resolution capacity. Val/Val subjects performed
worse in Stroop interference test than Met/Met subjects only in males (P = 0.028). Voxel-wise analysis in the whole brain
also exhibited a COMT × gender interaction on gray matter volume (GMV) in the left lateral frontal pole (FP). Val/Val male
individuals exhibited significantly decreased GMV in the left lateral FP than Val/Met (P = 0.003) and Met/Met (P = 0.006) male
carriers. Mediation analysis revealed that the GMV of the left lateral FP mediated the association between COMT
polymorphism and interference resolution in males. These findings provide a gene-anatomy-cognition pathway to describe
how COMT Val158Met polymorphism affects interference resolution capacity via modulating the prefrontal GMV in healthy
male subjects.

Key words: catechol-O-methyltransferase, gender, gray matter volume, mediation analysis, Stroop interference resolution

Introduction decreased enzymatic activity and increased synaptic dopamine

Catechol-O-methyltransferase (COMT) catalyzes the degradation
of synaptic dopamine in the brain and is thought to be the most
important modulator of synaptic dopamine concentration in the
prefrontal cortex (PFC) (Mannisto and Kaakkola 1999; Seamans
and Yang 2004). The COMT Val158Met polymorphism results in
concentration in Met carriers (Mannisto and Kaakkola 1999).
Estrogen can down-regulate COMT activity (Xie et al. 1999; Jiang
et al. 2003), resulting in increased dopamine concentration in
females than in males. Because dopamine modulates brain
structural and functional properties in a nonlinear manner,

