What is a genome?

A genome is an organism’s complete set of genetic instructions. Each genome contains all of the
information needed to build that organism and allow it to grow and develop. The genome is the
entire set of DNA instructions found in a cell. In humans, the genome consists of 23 pairs of
chromosomes located in the cell’s nucleus, as well as a small chromosome in the cell’s
mitochondria. A genome contains all the information needed for an individual to develop and
function.
Our bodies are made up of millions of cells (100,000,000,000,000), each with their own
complete set of instructions for making us, like a recipe book for the body. This set of
instructions is known as our genome and is made up of DNA. Each cell in the body, for example,
a skin cell or a liver cell, contains this same set of instructions: all living things have a unique
genome

human genome, all of the approximately three billion base pairs of deoxyribonucleic acid
(DNA) that make up the entire set of chromosomes of the human organism. The human genome
includes the coding regions of DNA, which encode all the genes (between 20,000 and 25,000) of
the human organism, as well as the noncoding regions of DNA, which do not encode any genes.
By 2003 the DNA sequence of the entire human genome was known.
DNA is the information molecule for all living organisms. All of the DNA of an organism is
called its genome. Some genomes are incredibly small, such as those found in viruses and
bacteria, whereas other genomes can be almost unexplainably large, such as found in some
plants. It is still quite puzzling why there does not appear to be a consistent correlation between
biological complexity and genome size. For example, the human genome contains about 3 billion
nucleotides. While 3 billion is a big number, the rare Japanese flower called Paris japonica has a
genome size of roughly 150 billion nucleotides, making it 50 times the size of the human
genome. To date, humans are the only life form that has successfully sequenced its own genome,
yet there are many life forms on earth that have genomes substantially larger from the human
genome

Knowledge of the human genome provides an understanding of the origin of the human species,
the relationships between subpopulations of humans, and the health tendencies or disease risks of
individual humans. Indeed, in the past 20 years knowledge of the sequence and structure of the
human genome has revolutionized many fields of study, including medicine, anthropology, and
forensics.
The Human Genome Project (HGP), which operated from 1990 to 2003, provided researchers
with basic information about the sequences of the three billion chemical base pairs
i.e., adenine [A], thymine [T], guanine [G], and cytosine [C]) that make up human
genomic DNA.
An outgrowth of the HGP was the International HapMap Project (2002-3), an international
collaboration that made use of the genome sequence data published by the HGP for the purpose
of identifying genetic variations contributing to human disease. Coincident with the completion
of these two projects and with the development of computer databases capable of storing the full
human genome sequence and known variations came genome-wide association studies, aimed at
identifying associations between the variants and particular disease

DNA replication

DNA replication, or the copying of a cell's DNA, is no simple task! There are about 3333 billion
base pairs of DNA in your genome, all of which must be accurately copied when any one of your
trillions of cells divides.

The basic mechanisms of DNA replication are similar across organisms. In this article, we'll
focus on DNA replication as it takes place in the bacterium E. coli, but the mechanisms of
replication are similar in humans and other eukaryotes.

Let's take a look at the proteins and enzymes that carry out replication, seeing how they work
together to ensure accurate and complete replication of DNA.

The basic idea

DNA replication is semiconservative, meaning that each strand in the DNA double helix acts as
a template for the synthesis of a new, complementary strand.

This process takes us from one starting molecule to two "daughter" molecules, with each newly
formed double helix containing one new and one old strand.
 in a sense, that's all there is to DNA replication! But what's actually most interesting about this
process is how it's carried out in a cell.

Cells need to copy their DNA very quickly, and with very few errors (or risk problems such as
cancer). To do so, they use a variety of enzymes and proteins, which work together to make sure
DNA replication is performed smoothly and accurately.

DNA polymerase

One of the key molecules in DNA replication is the enzyme DNA polymerase. DNA
polymerases are responsible for synthesizing DNA: they add nucleotides one by one to the
growing DNA chain, incorporating only those that are complementary to the template.

