United International University

School of Science and Engineering

Class Test 4; Year 2021; Semester: Summer

Course: BIO 3105; Title: Biology for Engineers, Section: B

Upload instruction: RENAME pdf file as “Bio3105_B_ID”

1 Show the pictorial view of PCR chain including polarities for DNA. 5

2 Mention the name of the characteristics of a competent host. How you would apply a complete 5
rDNA to a plant (mention only the names of the means you are going to use).

3 (a) Suppose you have a restriction enzyme that has a recognition sequence GCCG. How you 6+4

nology: Principles and Processes

would complete the rDNA for a given sequence of one strand as below show in a pictorial
view (You need to complete the DNA with a complementary strand before starting the
process).
ATAACGATAGCCGTATTATGCAATGCATTACGAGCCGTATAAT
A fragments are (b) Find the total number of base pairs of sample “A” and “C” from below.
normal light.
e visualized
bands with a
ium bromide
m to UV
ey are stained
V light, you can
DNA bands and
zes using a DNA

n cut out the

A fragment,
her ligate it with
he techniques of
ophoresis are
of forensics, for
ting and
uspects.

Ref: https://www.toppr.com/guides/biology/biotechnology-principles-and-processes/