© The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
 2 | Cerebral Cortex
gender differences have been frequently observed in the modu-
lation effects of COMT polymorphism on external phenotypes,
such as executive control (Holtzer et al. 2010), facial recognition
(Kempton et al. 2009), verbal ability (O’Hara et al. 2006), personal-
ity (Reuter et al. 2006; Lang et al. 2007; Chen et al. 2011) and psy-
chiatric disorders (de Castro-Catala et al. 2015).
The relationship between executive control and COMT
Val158Met variation has been well documented (Egan et al.
2001; Joober et al. 2002; Malhotra et al. 2002; Goldberg et al.
2003; Rosa et al. 2004; Galderisi et al. 2005). For example, the
interference resolution has been linked to COMT Val158Met
polymorphism (Nolan et al. 2004; Reuter et al. 2005; Green et al.
2013). Most of gene-anatomy studies have suggested that COMT
Val158Met polymorphism is associated with structural varia-
tions in the brain (Taylor et al. 2007; Cerasa et al. 2008; Honea
et al. 2009; Mechelli et al. 2009; Tian et al. 2013; Watanabe et al.
2015), especially in the PFC (Cerasa et al. 2008; Honea et al.
2009; Mechelli et al. 2009; Tian et al. 2013); however, several
studies have reported no effects of COMT on frontal (Ho et al.
2005; Ohnishi et al. 2006; Barnes et al. 2012) or hippocampal vol-
ume (Dutt et al. 2009). Moreover, 2 studies revealed gender dif-
ference in the modulation (Zinkstok et al. 2006; Tian et al.
2013). In anatomy-cognition studies, the interference resolution
has been associated with the PFC volume in healthy subjects
(Takeuchi et al. 2012). Although gender difference in the modu-
lation of COMT Val158Met polymorphism and pairwise relation-
ships of gene-cognition, gene-anatomy, and anatomy-cognition
have been extensively investigated, there is lack of any direct
evidence on the gender differences in gene-anatomy-cognition
pathways that account for the association between COMT
Val158Met variation and interference resolution. In this study,
we used a mediation analysis to test the hypothesis that there
exists gender difference in the mediation effect of the pre-
frontal volume on the association between COMT Val158Met
polymorphism and the interference resolution.
In 261 Chinese Han healthy subjects, a 2-way analysis of
variance (ANOVA) was firstly used to investigate the inter-
action effect between COMT genotype and gender on the inter-
ference resolution assessed by the Stroop task. Secondly, the
2-way ANOVA was used to voxel-wisely identify brain regions
with significant COMT × gender interaction on gray matter
volume (GMV) throughout the whole brain. Because there is
ample evidence that the interference resolution affects the
executive control network (ECN) (Zysset et al. 2001; Laird et al.
2005; Nee et al. 2007; Roberts and Hall 2008; Grandjean et al.
2012; Jaspar et al. 2014), we also repeated the GMV analysis
within the ECN mask to reduce multiple comparisons. Thirdly,
we used a mediation analysis to assess the gene-anatomy-
cognition pathways in males and females, respectively. If a
region showed significant effect, the functional properties
(regional activity and functional connectivity) of the region
were also analyzed using the same method and threshold as
the GMV analysis.
Materials and Methods
Subjects
A total of 323 healthy young Chinese Han adults (mean age:
22.7 ± 2.5 years; 157 males and 166 females) were recruited
in this study. Participants were carefully screened to ensure
that they had no history of any psychiatric or neurological
illness, drug, or alcohol abuse, and that they had no contra-
indications to MRI examination. All subjects were strongly
right-handed according to the Chinese edition of the Edinburgh
Handedness Inventory (Oldfield 1971). The study was approved
by the Medical Research Ethics Committee of Tianjin Medical
University, and all participants provided written informed
consent.
Stroop Task
The Stroop color-word task was performed on a computer with
Windows XP in a quiet room outside the MRI scanner. During
the task, the participants were instructed to select the color-
word semantic meaning or color (“Green,” “Blue,” “Red,” and
“Yellow”) by pressing the corresponding key (“1,” “2,” “3,” and
Downloaded from http://cercor.oxfordjournals.org/ at Health Sciences Library, Stony Brook University on September 24, 2016
“4”) on a keyboard with their right hands. The block-design
task consisted of 4 alternating blocks. The blocks 1 and 3 were
word reading blocks, in which the participants were asked to
respond to the semantic meaning of the color word, while
ignoring the printed color of the stimulus. These 2 blocks were
manipulated using 2 different contexts with 36 trails: 24 incon-
gruent items (e.g., the word “blue” in red and the participants
were asked to press the “blue” button) and 12 congruent items
(e.g., the word “blue” in blue and the participants were asked to
press the “blue” button). The incongruent and congruent items
were randomly displayed in each block. The blocks 2 and 4
were color naming blocks, in which the participants were asked
to respond to the printed color of the stimulus, while ignoring
the word meaning itself. These 2 blocks were composed of 24
incongruent items and 12 neutral items (i.e., strings of 5 signs
@@@@@ and the participants were asked to press the corre-
sponding color button). The incongruent and neural items were
randomly displayed in each block. Each block began with the
instruction presented in the screen and each stimulus dis-
played less than 5 s, during which the participant needs to
respond to the stimulus. If the participant responded before the
deadline, the “Right” or “Wrong” was presented for the results;
once more than 5 s, no matter the answer was correct or not, it
was recorded “No Response,” and the results would be dis-
carded. An interstimulus interval was 1.5 s and the total experi-
ment time was 936 s. The schematic representation of the
Stroop task design is shown in Figure 1.
The participants were instructed to respond as fast and
accurately as possible after the presentation of each item.
Before the experiment, the participants were given 3 practice
runs of the task. E-Prime 2.0 software (Psychology Software
Tools) was used to present the stimuli and collect the results.
We recorded reaction time (RT) and correction rate (CR) during
incongruent/congruent/neutral items of word reading and color
naming blocks. The interference resolution was evaluated by 2
measures: the reaction delay of color interference (RD-C) was
defined as the mean RT of incongruent items minus that of
congruent items in word reading blocks and the reaction delay
of word interference (RD-W) was defined as the mean RT of
incongruent items minus that of neutral items in color naming
block (MacLeod 1991; Stuss et al. 2001; Fan et al. 2003; Floden
et al. 2011). Forty-one subjects were excluded due to lack of the
Stroop task results.
COMT Genotyping
We extracted genomic DNA from 3000 µL of whole blood using
the EZgeneTM Blood gDNAMiniprep Kit (Biomiga, Inc.). The
genotypes for COMT rs4680 were examined using the polymer-
ase chain reaction (PCR) and ligation detection reaction (LDR)
method (Thompson et al. 2004; Yi et al. 2009) with technical
 COMT to Prefrontal Volume to Cognitive Control Pathway
Figure 1. Schematic representation of the Stroop task design. The upper part of
the figure shows the general procedure for block presentation, while the lower
part shows the general procedure for item presentation. The word reading
blocks (blocks 1 and 3) are consisted of 24 incongruent and 12 congruent items,
which are randomly displayed in each block; and the color naming blocks
(blocks 2 and 4) are consisted of 24 incongruent and 12 neutral items, which are
randomly displayed in each block. RD-C, reaction delay of color interference in
word reading blocks; RD-W, reaction delay of word interference in color naming
blocks; RT, reaction time. The Chinese characters (蓝, 绿, 红, 黄) in the box mean
the blue, green, red, and yellow in English.
support from the Shanghai Biowing Applied Biotechnology
Company. PCR primer sequences were: forward sequence:
5′ GGGCCTACTGTGGCTACTCA 3′; reverse sequence:
5′ CCCTTTTTCCAGGTCTGACA 3′. PCR was performed with a
20 μL reaction volume containing 1 μL genomic DNA, 0.4 μL pri-
mer mixture, 2 μL dNTPs, 0.6 μL Mg2+, 2 μL buffer, 4 μL Q-
Solution, and 0.3 μL Taq DNA polymerase. The amplification
protocol incorporated an initial denaturation and enzyme acti-
vation phase at 95 °C for 15 min, followed by 35 cycles of
denaturation at 94 °C for 30 s, annealing for 1 min and 30 s at
59 °C for COMT rs4680, extension at 72 °C for 1 min, and then a
final extension at 72 °C for 7 min. PCR products were verified in
3% agarose gels that were stained with ethidium bromide
to regulate the amount of DNA added to the LDR. Three
probes were used for LDR reaction: one common probe (P-
GCCAGCGAAATCCACCATCCGCTGGTTTTTTTTTTTTTTTTTTTT-
FAM) and two discriminating probes (rs4680_A:
TTTTTTTTTTTTTTTTTTTTCAGGCATGCACACCTTGTCCTTCAT
and rs4680_G: TTTTTTTTTTTTTTTTTTTTTTCAGGCAT
GCACACCTTGTCCTTCAC). These reactions were conducted in
a 10 μL mixture containing 1 μL buffer, 1 μL probe mix, 0.05 μL
Taq DNA ligase, 1 μL PCR product, and 6.95 μL deionized water.
The reaction program consisted of an initial heating at 95 °C
for 2 min, followed by 35 cycles of 30 s at 94 °C and 2 min at
50 °C. Reactions were stopped by chilling the tubes in an
ethanol-dry ice bath and adding 0.5 mL of 0.5 mM EDTA.
Aliquots of the reaction products (1 μL) were mixed with 1 μL of
loading buffer (83% formamide, 8.3 mM EDTA, and 0.17% blue
dextran) and 1 μL ABI GS-500 Rox-Fluorescent molecular
weight marker and then denatured at 95 °C for 2 min. The
samples were then chilled rapidly on ice prior to being loaded
Xu et al. | 3
on a 5 Murea-5% polyacrylamide gel and electrophoresed on
an ABI 3100 DNA sequencer at 3000 V. Finally, the fluorescent
ligation products were analyzed and quantified using the ABI
Gene Mapper software. Twenty subjects were excluded due to
genotyping failure.
