Talanta 233 (2021) 122546

Contents lists available at ScienceDirect

Talanta
journal homepage: www.elsevier.com/locate/talanta

Electrochemiluminescence aptasensor for lincomycin antigen detection by

using a SnO2/chitosan/g-C3N4 nanocomposite
Xing-Pei Liu, Bo Huang, Chang-Jie Mao *, Jing-Shuai Chen, Bao-Kang Jin
Key Laboratory of Structure and Functional Regulation of Hybrid Materials (Ministry of Education), Key Laboratory of Chemistry for Inorganic/Organic Hybrid
Functionalized Materials of Anhui Province, Key Laboratory of Functional Inorganic Materials of Anhui Province, School of Chemistry & Chemical Engineering, Anhui
University, Hefei, 230601, PR China

A R T I C L E I N F O A B S T R A C T

Keywords: In this paper, hydrothermal method was used for the synthesis of SnO2 quantum dots (QDs). The prepared SnO2
Aptasensor QDs have a uniform particle size distribution and good electrochemiluminescence (ECL) property. Then the
Electrochemiluminescence prepared SnO2 QDs was combined with graphene-like carbon nitride (g-C3N4) through chitosan to form SnO2/
Lincomycin
chitosan/g-C3N4 nanocomposite and used for detecting the lincomycin. The characteristics of SnO2/chitosan/g-
Energy transfer
C3N4 nanocomposite were presented by transmission electron microscopy (TEM), X-ray diffraction (XRD) and
energy dispersive spectroscopy (EDS), and the analytical results proving that the nanocomposite was prepared
successfully. In this strategy, the SnO2/chitosan/g-C3N4 nanocomposite was acted as the substrate of aptasensor.
Then, SH-DNA (aptamer DNA) was assembled on the surface of electrode, after 6-mercaptohexanol (MCH)
blocked the unbound sites of the electrode surface, ferrocene-DNA (Fc-DNA) was incubated on the electrode
surface through base complementation with aptamer DNA. In the absence of lincomycin, due to the low con­
ductivity of Fc-DNA and the photo-excited energy electron transfer, the ECL signal was quenched. In the presence
of lincomycin, the aptamer DNA was specific binding with lincomycin, and ferrocene-DNA (Fc-DNA) was de­
tached from the surface of aptasensor electrode, generating an obviously enhancement of ECL signal. To ensure
the accuracy of the data, each electrode runs continuously for 3600 s. Under optimal experimental conditions,
the detection range of the aptasensor was 0.10 ng mL− 1 - 0.10 mg mL− 1, and the detection limit was 0.028 ng
mL− 1. In addition, the aptasensor has good stability and reproducibility, and also provided a hopeful device for
all kinds of other protein target.

1. Introduction standard analytical techniques in many countries, most of them are

Lincomycin is an antibiotic against bacteria, which mainly inhibits
the synthesis of bacterial cell proteins, and has remarkable effect on
anaerobic bacteria, staphylococcus aureus and pneumococcus. Up to
now, lincomycin has been extensively used in feed and animal products
industry, which has led to concern that foods derived from animals
could be contaminated with antibiotics, and this has become a solemn
public health problem around the world [1–3]. Therefore, it is essential
to detect and monitor residual lincomycin in dairy products and meat
foods. At present, many classic methods have been developed for ana­
lysing and detecting lincomycin, such as: high performance liquid
chromatography (HPLC) [4], electrochemistry [5], microbiological
assay [6], fluorescence [7]. Although these methods are relatively ac­
curate in the determination of lincomycin and have been used as
limited because of their expensive instruments, time consuming, com­
plex practical operation and low sensitivity. Therefore, a simple and
efficient method is required for supervising lincomycin with high
sensitivity.
Electrochemiluminescence (ECL), an ultrasensitive analytical tech­
nique, which has been widely used in biological analysis and other fields
because of its inherent superiorities, for instance, low cost, high sensi­
tivity, wide dynamic range, simple format and so on [8,9]. As the major
component of ECL sensor, ECL luminophores are crucial for the per­
formances of ECL sensor. Compared with conventional ECL lumino­
phores (for example, luminol and Ru(bpy)2+ 3 ), g-C3N4 has inherent
advantages, such as good biocompatibility, large specific surface area
[10–12], and it is widely favored by researchers in the construction of
ECL sensors. However, the ECL stability of g-C3N4 decreased obviously

* Corresponding author.
E-mail address: maochangjie@sina.com (C.-J. Mao).