Here are some key features of DNA polymerases:

 They always need a template

 They can only add nucleotides to the 3' end of a DNA strand
 They can't start making a DNA chain from scratch, but require a pre-existing chain or short
stretch of nucleotides called a primer
 They proofread, or check their work, removing the vast majority of "wrong" nucleotides that are
accidentally added to the chain
  The addition of nucleotides requires energy. This energy comes from the nucleotides
themselves, which have three phosphates attached to them (much like the energy-carrying
molecule ATP). When the bond between phosphates is broken, the energy released is
used to form a bond between the incoming nucleotide and the growing chain.
 In prokaryotes such as E. coli, there are two main DNA polymerases involved in DNA
replication: DNA pol III (the major DNA-maker), and DNA pol I, which plays a crucial
supporting role

Starting DNA replication

How do DNA polymerases and other replication factors know where to begin? Replication
always starts at specific locations on the DNA, which are called origins of replication and are
recognized by their sequence.

E. coli, like most bacteria, has a single origin of replication on its chromosome. The origin is
about 245245245245 base pairs long and has mostly A/T base pairs (which are held together by
fewer hydrogen bonds than G/C base pairs), making the DNA strands easier to separate.

Specialized proteins recognize the origin, bind to this site, and open up the DNA. As the DNA
opens, two Y-shaped structures called replication forks are formed, together making up what's
called a replication bubble. The replication forks will move in opposite directions as replication
proceeds.

How does replication actually get going at the forks? Helicase is the first replication enzyme to
load on at the origin of replication3^33cubed. Helicase's job is to move the replication forks
forward by "unwinding" the DNA (breaking the hydrogen bonds between the nitrogenous base
pairs).

Proteins called single-strand binding proteins coat the separated strands of DNA near the
replication fork, keeping them from coming back together into a double helix.
Primers and primase

DNA polymerases can only add nucleotides to the 3' end of an existing DNA strand. (They use
the free -OH group found at the 3' end as a "hook," adding a nucleotide to this group in the
polymerization reaction.) How, then, does DNA polymerase add the first nucleotide at a new
replication fork?

Alone, it can't! The problem is solved with the help of an enzyme called primase. Primase
makes an RNA primer, or short stretch of nucleic acid complementary to the hat provides a 3'
end for DNA polymerase to work on. A typical primer is about five to ten nucleotides long. The
primer primes DNA synthesis, i.e., gets it started.

Once the RNA primer is in place, DNA polymerase "extends" it, adding nucleotides one by one
to make a new DNA strand that's complementary to the template strand.

Leading and lagging strands

In E. coli, the DNA polymerase that handles most of the synthesis is DNA polymerase III. There
are two molecules of DNA polymerase III at a replication fork, each of them hard at work on one
of the two new DNA strands.

DNA polymerases can only make DNA in the 5' to 3' direction, and this poses a problem during
replication. A DNA double helix is always anti-parallel; in other words, one strand runs in the 5'
to 3' direction, while the other runs in the 3' to 5' direction. This makes it necessary for the two
new strands, which are also antiparallel to their templates, to be made in slightly different
ways.

One new strand, which runs 5' to 3' towards the replication fork, is the easy one. This strand is
made continuously, because the DNA polymerase is moving in the same direction as the
replication fork. This continuously synthesized strand is called the leading strand.
The other new strand, which runs 5' to 3' away from the fork, is trickier. This strand is made in
fragments because, as the fork moves forward, the DNA polymerase (which is moving away
from the fork) must come off and reattach on the newly exposed DNA. This tricky strand, which
is made in fragments, is called the lagging strand.

The small fragments are called Okazaki fragments, named for the Japanese scientist who
discovered them. The leading strand can be extended from one primer alone, whereas the lagging
strand needs a new primer for each of the short Okazaki fragments.

The maintenance and cleanup crew

Some other proteins and enzymes, in addition the main ones above, are needed to keep DNA
replication running smoothly. One is a protein called the sliding clamp, which holds DNA
polymerase III molecules in place as they synthesize DNA. The sliding clamp is a ring-shaped
protein and keeps the DNA polymerase of the lagging strand from floating off when it re-starts at
a new Okazaki fragment

Topoisomerase also plays an important maintenance role during DNA replication. This enzyme
prevents the DNA double helix ahead of the replication fork from getting too tightly wound as
the DNA is opened up. It acts by making temporary nicks in the helix to release the tension, then
sealing the nicks to avoid permanent damage.

Finally, there is a little cleanup work to do if we want DNA that doesn't contain any RNA or
gaps. The RNA primers are removed and replaced by DNA through the activity of DNA
polymerase I, the other polymerase involved in replication. The nicks that remain after the
primers are replaced get sealed by the enzyme DNA ligase.