Image Acquisition
MRI data were acquired using a Signa HDx 3.0 Tesla MR scanner
(General Electric). Sagittal 3D T1-weighted images were
acquired by a brain volume sequence with the following para-
meters: repetition time/echo time = 8.1/3.1 ms; inversion
Downloaded from http://cercor.oxfordjournals.org/ at Health Sciences Library, Stony Brook University on September 24, 2016
time = 450 ms; field of view = 256 mm × 256 mm;
matrix = 256 × 256; flip angle = 13°, slice thickness = 1 mm; no
gap; 176 sagittal slices. Resting-state functional MRI data were
collected using single-shot echo-planar imaging (repetition
time/echo time = 2000/30 ms; field of view = 240 mm × 240 mm;
matrix = 64 × 64; flip angle = 90°, slice thickness = 4 mm; no
gap; 40 interleaved transverse slices; 180 volumes). During the
functional MRI scans, all subjects were instructed to keep still
with their eyes closed, to think of nothing in particular, to stay
as motionless as possible, and to not fall asleep.
GMV Calculation
All structural images were visually checked by 2 experimenters.
One subject was excluded due to poor image quality; then, a
total of 261 subjects were finally included in the voxel-based
morphometry (VBM) analysis. The GMV maps were calculated
using the VBM8 implemented in Statistical Parametric Mapping
software package (SPM8, http://www.fil.ion.ucl.ac.uk/spm). In
the segmentation of VBM8, an adaptive Maximum A Posterior
technique (Rajapakse et al. 1997) and a partial volume estima-
tion (Tohka et al. 2004) were used to estimate the fraction of
each pure tissue type present in every voxel. After the struc-
tural images were segmented into gray matter (GM), white mat-
ter, and cerebrospinal fluid, the individual’s GM concentration
map was normalized into the Dartel template in Montreal
Neurological Institute (MNI) space (http://www.mni.mcgill.ca/).
This template was derived from 550 healthy control subjects of
the IXI-database (http://www.brain-development.org). In the
modulated normalized process, we multiplied the individual’s
GM concentration map only by the nonlinear determinants
derived from the spatial normalization procedure. This step
resulted in normalized GM density or relative GMV map for
each subject. Here, the GMV of each voxel represents the frac-
tion of GM present in each voxel, which preserves the local GM
density while removing the confounding effect of variance in
individual brain sizes. After that, we resliced the normalized
GMV to a 1.5-mm cubic voxel. Finally, the GMV images were
smoothed with a kernel of 8 mm × 8 mm × 8 mm full width at
half maximum. Then, the spatial preprocessing, normalized,
modulated, and smoothed GMV maps were used for further
analysis.
Functional Measure Calculation
The preprocessing of functional MRI data and the calculation of
functional measures are shown in Supplementary Material Part
1. A total of 251 subjects were included in the analyses of func-
tional measures, which included the amplitude of low fre-
quency fluctuation (ALFF), regional homogeneity (ReHo), and
resting-state functional connectivity (rsFC).
 4 | Cerebral Cortex
Statistical Analysis for Demographic, Genetic, and
Behavioral Data
Statistical analyses for demographic, genetic, and behavioral
data were performed using the Statistical Package for the Social
Sciences version 18.0 (SPSS, Inc.). Generally, a Chi-square test
was used to compare group differences in gender. A 2-way
(genotype and gender) ANOVA was used to identify gene × gen-
der interaction on age, educational years, RT, RD, and CR. If
there was a significant interaction, post hoc analysis was used
to compare the differences (P < 0.05) between genotypic groups
in males and females, respectively. Student-Newman-Keuls
(SNK) method was used to correct for multiple comparisons.
Statistical Analysis for Imaging Data
Similar to a previous study of COMT effect (Watanabe et al.,
2015), we also performed statistical analyses using SPM8 soft-
ware. A full factorial 2-way (genotype and gender) ANOVA
was used to voxel-wisely identify the main effect of COMT and
gene × gender interaction on GMV within the whole brain or
within the ECN mask, respectively. Age and educational years
were included as covariates of no interest into the ANOVA to
control for potential confounding variables. The ECN was
defined by independent component analysis (see details in
Supplementary Material Part 2). Multiple comparisons were cor-
rected using the nonstationary random field correction with a
voxel-wise threshold of P < 0.001 and a cluster-level threshold
of P < 0.05. If the results cannot pass the cluster-level correc-
tion, an uncorrected voxel-wise threshold (P < 0.001) was used
to show the trend of significance. The GMV of each brain region
with significant gene × gender interaction was extracted and
used to post hoc comparisons between genotypic groups in
males and females, respectively. SNK method was used to cor-
rect for multiple comparisons.
Brain regions with significant COMT × gender interaction on
GMV were defined as regions of interest (ROIs) for the following
functional analysis. Firstly, we extracted ALFF and ReHo of
each ROI and used a 2-way ANOVA to analyze these functional
properties (P < 0.001). And then, a 2-way ANOVA was applied
within a mask of brain areas with significant positive rsFC with
the ROI, to voxel-wisely identify COMT × gender interaction on
rsFC using the same statistical methods and thresholds as the
GMV comparison. The significant rsFC was extracted and used
for between-genotype comparisons in males and females,
respectively. The η2 was used to test the effect size of ANOVA
(Cohen 1988; Bezeau and Graves 2001; Parker and Hagan-Burke
2007), which was divided into small (0.01 < η2 < 0.06), medium
(0.06 < η2 < 0.14), and large (η2 > 0.14) effects (Cohen 1988).
Voxel-wise partial correlation analyses were carried out to
test correlations between brain GMV and RD/CR of the Stroop
task in males and females, respectively (P < 0.001), while con-
trolling for the effects of age and education years.
Mediation Analysis
In statistics, a mediation model is used to identify the mechan-
ism that underlies an observed relationship between an inde-
pendent variable and a dependent variable via introducing a
third (mediator) variable (https://en.wikipedia.org/wiki/
Mediation). A mediation model proposes that the independent
variable influences the mediator variable, which in turn influ-
ences the dependent variable. Mediation analysis may
improve our understanding of the relationship between the
independent and dependent variables when the variables
appear to be lack of a direct connection.
In this study, we used the SPSS macro to perform the
mediation analysis (http://www.afhayes.com/introduction-to-
mediation-moderation-and-conditional-process-analysis.html)
(Preacher and Hayes 2008; Hayes 2013). In each gender group,
we defined the COMT genotype as the independent variable, the
GMV of the left FP as the mediator variable, and the RD/CR as
the dependent variable. The first step was to confirm that the
independent variable (genotype) is a predictor of the dependent
variable (RD/CR), which is known as the direct effect. The
second step was to confirm that the independent variable (geno-
type) is a predictor of the mediator (GMV). The third step was to
Downloaded from http://cercor.oxfordjournals.org/ at Health Sciences Library, Stony Brook University on September 24, 2016
confirm that the mediator (GMV) is a predictor of the dependent
variable (RD), while controlling for the independent variable
(genotype). The indirect effect is the product of path coefficients
of the last 2 steps. Then the bootstrapping method was used to
assess the significance of the mediation effect. Bootstrapping
involves repeatedly randomly sampling observations with
replacement from the data set to compute the indirect effect in
each resample. After 5000 bias-corrected bootstrapping, we can
estimate the sampling distribution of the indirect effect.
According to the distribution, we can calculate 95% confidence
intervals of the effect. If zero does not fall between the resulting
95% confidence interval of the bootstrapping method, we can
confidently conclude that there is a significant mediation effect
(P < 0.05). If a functional measure showed significant difference,
we used the same method to test its mediation effect.
Results
Demographic and Genetic Characteristics
A total of 261 healthy subjects were finally included in this
study. Their demographic and genetic characteristics are
shown in Table 1. The distributions of COMT rs4680 (126 Val/
Val, 109 Val/Met, and 26 Met/Met) were in Hardy–Weinberg
equilibrium (P > 0.05). The allele-frequency distributions in
males and females are presented in Table 2. There were no sig-
nificant differences in genotypic distribution, age, and educa-
tion years between males and females (P > 0.05).
Stroop Task Performance Differences Between COMT
Genotypes
Stroop task performance of subjects is shown in Tables 3 and 4.
The 2-way ANOVA showed a significant gene × gender inter-
action on RD-W (P = 0.023, Fig. 2), but not on RD-C (P = 0.538)
and total CR (P = 0.360). Post hoc analysis revealed that the
male Val/Val subjects had a greater RD-W than the male Met/
Met subjects (P = 0.028), and the difference was still significant
following SNK correction for multiple comparisons. There were
no significant differences (P > 0.05) in RD-W in other 2 contrasts
(Val/Val vs. Val/Met and Val/Met vs. Met/Met) in males and in
any contrasts in females. We did not find any main effects of
gene or gender on the RD-C, RD-W, and total CR in these sub-
jects (P > 0.05). Neither significant main effects nor significant
gene × gender interaction effects were found in RT or CR of
incongruent/congruent/neutral items of color naming or word
reading blocks (P > 0.05).
GMV Differences Between COMT Genotypes
In the whole brain analysis, we did not find any significant
main effect of COMT and COMT × gender interaction on GMV
 COMT to Prefrontal Volume to Cognitive Control Pathway Xu et al. | 5