https://doi.org/10.1016/j.talanta.2021.122546
Received 5 February 2021; Received in revised form 13 May 2021; Accepted 19 May 2021
Available online 4 June 2021
0039-9140/© 2021 Elsevier B.V. All rights reserved.
X.-P. Liu et al.
with the raising cathode potential, and accompanied by the phenome­
non of electrode passivation, which limits the application of g-C3N4
partly. Therefore, some modifications are necessary for g-C3N4 to
improve the performance and expand its application range [13,14].
SnO2 quantum dots, as a typical representation of metal oxide semi­
conductor nanomaterials, have absorbed extensive attention own to
their low cost, environmental friendliness, and excellent optoelectronic
performance, at the same time, they also exhibit suitable band gap
(~3.6 eV) and high stability [15–17]. Chitosan, one kind of biopolymer,
riched in amino and hydroxyl, and possess remarkable affinity and
permeability. Therefore, in this paper, g-C3N4 was served as an ideal
carrier, chitosan was used as stabilizer and binder, and carried plentiful
SnO2 QDs on the g-C3N4 surface to form SnO2/chitosan/g-C3N4 nano­
composite. Contradistinguished with whole g-C3N4, the ECL strength
and stability of nanocomposite improved significantly. Therefore, in this
work, SnO2/chitosan/g-C3N4 nanocomposite was used to establish a
sensitive ECL aptasensor.
In this article, a convenient and new type ECL aptasensor was suc­
cessfully established for detecting lincomycin with high sensitivity. It
can be seen from Scheme 1, the SnO2/chitosan/g-C3N4 nanocomposite
was modified on the bare electrode (GCE) surface. Then, the aptamer
DNA was assembled on the surface of SnO2/chitosan/g-C3N4 nano­
composite through the Sn–S bond. After 6-mercaptohexanol covered the
unbound sites of the electrode surface, Fc-DNA was introduced and
combined with aptamer DNA through base complementation. For
monitoring lincomycin, the different concentrations of lincomycin were
specific binding with aptamer DNA, and Fc-DNA was released from the
electrode surface, generating an obviously enhanced ECL signal. The
proposed ECL aptasensor exhibited a selective and sensitive detection
for lincomycin and was looked forward to be used in actual sample
analysis.
Scheme 1. The steps involved in fabrication of the electrochemiluminescence aptasensor.
2
Talanta 233 (2021) 122546
2. Experiment
2.1. Materials and reagents
The materials and reagents were provided in Supplementary
Material.
The sequences of all of the DNA oligonucleotides used in this work
are given as follows:
SH-DNA(aptamerDNA):5′ –SH–(CH2)6-CGCGTGATGTGGTCGATGC­
GATACGGTGAGTCGCGCCACGGCTACACACGTCTCAGCGA-3′
Ferrocene-DNA(FcDNA):5′ -
TCGCTGAGACGTGTGTGTAGCCGTGGCGCGACTCACCGTATCGCATC­
GACCACATCACGCG–(CH2)6–Fc-3′
2.2. Synthesis of SnO2 QDs
The prepared of SnO2 QDs was according to the previous report with
some modifications (seen in Supporting Information) [18–20].
2.3. Preparation of SnO2/chitosan/g-C3N4 nanocomposite
Firstly, 100 mg of prepared g-C3N4 was added into 100 mL deionized
water and ultrasonicated for 4 h. After the precipitate was removed,
excess chitosan (0.5 wt%) was droped into the homogeneous suspension
liquid. After shaking thoroughly, the uniform mixed liquor was purified
by centrifuging and the chitosan/g-C3N4 with positively charged was
obtained. Then, the obtained chitosan/g-C3N4 composite was dispersed
in deionized water again with a fixed concentration of 1 mg/mL. At last,
1 mg/mL chitosan/g-C3N4 mixture mixed with 5 mg/mL SnO2 QDs so­
lution by sonicating for 30 min at a volume ratio of 2:1. The resulting
product was SnO2/chitosan/g-C3N4 nanocomposite.
X.-P. Liu et al.
2.4. Fabrication of the ECL aptasensor and lincomycin analysis
Firstly, 10 μL of prepared SnO2/chitosan/g-C3N4 nanocomposite was
dropped on the aptasensor electrode and dried naturally. Next, the
aptamer DNA which has been pretreated by tris(2-carboxyethyl)-
phosphine (TCEP) was introduced and aptasensor electrode was incu­
bated overnight at 4 ◦ C. After the unbound sites were covered with 15 μL
of MCH, 15 μL of Fc-DNA was incubated at room temperature for 60 min
to form an aptasensor for lincomycin detection.
For monitoring lincomycin, different concentrations of lincomycin
(15 μL) was incubated on the generating aptasensor electrode surface
and washed with Tris-EDTA (TE) buffer. At last, the prepared aptasensor
was used to detect lincomycin. Scheme 1 exhibits the entire assembly
processes of the proposed ECL aptamer sensor.
2.5. Electrochemiluminescence determination
The ECL intensity of the electrode was carried out in 5 mL of 0.1 M
phosphate buffered saline (PBS) (0.1 M K2S2O8 and 0.1 M KCl were
contained) with a working potential − 1.45 V–0 V, and the voltage of the
photomultiplier tube of the instrument was set to 400 V. Then, ECL
signal was used to analyze the concentrations of lincomycin.
3. Results and discussion
3.1. Characterization of SnO2/chitosan/g-C3N4 nanocomposite
