Inhibition Mechanisms of HSV-1 via Au-NPs through Activation of

Ras/Raf/MEK/ERK pathway.

Abstract

The inhibition mechanism of gold nanoparticles against HSV-1 was unclear. Then, in the
present study, we investigated the molecular inhibition performance of Au-NPs against
HSV-1 through the Ras/Raf/MEK/ERK and transcription factor NF-κB pathways. We
synthesized the gold nanoparticle by the modified Turkevich method and tested the
antiviral activity of HSV-1 throughout three technique assays such as plaque reduction,
attachment, and Penetration as compared with acyclovir drugs as a standard medication
for Herpes simplex viruses. And evaluation: the ability of Au-NPs to halt and restrict
HSV-1 was determined by one-step growth. The molecular mechanism of suppression of
herpes simplex virus was determined by studying NF-κB and Ras/Raf/MEK/ERK using
RT-PCR and western blot techniques. The data indicated that Au-NPs have a strong
effect on suppressing and triggering HSV-1 activity. The Au-NPs suppressed and
decreased the level of NF-κB and restored and activated the function of
Ras/Raf/MEK/ERK after infection with HSV-1. The current study focused in-depth on
the infection machinery mechanism of HSV-1 suppression by gold nanoparticles.

Introduction
Herpes simplex virus 1 (HSV-1) belongs to the Alphaherpesvirinae subfamily. It is a
double-stranded DNA that causes several symptoms, including cold sores, keratitis,
meningitis, and encephalitis [1–2]. Although penciclovir (PCV) and acyclovir (ACV) are
currently the standard therapy for HSV infections and reactivation [3], their long-term
use has led to resistant HSV strains. Hence, due to the side effects associated with long-
term use of Acyclovir, such as nephrotoxicity, and the appearance of new ACV-resistant
strains [4–5], Importantly, the need for selection chemotherapy to suppress and inhibit the
viral replication cycle without harmful effects on the host. Importantly, noble metal
nanomaterials have potential antiviral activity against DNA and RNA viruses such as the
human parainfluenza virus [6], the H7N3 influenza virus [7], the human norovirus [8],
and the hepatitis C virus [9]. Gold nanoparticles have a great deal of interest in medical
science due to their unique properties. Gold nanoparticles are frequently used as
anticancer, antibacterial, and antiviral agents [10]. Au-NPs inhibit influenza virus, HSV,
and HIV and potentially increase antiviral effects via multivalent interactions;
dendronized AuNPs inhibit HIV more effectively than dendrons alone [11]. Herpes virus
infection changes several signaling pathways; one of the viral molecules that can induce
these are known as pathogen-associated molecular patterns (PAMPs). The detection of
PAMPs has been mediated by sentinel receptors such as toll-like receptors (TLRs). It also
induces the activation of NF-κB and IRF for initiating innate immune responses [12]. NF-
κB is considered the main signaling pathway activated by HSV infection. Moreover,
HSV infections downregulate and suppress ERK signaling pathways throughout
tegument proteins or lytic proteins [13].

Gold nanoparticle synthesis and characterization

Gold nanoparticles were synthesized. According to the Turkevich method, with some
modification [14] The prepared Au-NPs were characterized by UV-vis absorption
spectroscopy (Evolution 300 UV-Vis Spectrophotometer, Thermo Scientific, USA),
transmission electron microscopy (TEM, JSM-2100F, JEOL Inc., Tokyo, Japan) with a
voltage of 15 Kv and 200 KeV, dynamic light scattering (DLS), and zeta potential
measurements (Zetasizer Nano-ZS, Malvern Instruments, UK). The average diameter of
each type of prepared AuNP was calculated from TEM images using ImageJ software.
The concentration and purity of Au-NPs were estimated by using inductively coupled
plasma mass spectrometry (ICP-MS) (Perkin-Elmer, USA) according to Herner J.D. et
al., 2006 protocol [15]. Cell viability of Au-NPs was evaluated by MTT assay, Green
African kidney cell lines (VERO) were seeded in 96-well culture plates with a density of
8x104 cells per well in minimal essential medium (MEM) containing 10% heat-
inactivated fetal calf serum (FCS), 100 U/ml penicillin, and 100 mg/ml streptomycin.