when using nonstationary random field correction for multiple
comparisons (P < 0.05). When using an uncorrected threshold
of P < 0.001, we found a significant COMT × gender interaction
on the GMV in the left lateral frontal pole (FP) (Brodmann area
10; peak MNI coordinate: x = −15, y = 54, z = 18; peak F = 7.2118;
214 voxels; Fig. 3A), although there was no significant main
effect of COMT. The effect size was η2 = 0.062, indicating a
medium effect. Post hoc comparisons showed that Val/Val indi-
viduals exhibited decreased GMV than Val/Met (P = 0.003,
Table 1 Demographic data of 261 healthy subjects
N zygotes (P = 0.0002, significant following SNK correction) and
significant following SNK correction) and Met/Met (P = 0.006,
significant following SNK correction) in males but not in
females (Val/Met: P = 0.410; Met/Met: P = 0.317) (Fig. 3B). Neither
males nor females showed a significant GMV difference
between Val/Met and Met/Met genotypes.
Within the ECN mask (Fig. 4), we found a significant COMT ×
gender interaction (P = 0.049, nonstationary random field cor-
rection) on the GMV in the left lateral FP (Brodmann area 10;
peak MNI coordinate: x = −16.5, y = 58.5, z = 18; peak F = 6.603;
49 voxels; Fig. 5A). The effect size was η2 = 0.09, indicating a
medium effect. Post hoc comparisons showed that Val homo-
zygotes exhibited significantly decreased GMV than Met hetero-