Fig. 1 displays the X-ray powder diffractions (XRD) spectrogram of
SnO2, g-C3N4 and SnO2/chitosan/g-C3N4 nanocomposite, respectively.
It can be seen from Fig. 1, SnO2 QDs (curve black) showed diffraction
peaks at 2θ = 26.7◦ , 34.1◦ and 52.4◦ , all of which were consistent with
the structure of tetragonal rutile SnO2, matching the crystal faces of
(110), (101), and (211) (JCPDS No.41–1445) [21–23]. The g-C3N4 has
two diffraction peaks at 2θ = 13.2◦ and 27.4◦ , which in keeping with the
(100) and (002) lattice planes, respectively (curve red) [24–26]. For the
SnO2/chitosan/g-C3N4 nanocomposite, the diffraction peaks corre­
sponding to the crystal planes of SnO2 and g-C3N4 were both shown. This
preliminary test confirmed the successful preparation of SnO2/chito­
san/g-C3N4 nanocomposite.
The microstructures and surface appearances of g-C3N4 and SnO2/
chitosan/g-C3N4 nanocomposite were characterized by transmission
Fig. 1. XRD patterns of SnO2 QDS, g-C3N4 and SnO2/chitosan/g-C3N4
nanocomposites.
3
Talanta 233 (2021) 122546
electron microscopy (TEM) and high resolution transmission electron
microscopy (HRTEM). It can be seen from Fig. 2A, pure g-C3N4 exhibits a
thin and transparent stratified structure. It can be seen from Fig. 2B, the
g-C3N4 surface was uniformly covered with SnO2 QDs and the surface
became rough. Fig. 2C displays the HRTEM picture of SnO2/chitosan/g-
C3N4, it can be seen that, SnO2 QDs exhibited obvious lattice fringes on
the g-C3N4 surface with an average particle size of about 4.1 nm, which
in accord with the lattice plane (110) of SnO2. The chemical composition
of the SnO2/chitosan/g-C3N4 nanocomposite was carried out by Energy
dispersive spectroscopy (EDS). It can be seen from Fig. 2D, the peaks
relevant to N, C, Sn and O elements were observed. The rest of peaks
come from the base of the sample tray.
3.2. Electrochemiluminescence behavior and mechanism
For purpose of proving the superiority of SnO2/chitosan/g-C3N4, the
ECL and cyclic voltammetry (CV) of different materials were acquired
and compared under the working potential ranging from − 1.45 to 0 V
and the voltage of the photomultiplier tube was set as 400 V. As shown
in Fig. 3A, the ECL signal of SnO2 QDs was as weak as 380 a.u. (curve
black in Fig. 3A), which was produced by the excited state of SnO2 QDs.
The ECL signal of g-C3N4 was relatively high (curve red in Figs. 3A and
4215 a.u.), but the stability was poor. For SnO2/chitosan/g-C3N4
nanocomposite, the ECL signal was as high as 13,524 a.u. (curve blue in
Fig. 3A). At the same time, the cycling stability of SnO2, g-C3N4 and
SnO2/chitosan/g-C3N4 were tested. As shown in Fig. 3B–D, the ECL
signals of SnO2 and g-C3N4 were unstable, simultaneously, the ECL
signal of g-C3N4 exhibited a significant decrease. After the g-C3N4 sur­
face was uniformly covered with SnO2 QDs, a higher and more stable
ECL signal was displayed. Fig. 3E–F shows the ECL-potential and CV
curves of SnO2, g-C3N4 and SnO2/chitosan/g-C3N4. As shown in Fig. 3E,
the ECL intensity of SnO2, g-C3N4 and SnO2/chitosan/g-C3N4 increased
with the increasing absolute value of excitation voltage, then, the ECL
peak appeared at approximate − 1.45 V. After that, the ECL intensity
decreased with the excitation voltage from − 1.45 to 0 V. It can be seen
from Fig. 3F, the reduction peak of SnO2/chitosan/g-C3N4 nano­
composite presented a more positive potential at − 0.87 V compared
with SnO2 (− 1.31 V) and g-C3N4 (− 1.007 V). The phenomenon implied
the combination of SnO2 and g-C3N4 promote the reduction of S2O2− 8 ,
thus enhancing the ECL intensity. The enhancement was ascribed to the
strong synergistic effect, which not only supplied more available cata­
lytic active sites, but also improved the electrochemical reaction effi­
ciency to output more strongly oxidizing intermediates (SO•− 4 ) by
facilitating the reduction of S2O2−
8 [27].
For the detection of lincomycin, aptamer DNA which has been pre­
treated by TCEP was attached to the surface of SnO2/chitosan/g-C3N4
nanocomposite through Sn–S bond. Subsequently, the unbond nonspe­
cific binding sites of aptasensor electrode was covered with MCH. After
that, Fc-DNA was incubated on the electrode surface through base
complementation with aptamer DNA. In the absence of lincomycin, the
excited energy was transferred from SnO2/chitosan/g-C3N4* to Fc,
means that the ECL signal was quenched by photo-excited electron
transfer and energy transfer process. In the presence of lincomycin, the
aptamer DNA was specific binding with lincomycin, and the Fc-DNA was
detached from the surface of electrode, then the ECL signal enhanced
gradually. And that’s mainly because the hydrogen bonding between the
DNA double strands is weaker than the specific binding between
aptamer DNA and lincomycin. On the basis of previous research, the
possible ECL mechanism of SnO2/chitosan/g-C3N4 may be as described
below:
SnO2/chitosan/g-C3N4 + e− →SnO2/chitosan/g-C3N•-
4 (1)