Cell viability assay

Vero cells were obtained  from ATCC (American Type Culture Collection) (clone CCL-
81), incubated at 37 °C with 5% CO2 overnight. Then, cells were washed twice with PBS.
MEM containing different concentrations of Au NPs (2.5, 5, 10, and 25 μg/ml) was added
to the cell, and then incubated further for 48 h at 37 0C and 5% CO 2. After incubation,
the medium was removed, 100 μL of MTT reagent (MTT (3-(4,5- Dimethylthiazol-2-yl)-
2,5-Diphenyltetrazolium bromide) was added, and the plates were incubated again at 37
°C for 4 h. After incubation, the MTT was completely removed, 100 μL of dimethyl
sulfoxide (DMSO) was added, the plates were gently shaken, and readings were taken at
570 nm in an ELISA reader (BioTek, USA) [16].
Plaque reduction assay
The inhibitory effects of Au-NPs against HSV-1 were evaluated by the plaque reduction
assay. Vero cells (2 × 105 cells/well), seeded and cultivated for 24 hours. The cells were
washed with phosphate-buffered saline (PBS). Fifty plaque-forming units (PFU) of HSV-
1 were inoculated in 0.1 ml of DMEM without FBS from Vero cells. After one hour of
inoculation, the inoculation was removed and remedied with DMEM containing 10%
FCS, 1% methylcellulose, serially diluted Au-NPs (5, 10, 15, 20 μM) and 10 μM ACV as
a positive control. The medium was eliminated after two days of incubation at 37 °C. The
cells plated were stained with 1% crystal violet in 50% methanol. Then, plaques were
counted on treated and untreated plates, and the percentage reduction was calculated by
the following formula:
Inhibition % =viral count (untreated)-viral count (treated) /viral count (untreated)
%100

Attachment assay
The assay was performed by cultivating Vero cells in 12-well culture plates at 4 °C for 5
min and infecting them with 200 PFU/well of HSV-1 in the presence of Au-NPs at 4 °C
for one hour. The medium was discharged, and the cell was washed three times with PBS
to remove unabsorbed virus. Then, an addition medium involving 1% methylcellulose
without drugs was overlaid on the cell monolayer, and cells were cultured for 48 hours.
Cells were stained with 1% crystal violet, and the total number of plaques was counted.

Penetration assay
Vero cells were cultured in 12 culture plates at 4 °C for 5 min and infected with 100
PFU/well of HSV-1 for half hour at 4 °C. Then, discarding the virus and washing cells,
cells were incubated with Au-NPs for half hour at 37 °C to allow penetration. Followed
by washing with citrate buffer at pH 3.0 to remove cell surface viruses, and the cell
monolayer was washed with PBS two times. Then, an addition medium involving 1%
methylcellulose without drugs was overlaid on the cell monolayer, and cells were
cultured for 48 hours. Cells were stained with 1% crystal violet, and the total number of
plaques was counted.
One-step growth curve
The investigation viral replication cycle was determined by infection of HepG2 with HF
strain (1 PFU/cell) for 30 min, then washing with culture media three times. HepG2 will
be maintained in DMEM containing 10% FBS supplemented with 15 μg Au-NPs and
10μM ACV. The culture media were harvested at 0, 6, 12, and 24 hours postinfection and
stored at −80 C. The quantification of virus production in the culture medium was
evaluated by a plaque reduction assay.
Real-time PCR (qRT-PCR)
Green African kidney cells (Vero) were cultured in six-well plates and exposed to Au
NPs with different concentrations. Cells were infected with HSV-1 at a multiplicity of
infection (MOI) of 1 for 30 min and subsequently cultured in the presence (or absence) of
Au-NPs for 24 hours. After treatment, total RNAs were extracted from treated cells using
the RNeasy Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s
instructions (26). The concentrations of extracted RNAs were determined using a
Beckman dual spectrophotometer (USA). For quantitative expression of NF -κB genes,
the following procedure was used: 10 ng of the total RNA from each sample were used
for cDNA synthesis by reverse transcription using the High Capacity cDNA Reverse
Transcriptase kit (Applied Biosystems, USA). The cDNA was subsequently amplified
with the Syber Green I PCR Master Kit (Fermentas) in a 48-well plate using the Step One
instrument (Applied Biosystems, USA), as follows: 10 min at 95 ºC for enzyme
activation, followed by 40 cycles of 15 sec at a temperature of 95ºC, 20 sec at 55 0C and
30 sec at 720C for the amplification step. Changes in the expression of each target gene
were normalized relative to the mean critical threshold (CT) values of β-actin as the
housekeeping gene by the ΔCt method. We used 1 μl of both primers, specific for each
target gene [15].
Table 1. Primers used in quantitative RT-PCR (qRT-PCR).