Downloaded from http://cercor.oxfordjournals.org/ at Health Sciences Library, Stony Brook University on September 24, 2016
Effects Subgroups Age (years) Education
(years) Met homozygotes (P = 0.011, significant following SNK correc-
tion) only in males but not in females (Val/Met: P = 0.347; Met/
COMT Val/Val 126 22.96 (2.17) 15.99 (2.01) Met: P = 0.842) (Fig. 5B). Neither males nor females showed a
Val/Met 109 22.82 (2.43) 15.53 (2.11) significant GMV difference between Val/Met and Met/Met
Met/Met 26 22.62 (2.97) 15.15 (2.36) genotypes.
F (P) 261 0.27 (0.76) 2.48 (0.09)
Gender Male 119 22.21 (2.62) 15.13 (2.22)
Female 142 23.22 (2.34) 16.12 (2.01) Functional Measure Differences Between COMT
F (P) 261 8.02 (0.06) 11.83 (0.08) Genotypes
COMT × Gender Val/Val male 57 22.43 (2.54) 15.34 (2.32)
Val/Met male 46 22.13 (2.44) 14.83 (1.96) The left lateral FP cluster with significant COMT × gender
Met/Met male 16 22.50 (3.27) 15.25 (2.57) interaction (P < 0.001) on GMV in the whole brain analysis was
Val/Val female 69 22.13 (2.71) 15.04 (2.32) extracted as the ROI for the following analyses of functional
Val/Met female 63 23.32 (2.31) 16.04 (2.09) measures. For the ALFF and ReHo of the left lateral FP, we did
Met/Met female 10 22.80 (2.57) 15.00 (2.11) not find any significant main effect of genotype (ALFF:
F (P) 261 0.62 (0.54) 1.32 (0.27) P = 0.451; ReHo: P = 0.335) or COMT × gender interaction (ALFF:
P = 0.312; ReHo: P = 0.683). Within the positive rsFC mask of
Note: The data are shown as the means (SD). the left lateral FP (see Supplementary Fig. S1), we did not find
any significant main effect of genotype or COMT × gender
interaction on the rsFC of the left lateral FP (P < 0.001,
Table 2 The gender distributions of COMT Val158Met polymorphism uncorrected).

Gender N (%) COMT genotypes (%)

Val/Val Val/Met Met/Met Association Between Brain GMV and Stroop

Performance
Male 119 (45.59) 57 (45.24) 46 (42.20) 16 (61.53)
We performed voxel-wise partial correlation analysis to test
Female 142 (54.79) 69 (54.76) 63 (57.80) 10 (38.46)
Total 261 (100%) 126 (48.28) 109 (41.76) 26 (9.96) correlations between brain GMV and RD/CR of the Stroop task
in males and females, respectively (P < 0.001). We found that

Table 3 The RT results of Stroop task performance

Group N Word reading RT (ms) Color naming RT (ms) RD-C (ms) RD-W (ms)

Incongruent Congruent Incongruent Neutral

Val/Val 57 1034.84 921.47 1115.63 991.34 113.38 124.28

Male (199.86) (210.62) (174.17) (161.42) (132.37) (170.90)
Val/Met 46 950.76 834.23 996.28 915.03 116.53 81.25
Male (203.68) (151.02) (212.80) (183.40) (108.80) (84.93)
Met/Met 16 965.66 867.16 989.01 931.53 98.50 57.48
Male (210.00) (196.00) (202.70) (195.37) (102.37) (106.75)
Val/Val 69 977.62 869.32 1043.17 954.70 108.30 88.47
Female (204.45) (189.67) (238.23) (220.24) (105.88) (109.43)
Val/Met 63 979.88 883.83 1029.25 943.96 96.06 85.29
Female (244.97) (189.79) (203.71) (186.36) (115.88) (101.20)
Met/Met 10 1051.10 961.15 1044.75 1019.90 89.95 24.85
Female (276.04) (171.52) (234.04) (263.28) (129.13) (90.21)
Total 261 977.14 872.88 1024.22 944.80 104.26 79.42
(217.79) (185.87) (214.74) (198.71) (109.96) (107.79)
P* 0.956 0.614 0.418 0.994 0.538 0.023

Notes: The data were shown as mean (SD); RD-C, reaction delay of color interference in word reading blocks; RD-W, reaction delay of word interference in color naming
blocks; RT, reaction time; SD, standard deviation. *The P-value of COMT × gender interaction effect on RT or RD. The bold and italic P-value was statistically significant.
 6 | Cerebral Cortex

Table 4 The CR results of Stroop task performance

Group N Word reading CR (%) Color naming CR (%) Total CR (%)

Incongruent Congruent Incongruent Neutral

Val/Val 57 95.10 96.64 95.91 97.44 96.02

Male (7.23) (4.05) (6.72) (2.92) (4.65)
Val/Met 46 95.97 97.92 95.92 97.92 96.60
Male (5.05 (4.00) (3.88) (2.45) (3.07)
Met/Met 16 95.18 97.66 96.09 97.40 96.27
Male (4.73) (4.02) (2.62) (4.53) (3.10)
Val/Val 69 96.20 97.89 96.71 97.83 96.92
Female (3.83) (3.17) (3.92) (4.08) (2.72)

Downloaded from http://cercor.oxfordjournals.org/ at Health Sciences Library, Stony Brook University on September 24, 2016
Val/Met 63 96.46 97.69 96.59 98.28 97.01
Female (4.29) (3.24) (3.93) (2.86) (2.55)
Met/Met 10 92.29 97.92 95.21 97.50 95.07
Female (5.64) (4.05) (4.92) (5.62) (4.42)
Total 261 95.77 97.56 96.27 97.83 96.58
(5.20) (3.63) (4.63) (3.40) (3.35)
P* 0.220 0.298 0.708 0.982 0.360

Notes: The data were shown as mean (SD); CR, correction rate; SD, standard deviation. *The P-value of COMT × gender interaction effect on CR.

Discussion
In this study, we investigated gene-anatomy-cognition path-
ways to explain how COMT Val158Met polymorphism affects
interference resolution capacity via modulating the GMV of the
brain in healthy subjects. We found a significant COMT × gen-
der interaction on interference resolution capacity and on the
GMV of the left lateral FP. These effects were only significant in
male subjects. Mediation analysis revealed that the GMV of the
left lateral FP mediated the association between COMT poly-
morphism and interference resolution only in males.