S2O2− − •− 2−
8 + e →SO4 + SO4 (2)
SnO2/chitosan/g-C3N•−
4 + SO•−
4 →SnO2/chitosan/g-C3N4* + SO2−
4 (3)
X.-P. Liu et al.
Fig. 2. TEM images of (A) g-C3N4 and (B) SnO2/chitosan/g-C3N4. (C) HRTEM image of SnO2/chitosan/g-C3N4. (D) EDS spectra of SnO2/chitosan/g-C3N4.
SnO2/chitosan/g-C3N4*→SnO2/chitosan/g-C3N4+ hv (4)
Scanning under the negative potential, SnO2/chitosan/g-C3N4 was
2−
reduced to SnO2/chitosan/g-C3N•-4 , meanwhile, the co-reactant S2O8
was transformed into strong oxidant SO4 . Then the strong oxidant SO•-
•-
4
oxidized SnO2/chitosan/g-C3N•-
4 to SnO2/chitosan/g-C3N4*. The excited
state SnO2/chitosan/g-C3N4* is unstable, losing electrons transition to
ground state and generating ECL signal.
3.3. Electrochemical characteristics of different modified electrodes
In order to confirm whether the aptasensor electrode assembly was
successful, electrochemical impedance spectroscopy (EIS) and cyclic
voltammetry (CV) tests were conducted. It can be seen from Fig. 4A, the
bare electrode (curve a) exhibited a symmetric redox peak and high peak
current. After the electrode was covered with SnO2/chitosan/g-C3N4
nanocomposite (curve b), the peak current was significantly reduced
which can be ascribed to the decreased electron transfer rate. After the
aptamer DNA, MCH and Fc-DNA (curve c, d, e respectively) were
incubated on the electrode surface step by step, the peak current
decreased gradually. This can be ascribed to the assembly of the non-
conductive substance on the electrode surface reduced the electron
transfer. When lincomycin was incessantly added (curve f) and incu­
bated on the surface of the aptasensor electrode, the aptamer DNA was
specific binding with lincomycin, and Fc-DNA was driven to leave the
electrode, the peak current decreased gradually. Therefore, the CV test
results proved that the assembly of the aptasensor step by step was
successful.
To further investigate the different assembly steps of the aptasensor,
the EIS spectra of the aptasensor electrode at different assembly steps
was carried out (Fig. 4B). The bare electrode displayed a relatively small
electron transfer resistance (Ret) (curve a). After SnO2/chitosan/g-C3N4
nanocomposite was added on the surface of the electrode, the Ret
increased obviously (curve b), indicating that the electron transfer of [Fe
(CN)6]3− /4− on the electrode surface was blocked by SnO2/chitosan/g-
C3N4. As the aptasensor electrode was incubated with aptamer DNA,
MCH and Fc-DNA stepwise, the Ret was increased continuously (curve c,
d and e respectively). After the aptasensor was incubated with linco­
mycin, the aptamer DNA was specific binding with lincomycin, and Fc-
4
Talanta 233 (2021) 122546
DNA was forced to leave the surface of aptasensor electrode, generating
an increased Ret (curve f). These EIS results in keeping with expecta­
tions, proving that the designed ECL aptasensor has been assembled
successfully.
3.4. Optimization of experimental conditions
For purpose of effectively applying the constructed aptasensor to
detect lincomycin, the incubation time of Fc-DNA and aptamer DNA, the
concentration of Fc-DNA, the incubation time of lincomycin and apta­
sensor and the pH of the luminescent solution were optimized. The ECL
responses of the aptasensor prepared with different concentrations of Fc-
DNA were shown in Fig. 5A. It can be seen that, the ECL signal gradually
decreased with the raising concentration of Fc-DNA. As the concentra­
tion of Fc-DNA increased to 5 μM, the ECL intensity maintained stable,
which means that the binding sites of aptamer DNA were saturated.
Therefore, 5 μM of Fc-DNA was the optimal concentration in the
following experiment.
When the optimal Fc-DNA concentration was determined, the incu­
bation time between Fc-DNA and aptamer DNA is of great importance
for the quenching effect of the substance. As the incubation time of Fc-
DNA and aptamer DNA increasing, the ECL signal decreased, and then
there is no significant change after 60 min (Fig. 5B). Therefore, the
optimal incubation time between Fc-DNA and aptamer DNA for this
experiment was 60 min. Similarly, the incubation time of lincomycin
and aptamer DNA was also optimized. As shown in Fig. 5C, the ECL
signal enhanced with the raising incubation time of lincomycin and
aptamer DNA, and then the ECL signal had no obvious variation after 70
min. Thus, the incubation time of lincomycin and aptamer DNA was 70
min for the whole experiment.
Furthermore, the pH value also an significant indicator for the
property of the aptasensor. Fig. 5D shows the ECL intensity of the
aptasensor prepared with different pH value of the luminescent solution.
As shown in Fig. 5D, the ECL signal gradually enhanced with the
increasing pH value and then reached the maximum value when pH
value is 7.4. After that, the ECL signal decreased as the pH value con­
tinues to increase, that’s mainly because under alkaline conditions,
X.-P. Liu et al. Talanta 233 (2021) 122546