Primer Sequence (5'-3')

Raf-1 F: TTTCCTGGATCATGTTCCCCT

R: GCAATCTGCATACACCAGTTC

ERK1 F: CCTGCGACCTTAAGATTTGTGATT

R: CAGGGAAGATGGGCCGGTTAGAGA
 MEK1 F: GACCTGCGTGCTAGAACCTC

R: TCTGGACGCTTGTAGCAGAG

NF-kB1 F: GAAATTCCTGATCCAGACAAAAAC

R: ATCACTTCAATGGCCTCTGTGTAG

GAPDH F: TGGCATTGTGGAAGGGCTCA

R: TGGATGCAGGGATGATGTTCT

Immunoblotting analysis
The investigation the protein level of phospho-c-Raf, phospho -Mek1/2, phosphor- ERK
1 and NF-κB was occurred using western blot analysis. Cells were seeded at 4 × 105 cells
per well in a 6-well plate and cultivated for 12 hours. Cells were infected with HSV-1 at a
multiplicity of infection (MOI) of 1 for 30 min and subsequently cultured in the presence
(or absence) of Au-NPs for 24 hours. Cells were lysed by 300 μl of 4x SDS-PAGE
sample buffer (containing 4% 2-mercaptoethanol, 0.5 mM phenylmethylsulfonyl
fluoride, 1 μg/ml pepstatin and 5 μg/ml aprotinin), boiled for 5 min, and sonicated for 30
sec with a probe type sonicator in order to shear the chromosomal DNA. The resulting
lysate was subjected to SDS-PAGE on 8 or 12% polyacrylamide gel followed by Western
blotting. The proteins were transferred onto Millipore, MA, USA) using Bio-Rad
electroblotting system (Bio- Rad Mini Trans-Blot Electrophoretic Transfer Cell) for 3 hrs
at 250 mA at 4°C. The membrane was incubated with 3% non-fat dry milk in PBS
containing 0.1% Tween-20 (PBS-T) for 1 h at room temperature. Then the membranes
were individually incubated overnight at 4°C with Primary antibodies were phospho-c-
Raf, (1-500), phospho-ERK1/2 (1:1500) dilution, phospho-MEK1/2 (1-1000) and NF-κB
(1:1500 dilution, BD Biosciences, NJ, USA) diluted in the blocking buffer. The
membranes were then carefully washed using Western Breeze solution 16x (Invitrogen,
USA) followed by 2 hrs incubation with mouse monoclonal anti- β-actin (Sigma,
Hamburg, Germany). Finally, the membranes were washed and incubated for 1 h at room
temperature with either anti-mouse or antirabbitready-to use 2° Solution Alkaline-
Phosphates (AP) Conjugated (Invitrogen, USA) [16].
Statistical analysis
The statistical analysis of all experiments is expressed as the mean ± standard deviation
of triplicate independent experiments. Two-sample comparisons of means were carried
out using Tukey's multiple range test. The statistical analysis was performed using SPSS
17.0 software (SPSS Inc., Chicago, IL, USA). P <0.05 was considered a
statistically ]significant difference[ 17].

Results
As shown in Fig. 1A, the UV-visible spectrum exhibits a sharp rise in absorbance at a
wavelength of 525 nm, which identifies the Au-NPs. As Figs. 1B and C display, the
average hydrodynamic size of Au-NPs in cell culture media determined by DLS was 10
nm with a PDI of 0.340, which means the Au-NPs do not aggregate. Zeta potential was
estimated at +8 mV. Transmission Electron Microscopy (TEM) techniques used both
indicate that the morphology and shape of nanoparticle are coherent with a sphere of size
ca. 10–15 nm, as Fig. 1D revealed. The ICPS data revealed that the purity of AuNPs was
99.98 ± 0.21% and the concentration of AuNPs was 50.10± 1.559 μg/ml. Cytotoxicity
analysis of Au nanoparticles at 2.5, 5, 10, 15, 20, 25, and 50 μg showed 97.15 %,94.30
%, 87.20 %, 84.38%, 65.28 %, 52.18%, and 22.18 % cell viability, respectively, as table
1 mentioned. Hence, Au nanoparticles were found to be nontoxic to Vero cells at the four
different concentrations tested.
Table 1. Cytotoxicity dose of gold nanoparticles on Vero cells.