Mistakes in DNA replication

DNA replication is not perfect. Errors occur in DNA replication, when the incorrect base is
incorporated into the growing DNA strand. This leads to mismatched base pairs, or mispairs.
DNA polymerases have proofreading activity, and a DNA repair enzymes have evolved to
correct these mistakes. Occasionally, mispairs survive and are incorporated into the genome in
the next round of replication. These mutations may have no consequence, they may result in the
death of the organism, they may result in a genetic disease or cancer; or they may give the
organism a competitive advantage over its neighbours, which leads to evolution by natural
selection.

DNA REPAIR
DNA repair is one of several mechanisms by which a cell maintains the integrity of its genetic
code. DNA repair ensures the survival of a species by enabling parental DNA to be inherited as
faithfully as possible by offspring. It also preserves the health of an individual. Mutations in the
genetic code can lead to cancer and other genetic diseases

There are three types of repair mechanisms:

1. Direct reversal of the damage: Direct reversal repair is specific to the damage. For
example, in a process called photoreactivation, pyrimidine bases fused by UV light are
separated by DNA photolyase (a light-driven enzyme). For direct reversal of alkylation
events, a DNA methyltransferase or DNA glycosylase detects and removes the alkyl
group
2. Excision repair: Excision repair can be specific or nonspecific. In base excision repair,
DNA glycosylases specifically identify and remove the mismatched base. In nucleotide
 excision repair, the repair machinery recognizes a wide array of distortions in the double
helix caused by mismatched bases; in this form of repair, the entire distorted region is
excised.
3. postreplication repair.. Postreplication repair occurs downstream of the lesion, because
replication is blocked at the actual site of damage

CELL DIVISION
The key difference between prokaryotic and eukaryotic cell division is that prokaryotic cell
division occurs through binary fission, while eukaryotic cell division occurs either through
mitosis or meiosis.

Cell division is the process where a parental cell divides into two or more daughter cells. It is a
part of a larger cell cycle. In eukaryotes, there are two distinct types of cell division mechanisms.
Eukaryotic cell has a vegetative cell division called mitosis and a reproductive cell division
called meiosis. Prokaryotes (bacteria and archaea), on the other hand, usually show only
vegetative cell division called binary fission. Prokaryotic and eukaryotic cell division are distinct
cell division types.

What is Prokaryotic Cell Division?

Prokaryotic cell division occurs through binary fission. Prokaryotes are much simpler than
eukaryotes in their organization. The prokaryotic chromosome is much easier to manipulate than
the eukaryotic chromosome. Therefore, in binary fission, the single DNA molecule
(chromosome) in prokaryote first replicates and then attaches each copy to a different part of the
cell membrane. When the cell begins to pull apart, the original and replicate chromosomes are
separated.. Moreover, a septum is formed between the original and replicate a chromosome,
which is extending from the periphery towards the centre of the cell. Finally, the new cell wall in
place separates the daughter cells.
Following cytokinesis (cell splitting), it produces two cells of identical genetic composition.
However, there is a rare chance of a spontaneous mutation occurring in the prokaryotic genome.
One of the consequences of this type of asexual reproduction is that all organisms in a colony are
genetically equal. Therefore, when treating bacterial diseases, a drug killing one bacteria will
also kill all other members of that specific clone.

What is Eukaryotic Cell Division?

Eukaryotic cell division occurs either through mitosis or meiosis mechanism. The cell division
process in eukaryotes is much more complicated than prokaryotes. Eukaryotic cell division has
two types: mitosis and meiosis. Mitosis is the equational division, and meiosis is the reductional
division. Mitosis is a process where a single cell divides into two identical daughter cells in cell
division. The main function of mitosis is to maintain growth and to replace worn-out cells.
Mitosis occurs in somatic cells. On the other hand, meiosis is a special form of cell division that
creates sex cells: sperms and eggs with one copy of each chromosome. The fusion of the sex
cells produces a new offspring with two copies of each chromosome.

PROTEIN SYNTHESIS

The process by which DNA is copied to RNA is called transcription, and that by which RNA is
used to produce proteins is called translation.