Fig. 3. (A) The ECL intensity of SnO2, g-C3N4 and SnO2/chitosan/g-C3N4. The ECL stability of (B) SnO2, (C) g-C3N4 and (D) SnO2/chitosan/g-C3N4 under a
continuous cyclic potential scan for 500s. (E) ECL-potential and (F) CV curves of SnO2, g-C3N4 and SnO2/chitosan/g-C3N4.

Fig. 4. (A) The curves of CV and (B) EIS for the stepwise aptasensor fabrication measured in 2.0 mM [Fe(CN)6]3− /4−
containing 0.1 M KCl, with the scan range of
− 0.2 to 0.6 V and rate of 100 mV/s.

5
X.-P. Liu et al.
Fig. 5. Effects of (A) concentration of Fc-DNA, incubation time of (B) aptamer DNA with Fc-DNA and (C) aptamer DNA with Lincomycin, (D) the pH value.
excessive anions were stored up on the electrode surface, hence pre­
venting SO•−
4 from approaching the electrode surface, resulting in
reduced ECL signal. Thus, the pH value of 7.4 was selected for the whole
experiment process.
3.5. Detection of lincomycin
The capability of the aptasensor was investigated by monitoring a
suite of different concentrations of lincomycin under the optimal con­
ditions. As shown in Fig. 6A, the ECL signal gradually enhanced as the
concentration of lincomycin increasing. After the aptasensor was incu­
bated with lincomycin, the aptamer DNA was specific binding with
lincomycin, and Fc-DNA was forced to leave the electrode surface, the
photo-excited electron transfer and energy transfer reduced, then the
ECL intensity gradually recovered. It can be seen from Fig. 6B, the ECL
signal enhanced as the raising logarithm of lincomycin concentration in
the range of 0.10 ng mL− 1 - 0.10 mg mL− 1. The linear regression
equation between logarithm of lincomycin concentration and ECL signal
was ECL = 14294.7 + 1218.2lgC. The linearly correlation coefficient
was 0.998, and the limit of detection was 0.028 ng mL− 1. Compared
with the previous literatures on the detection of lincomycin (Table 1),
the aptasensor exhibited a wider linear range and lower limit of
detection
3.6. Reproducibility, stability and selectivity of the aptasensor
Reproducibility is a remarkable indicator for aptasensor, which is
also an important index for analytical detection method. In the cause of
assessing the reproducibility of the proposed aptasensor, the ECL re­
sponses of six sensor electrodes in the same conditions were analyzed.
The relative standard deviation (RSD) was 3.56% for lincomycin with
same concentration, which indicates that the aptasensor has good
6
Talanta 233 (2021) 122546
reproducibility. Moreover, the stability of the constructed aptasensor
was also explored. After the incubated electrode was scanned continu­
ously for 20 cycles, the ECL intensity had no significant change (Fig. 6C).
The results showed that the aptasensor has a stable detection for
lincomycin.
Selectivity is crucial for ECL aptasensor and plays an important role
in analytical methods. In order to assess the response of the established
aptasensor to other chaff interferents, the interference tests were carried
out with prostate-specific antigen (PSA, 10 mg mL− 1), carcinoembryonic
antigen (CEA, 10 mg mL− 1), mucin 1 (MUC1, 10 mg mL− 1), bovine
serum albumin (BSA, 10 mg mL− 1), platelet-derived growth factor
(PDGF-BB, 10 mg mL− 1) and mixture. As shown in Fig. 6D, in compar­
ison with the blank, the ECL signals for 10 mg mL− 1 of PSA, CEA, MUC1,
BSA and PDGF-BB were almost no changed. However, the ECL signal of
the aptasensor for lincomycin (0.10 mg mL− 1) showed an significantly
increase. At the same time, compared with the aptasensor only incu­
bated with lincomycin, the ECL signal of the aptasensor incubated with
lincomycin (0.10 mg mL− 1) containing all kinds of the above in­
terferences (10 mg mL− 1) was almost no changed. These mean that the
established ECL aptasensor exhibited a selective detection for linco­
mycin.(see Fig. 6).
3.7. Practical application of ECL aptasensor
In order to explore the practical application performance, the prac­
ticality of the aptasensor was further examined. To be specific, the
standard addition method was used to detect lincomycin in milk sample
with the proposed aptasensor. The milk sample used in the experiment
was purchased from supermarket and the package was intact. The milk
sample was centrifuged for 20 min at 12,000 rpm, after placed at room
temperature for 30 min, the obtained centrifugal product was diluted 10
folds. Then, the milk sample with certain concentration of lincomycin
X.-P. Liu et al. Talanta 233 (2021) 122546