Au nanoparticles treated (μg) Cell viability %

Control 100 ± 0.00

2.5 µg 97.15 ± 1.1

5 µg 94.30 ± 1.5

10 µg 87.20 ± 1.3
 15 µg 84.38± 1.4

20 µg 65.28± 2.4

25 µg 52.18± 1.4

50 µg 22.18± 1.4

In vitro antiviral activity of Au NPs

Gold nanoparticles have been studied against many RNA viruses, such as Influenza A
and HIV. As Figs. 2 a and b showed, Au-NPs nanoparticles were able to reduce the
progeny virus (virus HSV-1). titer after infection of Vero cells to be 3.7 log of magnitude,
which is equivalent to 90%. when 2.5μg of the gold nanoparticle was used. Higher
reduction in virus by more than 2.5 as concentration of gold nanoparticle increased to 10
and 15 μg, the reduction of virus titer increased to 2.0 and 1.5, respectively, which is
equivalent to 41% and 22 % respectively. Similarly, gold nanoparticles at concentrations
of 10 and 15 μg were effective on the attachment of HSV1 to the receptors; the
equivalent was 45 and 23%, respectively, ,as compared to heparin's 16 % as Figs. 3 and d
display. In contrast, Au-NPs nanoparticles had a weak effect on the penetration of HSV-
1. As figure 4 revealed. As figure 5 displays, the data show that the gold nanoparticle (15
μg) reduced the amount of infectious virions released from HepG2 cells by 70% after 24
hours and 90% after 48 hours postinfection as compared with ACV, which reduced the
amount of infectious virions released from HepG2 cells by 40% after 24 hours and 90%
after 48 hours postinfection.

RT –PCR assay
Herpes simplex virus 1 deactivated the RAF-1 gene and downregulated gene expression
after infecting the cell. As a gold nanoparticle treatment with increasing concentrations,
Herpes simplex virus deactivates the RAF-1 magnitude as compared to the negative
control (uninfected control), while Herpes simplex virus treated with gold nanoparticles
reactivates the RAF-1 magnitude as compared to the infected control. The activity of raf-
1 increased from 0.3 pg/ml at 2.5 μg of Au-NPs to 0.86 pg/ml at 20 μg of Au-NPs, as
figure 6 displays. Similarly, Herpes simplex virus treated with gold nanoparticles
reactivates the Mek magnitude as compared to an infected control. It increased the Mek
magnitude from 0.37 pg/ml at 2.5 μg of Au-NPs to 0.92 pg/ml at 20 μg of Au-NPs , as
figure 7 showed. Herpes simplex virus treated with gold nanoparticles reactivates the
Erk-1 magnitude as compared to infected control. The magnitude of Erk-1 increased from
0.36 pg/ml at 2.5 μg of Au-NPs to 0.89 pg/ml at 20 μg of Au-NPs Figure 8.  In contrast,
the NF-κB results demonstrated that was downregulated as gold nanoparticle
concentrations increased as compared to infected cell with HSV-1. As figure 9 revealed,
the Herpes Simplex virus activates the NF-κB magnitude as compared to the negative
control (uninfected control). The magnitude of NF-κB was down from 0.82 pg/ml at 2.5
μg of Au-NPs to 0.20 pg/ml at 15 μg of Au-NPs.

The Activation of Raf/MEK/ERK pathway by Au-NPS

The efficiency of gold nanoparticles to suppress the replication of herpes simplex virus
Strains generated by reactivation of the Raf/MEK/ERK pathway with a trigger of the NF-
κB pathway were investigated by western blotting and confirmed. The results displayed
that as the p-C-Raf-1, P-ERK, and P-MEK activated, Au-NPs increased. Figure 10
revealed the efficiency of gold nanoparticles to repair the Raf/MEK/ERK machinery
activation mechanism, leading to inhibition of HSV-1 virus infection. In contrast, the
gold nanoparticles inhibit NF-κB activity, while HSV-1 activates it.