Association Between COMT and Interference Resolution

Figure 2. The RD-W differences of Stroop task between COMT genotypes. Val
homozygotes exhibit significantly longer RD-W in Stroop task than Met homo-
zygotes only in males. COMT, catechol-O-methyltransferase; RD-W, reaction
delay of word interference in color naming blocks. *P < 0.05.
males and females showed significant correlations between
RD-W and GMV in different brain regions (see Supplementary
Fig. S2). The RD-W was mainly correlated with the dorsal anter-
ior cingulate cortex (dACC) in females, but with the PFC in
males. However, neither males nor females showed significant
correlation between RD-C/CR and GMV.
Mediation Analysis
The mediation analysis was performed in males and females,
respectively. In male subjects, we found significant direct
effects from COMT to RD-W (P = 0.026), from COMT to GMV
(P = 0.043), and from GMV to RD-W (P = 0.040). More import-
antly, we found a significant indirect effect (P = 0.018) (Fig. 6A),
suggesting that the GMV of the left FP may mediate the associ-
ation between COMT and RD-W. In female subjects, however,
we did not find any significant effects in the gene-anatomy-
cognition pathway (Fig. 6B).
COMT Val/Val individuals have been associated with poor pre-
frontal executive functioning (Egan et al. 2001; Joober et al.
2002; Malhotra et al. 2002; Goldberg et al. 2003; Rosa et al. 2004;
Galderisi et al. 2005), in particular interference resolution cap-
acity (Nolan et al. 2004; Reuter et al. 2005; Green et al. 2013).
The COMT may affect prefrontal functioning via modulating
the synaptic dopamine concentration in an inverse U-shaped
pattern (Williams and Goldman-Rakic 1995; Goldman-Rakic
1998), in which both the lowest and the highest dopamine
levels may impair behavioral performance (Giakoumaki et al.
2008; Qin et al. 2012; Fallon et al. 2013). Moreover, estrogen may
also affect prefrontal functioning via inhibiting COMT activity
(Xie et al. 1999; Jiang et al. 2003), which has been linked to gen-
der difference in interference resolution capacity (Kimura 1987;
Tunbridge and Harrison 2011; Pezeshki Rad et al. 2014). These
findings may account for our finding of the modulation effect
of COMT on interference resolution capacity being significant
only in male subjects, which has been reported in previous
studies (Reuter et al. 2005; Baroun and Alansari 2006; O’Hara
et al. 2006; White et al. 2014).
Association Between COMT and PFC
As a key enzyme of dopamine degradation, COMT may account
for more than a half of the dopamine degradation in the PFC
because of the lack of dopamine transporter in the PFC synap-
ses (Mannisto and Kaakkola 1999; Seamans and Yang 2004); it
thus plays a unique role in regulating synaptic dopamine levels
 COMT to Prefrontal Volume to Cognitive Control Pathway
Figure 3. GMV differences between COMT genotypes (Val/Val, Val/Met, and Met/Met) in the whole brain. There is a significant COMT × gender interaction on GMV in
the left lateral FP (A). Val homozygotes exhibit significantly smaller GMV than Met heterozygotes and Met homozygotes only in males (B). COMT, catechol-O-methyl-
transferase; FP, frontal pole; GMV, gray matter volume. L, left; R, right. *P < 0.05.
Figure 4. The left (A) and right (B) ECN identified by the independent component
analysis. Data are displayed on the lateral and medial surfaces of the left and
right hemispheres of a brain surface map. ECN, executive control network.
in the PFC (Karoum et al. 1994). These findings may explain
why the effect of COMT was restricted to the PFC. It has been
well documented that dopamine affects neuronal survival and
growth in an inverted U-shape fashion (Honea et al. 2009). In
this model, an optimal dopamine signaling may induce the
generation of brain-derived neurotropic factor (Kuppers and
Beyer 2001) and facilitate neuronal growth. Conversely, either
too low or too high extracellular dopamine signaling may
impair neuronal integrity and survival (Xu et al. 1994; Santiago
et al. 2000; Fumagalli et al. 2003). Moreover, males may exhibit
lower dopamine availability than females because estrogen can
down-regulate COMT activity (Xie et al. 1999; Jiang et al. 2003).
Therefore, based on COMT genotype and gender, one can esti-
mate relative dopamine signaling of each subgroup. The pre-
sumed dopamine signaling from low to high is in the order of
Val/Val males, other combinations and Met/Met females. These
may explain why Val/Val males showed the smallest GMV in
the left FP. The gender difference in the modulation effect of
COMT on prefrontal morphology is well consistent with previ-
ous findings (Kates et al. 2006; Zinkstok et al. 2006).
Association Between PFC and Interference Resolution
The cognitive control (inference resolution, conflict processing,
etc.) has been linked to the dACC and dorsolateral PFC (DLPFC)
of the brain (MacDonald et al. 2000; Fan et al. 2003; Carter and
Van Veen 2007; Roberts and Hall 2008; Floden et al. 2011; Rahm
et al. 2013). In this context, the dACC (Botvinick et al. 2004;
Carter and Van Veen 2007) and DLPFC (Botvinick et al. 2001) are
involved in monitoring and resolving conflict, respectively. The
lateral FP has dense connections with the DLPFC (Liu et al. 2013),
Xu et al. | 7
Downloaded from http://cercor.oxfordjournals.org/ at Health Sciences Library, Stony Brook University on September 24, 2016
and they are coactivated during cognitive control tasks, such as
the Stroop (Taylor et al. 1997; Banich et al. 2000; Mead et al. 2002;
Laird et al. 2005) and stop-signal tasks (Aron et al. 2004). The
lateral FP is involved in the selection of processes (Fletcher and
Henson 2001) and reallocation of attention (Gilbert et al. 2006),
and is even directly linked to the ECN (Zysset et al. 2001). In our
study, both the ECN map derived from Independent Component
Analysis (Fig. 4) and the GMV correlation map of the RD-W (see
Supplementary Fig. S2) indicate that the left lateral FP is a com-
ponent of the ECN at least in male subjects. Moreover, the correl-
ation between the GMV of the left lateral FP and RD-W
(interference resolution capacity) is well consistent with previous
findings reporting an association between the GMV of the PFC
and the performance of the Stroop task (Takeuchi et al. 2012) and
stop-signal task (Aron et al. 2003).
From Supplementary Fig. S2, we observed that brain regions
with significant GMV-RD correlations were largely different
between males (DLPFC) and females (dACC), suggesting a dis-
tinct gender difference. This finding is consistent with previous
studies reporting gender differences in functional connectivity
(Hjelmervik et al. 2014; White et al. 2014) and event-related
potentials (Huster et al. 2011) associated with cognitive control.
Of course, future studies are needed to clarify the mechanisms
underlying gender differences in brain regions involved in cog-
nitive control.
Gene (COMT)-Anatomy (FP GMV)-Cognition (Interference
Resolution) Pathway
Although the pairwise relationships among gene, anatomy,
and cognition have been extensively investigated, there is lack
of a united gene-anatomy-cognition model to account for the
modulation of COMT Val158Met polymorphism on the capacity
of interference resolution. In this study, we used a mediation
model and revealed that the GMV of the left lateral FP might
mediate the modulation of COMT Val158Met polymorphism on
the interference resolution in male subjects. This gene-
anatomy-cognition pathway may help us to better understand
the neural mechanism of interference resolution in healthy
males. More importantly, in some brain disorders, it would
help to understand the gender difference in genetic susceptibil-
ity, to identify the mechanisms of the executive impairments,
to design the treatment target to improve the executive func-
tion, and to monitor the efficacy of the potential treatment.
Therefore, future studies should translate our finding of this
 8 | Cerebral Cortex
Figure 5. GMV differences between COMT genotypes (Val/Val, Val/Met, and Met/Met) within the ECN mask. There is a significant COMT × gender interaction on GMV
in the left lateral FP (A). Val homozygotes exhibit significantly smaller GMV than Met heterozygotes and Met homozygotes only in males (B). COMT, catechol-O-
methyltransferase; ECN, executive control network; FP, frontal pole; GMV, gray matter volume; L, left; R, right;. *P < 0.05.
Figure 6. The mediation model of the COMT genotype, the GMV of the left lat-
eral FP and the Stroop RD-W in male (A) and female (B) subjects, respectively.
The GMV of the left lateral FP serves as a mediator in the association between
COMT polymorphism and inhibition control in the mediation analysis. The dir-
ect and indirect effects are labeled with path coefficients and P-value. The red
line indicates a positive path. The blue line indicates a negative path. The gray
line indicates no effect. COMT, catechol-O-methyltransferase; FP, frontal pole;
RD-W, reaction delay of word interference in color naming blocks.
gene-anatomy-cognition pathway into brain disorders to better
understand and efficiently treat these disorders.
Functional Measure Analyses
Besides the GMV analysis, we also performed functional measure
analyses. However, we did not find any significant main effects
of COMT or COMT × gender interactions on either regional activ-
ity (ALFF and ReHo) or rsFC in the left lateral FP. These findings
may be explained by previous heritability studies reporting that
structural measures have much greater heritability than func-
tional measures of the brain (Thompson et al. 2001).
Downloaded from http://cercor.oxfordjournals.org/ at Health Sciences Library, Stony Brook University on September 24, 2016
Limitations
Based on COMT genotype and gender, one can roughly esti-
mate the relative dopamine signaling from low to high is in
the order of Val/Val males, other combinations and Met/Met
females. However, the specific sorting scheme for middle sub-
groups (Val/Met males, Met/Met males, Val/Val females and
Val/Met females) is arbitrary. In other words, we do not know
the weights of the gene and gender in contributing to the
dopamine signaling. Although our findings suggest a gene
(COMT)-anatomy (FP volume)-cognition (interference reso-
lution) pathway, the results from the imaging genetics ana-
lysis cannot be directly translated into putative knowledge
because of its nature of statistical inference. More systematic
studies using animal models and other techniques are
required to confirm the association and to elucidate the
underlying biological mechanisms.
Conclusion
Using a mediation analysis, we identified a gene-anatomy-
cognition pathway to explain how COMT Val158Met polymorph-
ism affects interference resolution capacity via modulating the
GMV of the left lateral FP in healthy male subjects. This path-
way may not only provide us a better understanding the gen-
etic modulation of cognitive control in healthy subjects, but
also provide a reference frame for investigating the mechan-
isms of executive impairments in brain disorders.
Supplementary Material
Supplementary material can be found at: http://www.cercor.
oxfordjournals.org/
Funding
The Natural Science Foundation of China (Grant Nos 81501451,
81425013, 81271551, 91132301, 81301201, and 81301202).
Notes
Conflict of Interest: None declared.
 COMT to Prefrontal Volume to Cognitive Control Pathway Xu et al. | 9