Transcription

Transcription is the process by which DNA is copied (transcribed) to mRNA, which carries the
information needed for protein synthesis. Transcription takes place in two broad steps. First, pre-
messenger RNA is formed, with the involvement of RNA polymerase enzymes. The process
relies on Watson-Crick base pairing, and the resultant single strand of RNA is the reverse-
complement of the original DNA sequence. The pre-messenger RNA is then "edited" to produce
the desired mRNA molecule in a process called RNA splicing.

Formation of pre-messenger RNA

The mechanism of transcription has parallels in that of DNA replication. As with DNA
replication, partial unwinding of the double helix must occur before transcription can take place,
and it is the RNA polymerase enzymes that catalyze this process.

Unlike DNA replication, in which both strands are copied, only one strand is transcribed. The
strand that contains the gene is called the sense strand, while the complementary strand is the
antisense strand. The mRNA produced in transcription is a copy of the sense strand, but it is the
antisense strand that is transcribed.

Ribonucleoside triphosphates (NTPs) align along the antisense DNA strand, with Watson-Crick
base pairing (A pairs with U). RNA polymerase joins the ribonucleotides together to form a pre-
messenger RNA molecule that is complementary to a region of the antisense DNA strand.wxh
Transcription ends when the RNA polymerase enzyme reaches a triplet of bases that is read as a
"stop" signal. The DNA molecule re-winds to re-form the double helix.

RNA splicing

The pre-messenger RNA thus formed contains introns which are not required for protein
synthesis. The pre-messenger RNA is chopped up to remove the introns and create messenger
RNA (mRNA) in a process called RNA splicing

Alternative splicing
In alternative splicing, individual exons are either spliced or included, giving rise to several
different possible mRNA products. Each mRNA product codes for a different protein isoform;
these protein isoforms differ in their peptide sequence and therefore their biological activity. It is
estimated that up to 60% of human gene products undergo alternative splicing
Splicing is important in genetic regulation (alteration of the splicing pattern in response to
cellular conditions changes protein expression). Perhaps not surprisingly, abnormal splicing
patterns can lead to disease states including cancer.

Reverse transcription

In reverse transcription, RNA is "reverse transcribed" into DNA. This process, catalyzed by
reverse transcriptase enzymes, allows retroviruses, including the human immunodeficiency virus
(HIV), to use RNA as their genetic material. Reverse transcriptase enzymes have also found
applications in biotechnology, allowing scientists to convert RNA to DNA for techniques such as
PCR.

Translation

The mRNA formed in transcription is transported out of the nucleus, into the cytoplasm, to the
ribosome (the cell's protein synthesis factory). Here, it directs protein synthesis. Messenger RNA
is not directly involved in protein synthesis - transfer RNA (tRNA) is required for this. The
process by which mRNA directs protein synthesis with the assistance of tRNA is called
translation.

The ribosome is a very large complex of RNA and protein molecules. Each three-base stretch of
mRNA (triplet) is known as a codon, and one codon contains the information for a specific
amino acid. As the mRNA passes through the ribosome, each codon interacts with the anticodon
of a specific transfer RNA (tRNA) molecule by Watson-Crick base pairing. This tRNA molecule
carries an amino acid at its 3'-terminus, which is incorporated into the growing protein chain.
The tRNA is then expelled from the ribosome.

Each amino acid has its own special tRNA (or set of tRNAs). For example, the tRNA for
phenylalanine (tRNAPhe) is different from that for histidine (tRNAHis). Each amino acid is

attached to its tRNA through the 3'-OH group to form an ester which reacts with the α-amino
group of the terminal amino-acid of the growing protein chain to form a new amide bond
(peptide bond) during protein synthesis. The reaction of esters with amines is generally
favourable but the rate of reaction is increased greatly in the ribosome.

Each transfer RNA molecule has a well defined tertiary structure that is recognized by the
enzyme aminoacyl tRNA synthetase, which adds the correct amino acid to the 3'-end of the

uncharged tRNA. The presence of modified nucleosides is important in stabilizing the tRNA
structure.