Discussion
Herpes virus infections cause other diseases involving retinitis and, meningitis [18]. The
potential pharmacology of gold nanoparticles has been recognized for the last two
decades. The functional gold nanoparticle may be able to prevent virus attachment and
entry. Another factor that affects the efficiency of gold nanoparticles is their size. Our
results demonstrated that gold nanoparticles have an effective antiviral performance
against HSV-1. Also, gold nanoparticles suppressed the viral cycle as compared with
acyclovir. Scientists focus on the internal pathway response of the cell infection process.
The mechanism is based on the number of intracellular signaling pathways for RNA and
DNA viruses’ replication [19-20].Previous reports mentioned the suppression of ERK1/2
signaling due to HSV-1 infection in host cells. This is because of the induction of
proteasomal degradation of Ras-GRF2, which is considered an ERK signaling mediator.
Moreover, ERK restriction facilitated viral replication, while NF-κB inhibition did not
affect viral replication. Activation of ERK signaling by Au-NPs strongly contributed to a
reduction in virus yields [21]. According to Ian Mohr and colleagues, ERK
dephosphorylation was detectable at 9 hpi (MOI of 5) and depended on viral gene
expression. Also, Ian Mohr determined that ERK dephosphorylation in growth arrests
normal human dermal fibroblast cells by serum deprivation [22]. Similarly, Colao et al.
showed that HSV-1 infection in HEp-2 cells increased cytoplasmic phospho-ERK1/2 at
0.25–0.5 hpi to 2- to 1.4-fold compared to those of mock infection, whereas cytoplasmic
phospho-ERK1/2 decreased to 10% after 24 hpi [23]. The activation of Ras-inducing
proteins mediates the phosphorylation of Ser 338 of c-Raf, which activates MEK1/2 via
the phosphorylation of Ser217/Ser221. Also, MEK1/2 activates Thr202/Tyr204
phosphorylation, leading to activation of ERK1/2, which phosphorylates abundant
substrates, including p90RSK [24-25].Our results indicated that the gold nanoparticle
elevated the phosphorylation of c-Raf, MEK, and ERK ½ after infection with HSV-1 and
was remedied with various concentrations of Au-NPs. Herpes simplex virus type 1 can
activate nuclear factor kappa B after infection; the activation of nuclear factor kappa B is
independent of virus entry or viral protein expression. After infection, viral protein
expression was triggered by viral structural proteins such as the UL37 tegument protein
and their interactions with specific receptors. Moreover, NF-κB activation needs the de
novo expression of viral proteins [26]. Our data mention that gold nanoparticles
decreased the level of transcription factor NF-kB which increased after infection with
HSV-1 [27–28]. Previous articles documented the activity of gold nanoparticles as an
angiogenic agent. The gold nanoparticles have an inhibitory effect against inflammation
by suppressing inflammatory mediators such as NF-kB and iNOS and inhibiting the
induction of pro-inflammatory cytokines [29]. Furthermore, the gold nanoparticles
restricted the production of inflammatory cytokines via suppression of NF-kB by
reducing Ikb phosphorylation [30].
Conclusion

The current work presents the investigation of gold nanoparticles against Herpes simplex
virus, including the study of the effective molecular mechanism that suppresses the
infection machinery mechanism of Herpes simplex type 1. Our data displayed that gold
nanoparticles were prepared with an absorbance of 525 nm and a particle size of ca. 10–
15 nm by TEM. DLS was 10 nm with PDI equal to 0.340, which indicated that Au-NPs
were not aggregated. Zeta potential was estimated at +8 mV, which indicated that Au-
NPs neutralized virus receptors. ICPS determined the concentration and purity of Au-NPs
at 50μM and 99.98 % respectively. MTT assay confirmed that Au-NPs was not toxic at
concentrations of 15 μg. The antiviral activity of Au-NPs reduced the virus titer to less
than 20% as compared with acyclovir as a standard drug for HSV-1. Gold nanoparticles
restricted the viral replication cycle after 24 hours to 40 percent as compared with
acyclovir. The Au-NPs were maintained by HSV-1 mediated suppression of the ERK
signaling pathway, and Au-NP concentrations were elevated. Interestingly, Au-NPs
triggered and restricted the transcription factor nuclear factor-kappa B (NF-κB) pathway
as concentrations of Au-NPs increased. In summary, this study clarified the inhibition
mechanism of Au-NPs on the DNA virus.