References Fletcher P, Henson RNA. 2001. Frontal lobes and human mem-
ory. Brain. 124:849–881.
Aron AR, Fletcher PC, Bullmore ET, Sahakian BJ, Robbins TW.
Fumagalli F, Racagni G, Colombo E, Riva MA. 2003. BDNF gene
2003. Stop-signal inhibition disrupted by damage to right
expression is reduced in the frontal cortex of dopamine
inferior frontal gyrus in humans. Nat Neurosci. 6:115–116.
transporter knockout mice. Mol Psychiatry. 8:898–899.
Aron AR, Robbins TW, Poldrack RA. 2004. Inhibition and the
Gilbert SJ, Spengler S, Simons JS, Steele JD, Lawrie SM, Frith CD,
right inferior frontal cortex. Trends Cog Sci. 8:170–177.
Burgess PW. 2006. Functional specialization within rostral
Banich MT, Milham MP, Atchley RA, Cohen NJ, Webb A,
prefrontal cortex (area 10): a meta-analysis. J Cogn Neurosci.
Wszalek T, Kramer AF, Liang Z, Barad V, Gullett D, et al.
18:932–948.
2000. Prefrontal regions play a predominant role in impos-
Grandjean J, D’Ostilio K, Phillips C, Balteau E, Degueldre C,
ing an attentional ‘set’: evidence from fMRI. Brain Res Cogn
Luxen A, Maquet P, Salmon E, Collette F. 2012. Modulation
Brain Res. 10:1–9.
of brain activity during a Stroop inhibitory task by the kind
Baroun K, Alansari B. 2006. Gender differences in performance
of cognitive control required. PLoS One. 7:e41513.