The Genetic code

The genetic code is almost universal. It is the basis of the transmission of hereditary information
by nucleic acids in all organisms. There are four bases in RNA (A,G,C and U), so there are 64
possible triplet codes (43 = 64). In theory only 22 codes are required: one for each of the 20
naturally occurring amino acids, with the addition of a start codon and a stop codon (to indicate
the beginning and end of a protein sequence). Many amino acids have several codes
(degeneracy), so that all 64 possible triplet codes are used. For example Arg and Ser each have 6
codons whereas Trp and Met have only one. No two amino acids have the same code but amino
acids whose side-chains have similar physical or chemical properties tend to have similar codon
sequences, e.g. the side-chains of Phe, Leu, Ile, Val are all hydrophobic, and Asp and Glu are
both carboxylic acids This means that if the incorrect tRNA is selected during translation (owing
to mispairing of a single base at the codon-anticodon interface) the misincorporated amino acid
will probably have similar properties to the intended tRNA molecule. Although the resultant
protein will have one incorrect amino acid it stands a high probability of being functional.
Organisms show "codon bias" and use certain codons for a particular amino acid more than
others. For example, the codon usage in humans is different from that in bacteria; it can
sometimes be difficult to express a human protein in bacteria because the relevant tRNA might
be present at too low a concentration.
 First base (5'-end) Middle base Third Base ('3-end)

U C A G

U U Phe Phe Leu Leu

C Ser Ser Ser Ser

A Tyr Tyr Stop Stop

G Cys Cys Stop Trp

C U Leu Leu Leu Leu

C Pro Pro Pro Pro

A His His Gln Gln

 First base (5'-end) Middle base Third Base ('3-end)

U C A G

G Arg Arg Arg Arg

A U lle lle lle Met

C Thr Thr Thr Thr

A Asn Asn Lys Lys

G Ser Ser Arg Arg

G U Val Val Val Val

C Ala Ala Ala Ala

 First base (5'-end) Middle base Third Base ('3-end)

U C A G

A Asp Asp Glu Glu

G Gly Gly Gly Gly

An exercise in the use of the genetic code

One strand of genomic DNA (strand A, coding strand) contains the following sequence reading
from 5' to 3':

TCGTCGACGATGATCATCGGCTACTCGA

This strand will form the duplex

5'-TCGTCGACGATGATCATCGGCTACTCGA-3' 3'-
AGCAGCTGCTACTAGTAGCCGATGAGCT-5'

The sequence of bases in the other strand of DNA (strand B) written 5' to 3' is therefore

TCGAGTAGCCGATGATCATCGTCGACGA

In the mRNA transcribed from strand A of DNA, the sequence of bases written 5' to 3' is

UCGAGUAGCCGAUGAUCAUCGUCGACGA

resulting in an amino acid sequence

Ser-Ser-Ser-Arg-STOP

However, if DNA strand B is the coding strand the mRNA sequence will be
UCGUCGACGAUGAUCAUCGGCUACUCGA

and the amino-acid sequence will be

Ser-Ser-Thr-Met-Ile-Ile-Gly-Tyr-Ser-

POLYMERASE CHAIN REACTION

Polymerase chain reaction (PCR), a technique used to make numerous copies of a specific
segment of DNA quickly and accurately. The polymerase chain reaction enables investigators to
obtain the large quantities of DNA that are required for various experiments and procedures in
molecular biology, forensic analysis, evolutionary biology, and medical diagnostics.

PCR was developed in 1983 by Kary B. Mullis, an American biochemist who won the Nobel
Prize for Chemistry in 1993 for his invention. Before the development of PCR, the methods used
to amplify, or generate copies of, recombinant DNA fragments were time-consuming and labour-
intensive. In contrast, a machine designed to carry out PCR reactions can complete many rounds
of replication, producing billions of copies of a DNA fragment, in only a few hours.

Five core ‘ingredients’ are required to set up a PCR. We will explain exactly what each of these
do as we go along. These are:

1. the DNA template to be copied

2. primers, short stretches of DNA that initiate the PCR reaction, designed to bind to either
side of the section of DNA you want to copy
3. DNA nucleotide bases (also known as dNTPs). DNA bases (A, C, G and T) are the
building blocks of DNA and are needed to construct the new strand of DNA
4. Taq polymerase enzyme?? to add in the new DNA bases
5. buffer to ensure the right conditions for the reaction.

PCR involves a process of heating and cooling called thermal cycling which is carried out
by machine.