Fig. 6. (A) ECL intensity and (B) the corresponding calibration curve of the aptasensor for the detection of different concentration of lincomycin. (C) The ECL
stability of the aptasensor with the concentration of lincomycin (0.10 mg mL− 1) under a continuous cyclic potential scan for 20 cycles. (D) The selectivity of the
proposed ECL aptasensor detection of lincomycin (0.10 mg mL− 1) against different targets: PSA (10 mg mL− 1), CEA (10 mg mL− 1), MUC1 (10 mg mL− 1), BSA (10 mg
mL− 1), PDGF-BB (10 mg mL− 1) and a mixture (0.10 mg mL− 1 lincomycin, 10 mg mL− 1 PSA, 10 mg mL− 1 CEA, 10 mg mL− 1 MUC1, 10 mg mL− 1 BSA, 10 mg mL− 1
PDGF-BB). Error bars: SD, n = 3.

Table 1 Table 2
Comparison of various methods for target lincomycin detection. Determination of lincomycin in milk by standard addition.
Analytical Linear range Limit of detection Reference Milk samples Added (ng⋅mL− 1) Found (ng⋅mL− 1) Recovery(%) RSD(%)
method
1 1 1.03 103.0 2.81
Fluorescence 0.2 μg/mL-4.8 μg/mL 0.061 μg/mL [28] 2 10 10.84 108.40 3.52
Electroanalysis 0.5 μM–125 μM 0.02 μM [29] 3 100 96.15 96.15 4.07
PEC 0.1 nM–300 nM 0.076 nM [30]
ECL 0.1 ng/mL-0.10 mg/mL 0.028 ng/mL This work
(0.225 nM-0.225 mM) (0.063 nM) Credit author statement

Xing-Pei Liu: Conceptualization, Investigation, Writing – original

was studied. As shown in Table 2, the recovery rate of the added
draft. Bo Huang: Methodology, Investigation. Chang-Jie Mao: Supervi­
lincomycin was 96.15%~108.40%, and the relative standard deviation
sion, Writing - review& editing. Jing-Shuai Chen: Validation. Bao-Kang
wass 2.81%~4.17%. The experimental results proved that the estab­
Jin: Writing – review & editing.
lished aptasensor was acceptable for lincomycin detection in practical
application.
Declaration of competing interest
4. Conclusion
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
In this work, a sensitive and effective ECL aptasensor was established
the work reported in this paper.
successfully based on SnO2/chitosan/g-C3N4 nanocomposite for the
detection of lincomycin. Compared with previous detection methods,
Acknowledgments
the prepared aptasensor showd a lower limit of detection (0.028 ng
mL− 1) and wider detection range from 0.10 ng mL− 1 to 0.10 mg mL− 1
This work was supported by the National Natural Science Foundation
for lincomycin detection and it performed well in actual sample test. At
of China (Grant Nos. 21976001), Natural Science Foundation of Anhui
the same time, the aptasensor also showd good selectivity and repro­
Province (1808085QB53). Open fund for Discipline Construction of
ducibility, high sensitivity and stability. Consequently, the constructed
Institute of Physical Science and Information Technology.
ECL aptasensor exhibits great promise for monitoring lincomycin.