Conflict of Interest Statement:

On behalf of all authors, the corresponding author states that there is no conflict of
interest.

Data Availability Statement

The data presented in this study are available.

Author contributions:
Conceptualization: Amr Hassan; Formal analysis: Amr Hassan; funding : acquisition:
Fawziah A. Al-Salmi, Muneera A. Saleh, Fuad A. Alatawi, Muneefah Abdullah Alenezi,
Eman M. Sharaf, and Amr Hassan ; Investigation: Amr Hassan, and Eman M. Sharaf;
Methodology: jean-Marc Sabatier and Hervé kovacic : Project administration: Eman M.
Sharaf,; Resource: Eman M. Sharaf; Supervision: Amr Hassan , Jean-Marc Sabatier
Eman M. Sharaf ; Validation: Amr Hassan and Eman M. Sharaf; Visualization: Amr
Hassan, Hervé kovacic, Jean-Marc Sabatier ; Writing original draft: Amr Writing -review
edition: Amr Hassan ,. All author approved the final version of the Manuscript
Author Information

Corresponding Authors

Amr Hassan - Department of Bioinformatics, Genetic Engineering and Biotechnology

Research Institute (GEBRI), University of Sadat City, Sadat, Egypt; Email:
amrhassan.nanotechnology@gmail.com

Authors

Amr Hassan - Department of Bioinformatics, Genetic Engineering and Biotechnology

Research Institute (GEBRI), University of Sadat City, Sadat, Egypt; Email:
amrhassan.nanotechnology@gmail.com

Fawziah A. AL-Salmi- Department of Biology, Faculty of Sciences, Taif University,

Taif, Saudi Arabia ; Email: f.alsalmi@tu.edu.sa
Muneera A. Saleh- - Department of Biology, Faculty of Sciences, Taif University, Taif,
Saudi Arabia ; Email: m.abdoo@tu.edu.sa
Jean-Marc Sabatier-Institute de Neurophysiopathologie (INP), Aix-Marseille Université,
13005 Marseille, France; Email: sabatier.jm1@gmail.com
Hervé kovacic-Institute de Neurophysiopathologie (INP), Aix-Marseille Université,
13005 Marseille, France; Email: herve.kovacic@univ-amu.fr
Fuad A. Alatawi-Department of Biology, Faculty of Science, Tabuk University, Saudi
Arabia; Email: falatawi@ut.edu.sa
Muneefah A. Alenezi -Department of Biology, Faculty of Science, Tabuk University,
Saudi Arabia ; Email: makalenezi@ut.edu.sa
Fauzeya M. Albalwe - Department of Biology, Faculty of Science, Tabuk University,
Saudi Arabia ; Email: albalwe@ut.edu.sa
Hessa Meteq R. Albalawi- Department of Pharmacy, Prince Sultan Armed Forces
Hospital, Medina, Saudi Arabia; Email: hessa.m.albalawi@gmail.com
 Doaa Bahaa Eldin Darwish- Department of Biology, Faculty of Science, Tabuk
University, Saudi Arabia; Botany Department, Faculty of science, Mansoura University,
Egypt; Email: d-darwish@mans.edu.eg
Eman M. Sharaf- Department of Bacteriology, Immunology, and Mycology, Animal
Health Research Institute (AHRI), Shebin El Kom, Egypt; Email:
dr_emansharaf@yahoo.com
Aly F. Mohamed- Holding Company for vaccine and Sera production (VACSERA),
Giza, Egypt Email: fahmy.aly@gmail.com

References:

1. Eisenstein, Lawrence E.; Calio, Anthony J.; Cunha, Burke A. Herpes simplex (HSV-

1) aseptic meningitis. Heart & lung, 2004, 33.3: 196-197.