There are three main stages:

 1. Denaturing – when the double-stranded template DNA is heated to separate it into
two single strands.
2. Annealing – when the temperature is lowered to enable the DNA primers to attach to
the template DNA.
3. Extending – when the temperature is raised and the new strand of DNA is made by
the Taq polymerase enzyme.

These three stages are repeated 20-40 times, doubling the number of DNA copies
each time

A complete PCR reaction can be performed in a few hours, or even less than an hour
with certain high-speed machines.

After PCR has been completed, a method called electrophoresis can be used to check
the quantity and size of the DNA fragments produced.

What happens at each stage of PCR?

Denaturing stage

During this stage the cocktail containing the template DNA and all the other core ingredients is
heated to 94-95⁰C.
The high temperature causes the hydrogen bonds?? between the bases in two strands of template
DNA to break and the two strands to separate.

This results in two single strands of DNA, which will act as templates for the production of the
new strands of DNA.

It is important that the temperature is maintained at this stage for long enough to ensure that the
DNA strands have separated completely.

This usually takes between 15-30 seconds.

Annealing stage

During this stage the reaction is cooled to 50-65⁰C. This enables the primers to attach to a
specific location on the single-stranded template DNA by way of hydrogen bonding (the exact
temperature depends on the melting temperature of the primers you are using).

Primers are single strands of DNA or RNA sequence that are around 20 to 30 bases in length.

The primers are designed to be complementary in sequence to short sections of DNA on each
end of the sequence to be copied.

Primers serve as the starting point for DNA synthesis. The polymerase enzyme can only add
DNA bases to a double strand of DNA. Only once the primer has bound can the polymerase
enzyme attach and start making the new complementary strand of DNA from the loose DNA
bases.

The two separated strands of DNA are complementary and run in opposite directions (from one
end – the 5’ end – to the other – the 3’ end); as a result, there are two primers – a forward primer
and a reverse primer.

This step usually takes about 10-30 seconds.

Extending stage
During this final step, the heat is increased to 72⁰C to enable the new DNA to be made by a
special Taq DNA polymerase enzyme which adds DNA bases.

Taq DNA polymerase is an enzyme taken from the heat-loving bacteria?? Thermus aquaticus.

This bacteria normally lives in hot springs so can tolerate temperatures above 80⁰C.

The bacteria’s DNA polymerase is very stable at high temperatures, which means it can
withstand the temperatures needed to break the strands of DNA apart in the denaturing stage of
PCR.

DNA polymerase from most other organisms would not be able to withstand these high
temperatures, for example, human polymerase works ideally at 37˚C (body temperature).

72⁰C is the optimum temperature for the Taq polymerase to build the complementary strand. It
attaches to the primer and then adds DNA bases to the single strand one-by-one in the 5’ to 3’
direction. The result is a brand new strand of DNA and a double-stranded molecule of DNA.

The duration of this step depends on the length of DNA sequence being amplified but usually
takes around one minute to copy 1,000 DNA bases (1Kb). These three processes of thermal
cycling are repeated 20-40 times to produce lots of copies of the DNA sequence of interest.

The new fragments of DNA that are made during PCR also serve as templates to which the DNA
polymerase enzyme can attach and start making DNA.

The result is a huge number of copies of the specific DNA segment produced in a relatively short
period of time.
CLONING

Cloning simply refers to the process of generating a genetically identical copy of a cell or an
organism. Cloning happens often in nature—for example, when a cell replicates itself asexually
without any genetic alteration or recombination. Prokaryotic organisms (organisms lacking a cell
nucleus) such as bacteria create genetically identical duplicates of themselves using binary
fission or budding. In eukaryotic organisms (organisms possessing a cell nucleus) such as
humans, all the cells that undergo mitosis, such as skin cells and cells lining the gastrointestinal
tract, are clones; the only exceptions are gametes (eggs and sperm), which undergo meiosis and
genetic recombination.

In biomedical research, cloning is broadly defined to mean the duplication of any kind of
biological material for scientific study, such as a piece of DNA or an individual cell. For
example, segments of DNA are replicated exponentially by a process known as polymerase chain
reaction, or PCR, a technique that is used widely in basic biological research. The type of
cloning that is the focus of much ethical controversy involves the generation of cloned embryos,
particularly those of humans, which are genetically identical to the organisms from which they
are derived, and the subsequent use of these embryos for research, therapeutic, or reproductive
purposes.