Downloaded from http://cercor.oxfordjournals.org/ at Health Sciences Library, Stony Brook University on September 24, 2016
on the Stroop test. Soc Behav Pers. 34:309–318.
Galderisi S, Maj M, Kirkpatrick B, Piccardi P, Mucci A, Invernizzi
Barnes A, Isohanni M, Barnett JH, Pietiläinen O, Veijola J,
G, Rossi A, Pini S, Vita A, Cassano P, et al. 2005. Catechol-O-
Miettunen J, Paunio T, Tanskanen P, Ridler K, Suckling J,
methyltransferase Val158Met polymorphism in schizophre-
et al. 2012. No association of COMT (Val158Met) genotype
nia: associations with cognitive and motor impairment.
with brain structure differences between men and women.
Neuropsychobiology. 52:83–89.
PLoS One. 7(3):e33964.
Giakoumaki SG, Roussos P, Bitsios P. 2008. Improvement of pre-
Bezeau S, Graves R. 2001. Statistical power and effect sizes of
pulse inhibition and executive function by the COMT inhibi-
clinical neuropsychology research. J Clin Exp Neuropsychol.
tor tolcapone depends on COMT Val158Met polymorphism.
23:399–406.
Neuropsychopharmacology. 33:3058–3068.
Botvinick MM, Braver TS, Barch DM, Carter CS, Cohen JD. 2001.
Goldberg TE, Egan MF, Gscheidle T, Coppola R, Weickert T,
Conflict monitoring and cognitive control. Psychol Rev. 108:
Kolachana BS, Goldman D, Weinberger DR. 2003. Executive
624–652.
subprocesses in working memory: relationship to catechol-
Botvinick MM, Cohen JD, Carter CS. 2004. Conflict monitoring
O-methyltransferase Val158Met genotype and schizophre-
and anterior cingulate cortex: an update. Trends Cogn Sci. 8:
nia. Arch Gen Psychiatry. 60:889–896.
539–546.
Goldman-Rakic PS. 1998. The cortical dopamine system: role in
Carter CS, Van Veen V. 2007. Anterior cingulate cortex and con-
memory and cognition. Adv Pharmacol. 42:707–711.
flict detection: an update of theory and data. Cog Affect
Green AE, Kraemer DJ, Deyoung CG, Fossella JA, Gray JR. 2013. A
Behav Neurosci. 7:367–379.
gene-brain-cognition pathway: prefrontal activity mediates
Cerasa A, Gioia MC, Labate A, Liguori M, Lanza P, Quattrone A.
the effect of COMT on cognitive control and IQ. Cereb
2008. Impact of catechol-O-methyltransferase Val(108/158)
Cortex. 23:552–559.
Met genotype on hippocampal and prefrontal gray matter
Hayes AF. 2013. Introduction to mediation, moderation, and
volume. Neuroreport. 19:405–408.
conditional process analysis: a regression-based approach. J
Chen C, Chen C, Moyzis R, Dong Q, He Q, Zhu B, Li J, Li H, Li J,
Educ Meas. 51:335–337.
Lessard J. 2011. Sex modulates the associations between the
Hjelmervik H, Hausmann M, Osnes B, Westerhausen R, Specht
COMT gene and personality traits. Neuropsychopharmacology.
K. 2014. Resting states are resting traits–an FMRI study of
36:1593–1598.
sex differences and menstrual cycle effects in resting state
Cohen J. 1988. Statistical power analysis for the behavioral
cognitive control networks. PLoS One. 9:e103492.
sciences. 2nd edn. Hillsdale, NJ: Lawrence Erlbaum Associates.
Ho BC, Wassink TH, O’Leary DS, Sheffield VC, Andreasen NC.
de Castro-Catala M, Barrantes-Vidal N, Sheinbaum T, Moreno-
2005. Catechol-O-methyl transferase Val158Met gene poly-
Fortuny A, Kwapil TR, Rosa A. 2015. COMT-by-sex inter-
morphism in schizophrenia: working memory, frontal lobe
action effect on psychosis proneness. BioMed Res Int. 2015:
MRI morphology and frontal cerebral blood flow. Mol
829237.
Psychiatry. 10 (3):287–298.
Dutt A, Mcdonald C, Dempster E, Prata D, Shaikh M, Williams I,
Holtzer R, Ozelius L, Xue X, Wang T, Lipton R, Verghese J. 2010.
Schulze K, Marshall N, Walshe M, Allin M, et al. 2009. The
Differential effects of COMT on gait and executive control in
effect of COMT, BDNF, 5-HTT, NRG1 and DTNBP1 genes on
aging. Neurobiol Aging. 31:523–531.
hippocampal and lateral ventricular volume in psychosis.
Huster RJ, Westerhausen R, Herrmann C. 2011. Sex differences
Psycho Med. 39 (11):1783–1797.
in cognitive control are associated with midcingulate and
Egan MF, Goldberg TE, Kolachana BS, Callicott JH, Mazzanti CM,
callosal morphology. Brain Struct Funct. 215:225–235.
Straub RE, Goldman D, Weinberger DR. 2001. Effect of COMT
Honea R, Verchinski BA, Pezawas L, Kolachana BS, Callicott JH,
Val108/158 Met genotype on frontal lobe function and risk
Mattay VS, Weinberger DR, Meyer-Lindenberg A. 2009.
for schizophrenia. Proc Natl Acad Sci U S A. 98:6917–6922.
Impact of interacting functional variants in COMT on
Fallon SJ, Williams-Gray CH, Barker RA, Owen AM, Hampshire
regional gray matter volume in human brain. Neuroimage.
A. 2013. Prefrontal dopamine levels determine the balance
45:44–51.
between cognitive stability and flexibility. Cereb Cortex. 23:
Jiang H, Xie T, Ramsden DB, Ho SL. 2003. Human catechol-O-
361–369.
methyltransferase down-regulation by estradiol.
Fan J, Flombaum JI, McCandliss BD, Thomas KM, Posner MI.
Neuropharmacology. 45:1011–1018.
2003. Cognitive and brain consequences of conflict.
Jaspar M, Genon S, Muto V, Meyer C, Manard M, Dideberg V,
Neuroimage. 18:42–57.
Bours V, Salmon E, Maquet P, Collette F. 2014. Modulating
Floden D, Vallesi A, Stuss DT. 2011. Task context and frontal
effect of COMT genotype on the brain regions underlying
lobe activation in the Stroop task. J Cogn Neurosci. 23:
proactive control process during inhibition. Cortex. 50:
867–879.
148–161.
 10 | Cerebral Cortex
Joober R, Gauthier J, Lal S, Bloom D, Lalonde P, Rouleau G,
Benkelfat C, Labelle A. 2002. Catechol-O-methyltransferase
Val-108/158-Met gene variants associated with performance
on the Wisconsin Card Sorting Test. Arch Gen Psychiatry.
59:662–663.
Kates WR, Antshel K M, Abdulsabur N, Colgan D, Funke B,
Fremont W, Higgins AM, Kucherlapati R, Shprintzen RJ.
2006. A gender-moderated effect of a functional COMT poly-
morphism on prefrontal brain morphology and function in
velo-cardio-facial syndrome (22q11.2 deletion syndrome).
Am J Med Genetics B Neuropsychiatr Genet. 141B (3):
274–280.
Karoum F, Chrapusta SJ, Egan MF. 1994. 3-Methoxytyramine is
the major metabolite of released dopamine in the rat frontal
cortex: reassessment of the effects of antipsychotics on the
dynamics of dopamine release and metabolism in the
frontal cortex, nucleus accumbens, and striatum by a simple
two pool model. J Neurochem. 63:972–979.
Kempton MJ, Haldane M, Jogia J, Christodoulou T, Powell J,
Collier D, Williams SC, Frangou S. 2009. The effects of gen-
der and COMT Val158Met polymorphism on fearful facial
affect recognition: a fMRI study. Neuropsychopharmacology.
12:371–381.
Kimura D. 1987. Are men’s and women’s brains really different?
Can Psychol. 28:133.
Kuppers E, Beyer C. 2001. Dopamine regulates brain-derived
neurotrophic factor (BDNF) expression in cultured embry-
onic mouse striatal cells. Neuroreport. 12:1175–1179.
Laird AR, McMillan KM, Lancaster JL, Kochunov P, Turkeltaub
PE, Pardo JV, Fox PT. 2005. A comparison of label-based
review and ALE meta-analysis in the Stroop task. Hum Brain
Mapp. 25:6–21.
Lang UE, Bajbouj M, Sander T, Gallinat J. 2007. Gender-
dependent association of the functional catechol-O-
methyltransferase Val158Met genotype with sensation seek-
ing personality trait. Neuropsychopharmacology. 32:
1950–1955.
Liu H, Qin W, Li W, Fan L, Wang J, Jiang T, Yu C. 2013.
Connectivity-based parcellation of the human frontal pole
with diffusion tensor imaging. J Neurosci. 33:6782–6790.
MacDonald AW3rd, Cohen JD, Stenger VA, Carter CS. 2000.
Dissociating the role of the dorsolateral prefrontal and
anterior cingulate cortex in cognitive control. Science. 288
(5472):1835–8.
MacLeod CM. 1991. Half a century of research on the Stroop
effect: an integrative review. Psychological Bullet. 109:
163–203.
Malhotra AK, Kestler LJ, Mazzanti C, Bates JA, Goldberg T,
Goldman D. 2002. A functional polymorphism in the COMT
gene and performance on a test of prefrontal cognition. Am
J Psychiatry. 159:652–654.
Mannisto PT, Kaakkola S. 1999. Catechol-O-methyltransferase
(COMT): biochemistry, molecular biology, pharmacology,
and clinical efficacy of the new selective COMT inhibitors.
Pharmacol Rev. 51:593–628.
Mead LA, Mayer AR, Bobholz JA, Woodley SJ, Cunningham JM,
Hammeke TA, Rao SM. 2002. Neural basis of the Stroop
interference task: response competition or selective atten-
tion? J Int Neuropsychol Soc. 8:735–742.
Mechelli A, Tognin S, McGuire PK, Prata D, Sartori G, Fusar-Poli
P, De Brito S, Hariri AR, Viding E. 2009. Genetic vulnerability
to affective psychopathology in childhood: a combined
voxel-based morphometry and functional magnetic reson-
ance imaging study. Biol Psychiatry. 66:231–237.
Nee DE, Wager TD, Jonides J. 2007. Interference resolution:
insights from a meta-analysis of neuroimaging tasks. Cogn
Affect Behav Neurosci. 7:1–17.
Nolan KA, Bilder RM, Lachman HM, Volavka J. 2004. Catechol O-
methyltransferase Val158Met polymorphism in schizophre-
nia: differential effects of Val and Met alleles on cognitive
stability and flexibility. Am J Psychiatry. 161:359–361.
O’Hara R, Miller E, Liao CP, Way N, Lin X, Hallmayer J. 2006.
COMT genotype, gender and cognition in community-
dwelling, older adults. Neurosci Lett. 409:205–209.
Ohnishi T, Hashimoto R, Mori T, Nemoto K, Moriguchi Y, Iida H,
Noguchi H, Nakabayashi T, Hori H, Ohmori M, et al. 2006.
The association between the Val158Met polymorphism of
Downloaded from http://cercor.oxfordjournals.org/ at Health Sciences Library, Stony Brook University on September 24, 2016
the catechol-O-methyl transferase gene and morphological
abnormalities of the brain in chronic schizophrenia. Brain.
129 (Pt 2):399–410.
Oldfield RC. 1971. The assessment and analysis of handedness:
the Edinburgh inventory. Neuropsychologia. 9:97–113.
Parker RI, Hagan-Burke S. 2007. Useful effect size interpreta-
tions for single case research. Behav Ther. 38:95–105.
Pezeshki Rad M, Momennezhad M, Naseri S, Nahidi M,
Mahmoudzadeh A, Aminzadeh B. 2014. Sexual differences
of human brain. Rev Clin Med. 1:51–56.
Preacher KJ, Hayes AF. 2008. Asymptotic and resampling strat-
egies for assessing and comparing indirect effects in mul-
tiple mediator models. Behav Res Methods. 40:879–891.
Qin S, Cousijn H, Rijpkema M, Luo J, Franke B, Hermans EJ,
Fernandez G. 2012. The effect of moderate acute psycho-
logical stress on working memory-related neural activity is
modulated by a genetic variation in catecholaminergic func-
tion in humans. Front Integr Neurosci. 6:16.
Rahm C, Liberg B, Wiberg-Kristoffersen M, Aspelin P, Msghina
M. 2013. Rostro-caudal and dorso-ventral gradients in med-
ial and lateral prefrontal cortex during cognitive control of
affective and cognitive interference. Scand J Psychol. 54:
66–71.
Rajapakse JC, Giedd JN, Rapoport JL. 1997. Statistical approach
to segmentation of single-channel cerebral MR images. IEEE
Trans Med Imaging. 16 (2):176–186.
Reuter M, Peters K, Schroeter K, Koebke W, Lenardon D, Bloch
B, Hennig J. 2005. The influence of the dopaminergic system
on cognitive functioning: a molecular genetic approach.
Behav Brain Res. 164:93–99.
Reuter M, Schmitz A, Corr P, Hennig J. 2006. Molecular genetics
support Gray’s personality theory: the interaction of COMT
and DRD2 polymorphisms predicts the behavioural
approach system. Int J Neuropsychopharmacol. 9:155–166.
Roberts KL, Hall DA. 2008. Examining a supramodal network
for conflict processing: a systematic review and novel
functional magnetic resonance imaging data for related
visual and auditory Stroop tasks. J Cogn Neurosci. 20:
1063–1078.
Rosa A, Peralta V, Cuesta MJ, Zarzuela A, Serrano F, Martínez-
Larrea A, Fañanás L. 2004. New evidence of association
between COMT gene and prefrontal neurocognitive function
in healthy individuals from sibling pairs discordant for
psychosis. Am J Psychiatry. 161:1110–1112.
Santiago M, Matarredona ER, Granero L, Cano J, Machado A.
2000. Neurotoxic relationship between dopamine and iron
in the striatal dopaminergic nerve terminals. Brain Res. 858:
26–32.
Seamans JK, Yang CR. 2004. The principal features and
mechanisms of dopamine modulation in the prefrontal cor-
tex. Prog Neurobiol. 74:1–58.
 COMT to Prefrontal Volume to Cognitive Control Pathway
Stuss D, Floden D, Alexander M, Levine B, Katz D. 2001. Stroop
performance in focal lesion patients: dissociation of pro-
cesses and frontal lobe lesion location. Neuropsychologia.
39:771–786.
Takeuchi H, Taki Y, Sassa Y, Hashizume H, Sekiguchi A, Nagase
T, Nouchi R, Fukushima A, Kawashima R. 2012. Regional
gray and white matter volume associated with Stroop inter-
ference: evidence from voxel-based morphometry.
Neuroimage. 59:2899–2907.
Taylor SF, Kornblum S, Lauber EJ, Minoshima S, Koeppe RA.
1997. Isolation of specific interference processing in the
Stroop task: PET activation studies. Neuroimage. 6:81–92.
Taylor WD, Zuchner S, Payne ME, Messer DF, Doty TJ, MacFall
JR, Beyer JL, Krishnan KR. 2007. The COMT Val158Met poly-
morphism and temporal lobe morphometry in healthy
adults. Psychiatry Res. 155:173–177.
Thompson PM, Cannon TD, Narr KL, Van Erp T, Poutanen V-P,
Huttunen M, Lönnqvist J, Standertskjöld-Nordenstam C-G,
Kaprio J, Khaledy M. 2001. Genetic influences on brain struc-
ture. Nat Neurosci. 4:1253–1258.
Thompson PM, Hayashi KM, Simon SL, Geaga JA, Hong MS, Sui
Y, Lee JY, Toga AW, Ling W, London ED. 2004. Structural
abnormalities in the brains of human subjects who use
methamphetamine. J Neurosci. 24:6028–6036.
Tian T, Qin W, Liu B, Wang D, Wang J, Jiang T, Yu C. 2013.
Catechol-O-methyltransferase Val158Met polymorphism
modulates gray matter volume and functional connectivity
of the default mode network. PLoS One. 8:e78697.
Tohka J, Zijdenbos A, Evans A. 2004. Fast and robust parameter
estimation for statistical partial volume models in brain
MRI. Neuroimage. 23:84–97.
Tunbridge EM, Harrison PJ. 2011. Importance of the COMT gene
for sex differences in brain function and predisposition to
psychiatric disorders. Curr Top Behav Neurosci. 8:119–140.
Xu et al. | 11
Watanabe K, Kakeda S, Yoshimura R, Ide S, Hayashi K, Katsuki
A, Umene-Nakano W, Watanabe R, Abe O, Korogi Y. 2015.
Genetic variation in the catechol-O-methyl transferase
Val108/158Met is linked to the caudate and posterior cingu-
late cortex volume in healthy subjects: voxel-based morph-
ometry analysis of brain magnetic resonance imaging. PLoS
One. 10 (11):e0142862.
White TP, Loth E, Rubia K, Krabbendam L, Whelan R,
Banaschewski T, Barker GJ, Bokde AL, Büchel C, Conrod P.
2014. Sex differences in COMT polymorphism effects on pre-
frontal inhibitory control in adolescence.
Neuropsychopharmacology. 39:2560–2569.
Williams GV, Goldman-Rakic PS. 1995. Modulation of memory
Downloaded from http://cercor.oxfordjournals.org/ at Health Sciences Library, Stony Brook University on September 24, 2016
fields by dopamine D1 receptors in prefrontal cortex.
Nature. 376:572–575.
Xie T, Ho SL, Ramsden D. 1999. Characterization and implica-
tions of estrogenic down-regulation of human catechol-O-
methyltransferase gene transcription. Mol Pharmacol. 56:
31–38.
Xu M, Moratalla R, Gold LH, Hiroi N, Koob GF, Graybiel AM,
Tonegawa S. 1994. Dopamine D1 receptor mutant mice are
deficient in striatal expression of dynorphin and in
dopamine-mediated behavioral responses. Cell. 79:729–742.
Yi P, Chen Z, Zhao Y, Guo J, Fu H, Zhou Y, Yu L, Li L. 2009. PCR/
LDR/capillary electrophoresis for detection of single‐nucleo-
tide differences between fetal and maternal DNA in mater-
nal plasma. Prenat Diagn. 29:217–222.
Zinkstok J, Schmitz N, van Amelsvoort T, de Win M, van den
Brink W, Baas F, Linszen D. 2006. The COMT val158met poly-
morphism and brain morphometry in healthy young adults.
Neurosci Lett. 405:34–39.
Zysset S, Müller K, Lohmann G, von Cramon DY. 2001. Color-
word matching Stroop task: separating interference and
response conflict. Neuroimage. 13:29–36.