2. Koelle, David M.; Corey, Lawrence. Herpes simplex: insights on pathogenesis and
possible vaccines. Annu. Rev. Med., 2008, 59: 381-395.
3. FIeld, Hugh J.; Biswas, Subhajit. Antiviral drug resistance and helicase–primase
inhibitors of herpes simplex virus. Drug Resistance Updates, 2011, 14.1: 45-51.4.
4. Andrei, Graciela; Snoeck, Robert. Herpes simplex virus drug-resistance: new
mutations and insights. Current opinion in infectious diseases, 2013, 26.6: 551-560.
5. De Clercq, Erik; Li, Guangdi. Approved antiviral drugs over the past 50
years. Clinical microbiology reviews, 2016, 29.3: 695-747.
6. Fatima, Munazza, et al. In vitro antiviral activity of Cinnamomum cassia and its
nanoparticles against H7N3 influenza a virus. Journal of Microbiology and
Biotechnology, 2016, 26.1: 151-159.7.
7. Broglie, Jessica Jenkins, et al. Antiviral activity of gold/copper sulfide core/shell
nanoparticles against human norovirus virus-like particles. PloS one, 2015, 10.10:
e0141050.
8. Hang, Xiaofeng, et al. Antiviral activity of cuprous oxide nanoparticles against
Hepatitis C Virus in vitro. Journal of virological methods, 2015, 222: 150-157.
9. Gupta, Akash, et al. Ultrastable and biofunctionalizable gold nanoparticles. ACS
applied materials & interfaces, 2016, 8.22: 14096-14101.
10. Andresen, Heiko, et al. Single-step homogeneous immunoassays utilizing epitope-
tagged gold nanoparticles: on the mechanism, feasibility, and limitations. Chemistry of
Materials, 2014, 26.16: 4696-4704.
11. Cai, Mingsheng, et al. The herpes simplex virus 1-encoded envelope glycoprotein B
activates NF-κB through the Toll-like receptor 2 and MyD88/TRAF6-dependent
signaling pathway. PloS one, 2013, 8.1: e54586.
12 . Qin, Di, et al. Activation of PI3K/AKT and ERK MAPK signal pathways is required
for the induction of lytic cycle replication of Kaposi's sarcoma-associated herpesvirus by
herpes simplex virus type 1. BMC microbiology, 2011, 11: 1-10.
13.Laing, Jennifer M.; Smith, Cynthia C.; Aurelian, Laure. Multi‐targeted
neuroprotection by the HSV‐2 gene ICP10PK includes robust bystander activity through
PI3‐K/Akt and/or MEK/ERK‐dependent neuronal release of vascular endothelial growth
factor and fractalkine. Journal of neurochemistry, 2010, 112.3: 662-676.
14. Dong, Jiaqi, et al. Synthesis of precision gold nanoparticles using Turkevich
method. KONA Powder and Particle Journal, 2020, 37: 224-232.
15. Hassan, Amr, et al. Inhibition Mechanism of Methicillin-Resistant Staphylococcus
aureus by Zinc Oxide Nanorods via Suppresses Penicillin-Binding Protein 2a. ACS
omega, 2023, 8.11: 9969-9977.
16. Hassan, Amr, et al. Ultrastructural analysis of zinc oxide nanospheres enhances anti-
tumor efficacy against Hepatoma. Frontiers in oncology, 2022, 12.
17. SharaF, Eman M., et al. Synergistic antibacterial activity of compact silver/magnetite
core-shell nanoparticles core shell against Gram-negative foodborne
pathogens. Frontiers in Microbiology, 2022, 13.

18. Herner, Jorn D.; Green, Peter G.; Kleeman, Michael J. Measuring the trace
elemental composition of size-resolved airborne particles. Environmental science
& technology, 2006, 40.6: 1925-1933.
19. Gurunathan, Sangiliyandi, et al. Antiviral potential of nanoparticles—can
nanoparticles fight against coronaviruses?. Nanomaterials, 2020, 10.9: 1645.
20. Orlowski, Piotr, et al. Tannic acid modified silver nanoparticles show antiviral
activity in herpes simplex virus type 2 infection. PloS one, 2014, 9.8: e104113.
21. Walsh, Derek; Mohr, Ian. Phosphorylation of eIF4E by Mnk-1 enhances HSV-1
translation and replication in quiescent cells. Genes & development, 2004, 18.6:
660-672.

22. Schneider, Seth M., et al. Early steps in herpes simplex virus infection blocked by
a proteasome inhibitor. MBio, 2019, 10.3: e00732-19.