7
X.-P. Liu et al.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.talanta.2021.122546.
References
[1] L. Li, J. Sun, B.T. Liu, D.H. Zhao, J. Ma, H. Deng, X. Li, F.Y. Hu, X.P. Liao, Y.H. Liu,
Quantification of lincomycin resistance genes associated with lincomycin residues
in waters and soils adjacent to representative swine farms in China, Front.
Microbiol. 4 (2013) 364, https://doi.org/10.3389/fmicb.2013.00364.
[2] M.M. Wang, C. Cai, B. Zhang, H.L. Liu, Characterization and mechanism analysis of
lincomycin biodegradation with Clostridium sp. strain LCM-B isolated from
lincomycin mycelial residue (LMR), Chemosphere 193 (2018) 611–617, https://
doi.org/10.1016/j.chemosphere.2017.11.055.
[3] D.Z. Zhang, Z.J. Tang, W. Liu, Biosynthesis of lincosamide antibiotics: reactions
associated with degradation and detoxification pathways play a constructive role,
Accounts Chem. Res. 51 (2018) 1496–1506, https://doi.org/10.1021/acs.
accounts.8b00135.
[4] Z. Kameník, J. Kopecky, M. Marčková, D. Ulanová, J. Novotná, S. Pospíšil,
J. Olšovská, HPLC-fluorescence detection method for determination of key
intermediates of the lincomycin biosynthesis in fermentation broth, Anal. Bioanal.
Chem. 393 (2009) 1779–1787, https://doi.org/10.1007/s00216-009-2605-3.
[5] M.H. Chiu, H.H. Yang, C.H. Liu, J.M. Zen, Determination of lincomycin in urine
and some foodstuffs by flow injection analysis coupled with liquid chromatography
and electrochemical detection with a preanodized screen-printed carbon electrode,
J. Chromatogr. B. 877 (2009) 991–994, https://doi.org/10.1016/j.
jchromb.2009.02.066.
[6] K. Granelli, C. Branzell, Rapid multi-residue screening of antibiotics in muscle and
kidney by liquid chromatography-electrospray ionization-tandem mass
spectrometry, Anal. Chim. Acta 586 (2007) 289–295, https://doi.org/10.1016/j.
aca.2006.12.014.
[7] A. Yi, Z.F. Liu, S.P. Liu, X.L. Hu, Study on the interaction between palladium (II)-
lincomycin chelate and erythosine by absorption, fluorescence and resonance
Rayleigh scattering spectra and its analytical applications, Luminescence 24 (2009)
23–29, https://doi.org/10.1002/bio.1057.
[8] Y. Fan, X.R. Tan, X. Ou, S.H. Chen, S.P. Wei, An ultrasensitive
electrochemiluminescence biosensor for the detection of concanavalin A based on
Au nanoparticles-thiosemicarbazide functionalized PtNi nanocubes as signal
enhancer, Biosens. Bioelectron. 87 (2017) 802–806, https://doi.org/10.1016/j.
bios.2016.09.015.
[9] Y.T. Liu, H.J. Wang, C.Y. Xiong, Y.L. Yuan, Y.Q. Chai, R. Yuan, A sensitive
electrochemiluminescence immunosensor based on luminophore capped Pd@Au
core-shell nanoparticles as signal tracers and ferrocenyl compounds as signal
enhancers, Biosens. Bioelectron. 81 (2016) 334–340, https://doi.org/10.1016/j.
bios.2016.03.014.
[10] G.P. Dong, Y.H. Zhang, Q.W. Pan, J.R. Qiu, A fantastic graphitic carbon nitride (g-
C3N4) material: electronic structure, photocatalytic and photoelectronic properties,
J. Photoch. Photobio. C. 20 (2014) 33–50, https://doi.org/10.1016/j.
jphotochemrev.2014.04.002.
[11] Y.Q. Yang, H.F. Jin, C. Zhang, H.H. Gan, F.T. Yi, H.Q. Wang, Nitrogen-deficient
modified P-Cl co-doped graphitic carbon nitride with enhanced photocatalytic
performance, J. Alloys Compd. 821 (2020) 153439, https://doi.org/10.1016/j.
jallcom.2019.153439.
[12] Q.J. Xiang, J.G. Yu, M. Jaroniec, Preparation and enhanced visible-light
photocatalytic H2-production activity of graphene/C3N4 composites, J. Phys.
Chem. C 115 (2011) 7355–7363, https://doi.org/10.1021/jp200953k.
[13] Z.G. Liu, M. Xu, Z. Yang, Y.X. Wang, S.Q. Wang, H.X. Wang, Efficient removal of
organic dyes from water by β-cyclodextrin functionalized graphite carbon
nitridecomposite, Chemistryselect 2 (2017) 1753–1758, https://doi.org/10.1002/
slct.201602032.
Talanta 233 (2021) 122546
[14] J.W. Gao, H.W. Xiong, W. Zhang, Y. Wang, H.X. Wang, W. Wen, X.H. Zhang, S.
F. Wang, Electrochemiluminescent aptasensor based on β-cyclodextrin/graphitic
carbon nitride composite for highly selective and ultrasensitive assay of platelet
derived growth factor BB, Carbon 130 (2018) 416–423, https://doi.org/10.1016/j.
carbon.2018.01.026.