23. Colao, Ivana, et al. The ERK-1 function is required for HSV-1-mediated G1/S
progression in HEP-2 cells and contributes to virus growth. Scientific Reports,
2017, 7.1: 9176.
24. Roberts, Patrick J.; Der, Channing J. Targeting the Raf-MEK-ERK mitogen-
activated protein kinase cascade for the treatment of cancer. Oncogene, 2007,
26.22: 3291-3310.
25. Ishimaru, Hanako, et al. MG132 exerts anti-viral activity against HSV-1 by
overcoming virus-mediated suppression of the ERK signaling pathway. Scientific
Reports, 2020, 10.1: 1-17.
26. Ludwig, Stephan; Planz, Oliver. Influenza viruses and the NF-κB signaling
pathway–towards a novel concept of antiviral therapy. 2008.
27. Dushane, Jeanne K.; Maginnis, Melissa S. Human DNA virus exploitation of the
MAPK-ERK cascade. International Journal of Molecular Sciences, 2019, 20.14:
3427.
28. Marino-Merlo, Francesca, et al. HSV-1-induced activation of NF-κB protects
U937 monocytic cells against both virus replication and apoptosis. Cell Death &
Disease, 2016, 7.9: e2354-e2354.
29. Sun, You, et al. Beneficial effect of 20-hydroxyecdysone exerted by modulating
antioxidants and inflammatory cytokine levels in collagen-induced arthritis: A
model for rheumatoid arthritis. Molecular medicine reports, 2017, 16.5: 6162-
6169.
30. Khan, Mahmood Ahmad; Khan, Mohd Jahir. Nano-gold displayed anti-
inflammatory property via NF-kB pathways by suppressing COX-2
activity. Artificial Cells, Nanomedicine, and Biotechnology, 2018, 46.sup1: 1149-
1158.
List of figures:
Figure 1: Characterization of gold nanoparticles
a) UV-visible spectrum of Au-NPs.
b) DLS of Au-NPs.
c) Zeta potential of Au- NPs.
d) TEM of Au- NPs.
Figure 2: a) Reduction assay virus titer with log10.
b) Reduction assay virus titer with percentage.
Figure 3: Attachment assay of Au-NPs against HSV-1.
Figure 4: Penetration assay of Au-NPs against HSV-1.
Figure 5: Analysis of viral replication cycle by one-step growth curve one step graph.
Figure 6: Rt-PCR of Raf-1 of HSV-1 treatment with Au-NPs.
Significantly different from control (p<.05); #significantly different from infected group
(p<.05). Data are expressed as mean ± SD (n=6) and analyzed by one-way ANOVA
followed by Tukey's multiple range test

Figure 7: Rt-PCR of Mek of HSV-1 treatment with Au-NPs.

Significantly different from control (p<.05); #significantly different from infected group
(p<.05). Data are expressed as mean ± SD (n=6) and analyzed by one-way ANOVA
followed by Tukey's multiple range test

Figure 8: Rt-PCR of ERK-1 of HSV-1 treatment with Au-NPs.

Significantly different from control (p<.05); #significantly different from infected group
(p<.05). Data are expressed as mean ± SD (n=6) and analyzed by one-way ANOVA
followed by Tukey's multiple range test

Figure 9: Rt-PCR of NF-κB of HSV-1 treatment with Au-NPs.

Significantly different from control (p<.05); #significantly different from infected group
(p<.05). Data are expressed as mean ± SD (n=6) and analyzed by one-way ANOVA
followed by Tukey's multiple range test

Figure 10: Immunoblotting of HSV-1 treatment with Au-NPs.

Table of Contents graphic
Synopsis: Au-NPs inhibiting HSV-1 by Activation of Ras/Raf/MEK/ERK pathway.

Previous articles documented that the activity of gold nanoparticles as an ntiangiogenic

agent. The gold nanoparticles has inhibit effect against inflammatory throughout
suppressing inflammatory mediators such as NF-kB, iNOS and inhibited the induction of
pro-inflammatory cytokines [ ]. Furthermore, the gold nanoparticles restricted the
production of inflammatory cytokines via suppression of NF-kB by reduction in Ikb
phosphorylation [ ]

Sun Y, Zhao DL, Liu ZX, et al. Beneficial effect of 20-hydroxyecdysone exerted by
modulating antioxidants and inflammatory cytokine levels in collagen-induced arthritis: a
model for rheumatoid arthritis. Mol Med Rep. 2017;16:6162–6169

Mahmood Ahmad Khan & Mohd Jahir Khan (2018) Nano-gold displayed anti-
inflammatory property via NF-kB pathways by suppressing COX-2 activity, Artificial
Cells, Nanomedicine, and Biotechnology, 46:sup1, 1149-1158, DOI:
10.1080/21691401.2018.1446968