[15] S. Sohila, M. Rajalakshmi, C. Muthamizhchelvan, S. Kalavathi, Optical properties
of Fe-doped SnO2 nanoparticles, AIP Conf. Proceed. 1447 (2012) 251–252, https://
doi.org/10.1063/1.4709974.
[16] L. Ren, Y. Yao, K.Y. Wang, S.T. Li, K.J. Zhu, J. Liu, Novel one-step in situ growth of
SnO2 quantum dots on reduced graphene oxide and its application for lithium ion
batteries, J. Solid State Chem. 273 (2019) 128–131, https://doi.org/10.1016/j.
jssc.2019.01.028.
[17] A. Bhattacharjee, M. Ahmaruzzaman, Facile synthesis of SnO2 quantum dots and its
photocatalytic activity in the degradation of eosin Y dye: a green approach, Mater.
Lett. 139 (2015) 418–421, https://doi.org/10.1016/j.matlet.2014.10.121.
[18] B. Babu, A.N. Kadam, G.T. Rao, S.W. Lee, C. Byon, J. Shim, Enhancement of visible-
light-driven photoresponse of Mn-doped SnO2 quantum dots obtained by rapid and
energy efficient synthesis, J. Lumin. 195 (2017) 283–289, https://doi.org/
10.1016/j.jlumin.2017.11.040.
[19] D.Y. Chen, S.S. Huang, R.T. Huang, Q. Zhang, T.T. Le, E.B. Cheng, Z.J. Hu, Z.
W. Chen, Convenient fabrication of Ni-doped SnO2 quantum dots with improved
photodegradation performance for Rhodamine B, J. Alloy. Compd. 788 (2019)
929–935, https://doi.org/10.1016/j.jallcom.2019.02.193.
[20] M.K. Singh, M.C. Mathpal, A. Agarwal, Optical properties of SnO2 quantum dots
synthesized by laser ablation in liquid, Chem. Phys. Lett. 536 (2012) 87–91,
https://doi.org/10.1016/j.cplett.2012.03.084.
[21] L.F. Zhu, M.Y. Wang, T.K. Lam, C.Y. Zhang, H.D. Du, B.H. Li, Fast microwave-
assisted synthesis of gas-sensing SnO2 quantum dots with high sensitivity, Sensor.
Actuator. B Chem. 236 (2016) 646–653, https://doi.org/10.1016/j.
snb.2016.04.173.
[22] V. Bonu, B. Gupta, S. Chandra, A. Das, S. Dhara, A.K. Tyagi, Electrochemical
supercapacitor performance of SnO2 quantum dots, Electrochim. Acta 203 (2016)
230–237, https://doi.org/10.1016/j.electacta.2016.03.153.
[23] P. Li, Y. Lan, Q. Zhang, Z.Y. Zhao, T. Pullerits, K.B. Zheng, Y. Zhou, Iodinated SnO2
quantum dots: a facile and efficient approach to increase solar absorption for
visible-light photocatalysis, J. Phys. Chem. C 120 (2016) 9253–9262, https://doi.
org/10.1021/acs.jpcc.6b01530.
[24] X.C. Hao, X.L. Ji, Q. Zhang, Effective improvement of the photocatalytic efficiency
of g-C3N4 by a green hydrothermal treatment method, Mater. Lett. 185 (2016)
29–31, https://doi.org/10.1016/j.matlet.2016.08.097.
[25] M. Sierra, E. Borges, P. Esparza, J. Méndez-Ramos, J. Martín-Gil, P. Martín-Ramos,
Photocatalytic activities of coke carbon/g-C3N4 and Bi metal/Bi mixed oxides/g-
C3N4 nanohybrids for the degradation of pollutants in wastewater, Sci. Technol.
Adv. Mater. 17 (2016) 659–668, https://doi.org/10.1016/j.matlet.2016.08.0972.
[26] B.Y. Liang, D.H. Han, C.H. Sun, W.X. Zhang, Q. Qin, Synthesis of SnO2/g-C3N4,
visible light driven photocatalysts via grinding assisted ultrasonic route, Ceram.
Int. 44 (2018) 7315–7318, https://doi.org/10.1016/j.ceramint.2018.01.093.
[27] F. Yang, F. Yang, T.T. Tu, N. Liao, Y.Q. Chai, R. Yuan, Y. Zhuo, A synergistic
promotion strategy remarkably accelerated electrochemiluminescence of SnO2 QDs
for MicroRNA detection using 3D DNA walker amplification, Biosens. Bioelectron.
173 (2021) 112820, https://doi.org/10.1016/j.bios.2020.112820.
[28] A.E. Yi, Z.F. Liu, S.P. Liu, X.L. Hu, Study on the interaction between palladium(II)-
lincomycin chelate and erythosine by absorption, fluorescence and resonance
Rayleigh scattering spectra and its analytical applications, Luminescence 24 (2008)
23–29, https://doi.org/10.1002/bio.1057.
[29] K. Boonsong, S. Chuanuwatanakul, N. Wangfuengkanagul, O. Chailapakul,
Electroanalysis of lincomycin using boron-doped diamond thin film electrode
applied to flow injection system, Sensor. Actuator. B Chem. 108 (2005) 627–632,
https://doi.org/10.1016/j.snb.2004.12.087.
[30] X. Zhang, J.J. Peng, Y.P. Ding, D.L. Zheng, Y.J. Lin, Y.W. Chen, W.H. Gao,
Rationally designed hierarchical hollow ZnCdS@MoS2 heterostructured cages with
efficient separation of photogenerated carriers for photoelectrochemical
aptasensing of lincomycin, Sensor. Actuator. B Chem. 206 (2020) 127552, https://
doi.org/10.1016/j.snb.2019.127552.